Post on 28-Dec-2015
transcript
Molecular Marker Evaluation DataLaura Fredrick Marek
ISU/NCRPIS, Ames, IA
WRPIS, Pullman, WA
supporting presentations by:
grape SSR information pea SNP information
Chuck SimonPGRU, Geneva, NY
Clare Coyne
Molecular Session
Provide an overview of current organization of molecular descriptors/information in GRIN.
Present and solicit suggestions about what information should be included in GRIN.
Present and solicit suggestions about how the data should be organized and presented in GRIN.
Does standardization of presentation format make searching GRIN easier and assist database connectivity?
What do users want to see?
Crops with defined molecular descriptors
maize
sugar beetcucumis
clover
hazelnut
woody-landscape
grape sunflower
vaccinium
sorghum
Not many crops; good time to evaluate/modify data organization and content.
Molecular category can be strictly defined.
A sampling of molecular descriptors
Currently every molecular descriptor is unique; DQ name and definition.
Crop DQNAME GRIN list name definitionalfalfa GENEDIST Chloroplast DNA hypervariability Chloroplast DNA hypervariability. The average distance relative to all other measured. Additional comment.clover ALLELEEFF Allele Effectiveness Effective number of alleles per locus; based on 10 isozyme loci with 28 allelesclover ALLELENUM Allele Number Mean number of alleles per polymorphic locus.clover HETEREXP Expected Heterozygosity Expected heterozygosity (Nei's 1978 unbiased heterozygosity).cucumis CSATGPI1 glucosephosphate isomerase loc glucosephosphate isomerase locus 1.cucumis CSATGPI2 glucosephosphate isomerase loc glucosephosphate isomerase locus 2cucumis CSATIDH isocitrate dehydrogenase isocitrate dehydrogenasecucumis CSATMDH1 malic dehydrogenase locus 1 malic dehydrogenase locus 1cucumis CSATMDH2 malic dehydrogenase locus 2 malic dehydrogenase locus 2cucumis CSATMDH3 malic dehydrogenase locus 3 malic dehydrogenase locus 3maize LOCUS-GOT1 locus gluta-oxa. transaminase1 Locus got1 glutamate-oxaloacetic transaminase1maize LOCUS-GOT2 locus gluta-oxa. transaminase2 Locus got2 glutamate-oxaloacetic transaminase2maize LOCUS-GOT3 locus gluta-oxa. transaminase3 Locus got3 glutamate-oxaloacetic transaminase3maize LOCUS-IDH1 locus isocitr. dehydrogenase1 Locus idh1 isocitrate dehydrogenase1maize LOCUS-IDH2 locus isocitr. dehydrogenase2 Locus idh1 isocitrate dehydrogenase2maize LOCUS-MDH1 locus malate dehydrogenase1 Locus mdh1 malate dehydrogenase1maize LOCUS-MDH2 locus malate dehydrogenase2 Locus mdh2 malate dehydrogenase2maize LOCUS-MDH3 locus malate dehydrogenase3 Locus mdh3 malate dehydrogenase3maize LOCUS-MDH4 locus malate dehydrogenase4 Locus mdh4 malate dehydrogenase4maize LOCUS-MDH5 locus malate dehydrogenase5 Locus mdh5 malate dehydrogenase5maize P-PHI024 p-phi024-cct(SSR) p-phi024-cct (SSR).sugarbeet-rapd AB09 Primer AB09 Primer AB09sugarbeet-rapd AB11 Primer AB11 Primer AB11sugarbeet-rapd AC15 Primer AC15 Primer AC15sugarbeet-rapd AD04 Primer AD04 Primer AD04sunflower ACO1 aconitate hydratase - 1 Aconitate hydratase; locus 1 (Aco1; 4.3.1.3). Comment: See Cronn et al. TAG (1997) 95:532-545 for locus and allele designation.sunflower ACO2 aconitate hydratase - 2 Aconitate hydratase; locus 2 (Aco1; 4.3.1.3). Comment: See Cronn et al. TAG (1997) 95:532-545 for locus and allele designation.sunflower IDH1 isocitrate dehydrogenase - 1 isocitrate dehydrogenase; locus 1 (Idh1; E.C. 1.1.1.41). Comment: See Cronn et al. TAG (1997) 95:532-545 for locus and allele designationsunflower MDH1 NAD+ malate dehydrogenase - 1 NAD+ malate dehydrogenase; locus 1 (Mdh1; E.C. 1.1.1.37). Comment: See Cronn et al. TAG (1997) 95:532-545 for locus and allele designationvaccinium CA112F SSR-CA112F GenBank Accession Number: CF810443 SSR Motif: (AG)7 Forward Primer: TCCACCCACTTCACAGTTCA Reverse Primer: etcvaccinium CA169F SSR-CA169F GenBank Accession Number: CF811071 SSR Motif: (GAT)4 Forward Primer: TAGTGGAGGGTTTTGCTTGG Reverse Primer: etcvaccinium CA190R SSR-CA190R GenBank Accession Number: CF811085 SSR Motif: (TGC)5 Forward Primer: TTATGCTTGCCATGGTGGTA Reverse Primer: etcvaccinium CA236F SSR-CA236F GenBank Accession Number: CF810540 SSR Motif: (TG)17 Forward Primer: GTTAAGCTTTTAGATGAGTTGATGG Reverse Primer: etcwoody-landscape CHEMMARK chemical marker Pigmentation and other chemical marker characterization (by locus when possible).woody-landscape DNA DNA marker DNA marker Characterization (by locus when possible)woody-landscape ISOZYME isozyme marker Isozyme marker characterization (by locus when possible)woody-landscape MORPHMARK morphological marker Morphological marker characterization (by locus when possible)
There is significant variation in definition field content.
GRIN link name
Molecular Descriptors
isozymes, allozymes*
SSRs*
RAPDs*
Molecular category can be strictly defined; descriptors involve specific DNA marker information.
indirect detection (gene products):
direct detection (DNA sequence):
AFLPs
STRsSNPsothers
RFLPs
*marker types with data in GRIN
Example of molecular GRIN data: isozymes
data from multiple crops
data for the same enzyme from multiple crops
Malate Dehydrogenase (MDH1) sunflower gel
allelle 2
allelle 1invariant mito. band
l-102B-4MDH
PI
5997
61PI 240660 P
I 59
9761
PI
5997
61
A
BC
D E
Isozyme Raw Data
gel by M. Brothers
MDH1 in study SUNFLOWER.SUN.ISOZYME.CORE.03
Isozyme data set in GRIN
One way to get data in an excel file is to search by descriptor in Oracle forms database (curators’ GRIN).
Sample size is critical information to include.
CROP DQNAME GRIN link name definitionclover* ALLELEEFF Allele Effectiveness Effective number of alleles per locus; based on 10 isozyme loci with 28 allelesclover* ALLELENUM Allele Number Mean number of alleles per polymorphic locus.clover* HETEREXP Expected Heterozygosity Expected heterozygosity (Nei's 1978 unbiased heterozygosity).clover* HETEROBS Observed Heterozygosity Observed heterozygosity.clover* POLYLOCI Polymorphic Loci Percent of polymorphic loci.cucumis CSATGPI1 glucosephosphate isomerase loc glucosephosphate isomerase locus 1.cucumis CSATGPI2 glucosephosphate isomerase loc glucosephosphate isomerase locus 2cucumis CSATIDH isocitrate dehydrogenase isocitrate dehydrogenasecucumis CSATMDH1 malic dehydrogenase locus 1 malic dehydrogenase locus 1cucumis CSATMDH2 malic dehydrogenase locus 2 malic dehydrogenase locus 2cucumis CSATMDH3 malic dehydrogenase locus 3 malic dehydrogenase locus 3cucumis 12 additional isozymesmaize LOCUS-CAT3 locus catalase3 Locus cat3 catalase3maize LOCUS-GOT1 locus gluta-oxa. transaminase1 Locus got1 glutamate-oxaloacetic transaminase1maize LOCUS-GOT2 locus gluta-oxa. transaminase2 Locus got2 glutamate-oxaloacetic transaminase2maize LOCUS-GOT3 locus gluta-oxa. transaminase3 Locus got3 glutamate-oxaloacetic transaminase3maize LOCUS-IDH1 locus isocitr. dehydrogenase1 Locus idh1 isocitrate dehydrogenase1maize LOCUS-IDH2 locus isocitr. dehydrogenase2 Locus idh1 isocitrate dehydrogenase2maize LOCUS-MDH1 locus malate dehydrogenase1 Locus mdh1 malate dehydrogenase1maize LOCUS-MDH2 locus malate dehydrogenase2 Locus mdh2 malate dehydrogenase2maize LOCUS-MDH3 locus malate dehydrogenase3 Locus mdh3 malate dehydrogenase3maize LOCUS-MDH4 locus malate dehydrogenase4 Locus mdh4 malate dehydrogenase4maize LOCUS-MDH5 locus malate dehydrogenase5 Locus mdh5 malate dehydrogenase5maize 12 additional isozymes
sunflower ACO1 aconitate hydratase - 1Aconitate hydratase; locus 1 (Aco1; 4.3.1.3). Comment: See Cronn et al. TAG (1997) 95:532-545 for locus and allele designation.
sunflower ACO2 aconitate hydratase - 2Aconitate hydratase; locus 2 (Aco1; 4.3.1.3). Comment: See Cronn et al. TAG (1997) 95:532-545 for locus and allele designation.
sunflower IDH1 isocitrate dehydrogenase - 1isocitrate dehydrogenase; locus 1 (Idh1; E.C. 1.1.1.41). Comment: See Cronn et al. TAG (1997) 95:532-545 for locus and allele designation
sunflower MDH1 NAD+ malate dehydrogenase - 1NAD+ malate dehydrogenase; locus 1 (Mdh1; E.C. 1.1.1.37). Comment: See Cronn et al. TAG (1997) 95:532-545 for locus and allele designation
sunflower 7 additional isozymeswoody-
landscape ISOZYME isozyme marker Isozyme marker characterization (by locus when possible)
*Summary statistics listed by accession. Allele data not presented.
Isozyme descriptors in GRIN
Cucumis molecular descriptors in GRIN
Field size limitation: link names for different descriptors appear identical.
CROP DQNAME GRIN link name definitionclover* ALLELEEFF Allele Effectiveness Effective number of alleles per locus; based on 10 isozyme loci with 28 allelesclover* ALLELENUM Allele Number Mean number of alleles per polymorphic locus.clover* HETEREXP Expected Heterozygosity Expected heterozygosity (Nei's 1978 unbiased heterozygosity).clover* HETEROBS Observed Heterozygosity Observed heterozygosity.clover* POLYLOCI Polymorphic Loci Percent of polymorphic loci.cucumis CSATGPI1 glucosephosphate isomerase loc glucosephosphate isomerase locus 1.cucumis CSATGPI2 glucosephosphate isomerase loc glucosephosphate isomerase locus 2cucumis CSATIDH isocitrate dehydrogenase isocitrate dehydrogenasecucumis CSATMDH1 malic dehydrogenase locus 1 malic dehydrogenase locus 1cucumis CSATMDH2 malic dehydrogenase locus 2 malic dehydrogenase locus 2cucumis CSATMDH3 malic dehydrogenase locus 3 malic dehydrogenase locus 3cucumis 12 additional isozymesmaize LOCUS-CAT3 locus catalase3 Locus cat3 catalase3maize LOCUS-GOT1 locus gluta-oxa. transaminase1 Locus got1 glutamate-oxaloacetic transaminase1maize LOCUS-GOT2 locus gluta-oxa. transaminase2 Locus got2 glutamate-oxaloacetic transaminase2maize LOCUS-GOT3 locus gluta-oxa. transaminase3 Locus got3 glutamate-oxaloacetic transaminase3maize LOCUS-IDH1 locus isocitr. dehydrogenase1 Locus idh1 isocitrate dehydrogenase1maize LOCUS-IDH2 locus isocitr. dehydrogenase2 Locus idh1 isocitrate dehydrogenase2maize LOCUS-MDH1 locus malate dehydrogenase1 Locus mdh1 malate dehydrogenase1maize LOCUS-MDH2 locus malate dehydrogenase2 Locus mdh2 malate dehydrogenase2maize LOCUS-MDH3 locus malate dehydrogenase3 Locus mdh3 malate dehydrogenase3maize LOCUS-MDH4 locus malate dehydrogenase4 Locus mdh4 malate dehydrogenase4maize LOCUS-MDH5 locus malate dehydrogenase5 Locus mdh5 malate dehydrogenase5maize 12 additional isozymes
sunflower ACO1 aconitate hydratase - 1Aconitate hydratase; locus 1 (Aco1; 4.3.1.3). Comment: See Cronn et al. TAG (1997) 95:532-545 for locus and allele designation.
sunflower ACO2 aconitate hydratase - 2Aconitate hydratase; locus 2 (Aco1; 4.3.1.3). Comment: See Cronn et al. TAG (1997) 95:532-545 for locus and allele designation.
sunflower IDH1 isocitrate dehydrogenase - 1isocitrate dehydrogenase; locus 1 (Idh1; E.C. 1.1.1.41). Comment: See Cronn et al. TAG (1997) 95:532-545 for locus and allele designation
sunflower MDH1 NAD+ malate dehydrogenase - 1NAD+ malate dehydrogenase; locus 1 (Mdh1; E.C. 1.1.1.37). Comment: See Cronn et al. TAG (1997) 95:532-545 for locus and allele designation
sunflower 7 additional isozymeswoody-
landscape ISOZYME isozyme marker Isozyme marker characterization (by locus when possible)
*Summary statistics listed by accession. Allele data not presented.
Isozyme descriptors in GRIN
* Summary statistics listed by accession.
Should a naming convention be used across crops for molecular descriptors? In general, this is done with morphological descriptors.
A sampling of molecular descriptorsCrop DQNAME GRIN list name definition
alfalfa GENEDIST Chloroplast DNA hypervariability Chloroplast DNA hypervariability. The average distance relative to all other measured. Additional comment.clover ALLELEEFF Allele Effectiveness Effective number of alleles per locus; based on 10 isozyme loci with 28 allelesclover ALLELENUM Allele Number Mean number of alleles per polymorphic locus.clover HETEREXP Expected Heterozygosity Expected heterozygosity (Nei's 1978 unbiased heterozygosity).cucumis CSATGPI1 glucosephosphate isomerase loc glucosephosphate isomerase locus 1.cucumis CSATGPI2 glucosephosphate isomerase loc glucosephosphate isomerase locus 2cucumis CSATIDH isocitrate dehydrogenase isocitrate dehydrogenasecucumis CSATMDH1 malic dehydrogenase locus 1 malic dehydrogenase locus 1cucumis CSATMDH2 malic dehydrogenase locus 2 malic dehydrogenase locus 2cucumis CSATMDH3 malic dehydrogenase locus 3 malic dehydrogenase locus 3maize LOCUS-GOT1 locus gluta-oxa. transaminase1 Locus got1 glutamate-oxaloacetic transaminase1maize LOCUS-GOT2 locus gluta-oxa. transaminase2 Locus got2 glutamate-oxaloacetic transaminase2maize LOCUS-GOT3 locus gluta-oxa. transaminase3 Locus got3 glutamate-oxaloacetic transaminase3maize LOCUS-IDH1 locus isocitr. dehydrogenase1 Locus idh1 isocitrate dehydrogenase1maize LOCUS-IDH2 locus isocitr. dehydrogenase2 Locus idh1 isocitrate dehydrogenase2maize LOCUS-MDH1 locus malate dehydrogenase1 Locus mdh1 malate dehydrogenase1maize LOCUS-MDH2 locus malate dehydrogenase2 Locus mdh2 malate dehydrogenase2maize LOCUS-MDH3 locus malate dehydrogenase3 Locus mdh3 malate dehydrogenase3maize LOCUS-MDH4 locus malate dehydrogenase4 Locus mdh4 malate dehydrogenase4maize LOCUS-MDH5 locus malate dehydrogenase5 Locus mdh5 malate dehydrogenase5maize P-PHI024 p-phi024-cct(SSR) p-phi024-cct (SSR).sugarbeet-rapd AB09 Primer AB09 Primer AB09sugarbeet-rapd AB11 Primer AB11 Primer AB11sugarbeet-rapd AC15 Primer AC15 Primer AC15sugarbeet-rapd AD04 Primer AD04 Primer AD04sunflower ACO1 aconitate hydratase - 1 Aconitate hydratase; locus 1 (Aco1; 4.3.1.3). Comment: See Cronn et al. TAG (1997) 95:532-545 for locus and allele designation.sunflower ACO2 aconitate hydratase - 2 Aconitate hydratase; locus 2 (Aco1; 4.3.1.3). Comment: See Cronn et al. TAG (1997) 95:532-545 for locus and allele designation.sunflower IDH1 isocitrate dehydrogenase - 1 isocitrate dehydrogenase; locus 1 (Idh1; E.C. 1.1.1.41). Comment: See Cronn et al. TAG (1997) 95:532-545 for locus and allele designationsunflower MDH1 NAD+ malate dehydrogenase - 1 NAD+ malate dehydrogenase; locus 1 (Mdh1; E.C. 1.1.1.37). Comment: See Cronn et al. TAG (1997) 95:532-545 for locus and allele designationvaccinium CA112F SSR-CA112F GenBank Accession Number: CF810443 SSR Motif: (AG)7 Forward Primer: TCCACCCACTTCACAGTTCA Reverse Primer: etcvaccinium CA169F SSR-CA169F GenBank Accession Number: CF811071 SSR Motif: (GAT)4 Forward Primer: TAGTGGAGGGTTTTGCTTGG Reverse Primer: etcvaccinium CA190R SSR-CA190R GenBank Accession Number: CF811085 SSR Motif: (TGC)5 Forward Primer: TTATGCTTGCCATGGTGGTA Reverse Primer: etcvaccinium CA236F SSR-CA236F GenBank Accession Number: CF810540 SSR Motif: (TG)17 Forward Primer: GTTAAGCTTTTAGATGAGTTGATGG Reverse Primer: etcwoody-landscape CHEMMARK chemical marker Pigmentation and other chemical marker characterization (by locus when possible).woody-landscape DNA DNA marker DNA marker Characterization (by locus when possible)woody-landscape ISOZYME isozyme marker Isozyme marker characterization (by locus when possible)woody-landscape MORPHMARK morphological marker Morphological marker characterization (by locus when possible)
There is significant variation in definition field content.
GRIN link name
Vaccinium DQ name derived from EST source name.
Currently every molecular descriptor is unique; DQ name and definition.
SSR gel (Licor) of individuals from three alfalfa cultivars.
Ted Kisha, W6, SSR gel image and information.
MW
M
MW
M
AragonHunter River
Yonca
CROP DQNAME GRIN link name Definition
alfalfa GENEDISTChloroplast DNA hypervariability
Chloroplast DNA hypervariability. The average distance relative to all other measured. Other data downloadable as Excel:135 by 135 matrix and Genetic distance between 2 accessions(8972 combinations)- click on Chloroplast DNA hypervariabili.
hazelnut hidden SSRs NA
[Data visible by selecting hazelnut/list of descriptors/molecular. Select descriptor. Select FILBERT. MEHLENBACHER. Select Mehlenbacher, S., Oregon State University. Select Cultivated.Hazelnut.SSR.2005. Select View a table of the SSR data as an Excel Spreadsheet.] [Data from 20 SSRs, 270 cultivars.]
maize P-PHI024 p-phi024-cct(SSR) p-phi024-cct (SSR).
vaccinium CA112F SSR-CA112F
GenBank Accession Number: CF810443 SSR Motif: (AG)7 Forward Primer: TCCACCCACTTCACAGTTCA Reverse Primer: GTTTATTGGGAGGGAATTGGAAAC Optimum Annealing Temperature: 62 C Separation: ABI 3100 Capillary Electrophoresis. Comment: Dye: Fam (Operon) Allele Size: 142-184 bp SSR-CA112F (Jeannie Rowland's EST library of cold-acclimated 'Bluecrop' flower buds) BLAST Hit: None BLAST Value: None SSR Location: Unknown
vaccinium CA169F SSR-CA169F
GenBank Accession Number: CF811071 SSR Motif: (GAT)4 Forward Primer: TAGTGGAGGGTTTTGCTTGG Reverse Primer: GTTTATCGAAGCGAAGGTCAAAGA Optimum Annealing Temperature: 62 C Separation: ABI 3100 Capillary Electrophoresis. Comment: Dye: Fam (Operon) Allele Size: 109-136bp SSR-CA169F (Jeannie Rowland's EST library of cold-acclimated 'Bluecrop' flower buds) BLAST Hit: None BLAST Value: None SSR Location: Unknown
vaccinium CA190R SSR-CA190R
GenBank Accession Number: CF811085 SSR Motif: (TGC)5 Forward Primer: TTATGCTTGCCATGGTGGTA Reverse Primer: TTGCGAAGGGACCTAGTAGC Optimum Annealing Temperature: 62 C Separation: Beckman CEQ 8000 Capillary Electrophoresis. Comment: Dye: Light Sabre Blue (Synthegen) Allele Size: 250-280 bp SSR-CA190R (Jeannie Rowland's EST library of cold-acclimated 'Bluecrop' flower buds) BLAST Hit: None BLAST Value: None SSR Location: Unknown
vaccinium CA236F SSR-CA236F
GenBank Accession Number: CF810540 SSR Motif: (TG)17 Forward Primer: GTTAAGCTTTTAGATGAGTTGATGG Reverse Primer: GTTTAACCAGTCCCAGACCCAAAT Optimum Annealing Temperature: 64 °C Separation: Beckman CEQ 8000 Capillary Electrophoresis. Comment: Dye: Light Sabre Blue (Synthegen) Allele Size: 214-241 bp SSR- CA236F (Jeannie Rowland's EST library of cold-acclimated 'Bluecrop' flower buds) BLAST Hit: None BLAST Value: None SSR Location: Unknown
vaccinium CA23F SSR-CA23F
GenBank Accession Number: CF810543 SSR Motif: (AGA)6 Forward Primer: GAGAGGGTTTCGAGGAGGAG Reverse Primer: GTTTAGAAACGGGACTGTGAGACG Optimum Annealing Temperature: 62 C Separation: ABI 3100 Capillary Electrophoresis. Comment: Dye: Hex (Operon) Allele Size: 155-164 bp SSR-CA23F (Jeannie Rowland’s EST library of cold-acclimated ‘Bluecrop’ flower buds) BLAST Hit: None BLAST Value: None SSR Location: Unknown
vaccinium CA855F SSR-CA855F
GenBank Accession Number: CF811000 SSR Motif: (GA)14..(CGA)5 Forward Primer: CGCGTGAAAAACGACCTAAT Reverse Primer: GTTTACTCGATCCCTCCACCTG Optimum Annealing Temperature 64 C Separation: Beckman CEQ 8000 Capillary Electrophoresis. Comment: Dye: Light Sabre Green (Synthegen) Allele Size: 225-258 bp SSR-CA855F (Jeannie Rowland's EST library of cold-acclimated 'Bluecrop' flower buds) BLAST Hit: Oryza cDNA clone (AK100986) BLAST Value: 6.00E-21 SSR Location: 5' UTR
vacciniumwoody-
landscape DNA DNA marker DNA marker Characterization (by locus when possible)
22 additional SSRs
SSR and other PCR-based descriptors in GRIN
Blueberry descriptor definition field includes more information than any other crop.
Blueberry SSR data model
A tour through public GRIN…or, what the information looks like to our users….
Nahla Bassil, Corvallis
Select “Research Crops and Descriptor/Evaluation Data Queries”.
Select “VACCINIUM”
Select “List of Descriptors”
CA stands for “cold acclimated”. (Only defined in embedded excel worksheet.)
Actual descriptor name does not include SSR- (affects ability to search in oracle forms database version).
Select “SSR-CA112F”
Abbreviated SSR definition on this page. Combined GRIN/information based choice?
Actual descriptor name does not include SSR- (affects ability to search in oracle forms database version).
In sunflower, the equivalent field is named “code values”.
Select “Observed values”
Full descriptor definition on this page. Contains descriptor specific information for this evaluation. More detail than any other descriptor.
Definition indicated allele range of 142-184 bp.
Go back to the full descriptor definition page.
Actual descriptor name does not include SSR- (affects ability to search in oracle forms database version).
Select “CULTIVATED BLUEBERRY.SSR.2005”
(Called study or environment on this page.)
Actual descriptor name does not include VACCINIUM (affects ability to search in oracle forms database version).
If select “VACCINIUM CA112F”, will go back to full definition page.
If select “54 Accessions …
(Called evaluation on this page.)
Blueberry accessions are clonal. In an out crossing seed crop, data in this category could look like….
Population sample size critical information to include.
Back to the evaluation page…
Select “an Excel Spreadsheet”.
CA23F CA112F CA169F CA190R CA236F CA344F CA421FPI 554833 CVAC 1190 Vaccinium corymbosum L. 1613A 155/158 142/144/146 112/115 240/243 238 153/156/159/162 180/182/192PI 554798 CVAC 47.001 Vaccinium corymbosum L. Atlantic 155/158 142/148 109/112/115/127 240/243/246 238 156/159/162 170/182/186/210
Vaccinium corymbosum L. Auroraa 155/158 142/144/146 109/112/121 240/243 230 156/159/168 170/180/182PI 554883 CVAC 849 Vaccinium corymbosum L. Berkeley 155/158 142/144 109/112/115/121 240/243/246 225/230 156/159/162 186/190/192/198PI 618193 CVAC 1344 Vaccinium hybrid Biloxi 155/158 142/144/146 112/127 240 230 147/153/159/168 170/182/192/224PI 554827 CVAC 851 Vaccinium corymbosum L. Bluecrop 155/158 142 109/115 240 230/238 153/156/162/168 166/170/182/198PI 554846 CVAC 226 Vaccinium corymbosum L. Bluejay 155/158 142/144/146/148 115/121 240/243/246 225/230 160/162/173 186/192/198PI 554799 CVAC 853 Vaccinium corymbosum L. Blueray 155/158 142/144/148 109/112/115 240/243/246 230/238 153/156 166/170/180/198PI 554837 CVAC 225 Vaccinium corymbosum L. Bluetta 155/158 142/144/146 112/115/118/121 240/246 0 156/157/160/162 166/180/184/222PI 554826 CVAC 78.001 Vaccinium corymbosum L. Cabot 158 142/144/149 112/115/121/127 240/243 225/230 153/154/156/160 166/176/180/210
Vaccinium corymbosum L. Chandlerb 155/158 142/144 109/115/121/127 240 238 153/156/162 170/182/192/198PI 554829 CVAC 53.001 Vaccinium corymbosum L. Coville 155 142 109/112/115/121 240/243/246 230/238 153/156/160/168 166/182/190/198PI 618035 CVAC 1020 Vaccinium corymbosum L. Darrow 155/158 142/146 109/115/127 243 225 156/162 176/190/192/198
Vaccinium corymbosum L. Draperb 155 142 109/112/115 240/243/246 222/230 153/156/159 166/186/198/206PI 554872 CVAC 703 Vaccinium corymbosum L. Duke 155/158 142/144 112/115 240/246 230/238 156/160/162 166/186/198PI 554893 CVAC 859 Vaccinium corymbosum L. Earliblue 155/158 142/144/149 112/115/121 240/243 225 156/160/162 166/192/198/222PI 554894 CVAC 701 Vaccinium corymbosum L. Elliott 155/158 142/144/146 109/115/121/127 243/246 230 153/156 182/190
Emeralda 155/158 142/171 109/112/115/136 240/246 225/230 153/156/159/168 170/186PI 554957 CVAC 720 Vaccinium hybrid Flordablue 155 142/144/172 112/115/121 240/246 230 156/159/162 174/186/192PI 554873 CVAC 721 Vaccinium corymbosum L. Georgiagem 155/158 142/144 109/112/115 246 223/230 156/159/162 170/192/198PI 554804 CVAC 57.001 Vaccinium corymbosum L. Grover 155/158 142/144 109/112/115 240/246 224/229/230 156/168/170 176/182/186/194PI 554805 CVAC 91.001 Vaccinium corymbosum L. Herbert 155/158 142/149 109/115 240/243 230 153/156/159 166/182/186/190PI 554807 CVAC 92.001 Vaccinium corymbosum L. Ivanhoe 155/158 142/144/149 109/112/115/121 240/243 0 153/162/168 166/184/192/222PI 554808 CVAC 90.001 Vaccinium corymbosum L. Jersey 155/158 142/144/149 109/112/115 240/243/246 230/238 156/162/168 176/182/186/198
Jewela 155/164 142/146 109/112/115/136 240/243/246 225 147/159/165 168/172/186/222PI 554810 CVAC 63.001 Vaccinium corymbosum L. June 238 153/156/159/162 170/182/192/222 310/326/328 238 153/156/159/162 170/182/192/222PI 618164 CVAC 1310 Vaccinium hybrid Legacy 0 156/159/162/168 170/182/190/192 303/318 0 156/159/162/168 170/182/190/192
Vaccinium corymbosum L. Libertya 230 153/156/160 170/182/198 318 230 153/156/160 170/182/198PI 618194 CVAC 1345 Vaccinium hybrid Magnolia 230/232 153/156/159/162 166/170/180/186 318/328 230/232 153/156/159/162 166/170/180/186PI 554832 CVAC 82.001 Vaccinium corymbosum L. Meader 225/230 156/162/168 166/170/192 310/328 225/230 156/162/168 166/170/192
Millenniaa 225 153/156/168 170/186 0 225 153/156/168 170/186PI 555317 CVAC 718 Vaccinium corymbosum L. Misty 225/230/232 153/156/162/165 186/195/198/220 312/328 225/230/232 153/156/162/165 186/195/198/220PI 554952 CVAC 702 Vaccinium hybrid Northland 225/232 156/162 180/182/186/190 0 225/232 156/162 180/182/186/190PI 554943 CVAC 217 Vaccinium hybrid Northsky 0 156/162/165 170/180/206/222 297/318/322 0 156/162/165 170/180/206/222PI - CVAC 1308 Vaccinium corymbosum L. Nui 230 153/156/162 170/182/192/206 318/326 230 153/156/162 170/182/192/206PI 554812 CVAC 228 Vaccinium corymbosum L. Olympia 229/230/232 156/159/170 170/176/180 309/339 229/230/232 156/159/170 170/176/180
PI 554944 O’ Nealb 225/238 154/159/162 166/198/222 318/328 225/238 154/159/162 166/198/222PI - CVAC 1321 Ozarkblue 223/238 159/160/162/168 166/170/182/192 316/329 223/238 159/160/162/168 166/170/182/192PI 554843 CVAC 864 Vaccinium corymbosum L. Patriot 230 156/162 166/182/192/198 318/328 230 156/162 166/182/192/198PI 618192 CVAC 1343 Vaccinium hybrid Pearl River 225/228/230/235 147/155/156/159 172/180/190/212/224 310/316/318/333 225/228/230/235 147/155/156/159 172/180/190/212/224PI 554815 CVAC 68.001 Vaccinium corymbosum L. Pioneer 232 156/159/162 170/180/182/210 303 232 156/159/162 170/180/182/210PI 554816 CVAC 69.001 Vaccinium corymbosum L. Rancocas 230 153/156/162 170/182/198/222 297/310/318 230 153/156/162 170/182/198/222a Patented material obtained from Fall Creek Farm and Nursery (Lowell, Ore.) with permission from the University of Florida or University of Michiganb Non-patented material obtained from Fall Creek Farm and Nursery (Lowell, Ore.)
Table 1. Fingerprints of 69 blueberry accessions using 13 SSR loci developed in the CULTIVATED.BLUEBERRY.SSR.2005 study from a floral bud cold acclimated (CA) EST
Accession # clocal local taxon
Genotype Designation
SSR Loci
Partial listing of CA-type Vaccinium SSRs (descriptors) and observation values. Other SSR types (NA, VCC) listed on separate worksheets in the file.
Is useful information missing from the blueberry model?
Publication reference
BLAST date, search algorithm and database(s) searched
Summary statistics (in publication?)
Put all common descriptor data in evaluation page description.
Population size or sampling information
Information Organization
Grape SSR data presented by Chuck
What information should be included?
Currently each molecular descriptor is unique. Most will be.
Significant variation in content in definition and evaluation fields.
How to name descriptors?
Introduce a new field containing molecular marker type (SSR, SNP etc) to facilitate cross-genera searching.
How to define evaluation (environment)?
Should descriptors follow a naming convention across crops?
Should definitions contain similar information across data types and crops?
Experimental details, raw data: Information to allow use of markers by other labs.Summary statistics: Information to assess accession diversity.
Descriptor definitions should contain descriptor unique information.
Evaluation/environment definitions should contain information in common to all descriptors in that evaluation.
SSR
SNP
isozyme
CROP
CROP-isozyme
CROP-SSR
CROP-SNP
molecular
SSR#1
SSR#2
SSR#3
SNP#1
SNP#2
isozyme#1
CROP CROPmolecular
DQ name
enzyme locus
DQ name
DQ nameDQ name
Consider how data organization affects searching ability in GRIN curators database version (oracle forms).
A B C
etc.
Structure of molecular data in GRINThree models are currently in use. B is most common.
etc.etc.
Which format best handles multiple accessions with multiple descriptors within multiple data types (blueberry model of 54/28 is a conservative amount of data)?
CROP DQNAME GRIN link name DefinitionProposed category
proposed descriptor
grape GENOMESZBP Genome Size Base Pairs Genome size in millions of base pairs per haploid genome cytologic no changegrape GENOMESZPG Genome Size in picograms Genome size in picograms per diploid genome. cytologic no change
hazelnut DORMALLELE* dormancy alleles dormancy allelesphysiology or
stress no change
hazelnut INCOMPATAL* incompatibility alleles incompatability alleles, where d = dominant and r = recessivephysiology or
stress no change
sorghum RESTORER B/R line restorer
Accessions crossed to various male-sterile (A-lines) lines in order to test their ability to restore fertility in F1 hybrids within a particular cytoplasmic system. cytologic cytoplasm type
* no information in GRIN about how data were obtained.
Re-categorize some molecular descriptors
other chromosome related information presented in the category “cytologic”
other cytoplasmic male sterility data presented in the category “cytoplasm type”
Summary: Molecular Session
What information should be included in GRIN?What do users want to see?
Include allele sizes and frequency data in GRIN.
Information to include in descriptor definition (as per SSR data model).
Primer sequences
GenBank reference Publication reference or information source.
Experimental details unique to individual descriptor such as:
Population sampling size
For BLAST search results, include search algorithm, date of search and database(s) searched.
Sample gel image(s) with standards (molecular weight and standard accession).
Experimental details in common to all descriptors in environment.
Information to include in evalutation/environment definition.
Summary: Molecular Session
How should the data be organized and presented in GRIN?
Would standardization of presentation format make searching GRIN easier and assist database connectivity?
Select descriptor name to allow cross crop searching.
Introduce a new field containing molecular marker type (SSR, SNP etc) to facilitate cross crop searches.
Embed information links in GRIN not on local WEB pages.
Consider re-categorization of descriptors to streamline searching.
Helianthus niveus ssp. niveus
on the Pacific coast sand dunes west of Vincente Guerrero, BC, Mex
endemic to Baja California, only Heilanthus taxa not represented in NPGS