Post on 22-Jan-2017
transcript
Methylation status and protein expression of RASSF1A in breastcancer patients
Hoda A. Hagrass • Heba F. Pasha • Mohamed A. Shaheen •
Eman H. Abdel Bary • Rasha Kassem
Received: 11 December 2012 / Accepted: 26 October 2013 / Published online: 20 November 2013
� Springer Science+Business Media Dordrecht 2013
Abstract Recently genetics and epigenetics alterations
have been found to be characteristic of malignancy and
hence can be used as targets for detection of neoplasia. RAS
association domain family protein 1A (RASSF1A) gene
hypermethylation has been a subject of interest in recent
researches on cancer breast patients. The aim of the present
study was to evaluate whether RASSF1A methylation status
and RASSF1A protein expression are associated with the
major clinico-pathological parameters. One hundred and
twenty breast cancer Egyptian patients and 100-control
subjects diagnosed with benign lesions of the breast were
enrolled in this study. We evaluated RASSF1A methylation
status in tissue and serum samples using Methyl specific
PCR together with RASSF1A protein expression in tissues
by immunohistochemistry. Results were studied in relation
to known prognostic clinicopathological features in breast
cancer. Frequency of RASSF1A methylation in tissues and
serum were 70 and 63.3 % respectively and RASSF1A
protein expression showed frequency of 46.7 %. There was
an association between RASSF1A methylation in tissues,
serum and loss of protein expression in tissues with invasive
carcinoma, advanced stage breast cancer, L.N. metastasis,
ER/PR and HER2 negativity. RASSF1A methylation in
serum showed high degree of concordance with methylation
in tissues (Kappa = 0.851, P \ 0.001). RASSF1A hyper-
methylation in tissues and serum and its protein expression
may be a valid, reliable and sensitive tool for detection and
follow up of breast cancer patients.
Keywords RAS association domain family protein
1A � Methylated polymerase chain reaction � Breast
cancer � Egypt
Abbreviations
RASSF1A RAS association domain family protein 1A
PCR Polymerase chain reaction
MSP Methyl specific PCR
CIS Carcinoma in situ
IHC Immunohistochemistry
Introduction
Breast cancer is the most common cancer and the second
most common cause of death from cancer in women. Every
year more than one million women are diagnosed with
breast cancer and approximately 400,000 die [1]. Breast
cancer is considered the leading cause of cancer death
among females in economically developing countries;
carcinoma of the breast is the most prevalent cancer among
Egyptian women and constitutes 29 % of National Cancer
H. A. Hagrass (&)
Clinical Pathology Department, Faculty of Medicine,
Zagazig University, Zagazig, Egypt
e-mail: hudahagrass@gmail.com
H. F. Pasha
Medical Biochemistry Department, Faculty of Medicine,
Zagazig University, Zagazig, Egypt
M. A. Shaheen
Histology and Cell Biology Department, Faculty of Medicine,
Zagazig University, Zagazig, Egypt
E. H. Abdel Bary
Pathology Department, Faculty of Medicine,
Zagazig University, Zagazig, Egypt
R. Kassem
Surgery Department, Faculty of Medicine,
Zagazig University, Zagazig, Egypt
123
Mol Biol Rep (2014) 41:57–65
DOI 10.1007/s11033-013-2837-3
Institute cases. Median age at diagnosis is one decade
younger than in countries of Europe and North America
and most patients are premenopausal [2].
For successful treatment and outcome, early detection of
breast cancer is a necessity. Despite the availability of
mammography and prevalence of self-examination, there is
still additional benefit to be gained from additional
screening methodologies. Free circulating DNA is
increased in the serum/plasma of cancer patients, and
methylation of certain genes has been found to be char-
acteristic for malignancy [3].
The genetic and epigenetic alterations that initiate and
drive tumorigenesis can be used as targets for detection of
neoplasia in body fluids [4], because they may precede
clinically obvious cancer, can be detected at sensitive
levels, may be specific for tumor cells, and can potentially
provide information about the prognosis and treatment of
the disease [5, 6]. CpG islands located in promoter regions
of genes are normally unmethylated. In cancer cells,
aberrant hypermethylation of these promoter regions is
associated with transcriptional silencing. Hypermethylation
is therefore an alternative mechanism for inactivation of
tumor suppressor genes [7, 8].
Also it has been found that gene hypermethylation is a
common and early alteration in many tumor types [9–11],
including breast [12–14], hence it is considered as a
promising target for detection strategies in clinical speci-
mens [5, 6].
Promoter methylation of putative tumor suppressor
genes in circulating free DNA (cfDNA) of bodily fluids,
like serum, is a rapidly growing research topic for early
cancer detection. However, in the breast cancer field, none
of the reported biomarkers has reached clinical application
[15].
RASSF1 encodes several isoforms, including RASSF1A,
RASSF1B, and RASSF1C, which are derived from alter-
native mRNA splicing and promoter usage [16]. RAS
association domain family protein 1A (RASSF1A) meth-
ylation status has been examined in different tumors [16,
17] and breast cancer [4, 14, 17, 18]. RASSF1A identified at
3p21.3 was suggested as the major target tumor suppressor
on the basis of its frequent epigenetic silencing [16]. It was
reported previously that RASSF1A is epigenetically inac-
tivated in 40–72 % of primary lung tumors by de novo
methylation at the CpG island in the promoter region [17,
19, 20]. Methylation-associated inactivation of RASSF1A
was also observed in a considerable proportion of breast,
ovarian, and nasopharyngeal cancer cell lines and primary
tumors [17, 19–22]. The tumor suppressor function of
RASSF1A has been suggested by observations that exog-
enous expression of RASSF1A decreases in vitro-colony
formation, suppresses anchorage-independent growth, and
dramatically reduces tumorigenicity in vivo [19, 20]. With
these tumor suppression effects, the presence of a RAS
association domain suggests that RASSF1 proteins may
function as effector molecules in RAS or related growth
inhibitory signaling pathways.
In this study we examined the methylation status of the
normally unmethylated RASSF1A gene in paired serum
and tissue samples in cancer breast patients together with
immunohistochemical analysis of RASSF1A protein.
Results were studied in relation to prognostic clinicopath-
ological features in a trial to reveal RASSF1A gene role in
prognosis.
Materials and methods
Specimen collection
One hundred twenty consecutive patients diagnosed with
breast cancer who were admitted to Zagazig University
hospitals, in the period from January 2011 to June 2012,
were enrolled in this study, patients who have received
chemotherapy or radiotherapy in the preoperative period
have been excluded. Patients’ ages ranged from 34 to
62 years. There were 20 cases of ductal CIS, 8 lobular CIS,
80 invasive ductal, and 12 invasive lobular carcinomas.
Matched preoperative serum and tissue specimens were
obtained from breast cancer patients and from control
group that included 100 patients with benign breast lesions
(70 fibroadenomas; 30 fibrocystic changes).
As regards tissue samples, 4 lm thick sections from
formalin-fixed, paraffine-embedded tissue blocks were
stained with hematoxylin–eosin for morphological assess-
ment. Tumors were evaluated for tumor grade using the
Elston and Ellis grading system for invasive carcinoma,
and the criteria of the European Breast Screening Group for
DCIS, and tumor stage based on TNM, according to the
2003 WHO classification of breast tumors [23].
Ethical consideration
A written consent was taken from all of the participants
after explaining details, benefits as well as risks to them.
Immunohistochemistry
Immunohistochemical staining was carried out using strep-
tavidin-biotin immunoperoxidase technique (Dako-cyto-
mation, Glostrup, Denmark). 3 lm thick sections, cut from
formalin fixed paraffin embedded blocks, were deparaffi-
nized in Xylene and rehydrated in graded alcohol. Sections
were boiled in citrate buffer (pH 6.0) for 20 min for antigen
retrieval and then washed in phosphate buffer saline (pH
7.3). Blocking of endogenous peroxidase activity by 3 %
58 Mol Biol Rep (2014) 41:57–65
123
H2O2 in methanol was attained. The slides were then incu-
bated over night with the monoclonal antibodies: anti-
RASSF1A (mouse monoclonal IgG, clone 3F3, code number
AB23950), anti-ER (mouse monoclonal IgG, code number
sc-56833, Santa Cruz Biotechnology, CA), anti-PR (rabbit
polyclonal IgG, code number sc-539, Santa Cruz Biotech-
nology, CA, USA) and anti-HER2 (mouse monoclonal IgG,
code number sc-33684, Santa Cruz Biotechnology, CA,
USA). Incubation with secondary antibody and product
visualization was performed employing (Dako Cytomation,
Glostrup, Denmark) method with diaminobenzidine (DAB)
substrate chromogen. Slides were finally counterstained with
Mayer’s haematoxylin. The primary antibody was replaced
by phosphate buffer solution (PBS) for negative controls.
RASSF1A protein expression appeared as yellowish
brown staining in the cytoplasm of the cells. Positive
staining in more than 10 % of tumor cells in the examined
area was considered. We calculated a score (intensity 9 %
area) for each tumor as follows: weak \100, moderate
100–200, and strong[200. Then a score equal or over 100
was considered positive expression, and bellow 100 con-
sidered as significant loss of expression [18].
DNA extraction
DNA was extracted from fresh frozen tissue or from blood
using a standard technique according to the manufacturer’s
instructions (QIAamp DNAMini kit, QIAGEN GmbH,
Hilden, Germany).
Methylation analysis
Specimen DNA was modified with sodium bisulfite, con-
verting all unmethylated, but not methylated, cytosine to
uracil followed by amplification with primers specific for
methylated versus unmethylated DNA [24] by using a
commercial kit (EpiTect Bisulfite, QIAGEN GmbH, Hil-
den, Germany) according to the manufacturer’s instruc-
tions in brief the procedure comprises a few simple steps:
bisulfite-mediated conversion of unmethylated cytosines;
binding of the converted single-stranded DNA to the
membrane of an EpiTect spin column; washing; desulfo-
nation of membrane-bound DNA; washing of the mem-
brane-bound DNA to remove desulfonation agent; and
elution of the pure, converted DNA from the spin column
then kept at -20 �C for further using.
Methylation-specific PCR analysis
PCR was performed with methylation specific primers
RASSF1A (U) F (50TGGTTTTTTTTAGTTTTTTTTTG
TT-30) R (50ACTACCATATAAAATTACACACA-30) RA
SSF1A (M) F (50GGTTTTTTTTAGTTTTTTTTCGTC-30)
R (50-CTACCGTATAAAATTACACGCG-30) using 200 ng
of the bisulfite-modified genomic DNA as templates and
EpiTect MSP kit (QIAGEN GmbH, Hilden, Germany) kit,
the cycling conditions consisted of an initial denaturation
step at 95 �C for 5 min, followed by 35 cycles of 94 �C for
30 s, 57 C for 30 s, and 72 �C for 45 s the PCR products
(15 ll) were resolved on a 2 % agarose gel. Both negative
and positive controls using EpiTect control DNA methyl-
ated (QIAGEN GmbH, Hilden, Germany) and Epitect
control DNA unmethylated (QIAGEN GmbH, Hilden,
Germany) were done but the data was not shown.
Statistical analysis
Data was analyzed using SPSS win statistical package ver-
sion 17 (SPSS Inc., Chicago, IL). Chi square test or Fisher’s
Table 1 Demographic and clinicopathologic characteristics of can-
cer breast patients
Variable Frequency (%)
Age (50.9 ± 7.75) years
\50 years 52 (43.3 %)
C50 years 68 (56.7 %)
Types
Carcinoma in situ 28 (23.3 %)
Invasive carcinoma 92 (76.7 %)
Grade
I, II 56 (46.7 %)
III 64 (46.7 %)
Stage
Early stage (0 & I) 48 (40 %)
Advanced stage (II & III) 72 (60 %)
ER
-ve 36 (30 %)
?ve 84 (70 %)
PR
-ve 52 (43.3 %)
?ve 68 (56.7 %)
Lymph node
-ve 80 (66.7 %)
?ve 40 (33.3 %)
RASSF1 IHC
-ve or \ 100 64 (53.3 %)
C100 56 (46.7 %)
RASSF1 methylation in tissue
M 84 (70.0 %)
U 36 (30 %)
RASSF1 methylation in serum
M 76 (63.3 %)
U 44 (36.7 %)
Mol Biol Rep (2014) 41:57–65 59
123
exact test was used to examine the relation between quali-
tative variables. For not-normally distributed quantitative
data, comparison between two groups was done using
Mann–Whitney test. Odds ratio (OR) with it 95 % confi-
dence interval (CI) were used for risk estimation. A P value
\0.05 was considered significant.
Results
In the current study we evaluated 120-breast cancer patients
mean age ± SD (50.9 ± 7.7) years and 100 patients diag-
nosed as benign breast lesions (70 fibroadenomas and 30
fibrocystic change) used as a control group. The mean
age ± SD was 38.4 ± 8.6 years. All patients were subjected
to clinical and histopathological evaluation. Both patients
and control groups were evaluated for RASSF1A gene hy-
permethylation in paired tissue and serum samples, further-
more RASSF1 protein expression in tissues was evaluated by
Immunohistochemistry.
Demographic and clinicopathologic data of breast can-
cer patients Table 1 and their frequencies as regards
RASSF1A methylation status in tissues and serum and
RASSF1A protein expression are shown in Table 2.
Comparison among different clinicopathological
groups as regards RASSF1A
There was a highly significant difference (P \ 0.001)
between in situ and invasive carcinoma when compared as
Table 2 Frequencies and associations of clinicopathologic characteristics with RASSF1A methylation status in serum and tissue and RASSF1A
IHC score
Frequency
N (%)
RASSF1A in tissue RASSF1A in serum RASSF1A IHC score
M U M U -ve or \100 C 100
84 (70 %) 36 (30 %) 76 (63.3 %) 44 (36.7 %) 64 (53.4 %) 56 (46.6 %)
Age (years)
\50 32 (61.5) 20 (38.5) 28 (53.8) 24 (46.2) 24 (46.2) 28 (53.8)
C50 52 (76.5) 16 (23.5) 48 (70.6) 20 (29.4) 40 (58.8) 28 (41.2)
P value 0.12 0.09 0.23
Type
Carcinoma in situ 12 (42.9) 16 (57.1) 8 (28.6) 20 (71.4) 8 (42.9) 18 (57.1)
Invasive carcinoma 72 (78.3) 20 (21.7) 68 (73.9) 24 (26.1) 56 (56.5) 38 (43.5)
P value \0.001 \0.001 0.02
Low grade (I, II) 38 (63.3) 22 (36.7) 34 (56.7) 26 (43.3) 28 (46.6) 32 (53.4)
High grade (III) 46 (76.7) 14 (23.3) 42 (70.0) 18 (30) 36 (60) 24 (40)
P value 0.16 0.19 0.2
Early stage (0 & I) 26 (54.1) 22 (45.9) 24 (50) 24 (50) 18 (37.5) 30 (62.5)
Advanced stage (II & III) 58 (80.6) 14 (19.4) 52 (72.2) 20 (27.8) 46 (63.8) 26 (36.2)
P value 0.004 0.02 0.008
ER
-ve 32 (88.9) 4 (11.1) 29 (80.5) 7 (19.5) 26 (71.2) 10 (27.8)
?ve 52 (61.9) 32 (38.1) 47 (47.6) 37 (52.4) 38 (38.1) 46 (61.9)
P value 0.006 0.02 0.01
PR
-ve 44 (84.6) 8 (15.4) 40 (76.9) 12 (23.1) 36 (69.2) 16 (30.8)
?ve 40 (58.8) 28 (41.2) 36 (52.9) 32 (47.1) 28 (42.2) 40 (58.8)
P value 0.004 0.01 0.004
HER2
-ve 50 (83.3) 10 (16.7) 44 (73.3) 16 (26.7) 39 (65) 21 (35)
?ve 34 (56.7) 26 (43.3) 32 (53.3) 28 (46.7) 25 (41.7) 35 (58.3)
P value 0.003 0.037 0.02
Lymph node
-ve 48 (60) 32 (40) 44 (55) 36 (45) 49 (61.3) 31 (38.7)
?ve 36 (90) 4 (10) 32 (80) 8 (20) 15 (37.5) 25 (62.5)
P value 0.002 0.01 0.02
60 Mol Biol Rep (2014) 41:57–65
123
regards RASSF1A methylation in tissues regards and serum,
while there was a statistical difference (P = 0.02) when
compared as regards RASSF1A protein expression in tissue.
Comparison between patients with low grade and high-
grade tumors (cut of point was grade I& II vs Grade III)
showed a non-significant difference as regards methylation
status in tissues (P = 0.16), serum (P = 0.19) and protein
expression in tissue (P = 0.20).
By comparing early stage to advanced stage patients (cut
of point was stage 0 & I vs stage II & III) as regards
RASSF1A methylation in tissues and serum and RASSF1A
protein expression in tissues we found significant differ-
ences (P = 0.004, 0.02 and 0.008 respectively) between
both groups with association of RASSF1A methylation and
higher frequency of loss of protein expression in tissues
with advanced stage patients.
Patients without lymph node metastasis were compared
to patients with LN metastasis as regards RASSF1A
methylation in tissue and serum and protein expression in
tissues, significant differences were found between the two
groups (P = 0.002, 0.01 and 0.02 respectively) as there
was an association between methylation in both tissue and
serum and loss of protein expression on one hand and
lymph node metastasis on the other.
Comparison according to hormone receptors and HER2
status as regards RASSF1A
In our study all patients were evaluated according to their
hormone receptor status, we found that there were signifi-
cant differences between ER-ve and ER?ve patients as
regards RASSF1A methylation in tissue, serum and protein
expression in tissue (P = 0.006, 0.02, 0.01 respectively)
with a higher frequency of methylation in both tissues and
serum in ER-ve patients, and an association between ER
negativity and loss of protein expression.
We found an association between methylation status of
RASSF1A and loss of its protein expression and PR-ve
negativity as there were significant differences between
PR-ve and PR?ve patients as regards RASSF1A meth-
ylation in tissue, serum and protein expression in tissue
(P = 0.004, 0.01, 0.004 respectively).
Group of patients with HER2-ve showed statistically
significant difference when compared with HER2?ve
patients group as regards RASSF1A methylation in tissue
(P = 0.003), in serum (P = 0.037) and RASSF1A protein
expression in tissues (P = 0.02).
Moreover triple negative patients (ER-ve, PR-ve,
HER2-ve) showed methylation in both tissue and serum
and loss of protein expression in all 16 cases (the data not
shown).
Case–control comparison and risk estimate
One hundred patients diagnosed as benign lesions of the
breast; there was a highly significant statistical difference
between patients group and control group when compared
as regards age (P \ 0.001) with the older age incidence in
cancer breast patients.
Comparison between breast cancer patients and control
group as regards RASSF1A methylation in both tissue and
serum and protein expression, showed highly statistical
significant difference (P \ 0.001) (Table 3).
Measurement of agreement for RASSF1A in tissue,
serum and protein expression by IHC
In the present study, we evaluated the concordance (mea-
surement of agreement) between RASSF1A methylation in
tissue and serum it showed a highly significant agreement
(kappa = 0.851, P \ 0.001) with a sensitivity of serum
testing 90.5 % and a specificity 100 %, reference to
RASSF1A methylation in tissue.
As for symmetric measures for both RASSF1A protein
expression by immunohistochemistry compared to RASSF1A
methylation in tissue showed significant measurement of
agreement (kappa = 0.521, P = 0.004), while it showed non-
significant agreement between RASSF1A protein expression
and methylation in the serum.
Discussion
Alterations in the methylation status of DNA are amongst the
most frequent molecular changes associated with human
cancers [5, 25, 26]. Aberrant promoter methylation has been
described for several genes in various malignancies and the
wide spectrum of genes involved suggest that specific tumors
may have their own distinct methylation profile [26, 27].
RASS1A gene has been a common factor in recent
studies using a panel of genes to study hypermethylation in
cancer breast patients [28–30], they tried to explore the role
of RASSF1A and other genes epigenetics in the prognosis,
early detection and differentiation between malignant and
non malignant lesions.
We conducted our study to explore the importance of
RASSF1A gene methylation and protein expression in
breast cancer patients and study its link with clinicopath-
ological characteristics in an attempt to assess its role in
prediction of prognosis. Moreover, we tried to assess the
sensitivity of non-invasive, accessible serum samples as a
potential tool for follow up of patients.
In the current study, we investigated 120 breast cancer
patients with mean age (50.9 ± 7.7 years) and 100 benign
Mol Biol Rep (2014) 41:57–65 61
123
breast lesions (38.4 ± 8.6 years), as control group for
RASSF1A methylation status in tissues, and serum toge-
ther with RASSF1A protein expression in tissues. We also
studied clinicopathological features and hormone receptor
status of cancer breast patients.
We found that there was no statistical significant dif-
ference between patients of different age groups ([, \50)
as regards methylation status in tissue or serum or protein
expression in tissues (P = 0.376, 0.346, 0.491 respec-
tively). This is similar to Jeronimo et al. [28] and Li et al.
[31] who didn’t find any correlation between age and gene
promoter methylation or protein expression. While it is
different from the Tunisian study that found an association
of age at diagnosis and methylation of RASSF1A gene
(P = 0.048) and they concluded that silencing of tumour
suppressor gene by abnormal methylation is a prevalent
event in tumors from younger patients [32] also other
previous studies found association between age and
methylation [33, 34]. The discrepancy among studies may
be explained by the fact that methylation profile of cancers
is ethnicity specific [35, 36].
Frequency of methylation of RASSF1A gene in tissues
and serum were 70 and 63.3 % respectively Fig. 1, which
is lower than Karray-Chouayekh et al. [32] and Park et al.
[29] who found that frequency of methylation in tissue in
breast cancer patients are 87 and 76 % respectively and
Dulaimi et al. [4] who found that frequency of methylation
in serum in breast cancer patients is 65 %. Ours results
were higher than a study by Alvarez et al. [18] who found
that the frequency of methylation in tissue among breast
cancer patients was 67 %.
Regarding RASSF1A protein expression, 53.4 % of our
cases showed weak or absent expression Fig. 2, this is
lower than what Li et al. [31] found (72.2 %). These dif-
ferences may be attributed to different selection criteria and
difference in sensitivity of MSP technique and anti-
RASSF1A antibodies.
Comparison between in situ and invasive breast cancer as
regards RASSF1A methylation in tissue, serum and protein
expression revealed significant difference with association
of hypermethylation and decrease in protein expression
with invasive tumors. This is similar to Dulaimi et al. [4]
who found an association of hypermethylation of
RASSF1A and invasive tumors and Alvarez et al. [18] who
found a significant decrease in protein expression in cases of
in situ carcinoma. This can be explained by the fact that
RASSF1A modulates multiple apoptotic cell cycle check-
points pathways and hence its methylation may lead to
progression of the disease [3, 36].
By comparing low and high-grade tumors there were no
statistical significant differences as regards RASSF1A
methylation in tissues, serum and protein expression. This is
in the same line with Karray-Chouayekh et al. [32] and
Alvarez et al. [18] who did not find any correlation between
RASSF1A hypermethylation and protein expression.
In the present study we found that there were statistical
differences between patients diagnosed with early and
advanced stages as regard RASSF1A methylation in tissue
and serum and loss of protein expression. This is similar to
Karray-Choueyek et al. [32] who found an association
between RASSF1A methylation and advanced tumor stage
and Alvarez et al. [18] who found association between loss
of protein expression and advanced tumor stage.
Comparing patients with lymph node metastasis to
patients without L.N. metastasis there were statistical dif-
ferences when compared as regards RASSF1A methylation
in tissue, serum or protein expression in tissues, as there
was an association between L.N. metastasis and methyla-
tion in tissues and serum also an association with loss of
protein expression in tissues. This is similar to a study by
Muller et al. [37] who found that L.N. metastasis had a
trend of high prevalence of methylation compared to the
primary breast carcinoma which suggests that RASSF1A
methylation may be a participant of key molecular path-
ways in tumor progression and aggressive tumor behavior.
In our study there was a significant association between
RASSF1A methylation in tissue, serum and loss of protein
expression on one hand and ER/PR and Her2 negativity on
Table 3 Methylation
frequencies of RASSF1 in
breast cancer patients and
patients with benign breast
lesions
Cancer patients (N = 120),
N (%)
Benign control (N = 100)
N (%)
P Sensitivity
(%)
Specificity
(%)
RASSF1A methylation, tissue
M 84 (70 %) 3 (3 %)
U 36 (30 %) 97 (97 %) \0.001 70 97
RASSF1A methylation, serum
M 76 (63.3 %) 1 (1 %)
U 44 (36.7 %) 99 (99 %) \0.001 63.3 99
RASSF1_IHC
\100 64 (53.3 %) 2 (2 %)
C100 56 (46.7 %) 98 (98 %) \0.001 53.3 98
62 Mol Biol Rep (2014) 41:57–65
123
the other hand. This is similar to Sunami et al. [38] who
found a strong correlation between ER/PR double negative
marker and hypermethylation. Similarly Gobel et al. [3]
found a strong correlation between ER/PR/HER2 triple
negative and hypermethylation, this may have been
explained by the possibility that RASSF1A methylation is
associated with bad prognosis and poor clinical outcome,
but the findings by previous studies [18, 30, 31, 39, 40]
contradicted with our results as they found an association
between ER/PR positivity and RASSF1A methylation.
Moreover Feng et al. [39] and Karray-Cheouyekh et al.
[32] found non-significant correlation between methylation
and Her2 status. We recommend further studies in this
context with larger number and more sensitive techniques.
In the present study nearly all cases with RASSF1A
methylation showed loss of protein expression in tissues,
this is in agreement with Alvarez et al. [18] who found a
highly significant association (P = 0.0063) between
RASSF1A promoter hypermethylation and loss of protein
expression, and they explained that promoter hyperme-
thylation is a relevant molecular mechanism in inhibiting
protein expression. Furthermore, Li et al. [31] suggested
that methylation maybe responsible for alleles silencing.
The silencing of gene expression may also be explained by
gene deletion or point mutation, tumors having deletion of
RASSF1 and presenting M and UM PCR products show a
significant loss of protein expression [18].
In the current study, we compared our breast cancer
patients to a control group (n = 100) diagnosed as fibro-
adenoma and fibrocystic disease and we found high sig-
nificant differences between the both groups as regards
RASSF1A methylation in tissue, serum and protein
expression by IHC as there were only 3, 1, 2 cases positive
for RASSF1A methylation in tissue and serum and had low
expression of RASSF1A protein respectively in control
group.
This means that RASSF1A methylation and protein
expression could be valuable tests in discrimination of
malignant from non-malignant breast lesions. This is con-
sistent with Sidransky [5] who stated that RASSF1A
methylation could be used as a cancer molecular marker.
We are in agreement of previous studies [37, 41–43],
who demonstrated that the acquisition of high level meth-
ylation at RASSF1A gene promoter is relevant for breast
Patient number (1) (2) (3) (4) (5) (6)
RASSF1A in serum
RASSF1A in tissue
Fig. 1 Representative samples
of methylation specific PCR
assays of RASSF1A in tissue
and serum methylated alleles
(M) 269 bp unmethylated
alleles (U) 271 bp
Fig. 2 A A case of ductal carcinoma in situ (UM) showing strong
RASSF1A immunoreactivity (original magnification 9200). B A case
of invasive duct carcinoma (M) showing moderate RASSF1A
immunoreactivity (original magnification 9400). C A case of
invasive duct carcinoma (M) showing negative RASSF1A immuno-
reactivity (original magnification 9400)
Mol Biol Rep (2014) 41:57–65 63
123
tumorigenesis, enabling their use as a specific breast cancer
marker.
In a trial to evaluate how serum samples can be trusted
with suspecting, diagnosis and follow up of cancer patients,
we studied the degree of concordance between RASSF1A
methylation in tissues and serum, we found that measure-
ment of agreement showed high degree of concordance
(kappa = 0.851, P \ 0.001).
Moreover we found that sensitivity of serum testing of
RASSF1A was 90.5 %, specificity 100 % in reference to
RASSF1A methylation in tissue. This is in context with
Dulaimi et al. [4] who confirmed that hypermethylation can
be detected by MSP in serum DNA and it can be consid-
ered as a screening method which may enhance early
detection of breast cancer.
Aberrant promoter methylation in serum may be used as
a routine clinical test for breast cancer detection which
obligates the use of more accessible samples, less painful
and less intruding with female privacy.
Moreover Yamamoto et al. [14] evaluated paired serum
and tissue samples from breast cancer patients for detection
of hyper methylation in a panel of genes including
RASSF1A and concluded that the use of more sensitive
MSP technique is promising for enhancing the sensitivity
for diagnosis of metastatic breast cancer and moreover this
can be used as a potential tumor marker for early detection
of cancer breast. They also evaluated RASSF1A gene
methylation before and after surgery and they found that it
turned to be negative after surgery which confirms that the
origin of serum DNA is the tumor itself.
Conclusion
RASSF1A gene hypermethylation in tissue and serum
together with loss of RASSF1A protein expression were
associated with clinicopathological features of bad prog-
nosis in breast cancer patients. RASSF1A hypermethylation
in serum showed high concordance with hypermethylation
in tissue and showed reasonable sensitivity and specificity.
In this context RASSF1A may be used in prediction, early
diagnosis, follow up in breast cancer patients.
Acknowledgments This work was funded by support of academic
research in Zagazig University Projects, Zagazig University Post-
graduate & Research Affairs.
Conflict of interest None declared.
References
1. Parkin DM, Bray F, Ferlay J, Pisani P (2002) Global cancer
statistics. CA Cancer J Clin 55:74–108
2. Allam MF, Abd Elaziz KM (2012) Evaluation of the level of
knowledge of Egyptian women of breast cancer and its risk
factors. A cross sectional study. J Prev Med Hyg 53(4):195–198
3. Gobel G, Auer D, Gaugg I, Schneitter A, Lesche R, Muller-
Holzner E, Marth C, Daxenbichler G (2011) Prognostic signifi-
cance of methylated RASSF1A and PITX2 genes in blood- and
bone marrow plasma of breast cancer patient. Breast Cancer Res
Treat 130:109–117
4. Dulaimi E, Hillinck J, Ibanez de Caceres I, Al-Saleem T, Cairns P
(2004) Tumor suppressor gene promoter hypermethylation in
serum of breast cancer patients. Clin Cancer Res 10:6189–6193
5. Sidransky D (2002) Emerging molecular markers of cancer. Nat
Rev Cancer 2:210–219
6. Laird PW (2003) The power and the promise of DNA methyla-
tion markers. Nat Rev Cancer 3:253–266
7. Baylin SB, Herman JG, Graff JR, Vertino PM, Issa J-PJ (1998)
Alterations in DNA methylation: a fundamental aspect of neo-
plasia. Adv Cancer Res 72:141–196
8. Jones PA, Laird PW (1999) Cancer epigenetics comes of age. Nat
Genet 21:163–167
9. Belinsky SA, Nikula KJ, Palmisano WA et al (1998) Aberrant
methylation of p16INK4a is an early event in lung cancer and a
potential biomarker for early diagnosis. Proc Natl Acad Sci USA
95:11891–11896
10. Esteller M, Sparks A, Toyota M et al (2000) Analysis of ade-
nomatous polyposis coli promoter hypermethylation in human
cancer. Cancer Res 60:4366–4371
11. Esteller M, Corn PG, Baylin SB, Herman JG (2001) A gene
hypermethylation profile of human cancer. Cancer Res
61:3225–3229
12. Lehmann U, Langer F, Feist H, Glockner S, Hasemeier B, Kreipe
H (2002) Quantitative assessment of promoter hypermethylation
during breast cancer development. Am J Pathol 160:605–612
13. Holst CR, Nuovo GJ, Esteller M, Chew K, Baylin SB, Herman
JG, Tlsty TD (2003) Methylation of p16(INK4a) promoters
occurs in vivo in histologically normal human mammary epi-
thelia. Cancer Res 63:1596–1601
14. Yamamoto N, Nakayama T, Kajita M, Miyake T, Iwamoto T,
Kim SJ, Sakai A, Ishihara H, Tamaki Y, Noguchi S (2012)
Detection of aberrant promoter methylation of GSTP1,
RASSF1A, and RARb2 in serum DNA of patients with breast
cancer by a newly established one-step methylation-specific PCR
assay. Breast Cancer Res Treat 132:165–173
15. Kloten V, Becker B, Winner K, Schrauder GM, Fasching AP,
Anzeneder T, Veeck J, Hartmann A, Knuchel R, Dahl E (2013)
Promoter hypermethylation of the tumorsuppressor genes ITIH5,
DKK3, and RASSF1A as novel biomarkers for blood-based
breast cancer screening. Breast Cancer Res 15:R4
16. Lee MG, Kim HY, Byun DS, Lee SJ, Lee CH, Kim JI, Chang SG,
Chi SG (2001) Frequent epigenetic inactivation of RASSF1A in
human bladder carcinoma. Cancer Res 61:6688–6692
17. Agathanggelou A, Honorio S, Macartney DP, Martinez A, Dallo
A, Rader J, Fullwood P, Chauhan A et al (2001) Methylation
associated inactivation of RASSF1A from region 3p21.3 in lung,
breast and ovarian tumours. Oncogene 20:1509–1518
18. Alvarez C, Tapia T, Cornejo V, Fernandez W, Alex M, Camus M,
Alvarez M, Devoto L, Carvallo P (2012) Silencing of tumor
suppressor genes RASSF1A, SLIT2, and WIF1 by promoter hy-
permethylation in hereditary breast cancer. Mol Carcinog
52:475–487. doi:10.1002/mc.21881
19. Dammann R, Yang G, Pfeifer GP (2001) Hypermethylation of the
cpG island of Ras association domain family 1A (RASSF1A), a
putative tumor suppressor gene from the 3p21.3 locus, occurs in a
large percentage of human breast cancers. Cancer Res 61:3105–3109
20. Burbee DG, Forgacs E, Zochbauer-Muller S, Shivakumar L,
Fong K, Gao B, Randle D, Virmani A, Bader Y, Sekido Y, Latif
64 Mol Biol Rep (2014) 41:57–65
123
F, Milchgrub S, Toyooka S, Gadzar AF, Lerman MI, Zabarovsky
E, White M, Minna JD (2001) The RASSF1A locus in the 3p21.3
homozygous deletion region: epigenetic inactivation in lung and
breast cancer and suppression of the malignant phenotype. J Natl
Cancer Inst (Bethesda) 93:691–699
21. Lo KW, Kwong J, Hui ABY, Chan SYY, To KF, Chan ASC,
Chow LSN, Teo PML, Johnson PJ, Huang DP (2001) High fre-
quency of promoter hypermethylation of RASSF1A in nasopha-
ryngeal carcinoma. Cancer Res 61:3877–3881
22. Vos MD, Ellis CA, Bell A, Birrer MJ, Clark GJ (2000) Ras uses
the novel tumor suppressor RASSF1 as an effector to mediate
apoptosis. J Biol Chem 275:35669–35672
23. Tavassoeli FA, Devilee P (2003) Pathology and genetics tumours
of the breast and female genital organs [M]. IARC Press, Lyon,
p 10
24. Herman J, Graff J, Myhanen S, Nelkin B, Baylin S (1996)
Methylation specific PCR: a noval PCR assay for methylation
status of CpG islands. Proc Natl Acad Sci USA 93:9821–9826
25. Rountree MR, Bachman KE, Herman JG et al (2001) DNA
methylation, chromatin inheritance, and cancer. Oncogene
20:3156–3165
26. Jones PA, Baylin SB (2002) The fundamental role of epigenetic
events in cancer. Nat Rev Genet 3:415–428
27. Esteller M (2002) CpG island hypermethylation and tumor sup-
pressor genes: a booming present, a brighter future. Oncogene
21:5427–5440. doi:10.1038/sj.onc.1205600
28. Jeronimo C, Monteiro P, Henrique R, Costa I, Costa VL, Filipe L,
Hoque MO, Pais I, Leal C, Teixeira MR, Sidransky D (2008)
Quantitative hypermethylation of a small panel of genes aug-
ments the diagnostic accuracy in fine-needle aspirate washings of
breast lesions. Breast Cancer Res Treat 109:27–34
29. Park SY, Kwon HJ, Lee HE, Ryu HS, Kim SW, Kim JH, Kim IA,
Jung N, Cho NY, Kang GH (2011) Promoter CpG island hy-
permethylation during breast cancer progression. Virchows Arch
458:73–84
30. Cho YH, Shen J, Gammon MD, Zhang YJ, Wang Q, Gonzalez K,
Xu X, Bradshaw PT, Teitelbaum SL, Garbowski G, Hibshoosh H,
Neugut AI, Chen J, Santella RM (2012) Prognostic significanceof
gene-specific promoter hypermethylation in breast cancer
patients. Breast Cancer Res Treat 131:197–205
31. Li Y, Wei Q, Cao F, Cao X (2008) Expression and promoter
methylation of the RASSF1A gene in sporadic breast cancers in
Chinese women. Oncol Rep 19:1149–1153
32. Karray-Chouayekh S, Trifa F, Khabir A, Boujelbane N, Sellami-
Boudawara T, Daoud J, Frikha M, Jlidi R, Gargouri A, Mokdad-
Gargouri R (2010) Aberrant methylation of RASSF1A is associ-
ated with poor survival in Tunisian breast cancer patients.
J Cancer Res Clin Oncol 136:203–210
33. Issa JP, Ottaviano YL, Celano P, Hamilton SR, Davidson NE,
Baylin SB (1994) Methylation of the oestrogen receptor CpG
island links ageing and neoplasia in human colon. Nat Genet
7:536–540
34. Waki T, Tamura G, Sato M, Motoyama T (2003) Age-related
methylation of tumor suppressor and tumour-related genes: an
analysis of autopsy samples. Oncogene 22:4128–4133
35. Bae YK, Brown A, Garrett E, Bornman D, Fackler MJ, Sukumar
S et al (2004) Hypermethylation in histologically distinct classes
of breast cancer. Clin Cancer Res 10:5998–6005. doi:10.1158/
1078-0432.CCR-04-0667
36. Mehrotra J, Ganpat MM, Kanaan Y, Fackler MJ, McVeigh M,
Lahti-Domenici J, Polyak K, Argani P, Naab T, Garrett E,
Parmigiani G, Broome C, Sukumar S (2004) Estrogen receptor/
progesterone receptor-negative breast cancers of young African-
American women have a higher frequency of methylation of
multiple genes than those of Caucasian women. Clin Cancer Res
10:2052–2057
37. Muller HM, Widschwendter A, Fiegl H, Ivarsson L, Goebel G,
Perkmann E, Marth C, Widschwendter M (2003) DNA methyl-
ation in serum of breast cancer patients: an independent prog-
nostic marker. Cancer Res 63:7641–7645
38. Sunami E, Shinozaki M, Sim M, Nguyen SL, Vu A, Giuliano AE,
Hoon DSB (2008) Estrogen receptor and HER2/neu status affect
epigenetic differences of tumor-related genes in primary breast
tumors. Breast Cancer Res 10:R46
39. Feng W, Orlandi R, Zhao N, Carcangiu ML, Tagliabue E, Xu J,
Bast RC Jr, Yu Y (2010) Tumor suppressor genes are frequently
methylated in lymph node metastases of breast cancers. BMC
Cancer 10:378
40. Van der Auwera I, Bovie C, Svensson C, Trinh XB, Limame R,
van Dam P, van Laere SJ, van Marck EA, Dirix LY, Vermeulen
PB (2010) Quantitative methylation profiling in tumor and mat-
ched morphologically normal tissues from breast cancer patients.
BMC Cancer 10:97
41. Evron E, Dooley WC, Umbricht CB, Rosenthal D, Sacchi N,
Gabrielson E, Soito AB, Hung DT, Ljung B, Davidson NE,
Sukumar S (2001) Detection of breast cancer cells in ductal
lavage fluid by methylation-specific PCR. Lancet 357:1335–1336
42. Fackler MJ, McVeigh M, Mehrotra J, Blum MA, Lange J, Lap-
ides A, Garrett E, Argani P, Sukumar S (2004) Quantitative
multiplex methylation-specific PCR assay for the detection of
promoter hypermethylation in multiple genes in breast cancer.
Cancer Res 64(13):4442–4452
43. Hoque MO, Feng Q, Toure P, Dem A, Critchlow CW, Hawes SE,
Wood T, Jeronimo C, Rosenbaum E, Stern J, Yu M, Trink B,
Kiviat NB, Sidransky D (2006) Detection of aberrant methylation
of four genes in plasma DNA for the detection of breast cancer.
J Clin Oncol 24:4262–4269
Mol Biol Rep (2014) 41:57–65 65
123