Post on 11-Nov-2021
transcript
Graduate Theses and Dissertations Iowa State University Capstones, Theses andDissertations
2017
Selection of functional RNA aptamers againstEbola glycoproteinsShambhavi ShubhamIowa State University
Follow this and additional works at: https://lib.dr.iastate.edu/etd
Part of the Biochemistry Commons
This Dissertation is brought to you for free and open access by the Iowa State University Capstones, Theses and Dissertations at Iowa State UniversityDigital Repository. It has been accepted for inclusion in Graduate Theses and Dissertations by an authorized administrator of Iowa State UniversityDigital Repository. For more information, please contact digirep@iastate.edu.
Recommended CitationShubham, Shambhavi, "Selection of functional RNA aptamers against Ebola glycoproteins" (2017). Graduate Theses and Dissertations.16528.https://lib.dr.iastate.edu/etd/16528
Selection of functional RNA aptamers against Ebola glycoproteins
by
Shambhavi Shubham
A dissertation submitted to the graduate faculty
in partial fulfillment of the requirements for the degree of
DOCTOR OF PHILOSOPHY
Major: Molecular Cellular and Developmental Biology
Program of Study Committee
Marit Nilsen-Hamilton, Major Professor
W. Allen Miller
Eric Henderson
Drena Dobbs
Walter Moss
Iowa State University
Ames, Iowa
2017
Copyright © Shambhavi Shubham 2017. All rights reserved.
ii
DEDICATION
I dedicate this dissertation to my mother Saroj Shrivastava for her constant support and
inspiration.
iii
TABLE OF CONTENTS
Page
LIST OF FIGURES…………………………………………………………………...v
ACKNOWLEDGMENTS……………………………………………………………vii
ABSTRACT……………………………………………………………………….....viii
CHAPTER 1: REVIEW OF LITERATURE
Filoviruses……………………………………………………………………..1
Filoviruses Pathogenesis………………………………………………………2
Ebola Virus Immune Evasion Strategy………………………………………..3
Viral Replication And Transcription…………………………………………..5
Ebola Glycoprotein GP1, 2……………………………………………………7
Ebola Glycoprotein GP1, 2 And Its Interaction with the Host Cell…………...9
Ebola Glycoprotein GP1, 2 Mediating Host and Cell Membrane Fusion……11
Ebola sGP…………………………………………………………………….12
Ebola sGP Role In Pathogenesis……………………………………………..14
Ebola Therapeutics And Vaccine…………………………………………….15
Ebola Diagnostic Kits………………………………………………………...16
Aptamers……………………………………………………………………...17
Methods of Selection In Aptamers……………………………………………21
High Throughput Sequencing And Data Analysis……………………………25
Aptamers vs Antibodies And Its Market State………………………………..27
iv
Aptamers In Diagnosis Of Viral Infections…………………………………...29
Aptamers In Preventing The Fusion Of Virus Particle With Host Cell……….31
CHAPTER 2: A 2’FY RNA EPITOPE FORMS AN APTAMER FOR
EBOLAVIRUS SGP: SELECTION AND CHARACTERIZATION………………..60
Abstract………………………………………………………………………..61
Introduction………………………………………………………………........62
Results……………………………………………………………………........63
Discussion……………………………………………………………………..67
Materials And Methods……………………………………………………….71
Legends To Figures……………………………………………………….......77
References……………………………………………………………………..79
CHAPTER 3: SELECTING A FUNCTIONAL ANTI–VIRAL RNA APTAMER
AGAINST EBOLAVIRUS SURFACE GLYCOPROTEIN…………………………..88
Abstract………………………………………………………………………...89
Introduction…………………………………………………………………......90
Results………………………………………………………………………......92
Discussion………………………………………………………………………95
Materials and Methods………………………………………………………….99
Legends to Figures…………………………………………………………......104
References……………………………………………………………………...106
CHAPTER4: CONCLUSION AND DISCUSSION………………………………...115
References………………………………………………………………………121
v
LIST OF FIGURES
CHAPTER 1 Page
Figure 1 Ebola Virus Particle 34
Figure 2 GP1,2Δmucin X ray Crystallography Structure 35
Figure 3 Prefusion and postfusion GP1,2 conformation 36
Figure 4 Structures of full length GP1,2 and sGP 37
Figure 5 SELEX protocol to isolate RNA aptamers 38
CHAPTER 2
Figure 1 Next Gen Sequencing Analysis and Consensus Motif Identification 83
Figure 2 Determining the affinities of 2’FY oligonucleotides against sGP 84
Figure 3 Determining the binding epitope of sGP on 2’FY RNA aptamer 85
Figure 4 Competition Binding Assay to determine the site of interaction of 86
various aptamer sequences
Figure 5 Specificity of 2’FY aptamer for sGP over serum proteins 87
CHAPTER 3
Figure 1 Comparison of top 10 sequences from SELEX experiments to select
aptamers that recognize GP1,2Δmucin and full length GP1,2 111
Figure 2 Selection through a sucrose cushion 112
Figure 3 Filter capture assay to estimate the affinity of oligonucleotide 4789 113
for GP1,2Δmucin
vi
Figure 4 Filter capture assay to determine the affinity of oligonucleotide 5185 114
and 5187 for GP1,2
vii
ACKNOWLEDGMENTS
I would like to thank my advisor Dr. Marit Nilsen-Hamilton for her support and
guidance all these years. She has taught me how to be a good experimentalist and an
independent researcher. Her ideas and knowledge made my Ph.D. experience productive and
stimulating. I am thankful to my committee members Dr. Allen Miller, Dr. Drena Dobbs, Dr.
Eric Henderson and Dr. Walter Moss for their time, guidance, and insightful questions. I would
like to acknowledge Dr. Eric Underbakke for teaching me Mass Spectrometry and being a
great mentor.
I would like to thank my lab manager Lee Bendickson for being very patient with me
and teaching critical technical details essential for designing good experiments. Thank you to
my past and present lab members who have contributed immensely to my personal and
professional time at Iowa State University. They have provided me with great guidance and
collaboration all these years and have been great friends as well.
My time in Ames was made enjoyable due to my friends, who provided me with a lot
of love, support, and guidance. I am grateful for the time spent with them not just discussing
science but also life.
Lastly, I would like to thank my parents and my sister for their love and encouragement.
This journey wouldn’t have been possible without them. Thanks to my loving, supporting and
patient husband Gunjan Pandey for standing by me through thick and thin. And most of all my
very loving son Reyansh Pandey, he’s made my life complete and encourages me to be a better
person every day. Thank You.
viii
ABSTRACT
Ebola viruses (EBOV) cause severe disease symptoms in humans and in non-human
primates in the form of viral hemorrhagic fever. Although EBOV outbreaks have not occurred
in the U.S., the virus is of public health concern as a potential bioterrorism organism for which
no vaccine or anti-viral is available. Fast-acting and prophylactic therapeutics are needed to
reduce mortality due to outbreaks in other countries and for use in the U.S. if the virus is used
in a bioterrorism attack. In view of the paucity of current antiviral therapies and diagnostic
systems for EBOV, we provide an alternative solution by selection of high affinity 2’FY-
stabilized RNA aptamers that bind the EBOV surface exposed glycoprotein, GP1 and soluble
glycoprotein (sGP). Aptamers are single stranded short nucleic acid oligonucleotides with
sequences that enable high affinity and specificity for their targets. Aptamers have comparable
affinity with antibodies, but they are not immunogenic and are raised by in-vitro methods.
They can be selected to bind to a precise region of a protein. By this means, an aptamer binding
the EBOV surface GP1 would prevent the interaction between the virus and the host cell,
disrupt the viral life cycle and an aptamer against sGP can be integrated with a detection
platform that can be used as a biosensor to detect Ebola infections.
1
CHAPTER 1
INTRODUCTION
Filovirus Overview
Filoviridae family is composed of three genera: Ebolaviruses, Marburgviruses and
Cueva viruses. There are two species of Marburgvirus, Marburg virus (MARV) and Ravn
virus (RAVV) and five species of Ebolavirus, Ebola virus (EBOV), Sudan virus (SUDV), Tai
Forest virus (TAFV), Reston Virus (RESTV) and Bundibugyo virus (BDBV) [1]. Ebola virus
is an enveloped, non-segmented and negatively stranded RNA virus with genome of roughly
19kb. Ebola virus particle is filamentous in shape and genome encodes seven structural
proteins beginning from the 3’ end: the nucleoprotein (NP), viral protein (VP35), VP40, the
glycoprotein (GP), VP30, VP24 and the RNA dependent RNA polymerase (L). The viral RNA
genome is encapsulated in NP that, along with VP35, VP30, and L form the replication
complex [2] (Figure 1). VP 40 is the major matrix protein and is sufficient for budding of virus-
like particles (VLPs), VP24 is a minor matrix protein [3, 4]. In addition to these proteins, Ebola
virus secretes into the blood stream soluble glycoprotein (sGP). It is a nonstructural, secretory
glycoprotein, which shares a 295-amino acid sequence with the glycoprotein GP. Ebolavirus
infection can cause hemorrhagic fever with mortality rates as high as 90% [5]. The most recent
outbreak was in 2014 when the incidence and prevalence of Ebola infections exceeded any
previous outbreak [6]. With its ability to cause severe pathogenicity and a high mortality rate,
the potential of being used for bioterrorism and the absence of any licensed vaccines or
therapeutics underscores the threat, this virus poses to public health [7].
2
Filovirus Pathogenesis
Filoviruses cause hemorrhagic fever in human and non-human primates and exhibit
high rates of mortality reaching up to 90%. Initial infection occurs through direct transmission
from bats which are believed to be the host reservoir [4]. Ebola virus enters the host through
mucosal surfaces and breaks through the skin. Most human infections have been caused by
direct contact with the human patients or cadavers or infected animal carriers. Infectious virus
particles or viral RNA have been detected in the semen and genital secretions of infected
patients [4]. The known infectivity titers in non-human primates have been reported to be in
the range of 107 to 108 plaque forming units/g[8], any exposure though the oral route can be
associated with very high infectious doses. Transmission of the Ebola virus through an aerosol
route has not been documented and is thought to be rare. Ebola virus, once it gains entry into
the body, targets a range of cells early during infection, including monocytes, macrophages
and dendritic cells, and then spreads to a variety of other cell types, including epithelial cells
in the visceral organs [10]. Transport of infected immune cells and free virus through the blood
stream is believed to enable the virus to spread from the site of initial infection. The high
lethality of Ebola viruses in large part is due to an early and strong inhibition of the innate
immune response [20].
3
Ebola Virus Immune Evasion Strategies
Phosphatidyl serine dependent
Ebola virus particles are filamentous in shape and can be up to a micron in length,
which would make it difficult for them to be taken in by the cells by clathrin or caveolin
mediated endocytosis. Clathrin mediated endocytosis is usually limited to virions of 100nm
whereas caveolin is around 50nm. It could be for this reason that Ebola virus is taken up by
macropinocytosis. Phosphatidylserine is a lipid found on the outer leaflet of apoptotic cells
where it alerts phagocytic cells to engulf the apoptotic cells by macropinocytosis. In a similar
fashion, phosphatidylserine on the Ebola virus particles is recognized by the (T-cell
immunoglobulin and mucin domain 1) TIM-1 receptors, interaction between TIM-1 receptor
and phosphatidylserine mediates the entry of virus into the host cells. Ebola virus acquires
phosphatidylserine from the plasma membrane microdomains, called lipid rafts, during the
budding process. Lipid rafts are highly enriched for phosphatidylserine on the external
leaflet[11]. The Ebola virus particles present themselves to phagocytic cells as apoptotic
bodies and avoid initiating the inflammatory response by being engulfed by the cells. [12, 13].
4
Preventing the interferon response
VP35
VP35 is a multifunctional protein, which is associated with the ribonuclear complex
and links the viral RNA polymerase (L) to the nucleoprotein (NP) during viral replication.
VP35 also inhibits α and β interferon responses by multiple mechanisms. One mechanism is
mediated by inhibiting RIG-I and MDA-5, innate pattern recognition receptors that detect
foreign cytoplasmic RNA. RIG-I recognizes 5’-triphoshophates of the blunt end of dsRNA and
MDA-5 senses long dsRNA. RIG-I and MDA-5 associates with a common downstream
adaptor IPS-1, which activates NF-kB, IRF-3, and IRF- 7 to trigger the expression of type I
interferon and pro-inflammatory cytokines. VP35 is a decoy substrate for IKKε /TBK-1
kinases and impedes the RIG-1 pathway by binding the N-terminal kinase domain of IKKε and
prevents IRF-3 phosphorylation. Interactions of IKKε with other proteins such as IRF-1 and
IPS-1 are also prevented due to binding of VP35 to IKKε [14]. These interactions successfully
block the activation of genes with interferon responsive promoters [15, 16]. In a second
mechanism, VP35 competes with RIG-I by binding to the blunt end of dsRNA, which prevents
RIG-I and MDA-5 responses [17-19].
VP24
Typically, when innate immunity is functional, the host response to a virus infection is
secretion of interferon proteins to generate antiviral responses in neighboring cells, signal
hematopoietic cell responses and increase antigen presentation. Secreted interferon binds to
type I and II interferon receptors, activating signaling via adaptor proteins, which results in the
5
phosphorylation and dimerization of the signal transducer and activator of transcription
(STAT) proteins. These dimerized transcription factors are transported to the nucleus where
they bind to interferon response elements and induce antiviral gene expression [20]. Since,
these pathways are so important in fighting viral infections, viruses usually target them.
Karyopherin-α1 is the nuclear membrane localized signal receptor that is responsible for
nuclear accumulation of the STAT-1 dimers. VP24 interacts with karyopherin-α1 to inhibit the
nuclear accumulation of STAT-1 and block interferon signaling. This mechanism prevents
antiviral effects in cells expressing Ebola virus [21].
RNA stability and replication
The heterogeneous nuclear protein complexes, C1/C2 proteins ((hnRNP C1/C2), reside
in the nucleus where they bind poly-U mRNA and assist in splicing before they are transported
into the cytoplasm. They also engage in cap independent, IRES (Internal Ribosome Entry Site)
dependent translation in the cytoplasm during mitosis [22]. Ebola VP24 causes relocalization
of hnRNP C1/C2 from the nucleus to cytoplasm. It is hypothesized that C1/C2 might bind the
poly-U tracts in Ebola viral RNA, thereby stabilizing it against degradation and enhancing
genomic replication [22]. This suggests that Ebola virus uses the host machinery to prolong
the half-life of its viral RNA and optimize transcription from its genome and viral replication.
Filoviral Replication and Transcription
Filovirus replication and transcription happens in the cytoplasm of the infected cell, the
virus encodes its own RNA-dependent RNA polymerase that uses the negative-strand viral
6
RNA as a template for transcription and replication. Nucleocapsid assembly for the virus is
mediated by three proteins NP, VP35 and VP30. The rate-limiting step for nucleocapsid
formation is nucleoprotein (NP) assisted formation of helical bundle. [23]. This is followed by
interactions with VP35 and VP30 and L to produce the ribonucleoprotein that encapsulates the
viral genome. [24, 25]. For budding and formation of a virion, VP35 interacts with capsid
protein VP40 and mediates the packaging of the nucleocapsid into the mature virion on the cell
surface [26].
Replication of the RNA genome is initiated by the synthesis of positive sense
intermediate (antigenome). The antigenome is the reverse complement of the RNA genome
and it serves as a template for the generation of negative stranded RNA. Studies with Marburg
and Ebola virus minigenome systems have established NP, VP35 and L as the minimal
essential components for viral replication [27, 28] [29].
Transcription process begins after the viral RNA is released into cytoplasm, the
polymerase complex starts to transcribe it. Viral genome available for transcription is oriented
in 3’ to 5’ direction, due to the polymerase complex stopping and reinitiating at each gene
junction, transcription of the starting gene NP is favored. Due to sequential transcription, a
gradient of transcribed gene products is generated. This leads to a non-homogenous
distribution of viral proteins [30]. During transcription the viral RNA is polyadenylated as
well as capped for cap-dependent translation of the viral mRNA [31].
Little is known about the mechanism of switching from the transcription to the
replication state but its hypothesized that the phosphorylation state of VP30 might play a
7
critical role in deciding if the polymerase complex will support replication or transcription
[32].
Viral assembly and budding are mediated by VP24 and VP40. To prepare the virus for
budding VP24, one of the matrix proteins, associates with the RNP complex and functions as
a signal to switch from the replication-transcription state to the viral assembly state [33]. These
mechanisms ensure that the machinery for viral transcription and replication is tightly
regulated.
Ebola Virus Glycoprotein GP1, 2
The fourth gene from the 3’ end of the filovirus genome encodes the viral envelope
GP1, 2 (a glycoprotein). Viral glycoprotein (GP1) is a heterotrimer that forms spikes on the
surface of the virus and is the only protein on the EBOV viral particle surface. Folding and
assembly of GP1 occurs independently of other viral proteins [34]. It is initially synthesized as
a precursor that is later cleaved by furin, a proprotein convertase, into GP1 (140kD) and GP2
(26kD) polypeptides that are linked by disulfide bonds [35]. The GP2 subunit contains two
heptad repeat regions that facilitate assembly of GP into trimers, a transmembrane anchor
sequence, and the fusion loop [34]. The heterotrimer (GP1 and GP2) assembles as a 450 KDa
complex on the surface of the nascent virion [36]. The GP1 subunit contains the cell surface
receptor binding site and a heavily glycosylated mucin domain. The residues responsible for
mediating interactions between GP1 and the host cell are within the 230-residue N-terminal
domain of GP1.
8
Deletion of the C-terminal mucin domain enhances viral infectivity in vitro [37-39].
This observation is explained by the crystal structure of EBOV GP (Figure2), in which the
receptor binding site of GP1 is masked by a glycan cap created by the mucin domain [36]. The
GP1 subunit responsible for interaction with the cell contains four different domains: base,
head, glycan cap and mucin like domain (MLD). The first three domains of GP1 are important
for expression and function of the prefusion state of the glycoprotein. The GP1 base forms a
hydrophobic, semicircular surface that interacts with the internal fusion loop and heptad repeat
of GP2, thereby acting as a clamp that holds the prefusion GP2 form. The head part of GP1 is
believed to contain the receptor binding domain (RBD) with a significant portion of this
domain exposed to the solvent.
The structure of the GP2 subunit, which is responsible for the fusion of viral and host
membrane, includes a hydrophobic internal fusion loop, two heptad repeats (HR1 and HR2)
and a CX6CC disulfide bond motif, membrane proximal external region and a transmembrane
anchor [40]. The internal fusion loop is wrapped around the outside of the GP trimer in the
pre-fusion state, with its hydrophobic side chains sequestered from the solvent due to packing
into a GP1 monomer.
Although Ebola virus species are antigenically distinct, the GP1 RBD is highly
conserved among them. The receptor binding domain of the Ebola viruses is masked by the
highly glycosylated domains of the mainly N-glycosylated glycan cap and a mucin like
domain, which is both N- and O-glycosylated [41]. Glycosyl groups protect proteins from
degradation but can also obstruct interaction of the glycosylated protein with another molecule.
Removal of the 7 glycan sites in the GP1 core had no significant effect on GP expression but
9
increased transduction compared with the wild type. Similar results were observed when the
mucin domain lacked its N-glycosylation [41]. These results demonstrated that the N linked
glycosyl groups on GP1 are not required for viral entry in Vero cells [41].
Ebola Virus Glycoprotein (GP1,2) Interaction With The Host Cell
Ebola viruses infect a broad range of cells and a host of proteins are known to enhance
viral entry into the host cells including the C-type lectins L-SIGN, DC-SIGN and the tyrosine
kinase receptor Axl [42-45]. Infectivity involves at least two recognition events 1) at the host
cell surface that mediates endocytosis and 2) in the endosome to mediate cytoplasmic entry.
The cell surface receptor for EBOV is believed to be the T-cell immunoglobulin and mucin
domain 1 (TIM-1) receptor [46]. The usual function of the TIM-1 receptor is to bind to
phosphatidyl serine (Ptd-Ser) on the surface of apoptotic cells and thereby facilitate
phagocytosis of these cells [47]. It has been shown that TIM-1 facilitates the entry of Dengue
Virus by directly interacting with the virion-associated phosphatidylserine [48].
Phosphatidylserine is the most highly represented anionic lipid in inner leaflet of plasma
membrane, where it usually is around 15-20% of anionic lipids [49]. Ebola Virus also gains
entry through interaction of the TIM-1 cell surface receptor and Ptd-Ser residue on the viral
envelope. The TIM-1 receptor enhances the internalization of pseudovirions that do not express
GP1, 2, confirming that TIM-1 and Ptd-Ser mediate the interaction for the viral entry into the
cell. [50]. After its initial interaction with the cell surface receptor, the virus enters the
endosomes through macropinocytosis. When the endosomes containing the virus particles
mature to late endosomes, the viral GP is further processed and it then interacts with the
10
endosomal receptor. However, although TIM-1 and DCSIGN have been identified as cellular
receptors for viral entry, the expression of TIM-1 and DCSIGN is not sufficient to make certain
cells permeable to Ebola virus entry. This result suggests that there may be distinct mechanisms
for Ebola mediated entry depending on which attachment factor is used for entry [51, 52].
Ebola virus requires endosomal processing before the final entry of the virus particle into the
cell. The protease, cathepsin B initiates entry which cleaves off the mucin domain and glycan
cap to expose the RBD [53-56].
The endosomal receptor for EBOV is believed to be the Niemann-Pick C1 (NPC1), a
lysosomal cholesterol transporter [57]. This conclusion is consistent with the observation that
Npc1−/− mice demonstrated significantly reduced viremia in comparison to wild type mice
when tested in a mouse model of Ebola disease [58]. NPC1 is a 13-pass transmembrane protein
found in the membranes of late endosomes and lysosomes of all cells [59]. It works together
with another protein, NPC2, to mediate the transport of cholesterol between cellular
compartments [60]. Binding site for C1 (NPC1) is exposed after the endosomal cysteine
proteases cleave EBOV GP1 to remove the heavily glycosylated C-terminal sequences, which
generates an entry intermediate comprised of the N terminal regions of GP1 and GP2 [54, 57].
The importance of the identified C1 (NPC1) binding site on GP1 was demonstrated with
virions that contained mutations in the C1 receptor binding residues, which are vital for viral
entry and for maintaining the conformation of the glycoprotein [57]. Recent studies have
shown that TIM-1 and NPC1-mediated interaction is responsible for viral fusion in the late
endosomes. Although, TIM-1 is primarily expressed on the cell surface, it is also found in early
endosomes and can cycle between the endosome and the cell surface [61]. A monoclonal
11
antibody (MabM224/1) against the TIM-1 receptor inhibits the internalization of Ebola virus
in Vero6 cells, which express the TIM-1 receptor. Thus, it is postulated that TIM-1 interacts
with the Ptd-Ser on Ebola virus, is taken into the endosome, and along with the cleaved
fragment of GP1, interacts with NPC-1 and initializes viral fusion with the late endosome lipid
membrane [62].
GP2-Mediated Viral and Host Membrane Fusion
The process of fusion of the viral and host cell membranes has a very high energy
barrier. To lower the activation barrier, viral proteins must undergo huge conformational
changes to generate sufficient released free energy. The first step for viral-host cell membrane
fusion in the endosome is to prime the envelope GP to a metastable conformation that can be
subsequently used for viral fusion. The crystal structure of EBOV GP1,2Δmucin (mucin
domain deleted) illustrates that the hydrophobic fusion residues are within the antiparallel β
scaffold and the structure is not conformationally restricted [63]. The N terminal of the fusion
loop has conformational freedom and is believed to aid fusion. In influenza and flaviviruses,
the main trigger for fusion is low pH, which results in protonation of histidine residues located
near positively charged residues in the prefusion state. These protonated histidines are found
in the post fusion conformation engaged in electrostatic interactions with the negatively
charged residues [64, 65]. The trigger for Ebola virus fusion is not well defined. Although the
low pH of the endosome is required for the cleavage of GP1,2 and for its subsequent interaction
with NPC1, the change in pH due to endosome maturation is not involved in triggering fusion.
However, it is unknown as yet if the cleavage of GP triggers the fusogenic conformation of the
12
virus [54] or the cleavage of GP by cathepsin B triggers another cellular factor that initiates
the fusion [55]. Even though the fusogenic trigger is unknown, it is evident from the crystal
structure that the GP2 hydrophobic patch, which clamps around GP1, must be released before
fusion. Comparing the pre- and post-fusion conformations of GP1,2 and GP2 respectively,
shows that the heptad repeat segments of GP2 unwinds from its prefusion state of a ring around
GP1, straightens and assembles into a 44 residue long helical rod like structure [63, 66, 67]. In
response to the rotational and translational movement of heptad repeat, the internal fusion loop
arranges itself to the top of the trimeric GP2 and adopts a 310 helical conformation, which is
stabilized by membrane interaction with hydrophobic residues in the fusion loop that mediate
penetration into the host membrane [68]. After formation of this intermediate conformation,
GP2 folds on itself bringing the two heptad repeats HR1 and HR2 close together to form a six-
helix bundle. This collapse of the two GP2 heptad repeats brings the host and viral membranes
closer causing the two bilayers to merge into a hemifusion stalk that eventually opens to a
fusion pore. (Figure 3).
Soluble Glycoprotein (sGP)
GP gene in the Ebola virus genome produces three different sized proteins: full length
676 aa GP1,2, pre-sGP which is 364 aa in length and a 298 residue small secreted protein
(ssGP) [69, 70]. These three proteins are produced because of transcriptional slippage of the
GP gene. GP1, 2 and ssGP are produced when slippage of the viral polymerase occurs at seven
consecutive uridines within the GP gene. With slippage of one U, an additional adenosine
residue is incorporated into the mRNA, which results in two sequential open reading frames
13
becoming a continuous reading frame that encodes full length GP1,2. sGP is produced from
the unedited version of the mRNA in which there is a stop codon at the end of the first reading
frame. Slippage along two Us and incorporation of two extra adenosines results in the
synthesis of ssGP, a secreted homodimer [69, 71]. The ratio of transcripts of these three
proteins have been shown to be (sGP:GP1.2:ssGP) of 71:24:5 in Vero E6 cells [71] suggesting
that sGP is the main viral protein product of the GP gene. Although the time of release of sGP
into the blood stream is unknown, sGP in 15 μL of serum, was readily detected by western blot
in comparison to GP1,2, which could not be detected [72].
Soluble glycoprotein (sGP) is encoded by the GP gene in all species of Ebola Virus. It
is initially synthesized as pre-GP which is shunted into the golgi complex via the signal
recognition complex. The sGP precursor undergoes post translational cleavage at the C-
terminus to yield the mature form of the protein [73]. After its proteolytic cleavage it forms a
103 KDa homodimer linked by two disulfide bonds at Cys 53 and Cys 306 [74, 75] with six
N-glycosylation sites [75]. sGP shares the first 295 amino acids with GP1, 2. A recently
determined cryo-EM structure of sGP showed that the monomeric structures of GP1,2 and
sGP are similar [Figure 4] [76]. Co-expression of sGP and GP2 by HEK293T cells resulted
in an sGP:GP2 protein complex that was recognized by the known neutralizing antibody KZ52
[77]. KZ52 is an antibody that was isolated from an Ebola survivor that binds to the interface
of GP1 and GP2 [63]. Using Circular Dichroism, Fluorescence Spectroscopy and MALLS it
was demonstrated that sGP, which is secreted as a disulfide linked homodimer, is mostly beta
sheet with 15% alpha helix content, and is highly stable at 37°C for up to 72 h [78].
14
Role Of sGP In Ebola Pathogenesis
sGP viral protein is secreted in large amounts by HEK293T cells and is present in the
blood of infected individuals [77], due to its high concentrations in blood various studies were
performed to determine its role in Ebola pathogenesis. One study suggested that sGP could
inactivate neutrophils by the binding to CD16b, which is a neutrophil specific Fc receptor III
[79]. However, these studies were challenged because the initial study overlooked the fact that
sGP could bind the neutrophil receptor indirectly through the Fc region of anti-sGP antibody
[80]. A later study confirmed that sGP immune complexes bound CD16b by demonstrating
that sGP complexed with an Fab fragment binds to neutrophils [81] These results argued
against the potential role of sGP as a neutrophil inactivator.
Another potential role of sGP was to promote apoptosis of B and T cells during viral
infection. Earlier reports had shown that lymphocyte apoptosis during Ebola infection could
be mediated through Fas/FasL interactions [82]. But, later it was demonstrated that sGP alone
or in combination with Fas ligands had no effect on frequency of Jurkat T cell death [82].
Investigators concluded that sGP does not induce apoptosis via extrinsic pathway. Thus, the
current evidence supports the conclusion that sGP is not involved in stimulating apoptosis of
lymphocytes.
A possible function of sGP in vascular dysregulation was also investigated, because
the expression of cellular adhesion molecules had earlier been shown to increase in the
presence of Ebola GP1,2. But, sGP and its degradation products failed to activate expression
of adhesion molecules in endothelial cells or to alter the integrity of endothelial cell barrier
[83]. Instead, when endothelial cells were treated with sGP and TNF-alpha (an inflammatory
15
signal that decreases endothelial barrier function), sGP restored barrier function, which
suggested an anti-inflammatory role for sGP [83]. Further studies explored the relationship
between the structure of sGP and its anti-inflammatory role. Mutations of Cys53Gly,
Cys306Gly, and the double mutant failed to restore the barrier function. Therefore, a fully
functional sGP homodimer is required for the protein to restore barrier function [75]. Overall,
these studies show that Ebola sGP might not have a role in the vascular deregulation but it
might have an anti-inflammatory function.
Immune modulation of host responses by sGP
Antibodies in the sera of human Ebola hemorrhagic fever survivors cross reacted with
sGP rather than GP1,2 [84]. Because sGP and GP1,2 are structurally similar they can be bound
by antibodies that recognize shared epitopes. However, due to the higher rate of production of
sGP in comparison to GP1,2, B cells that recognize sGP specific epitopes or shared epitopes
outcompete the B cells that recognize GP1,2 specific antibodies. This is believed to be the
reason for the biased population of antibodies that target sGP specific epitopes and GP1,2
shared epitope. Thus, the presence of high concentrations of sGP in the blood directs antibody
production towards sGP, which acts as a decoy to allow the viral infection to continue unabated
[85].
Vaccine and Therapeutics For Ebola
Until the 2014 Ebola outbreak no vaccines or therapeutics were available because the
infected population was very small and few companies were interested in the market. However,
16
with the magnitude of the outbreak in 2014, various vaccine formulations were proposed and
clinical trials were initiated. Clinical trials with rVSV-ZEBOV vaccine found that it was 70-
100% effective in providing protection therefore can be used in future outbreaks [86]. ChAd3-
ZEBOV, developed by GlaxoSmithkline in collaboration with the US national institute of
allergy and infectious diseases is still in clinical trial. The Novavax recombinant Ebola vaccine
is currently undergoing Phase II clinical trial. Other products in development include an oral
adenovirus (Vaxart), a different vesicular stomatitis virus candidate (Profectus Biosciences,
recombinant protein (Protein Sciences), DNA vaccine (Invovia) and a recombinant rabies
vaccine from (Jefferson University) [87].
Apart from the vaccines, there are many candidate therapeutics being evaluated
including small molecule inhibitors [88, 89] and siRNA based therapeutics [90]. ZMapp is a
cocktail of humanized antibodies that target three different sites on the Ebola glycoprotein
[91]. These three antibodies are produced by genetically modified tobacco plants and clinical
trials for Zmapp were concluded in 2016 [92]. The drug was well received by patients; however
it did not produce definitive results with the small number of patients in the trial. Therefore,
the FDA allowed Mapp Biopharmaceuticals to make Zmapp available to a larger number of
patients to obtain definitive answers.
Diagnostic Kits for EBOLA
WHO reported that, between 15th Feb 2015 and 19th April 2015, more than 26044
people were infected and around 10808 died from Ebola Virus [93]. As just discussed, several
potential drugs and vaccines are being tested, yet no FDA-approved treatment has yet been
17
commercialized. To minimize spread of the virus a means of early detection of Ebola virus is
needed so that infected individuals can be quarantined. By 2014 WHO had received 17
applications from diagnostic companies for devices to detect Ebola virus [94]. These included
reverse transcriptase polymerase chain reaction (RT-PCR) methods for detecting genomic
sequences, immunochromatographic strip formats and ELISAs. RT-PCR is the standard
diagnostic method for Ebola virus and is highly sensitive. However, it requires trained
personnel and specialized equipment in addition to high level biocontainment measures. In
addition, RT-PCR involves several steps during PCR amplification and requires constant
monitoring of the temperature. A constant power source is needed to limit the assay to specific
laboratories. The WHO approved a gold strip procedure for detecting Ebola virus. It is less
sensitive than RT-PCR and therefore would not detect an Ebola infection immediately after
the symptoms appear. It also has a 15% false positive rate, which limits its application as a
diagnostic kit. Current methods for Ebola detection dependent on the availability of necessary
reagents, require close contact with infected samples, and a constant supply of power. This
motivates interest in developing a robust, sensitive, and in-house diagnostic kit.
Aptamers
The term aptamer is derived from the latin word “aptus” which means “fit” and in
Greek the word meros, which means “particles”. Aptamers are short oligonucleotides with
sequences that enable them to bind to their selected targets with high affinity and specificity.
Aptamers have access to a repertoire of tertiary structural elements, including bulges, loops,
pseudoknots, and hairpin loops. Due to their varied structures and their capability to snugly
18
bind to the target molecule, the aptamer targets range from prokaryotic/eukaryotic cells, viral
particles, small molecules, and proteins. The interactions between the aptamer and target
consist mainly of a combination of stacking of aromatic rings, electrostatic and van der Waals
interactions and hydrogen bonding [95, 96].
SELEX (Systematic Evolution of Ligands through Exponential enrichment) is a
process that involves progressive siphoning of oligonucleotides (aptamers) through iterative
rounds of partitioning and amplification [97]. A randomized pool of RNA or ssDNA is
incubated with target molecules under specific buffer conditions. Oligonucleotides that bind
the target are separated from the unbound and are later amplified. The process is repeated until
the pool randomness is significantly reduced [96 168].
SELEX
Library Generation
The first step in SELEX process is to generate a randomized sequence oligonucleotide
library, which consists of ssDNA oligonucleotides comprised of a 20-60 nt random region
flanked by constant primer regions to be used for amplification. For selection of DNA aptamers
the synthesized pool can be directly used. Whereas for RNA aptamer selection, ssDNA pool
is converted to dsDNA and modified to include a T7RNA polymerase promoter using a primer.
The maximum number of random sequences in the library can be determined using 4n with n
being the number of positions in the random sequence. For our SELEX experiments we used
53 nucleotides in the random regions which translates to ~1032 possible sequences. However,
our starting pool size includes only 1015 oligonucleotides. It has been reported that the
19
probability of an aptamer for its target ranges from 10-13 to 10-14 with mean/mode probability
of 10-11 [98]. Therefore, a pool of 1015 complexity is frequently used for aptamer selection.
Things that need to be considered in the pool design are pool length, which will determine the
complexity of the pool, and nucleotide composition of the random sequences and constant
regions. Long oligonucleotides can be expected to adopt multiple secondary structures, which
might impede the correct folding of the desired binding motif. From studies to determine the
optimal length of the random region in oligonucleotide libraries it was suggested that longer
random pools (70-200nts) should be used to select for ribozymes, whereas shorter
oligonucleotides (<70nt) would serve the purpose for selecting aptamers [99]. Experiments
with pools containing different lengths of random region (16, 22, 26 50, 70 and 90) were used
to select for an aptamer that binds isoleucine, results showed that the optimum pool length for
isolating the desired aptamer was 50-70 nt [100]. A second important factor in designing pools
is the complexity of the pool. This depends on the ratio of the four nucleotides used to create
the ssDNA library, which can be determined in the manufacturing process [101, 102].
Chemically modified nucleotides can be used to introduce new features to aptamers
such as enhancing the sites of interaction with the target, improving the aptamer’s structural
stability or providing enhanced nuclease resistance [103, 104]. Two approaches can be used to
generate modified nucleotides. The first is to incorporate modified nucleotides at the time of
pool generation. However, this approach could be a problem if DNA or RNA polymerase will
not recognize the desired modified nucleotide as substrate. A second option is to modify the
already selected aptamer. However, a modification to an already selected aptamer might alter
the binding affinity or completely abolish binding [102].
20
Different techniques have been utilized to obtain modified aptamers conforming to a
desired function. For example, 2’F and 2’NH2 modifications in the 2’ ribose have been
included to improve the aptamer structural stability and nuclease resistance [105, 106].
Nucleotides containing photoactivable functional groups (e.g. 5 iodo,5-bromo and 4
thiouridine), which can covalently crosslink with a target protein, have also been used to
increase the affinity and specificity of the aptamers for their targets [107]. Modified aptamers
containing fluorescent groups have been used to study the binding of the aptamer to the protein
[108]. Amino acid side chain, like groups on 5-benzylaminocarbonyl-dU, 5-
napthylmethylaminocarbonyl-dU, 5-tryptaminocarbonyl-dU and 5-isobutylaminocarbonyl-
dU, confer a significant increase in chemical diversity, thereby increasing the chances of
interaction with proteins. For example, SOMAmers (Slow off rate modified aptamers) are
ssDNA aptamers with modified uracils and 5-methyl-dC [109].
Another important aspect of pool design is the design of constant regions. The sequence
of the constant region affects the amplification efficiency during PCR and RT (reverse
transcription) in case of RNA. The constant regions should be designed so as to not form stable
secondary structures [100]. Primers corresponding to the constant regions should also not form
strong secondary structures or include sequences that can cause primer dimers to form. To
improve amplification efficiency, the 3’ primer end should have WSS (W=T or A and S= G or
C) because polymerases can extend well with ACC at the 3’ end. A/T rich regions at the 3’
end can be used to avoid mispriming [110].
21
The selection process
SELEX process (Figure 5) starts with the incubation of the target with a pool of
oligonucleotides with random central sequences followed by a selection step in which the
bound oligonucleotide is separated from the unbound using a partitioning method. After this
separation for an RNA aptamer the selected RNA is reverse transcribed and further amplified
through PCR. In case of selection for a DNA aptamer the bound ssDNA is PCR-amplified.
Multiple rounds are performed in succession, which involve in vitro transcription for RNA
aptamer selection and separation of single stranded DNA for DNA aptamers. After multiple
rounds have been completed, the pools are analyzed by Next Gen Sequencing or Sanger
sequencing and evaluated for their ability to bind to the target with high affinity and specificity.
Aptamer Selection Methods
Filter capture
The filter capture method has been used extensively for selection of aptamers. The
principle factor in the method is the nonspecific binding of the target protein to the
nitrocellulose filter with the oligonucleotides passing through. Oligonucleotides bound to the
protein are trapped on the filter. This method has been widely successful but has the following
limitations 1) the efficiency of protein capture varies with the protein, 2) small molecules
cannot be captured on the membrane, and 3) certain aptamers bind to nitrocellulose
membranes in the absence of their protein target [111]. The filter capture method relies on the
true equilibrium binding of aptamers to the target protein in solution in comparison to other
methods in which either the target or the aptamer is immobilized on a solid support [112]. In
22
all these methods, including the filter capture method, the washing steps that follow the
partitioning can distort the equilibrium achieved in binding if the complex is characterized by
a high off-rate. However, the washing step is the shortest in the filter capture method compared
to others and thus least likely to influence the outcome. The filter capture method is also widely
used for evaluating the binding of the selected aptamers to the target protein [113].
Bead based SELEX
Immobilization of target molecules on a solid support is another method for selection
[114], various affinity tags (6X his, GST and MBP) can be used, in addition to coupling
chemistries such (amine, thiol or carboxyl). In bead based selection, target molecules can either
be pre-immobilized then incubated with the target library or the molecules can be incubated
with the target library and then captured by the affinity column. Various versions of affinity
chromatography have been used for selections such as 1) MEDUSA (Microplate based
enrichment device used for the selection of aptamers) [115], 2) the particle display method
[116] in which emulsion PCR is used to immobilize 105 copies of a single clonally amplified
ssDNA aptamer on each bead, the beads then incubated with fluorescent labeled target
molecules and sorted by flow cytometry, and 3) MonoLEX, which has been shown to generate
ssDNA aptamers in a single round that bind whole vaccinia virus particles [117].The
limitations of Bead-based SELEX are the restrictive interaction surface, requirement for
electronic instruments and flow pumps and increased non-specific interactions due to density-
dependent cooperative target binding [118].
23
Electrophoretic SELEX
EMSA (Electrophoretic Mobility shift assay) has long been used for downstream
applications during SELEX, mostly for evaluating the binding of potential aptamers to the
target protein. However, this method has also been used for aptamer selection [119]. Although
this method offers advantages such as equilibrium binding and separation of the bound and
unbound populations, it can be used with only some proteins and under limited buffer
conditions. As well, the volumes that can be accommodated in the gels used for separation are
too small to include the number of oligonucleotides required for the maximum possible
sequence diversity for SELEX. Therefore, it is wiser to use this method for downstream
applications.
A modification of EMSA is capillary electrophoresis which also relies on the
electrophoretic mobility of the aptamer, but separation is in the capillary as opposed to the gel
[120]. However, this method is limited to molecules that are within a certain size bracket and
that are charged so they can be resolved on the capillary.
Microfluidic SELEX
In the recent times, microfluidic SELEX has been used for selection of aptamers. There
are two different kinds of platforms 1) the target molecule is immobilized on micromagnetic
beads [121] and 2) the target molecule is encapsulated in sol-gel, gel like porous silica material
[122]. Microfluidic platforms allow fewer rounds of selection due to reduction in the available
target molecule along with function to perform continuous washing. This continuous washing
step allows removal of weak and nonspecific binders [123]. Since they are small, the use of
24
reagents is considerably reduced for microfluidic methods and the sol-gel based microfluidic
system can be utilized to select against multiple targets in one experiment. Even though the
advantages of this method are many, the usage of this method might be limited due to the
requirement for fabricated devices and electronic instruments. In sol gel based platform there
is also the chance of undesired effects of a chemical reaction during sol-gel formation on the
target molecule.
Cell SELEX
Cell-SELEX is used to select for aptamers against cells or cell fragments rather than
targeting a specific protein. In all SELEX procedures, negative selection against proteins or
cells other than the desired biomarker helps in gaining specificity towards the targeted
biomarker. Cell SELEX has been used to identify aptamers that can differentiate between
normal or diseased cell types [124, 125] and therefore the negative selective steps are generally
against normal cells. Cell SELEX has been used to select aptamers with therapeutic potential.
In terms of experiments, positive and negative selections can be done under conditions of
steady state equilibrium binding. Due to the possibility of nucleic acid aptamers being either
degraded or internalized during selection, Cell-SELEX protocols usually employ shorter
incubation periods than necessary for reaching equilibrium. Since cell surfaces also display
non-target cellular proteins, it is difficult to achieve very high specificity towards the target
molecules. TECS SELEX addresses this problem by overexpressing the desired target protein
for selections. An aptamer that recognizes the TGF-β type III receptor with nanomolar affinity
was successfully selected using this method [126]. Another complication of Cell-SELEX is
25
that it is prone to artifacts resulting from the presence of dead cells in the selection population
Cell-SELEX protocols use FACS to separate bound and unbound aptamers [127]. This enables
sorting of live and dead cells along with selecting cells with bound aptamers [128].
High Throughput Sequencing and Data Analysis
Incorporation of high throughput sequencing into the SELEX protocol for the analysis
of enriched aptamer libraries and identification of candidate aptamers has been the most
informative recent change in SELEX applications. Previously, enriched aptamer pools were
cloned into a plasmid and a few hundred individual clones were sequenced to identify high
affinity aptamers. In contrast, high throughput sequencing analysis has a readout of over a
hundred million sequences. Candidate aptamers can be selected at much earlier rounds by
studying the enrichment of an oligonucleotide with a particular sequence across various
rounds, whereas conventional cloning-based aptamer identification required multiple rounds
until an ensured enriched population was observed [129]. Illumina platforms are a preferred
platform for NGS as they offer a significantly higher number of sequence reads with read
lengths, which would cover the random regions and also the constant regions of most libraries
[130, 131]. A large number of reads helps in gaining a more comprehensive insight into the
sequence and structural features of the aptamers selected and a broad perspective on the
progress of each SELEX process. Information gathered through NGS has also helped to
predict secondary structure of the RNA aptamer and to identify appropriate truncations that
yielded a better binding aptamer [132]. Given the ability of NGS to sequence multiple SELEX
rounds simultaneously, it can be used to monitor the selection process as it proceeds. For
26
example, in a recent study SELEX pools derived from a genomic library selected against the
E.coli Hfq protein were run in parallel with a control SELEX (Neutral SELEX) that did not
include the target during the selection steps and was subjected to the same PCR and RT
treatments. The analysis of various rounds revealed that selection with the target progressed
independently of the Neutral SELEX, with the former resulting in substantial enrichment of
certain sequences whereas with the latter there was no enrichment of sequences [133].
It is widely accepted now that even highly enriched libraries contain many thousands
of potential aptamer sequences, many of them present in the populations in lower numbers. It
has also become more evident that the most abundant oligonucleotides obtained in the final
SELEX pools might not have the sequences for the highest target affinities. Other than
selection for affinity to the target, reasons for high abundance of an oligonucleotide with a
sequence in a selected pool could be PCR amplification bias or affinity of the oligonucleotide
with that sequence to the partitioning matrix. Therefore, the fold enrichment over one or more
SELEX rounds rather than abundance is a much better determinant of high affinity aptamers
[131]. Tracking fold-enrichment is a good way to identify aptamers especially if the starting
library is biased.
The current capability of generating an immense amount of data and its contribution to
better understanding the SELEX process has resulted in high throughput sequencing being
used by most aptamer research groups to analyze the SELEX results. Despite its popularity,
the development of specific bioinformatics tools for identification of candidate aptamers from
the huge amounts of sequencing data is limited. Current bioinformatics tools based on
clustering identify top clusters and the aptamer population can be traced to identify the
27
enriched sequences. Current tools also allow sorting of the putative aptamer sequences via their
sequence structure motifs [134-136]. However, bioinformatics tools are still needed that better
predict the target binding aptamer candidates based on structure or sequence classifications.
Aptamers vs. Antibodies and The Current State Of The Market
Antibodies, have been widely used for various purposes. Apart from being used in the
lab for research, they are used as therapeutics drugs, are also functionalized on biosensors for
detection purposes. Although, antibodies have been fundamental to several applications, there
are limitations associated with its usability. Synthesis of an antibody is time consuming and
there is always an issue of reproducibility between batches. Neutralizing antibodies have been
traditionally used to prevent the spread of viral infections. But, no neutralizing antibodies have
yet been commercialized for EBOV. Also, antibodies used in passive immunity must be
“humanized” to prevent their immunogenicity. Thus, even if there were an effective anti-
EBOV antibody available, it would be very expensive and time consuming to humanize the
antibody. Antibodies due to their short shelf life, require proper storage conditions, therefore
when used for a detection platform, conditions amenable for preserving antibodies is needed.
In addition, to perform techniques like RT-PCR or ELISAs trained personnel is required.
Usage of antibodies adds up to additional costs and require infrastructure, regions affected by
Ebola viruses have poor infrastructure therefore storage of these drugs and kits require
additional costs and efforts.
Aptamers have been established as a potent alternative for antibodies. Aptamers have
been selected against several targets to function either as a therapeutic drug or as a biosensor.
28
Aptamers have notable advantages over antibodies that include non-immunogenicity, in-vitro
production, and stability. Aptamers can be rapidly reconstituted and the in vivo
pharmacokinetics and tissue distribution can be tuned by chemical modifications including
conjugation to high molecular weight molecules such as PEG. Conjugation can increase the
half-life of an aptamer from 40 min to 50 h. Modifications such as with fluorine in the 2’
position also increase stability in serum [137].
Even though aptamers were discovered in 1990 they still haven’t effectively transcended from
research labs into the market full-fledged even though they hold many advantages over
antibodies (Table 1). Only one aptamer-based product Macugen has cleared clinical trials and
is available in the market. The huge investment of pharmaceutical companies in the antibody
market may be partly responsible for the resistance against aptamers. Even though few
aptamers are in the market, the research on aptamers hasn’t receded. A handful of companies
have been developing and marketing aptamers as antibody-like binding reagents for research
and development. These companies are Soma Logic (Boulder, CO, USA), OTC Biotech (San
Antonio, TX, USA), Aptagen (Jacobus, PA, USA), Base Pair Biotechnologies (Houston, TX,
USA), NeoVentures Biotechnologies (London, ON, Canada), Aptamer Sciences (Pohang,
Korea). A few companies marketed aptamers as components of assay kits or concentrating
devices, such as NeoVentures Ochratoxin A. Soma Logic , a company at the forefront of
aptamer research, has been pushing its technology, SOMAmers and SOMAscan aptamer
platform sensors, in the diagnostic market [138].
29
Aptamers In The Diagnosis Of Viral Infections
Proper diagnosis of any viral infection is important for preventing its spread. Symptoms
of an acute infection are at first non-diagnostic and associated with a variety of viral infections.
To prevent its spread, it is imperative that the infectious agent be identified in the early stages.
Aptamer development to date has been concentrated mostly on the well-known viral diseases
such as HIV, Influenza virus, SARS and HPV [155-158]. Little research has been done on a
wider variety of other viral diseases, including Ebola virus. Very few aptamers have been
reported that bind Ebola viral proteins or are directed towards blocking an antiviral function
[159, 160].
There is a wide range of aptasensor options designed based on different principles for
detection of viral particles. An aptasensor was designed to detect avian influenza virus, based
on the principle of quartz crystal microbalance [161]. Gold microelectrodes with impedimetric
Table 1: Advantages of aptamers
Advantages References
Bind to a wide range of targets including
metal ions, metabolites, proteins, viruses &
mammalian cells
[139-144]
Aptamers can be synthesized chemically,
reducing batch to batch variation and can be
used as tools for drug loading and antidote
application.
[145]
Aptamers generate little to no
immunogenicity in therapeutic applications.
[140, 146-148]
Aptamers can be conjugated to molecules
such as drugs, carriers, toxins and siRNA for
therapeutic applications.
[148-151]
Aptamers can be conjugated with imaging
probes for molecular imaging applications
[152-154]
30
properties allows one to distinguish between active and inactive forms of virus. Using specific
DNA aptamers viable virus was detected by using the impedimetric sensor [162]. Other
approaches to detect viral antigens include an RNA aptamer sensor to the HCV core antigen
in which fluorescent dye ( Cy3) conjugated RNA aptamer was the means of detection.[163]
In another study an aptamer to viral glycoprotein E2 was selected using CS SELEX and
demonstrated to inhibit HCV infection in Huh7.5.1 cells [144].
Comparison of aptamer based tests with other analytical methods
Most current methods to detect virus infections rely on Enzyme linked immunosorbent
assay (ELISA) or RT-PCR [161, 164, 165]. However, ELISA is reported to have low
sensitivity and very high rates of false positives [166-168]. It also cannot be broadly applied
because of the need for specific antibodies that are difficult to obtain for several viral diseases
[169]. RT-PCR can be performed without application of antibodies and can detect the viral
genome efficiently. It is also a sensitive method. Although the advantages are many for RT-
PCR, it requires expensive enzymes and trained personnel to do these analyses.
Aptamers could be used to circumvent bottlenecks in the current detection systems for
viral diseases. Properly developed and authenticated aptamers could efficiently differentiate
between infected and non-infected cells.
On a Hydrogel coated QCM (Quartz crystal microbalance aptasensor) biosensor, anti-
H5 antibodies were coated in parallel with anti-H5 aptamers. Although, same concentration of
antibody was coated as the aptamer, the detection limit of H5N1 with anti-H5 antibody was
0.128U whereas with the aptamer the detection limit was 0.0128U. [161, 167]. In addition to
31
providing higher sensitivity, detection using aptamers takes less time than with antibodies or
PCR. For example, to detect avian influenza virus the time for detection by ELISA or qPCR
would be 3 hours and 5 hours respectively, whereas with an aptasensor it only takes 1.5 hours
[165-168].
Aptamers In Preventing The Fusion Of Virus Particle To The Host Cell
Apart from diagnosis, another obvious function of an aptamer could be as a therapeutic.
An aptamer could act as a therapeutic agent by preventing the interaction between the viral
proteins and the host cell receptor proteins. Many aptamers have been selected that inhibit viral
entry. An RNA aptamer (B40) that binds HIV gp120 inhibits viral interaction with T cell co-
receptor CCR5. Application of the aptamer resulted in a decreased concentration of p24
antigen in the supernatants from virus-infected cultures of human peripheral mononuclear
blood cells as measured by ELISA. Further characterization of the aptamer showed that it binds
to the core conserved region of gp120 [170-172].
E2 protein is a potential target for creating blocking aptamers against HCV infection.
E2 is a coreceptor of human CD81, which is presented on hepatocytes and B lymphocytes.
ZE2, a DNA aptamer selected against, E2 blocked E2 binding of a wide range of HCV
serotypes to Huh7.5.1, human established cells line of hepatocellular carcinoma cells. The
presence of the aptamer reduced viral RNA levels was tested by qPCR. [144].
A DNA aptamer A22 to the influenza virus HA protein, blocked influenza virus entry
into MDCK (Madin-Darby Canine Kidney). Cell viability increased in proportion to A22
aptamer concentrations from 50 to 100 pM. The therapeutic potential of this aptamer was also
32
demonstrated in an animal model in which mice infected with A/Texas/1/7 influenza strain and
simultaneously treated with the aptamer A22, lost weight slower that the non-treated control
group [173]. C7-35M, a DNA aptamer that binds to receptor binding region of hemagglutinin
binds to the virus particles and inhibits the binding of the virus to the host cell receptors. [174].
Similar studies tested the effect of aptamers against human cytomegalovirus infections.
Two RNA aptamers that recognize HCMV viral glycoproteins B and H, reduced the infectivity
of cytomegalovirus in a human foreskin fibroblast cell line culture [175]. Aptamers against
HSV-1 bound viral glycoprotein D, a ligand of Nectin-1, which mediates HSV entry into the
host cell. Reduced infectious potential of HSV-1 was observed in proportion to the dose of this
aptamer. The treatments showed no evidence of cytotoxicity and the aptamer could distinguish
between HSV-1 and HSV-2 strains [176].
In my thesis, data from SELEX experiments to select 2’Fluoro pyrimidine modified
RNA aptamers against Ebola glycoproteins GP1,2 and sGP is presented.
34
Figure 1: Ebola Virus Particle.
Filamentous Ebola virus particle, Nucleocapsid comprises of RNA polymerase (L),
Nucleoprotein (NP), VP35, VP30. Major and minor matrix proteins laying beneath the viral
membrane VP40 and VP24. Anchored glycoprotein (GP) on the surface of the virus particles.
Reprinted by permission from [177].
35
Figure 2: X ray crystallography determined structure of GP1,2 ΔmucinΔtm.
The structure of Ebola virus glycoprotein bound to neutralizing antibody KZ52. GP1,2 is a
heterotrimer expressed on the surface of the viral membrane. The cartoon depicts the mucin
domain that shrouds the protein along with glycan cap. The red region is supposed to be the
receptor binding domain. Reprinted by permission from [63].
36
Figure 3: Prefusion and and postfusion conformational switch of GP1,2 glycoprotein.
The cartoon depicts the interaction of GP1,2 with host cell receptors followed by
internalization via micropinocytosis. Once the virus is internalized into the endosomes, low
pH dependent proteases cleave the glycan cap and mucin domain to expose the receptor
binding domain 19-KDa core bonded to GP2. The receptor binding domain interacts with a
receptor in the endosomes and this interaction allows a conformational change within GP2.
This conformational change allows GP2 to release its internal fusion loop (IFL) and insert into
host cell membrane. Interaction between the heptad repeats 2 and 1 brings host cell and viral
membrane into contact and forms a hemifusion stalk. The hemifusion stalk causes the
formation of a fusion pore. Reprinted by permission from [36].
37
Figure 4: CryoEM determined structures of full length GP1,2 glycoprotein and soluble
glycoprotein (sGP). Cryo EM determined quaternary structure of GP1,2. The figure also
depicts the residues of N linked glycosylation and mucin domain sites.Cryo EM determined
structure of sGP shows a parallel homodimer connected by disulfide bonds at the N and C
terminus. The monomer structures of GP1,2 and sGP are similar. Reprinted by permission
from [76]
38
Figure 5: SELEX protocol for the selection of RNA aptamer that binds the target protein.
A DNA pool with a complexity of 1015 was PCR amplified, followed by transcription to
prepare an RNA pool. The RNA pool was incubated with target protein and non-binders were
separated by capture on a nitrocellulose filter. Retained RNA was eluted and reverse
transcribed followed by PCR to amplify the selected sequences. This process was performed
for 8-10 times before submitting for NGS.
39
References
1. Kuhn, J.H., et al., Proposal for a revised taxonomy of the family Filoviridae:
classification, names of taxa and viruses, and virus abbreviations. Archives of virology, 2010.
155(12): p. 2083-2103.
2. Elliott, L.H., M.P. Kiley, and J.B. McCormick, Descriptive analysis of Ebola
virus proteins. Virology, 1985. 147(1): p. 169-176.
3. Noda, T., et al., Ebola virus VP40 drives the formation of virus-like filamentous
particles along with GP. Journal of virology, 2002. 76(10): p. 4855-4865.
4. Takada, A., Filovirus tropism: cellular molecules for viral entry. Frontiers in
microbiology, 2012. 3.
5. Dolnik, O., L. Kolesnikova, and S. Becker, Filoviruses: Interactions with the
host cell. Cell Mol Life Sci, 2008. 65(5): p. 756-76.
6. Benton, A. and K.Y. Dionne, International Political Economy and the 2014
West African Ebola Outbreak. African Studies Review, 2015. 58(01): p. 223-236.
7. Gunaratne, N.D., Ebola Virus and the Threat of Bioterrorism, The. Fletcher F.
World Aff., 2015. 39: p. 63.
8. Geisbert, T.W., et al., Pathogenesis of Ebola hemorrhagic fever in cynomolgus
macaques: evidence that dendritic cells are early and sustained targets of infection. The
American journal of pathology, 2003. 163(6): p. 2347-2370.
9. BREMEN, J., et al., The epidemiology of Ebola hemorrhagic fever in Zaire.
1976, SR Pattyn. New York, Elsevier/North-Holland Biomedical Press.
40
10. Geisbert, T.W., et al., Pathogenesis of Ebola hemorrhagic fever in primate
models: evidence that hemorrhage is not a direct effect of virus-induced cytolysis of
endothelial cells. The American journal of pathology, 2003. 163(6): p. 2371-2382.
11. Amara, A. and J. Mercer, Viral apoptotic mimicry. Nature Reviews
Microbiology, 2015. 13(8): p. 461-469.
12. Biermann, M., et al., Surface code—biophysical signals for apoptotic cell
clearance. Physical biology, 2013. 10(6): p. 065007.
13. Morizono, K. and I.S. Chen, Role of phosphatidylserine receptors in enveloped
virus infection. Journal of virology, 2014. 88(8): p. 4275-4290.
14. Prins, K.C., W.B. Cárdenas, and C.F. Basler, Ebola virus protein VP35 impairs
the function of interferon regulatory factor-activating kinases IKKε and TBK-1. Journal of
virology, 2009. 83(7): p. 3069-3077.
15. Basler, C.F., et al., The Ebola virus VP35 protein functions as a type I IFN
antagonist. Proceedings of the National Academy of Sciences, 2000. 97(22): p. 12289-12294.
16. Basler, C.F., et al., The Ebola virus VP35 protein inhibits activation of
interferon regulatory factor 3. Journal of virology, 2003. 77(14): p. 7945-7956.
17. Cárdenas, W.B., et al., Ebola virus VP35 protein binds double-stranded RNA
and inhibits alpha/beta interferon production induced by RIG-I signaling. Journal of virology,
2006. 80(11): p. 5168-5178.
18. Leung, D.W., et al., Structure of the Ebola VP35 interferon inhibitory domain.
Proceedings of the National Academy of Sciences, 2009. 106(2): p. 411-416.
41
19. Leung, D.W., et al., Structural basis for dsRNA recognition and interferon
antagonism by Ebola VP35. Nature structural & molecular biology, 2010. 17(2): p. 165-172.
20. Ivashkiv, L.B. and L.T. Donlin, Regulation of type I interferon responses.
Nature Reviews Immunology, 2014. 14(1): p. 36-49.
21. Leung, L.W., et al., Ebola virus VP24 binds karyopherin α1 and blocks STAT1
nuclear accumulation. Journal of virology, 2006. 80(11): p. 5156-5167.
22. Shabman, R.S., et al., The Ebola virus VP24 protein prevents hnRNP C1/C2
binding to karyopherin α1 and partially alters its nuclear import. Journal of Infectious Diseases,
2011. 204(suppl 3): p. S904-S910.
23. Kolesnikova, L., et al., Ultrastructural organization of recombinant Marburg
virus nucleoprotein: comparison with Marburg virus inclusions. Journal of virology, 2000.
74(8): p. 3899-3904.
24. Watanabe, S., T. Noda, and Y. Kawaoka, Functional mapping of the
nucleoprotein of Ebola virus. Journal of virology, 2006. 80(8): p. 3743-3751.
25. Noda, T., et al., Assembly and budding of Ebolavirus. PLoS Pathog, 2006. 2(9):
p. e99.
26. Johnson, R.F., et al., Ebola virus VP35-VP40 interaction is sufficient for
packaging 3E-5E minigenome RNA into virus-like particles. Journal of virology, 2006. 80(11):
p. 5135-5144.
27. Becker, S., et al., Interactions of Marburg virus nucleocapsid proteins.
Virology, 1998. 249(2): p. 406-417.
42
28. Mühlberger, E., et al., Three of the four nucleocapsid proteins of Marburg virus,
NP, VP35, and L, are sufficient to mediate replication and transcription of Marburg virus-
specific monocistronic minigenomes. Journal of virology, 1998. 72(11): p. 8756-8764.
29. Mühlberger, E., et al., Comparison of the transcription and replication strategies
of Marburg virus and Ebola virus by using artificial replication systems. Journal of virology,
1999. 73(3): p. 2333-2342.
30. Whelan, S., J. Barr, and G. Wertz, Transcription and replication of
nonsegmented negative-strand RNA viruses, in Biology of Negative Strand RNA Viruses: The
Power of Reverse Genetics. 2004, Springer. p. 61-119.
31. Shabman, R.S., et al., An upstream open reading frame modulates Ebola virus
polymerase translation and virus replication. PLoS Pathog, 2013. 9(1): p. e1003147.
32. Biedenkopf, N., et al., Phosphorylation of Ebola virus VP30 influences the
composition of the viral nucleocapsid complex impact on viral transcription and replication.
Journal of Biological Chemistry, 2013. 288(16): p. 11165-11174.
33. Watanabe, S., et al., Ebola virus (EBOV) VP24 inhibits transcription and
replication of the EBOV genome. Journal of Infectious Diseases, 2007. 196(Supplement 2): p.
S284-S290.
34. Sanchez, A., et al., Biochemical analysis of the secreted and virion
glycoproteins of Ebola virus. J Virol, 1998. 72(8): p. 6442-7.
35. Volchkov, V.E., et al., Processing of the Ebola virus glycoprotein by the
proprotein convertase furin. Proc Natl Acad Sci U S A, 1998. 95(10): p. 5762-7.
43
36. Lee, J.E. and E.O. Saphire, Ebolavirus glycoprotein structure and mechanism
of entry. Future Virol, 2009. 4(6): p. 621-635.
37. Manicassamy, B., et al., Comprehensive analysis of ebola virus GP1 in viral
entry. J Virol, 2005. 79(8): p. 4793-805.
38. Jeffers, S.A., D.A. Sanders, and A. Sanchez, Covalent modifications of the
ebola virus glycoprotein. J Virol, 2002. 76(24): p. 12463-72.
39. Brindley, M.A., et al., Ebola virus glycoprotein 1: identification of residues
important for binding and postbinding events. J Virol, 2007. 81(14): p. 7702-9.
40. Gallaher, W.R., Similar structural models of the transmembrane proteins of
Ebola and avian sarcoma viruses. Cell, 1996. 85(4): p. 477-478.
41. Lennemann, N.J., et al., Comprehensive functional analysis of N-linked glycans
on Ebola virus GP1. MBio, 2014. 5(1): p. e00862-13.
42. Ji, X., et al., Mannose-binding lectin binds to Ebola and Marburg envelope
glycoproteins, resulting in blocking of virus interaction with DC-SIGN and complement-
mediated virus neutralization. J Gen Virol, 2005. 86(Pt 9): p. 2535-42.
43. Takada, A., et al., Human macrophage C-type lectin specific for galactose and
N-acetylgalactosamine promotes filovirus entry. J Virol, 2004. 78(6): p. 2943-7.
44. Simmons, G., et al., DC-SIGN and DC-SIGNR bind ebola glycoproteins and
enhance infection of macrophages and endothelial cells. Virology, 2003. 305(1): p. 115-23.
45. Brindley, M.A., et al., Tyrosine kinase receptor Axl enhances entry of Zaire
ebolavirus without direct interactions with the viral glycoprotein. Virology, 2011. 415(2): p.
83-94.
44
46. Kondratowicz, A.S., et al., T-cell immunoglobulin and mucin domain 1 (TIM-
1) is a receptor for Zaire Ebolavirus and Lake Victoria Marburgvirus. Proc Natl Acad Sci U S
A, 2011. 108(20): p. 8426-31.
47. Kobayashi, N., et al., TIM-1 and TIM-4 glycoproteins bind phosphatidylserine
and mediate uptake of apoptotic cells. Immunity, 2007. 27(6): p. 927-40.
48. Meertens, L., et al., The TIM and TAM families of phosphatidylserine receptors
mediate dengue virus entry. Cell Host Microbe, 2012. 12(4): p. 544-57.
49. Adu-Gyamfi, E., et al., Host Cell Plasma Membrane Phosphatidylserine
Regulates the Assembly and Budding of the Ebola Virus. Journal of virology, 2015: p. JVI.
01087-15.
50. Moller-Tank, S., et al., Role of the phosphatidylserine receptor TIM-1 in
enveloped-virus entry. Journal of virology, 2013. 87(15): p. 8327-8341.
51. Alvarez, C.P., et al., C-type lectins DC-SIGN and L-SIGN mediate cellular
entry by Ebola virus in cis and in trans. Journal of virology, 2002. 76(13): p. 6841-6844.
52. Lasala, F., et al., Mannosyl glycodendritic structure inhibits DC-SIGN-
mediated Ebola virus infection in cis and in trans. Antimicrobial agents and chemotherapy,
2003. 47(12): p. 3970-3972.
53. Dube, D., et al., The primed ebolavirus glycoprotein (19-kilodalton GP1, 2):
sequence and residues critical for host cell binding. Journal of virology, 2009. 83(7): p. 2883-
2891.
54. Chandran, K., et al., Endosomal proteolysis of the Ebola virus glycoprotein is
necessary for infection. Science, 2005. 308(5728): p. 1643-5.
45
55. Schornberg, K., et al., Role of endosomal cathepsins in entry mediated by the
Ebola virus glycoprotein. Journal of virology, 2006. 80(8): p. 4174-4178.
56. Hood, C.L., et al., Biochemical and structural characterization of cathepsin L-
processed Ebola virus glycoprotein: implications for viral entry and immunogenicity. Journal
of virology, 2010. 84(6): p. 2972-2982.
57. Miller, E.H., et al., Ebola virus entry requires the host-programmed recognition
of an intracellular receptor. EMBO J, 2012. 31(8): p. 1947-60.
58. Herbert, A.S., et al., Niemann-Pick C1 Is Essential for Ebolavirus Replication
and Pathogenesis In Vivo. mBio, 2015. 6(3): p. e00565-15.
59. Davies, J.P. and Y.A. Ioannou, Topological analysis of Niemann-Pick C1
protein reveals that the membrane orientation of the putative sterol-sensing domain is identical
to those of 3-hydroxy-3-methylglutaryl-CoA reductase and sterol regulatory element binding
protein cleavage-activating protein. Journal of Biological Chemistry, 2000. 275(32): p. 24367-
24374.
60. Infante, R.E., et al., NPC2 facilitates bidirectional transfer of cholesterol
between NPC1 and lipid bilayers, a step in cholesterol egress from lysosomes. Proceedings of
the National Academy of Sciences, 2008. 105(40): p. 15287-15292.
61. Balasubramanian, S., et al., TIM family proteins promote the lysosomal
degradation of the nuclear receptor NUR77. Science signaling, 2012. 5(254): p. ra90.
62. Kuroda, M., et al., Interaction between TIM-1 and NPC1 Is Important for
Cellular Entry of Ebola Virus. Journal of virology, 2015. 89(12): p. 6481-6493.
46
63. Lee, J.E., et al., Structure of the Ebola virus glycoprotein bound to an antibody
from a human survivor. Nature, 2008. 454(7201): p. 177-182.
64. Bullough, P.A., et al., Structure of influenza haemagglutinin at the pH of
membrane fusion. Nature, 1994. 371(6492): p. 37-43.
65. Kampmann, T., et al., The role of histidine residues in low-pH-mediated viral
membrane fusion. Structure, 2006. 14(10): p. 1481-1487.
66. Weissenhorn, W., et al., Crystal structure of the Ebola virus membrane fusion
subunit, GP2, from the envelope glycoprotein ectodomain. Molecular cell, 1998. 2(5): p. 605-
616.
67. Malashkevich, V.N., et al., Core structure of the envelope glycoprotein GP2
from Ebola virus at 1.9-Å resolution. Proceedings of the National Academy of Sciences, 1999.
96(6): p. 2662-2667.
68. Freitas, M.S., et al., Structure of the Ebola fusion peptide in a membrane-
mimetic environment and the interaction with lipid rafts. Journal of Biological Chemistry,
2007. 282(37): p. 27306-27314.
69. Sanchez, A., et al., The virion glycoproteins of Ebola viruses are encoded in
two reading frames and are expressed through transcriptional editing. Proceedings of the
National Academy of Sciences, 1996. 93(8): p. 3602-3607.
70. VOLCHKOV, V.E., et al., GP mRNA of Ebola Virus Is Edited by the Ebola
Virus Polymerase and by T7 and Vaccinia Virus Polymerases 1. Virology, 1995. 214(2): p.
421-430.
47
71. Mehedi, M., et al., A new Ebola virus nonstructural glycoprotein expressed
through RNA editing. Journal of virology, 2011. 85(11): p. 5406-5414.
72. Sanchez, A., et al., Detection and molecular characterization of Ebola viruses
causing disease in human and nonhuman primates. Journal of Infectious Diseases, 1999.
179(Supplement 1): p. S164-S169.
73. Volchkov, V.E., et al., Processing of the Ebola virus glycoprotein by the
proprotein convertase furin. Proceedings of the National Academy of Sciences, 1998. 95(10):
p. 5762-5767.
74. Barrientos, L.G., et al., Disulfide bond assignment of the Ebola virus secreted
glycoprotein SGP. Biochemical and biophysical research communications, 2004. 323(2): p.
696-702.
75. Falzarano, D., et al., Structure‐Function Analysis of the Soluble Glycoprotein,
sGP, of Ebola Virus. Chembiochem, 2006. 7(10): p. 1605-1611.
76. Pallesen, J., et al., Structures of Ebola virus GP and sGP in complex with
therapeutic antibodies. Nature microbiology, 2016. 1: p. 16128.
77. Iwasa, A., M. Shimojima, and Y. Kawaoka, sGP serves as a structural protein
in Ebola virus infection. Journal of Infectious Diseases, 2011. 204(suppl 3): p. S897-S903.
78. Barrientos, L.G., et al., Secreted Glycoprotein from Live Zaire ebolavirus—
Infected Cultures: Preparation, Structural and Biophysical Characterization, and
Thermodynamic Stability. Journal of Infectious Diseases, 2007. 196(Supplement 2): p. S220-
S231.
48
79. Yang, Z.-y., et al., Distinct cellular interactions of secreted and transmembrane
Ebola virus glycoproteins. Science, 1998. 279(5353): p. 1034-1037.
80. Sui, J. and W.A. Marasco, Evidence against Ebola virus sGP binding to human
neutrophils by a specific receptor. Virology, 2002. 303(1): p. 9-14.
81. Maruyama, T., et al., Ebola virus, neutrophils, and antibody specificity.
Science, 1998. 282(5390): p. 843-843.
82. Wauquier, N., et al., Human fatal zaire ebola virus infection is associated with
an aberrant innate immunity and with massive lymphocyte apoptosis. PLoS Negl Trop Dis,
2010. 4(10): p. e837.
83. Wahl-Jensen, V.M., et al., Effects of Ebola virus glycoproteins on endothelial
cell activation and barrier function. Journal of virology, 2005. 79(16): p. 10442-10450.
84. Maruyama, T., et al., Recombinant human monoclonal antibodies to Ebola
virus. Journal of Infectious Diseases, 1999. 179(Supplement 1): p. S235-S239.
85. Mohan, G.S., et al., Antigenic subversion: a novel mechanism of host immune
evasion by Ebola virus. PLoS pathogens, 2012. 8(12): p. e1003065.
86. Henao-Restrepo, A.M., et al., Efficacy and effectiveness of an rVSV-vectored
vaccine in preventing Ebola virus disease: final results from the Guinea ring vaccination, open-
label, cluster-randomised trial (Ebola Ça Suffit!). The Lancet, 2017. 389(10068): p. 505-518.
87. World Health Organization. Ebola vaccines, therapies, and diagnostics. 2015;
Available from: http://www.who.int/medicines/emp_ebola_q_as/en/.
88. Côté, M., et al., Small molecule inhibitors reveal Niemann-Pick C1 is essential
for Ebola virus infection. Nature, 2011. 477(7364): p. 344-348.
49
89. Warren, T.K., et al., Protection against filovirus diseases by a novel broad-
spectrum nucleoside analogue BCX4430. Nature, 2014. 508(7496): p. 402-405.
90. Geisbert, T.W., et al., Postexposure protection of non-human primates against
a lethal Ebola virus challenge with RNA interference: a proof-of-concept study. The Lancet,
2010. 375(9729): p. 1896-1905.
91. Murin, C.D., et al., Structures of protective antibodies reveal sites of
vulnerability on Ebola virus. Proceedings of the National Academy of Sciences, 2014. 111(48):
p. 17182-17187.
92. PREVAIL, I. and M.-N.P.I.S. Team, A Randomized, Controlled Trial of ZMapp
for Ebola Virus Infection. The New England journal of medicine, 2016. 375(15): p. 1448.
93. World Health Organization. Ebola Situation Report. 2015; Available from:
http://apps.who.int/ebola/current-situation/ebola-situation-report-22-april-2015-0.
94. Butler, D., Ebola experts seek to expand testing. Nature, 2014. 516(7530): p.
154-155.
95. Ellington, A.D. and J.W. Szostak, In vitro selection of RNA molecules that bind
specific ligands. nature, 1990. 346(6287): p. 818-822.
96. Hermann, T. and D.J. Patel, Adaptive recognition by nucleic acid aptamers.
Science, 2000. 287(5454): p. 820-825.
97. Gopinath, S.C.B., Methods developed for SELEX. Analytical and bioanalytical
chemistry, 2007. 387(1): p. 171-182.
98. Gold, L., et al., Diversity of oligonucleotide functions. Annual review of
biochemistry, 1995. 64(1): p. 763-797.
50
99. Sabeti, P.C., P.J. Unrau, and D.P. Bartel, Accessing rare activities from random
RNA sequences: the importance of the length of molecules in the starting pool. Chemistry &
biology, 1997. 4(10): p. 767-774.
100. Legiewicz, M., et al., Size, constant sequences, and optimal selection. Rna,
2005. 11(11): p. 1701-1709.
101. Famulok, M. and G. Mayer, Aptamers as tools in molecular biology and
immunology, in Combinatorial Chemistry in Biology. 1999, Springer. p. 123-136.
102. Kulbachinskiy, A., Methods for selection of aptamers to protein targets.
Biochemistry (Moscow), 2007. 72(13): p. 1505-1518.
103. Eaton, B.E., L. Gold, and D.A. Zichi, Let's get specific: the relationship
between specificity and affinity. Chemistry & biology, 1995. 2(10): p. 633-638.
104. Kusser, W., Chemically modified nucleic acid aptamers for in vitro selections:
evolving evolution. Reviews in Molecular Biotechnology, 2000. 74(1): p. 27-38.
105. Jayasena, S.D., Aptamers: an emerging class of molecules that rival antibodies
in diagnostics. Clinical chemistry, 1999. 45(9): p. 1628-1650.
106. Nimjee, S.M., C.P. Rusconi, and B.A. Sullenger, Aptamers: an emerging class
of therapeutics. Annu. Rev. Med., 2005. 56: p. 555-583.
107. Jensen, K.B., et al., Using in vitro selection to direct the covalent attachment of
human immunodeficiency virus type 1 Rev protein to high-affinity RNA ligands. Proceedings
of the National Academy of Sciences, 1995. 92(26): p. 12220-12224.
108. Nutiu, R. and Y. Li, Aptamers with fluorescence-signaling properties. Methods,
2005. 37(1): p. 16-25.
51
109. Gold, L., et al., Aptamer-based multiplexed proteomic technology for
biomarker discovery. PloS one, 2010. 5(12): p. e15004.
110. Pollard, J., S.D. Bell, and A.D. Ellington, Design, synthesis, and amplification
of DNA pools for construction of combinatorial pools and libraries. Current Protocols in
Molecular Biology, 2000: p. 24.2. 1-24.2. 24.
111. Shi, H., et al., Evolutionary dynamics and population control during in vitro
selection and amplification with multiple targets. RNA, 2002. 8(11): p. 1461-1470.
112. Ozer, A., J.M. Pagano, and J.T. Lis, New technologies provide quantum
changes in the scale, speed, and success of SELEX methods and aptamer characterization.
Molecular Therapy—Nucleic Acids, 2014. 3(8): p. e183.
113. Hall, K.B. and J.K. Kranz, Nitrocellulose filter binding for determination of
dissociation constants, in RNA-protein interaction protocols. 1999, Springer. p. 105-114.
114. Nieuwlandt, D., M. Wecker, and L. Gold, In vitro selection of RNA ligands to
substance P. Biochemistry, 1995. 34(16): p. 5651-5659.
115. Latulippe, D.R., et al., Multiplexed microcolumn-based process for efficient
selection of RNA aptamers. Analytical chemistry, 2013. 85(6): p. 3417-3424.
116. Wang, J., et al., Particle Display: A Quantitative Screening Method for
Generating High‐Affinity Aptamers. Angewandte Chemie International Edition, 2014. 53(19):
p. 4796-4801.
117. Nitsche, A., et al., One-step selection of Vaccinia virus-binding DNA aptamers
by MonoLEX. BMC biotechnology, 2007. 7(1): p. 48.
52
118. Ozer, A., et al., Density-dependent cooperative non-specific binding in solid-
phase SELEX affinity selection. Nucleic acids research, 2013. 41(14): p. 7167-7175.
119. Tsai, R.Y. and R.R. Reed, Identification of DNA recognition sequences and
protein interaction domains of the multiple-Zn-finger protein Roaz. Molecular and cellular
biology, 1998. 18(11): p. 6447-6456.
120. Mendonsa, S.D. and M.T. Bowser, In vitro evolution of functional DNA using
capillary electrophoresis. Journal of the American Chemical Society, 2004. 126(1): p. 20-21.
121. Huang, C.-J., et al., Integrated microfluidic system for rapid screening of CRP
aptamers utilizing systematic evolution of ligands by exponential enrichment (SELEX).
Biosensors and Bioelectronics, 2010. 25(7): p. 1761-1766.
122. Park, S.-m., et al., Selection and elution of aptamers using nanoporous sol-gel
arrays with integrated microheaters. Lab on a Chip, 2009. 9(9): p. 1206-1212.
123. Oh, S.S., et al., Improving aptamer selection efficiency through volume
dilution, magnetic concentration, and continuous washing in microfluidic channels. Analytical
chemistry, 2011. 83(17): p. 6883-6889.
124. Morris, K.N., et al., High affinity ligands from in vitro selection: complex
targets. Proceedings of the National Academy of Sciences, 1998. 95(6): p. 2902-2907.
125. Shangguan, D., et al., Aptamers evolved from live cells as effective molecular
probes for cancer study. Proceedings of the National Academy of Sciences, 2006. 103(32): p.
11838-11843.
53
126. Ohuchi, S.P., T. Ohtsu, and Y. Nakamura, Selection of RNA aptamers against
recombinant transforming growth factor-β type III receptor displayed on cell surface.
Biochimie, 2006. 88(7): p. 897-904.
127. Raddatz, M.S.L., et al., Enrichment of Cell‐Targeting and Population‐Specific
Aptamers by Fluorescence‐Activated Cell Sorting. Angewandte Chemie, 2008. 120(28): p.
5268-5271.
128. Avci-Adali, M., et al., Pitfalls of cell-systematic evolution of ligands by
exponential enrichment (SELEX): existing dead cells during in vitro selection anticipate the
enrichment of specific aptamers. Oligonucleotides, 2010. 20(6): p. 317-323.
129. Cheng, C., et al., In vivo SELEX for Identification of Brain-penetrating
Aptamers. Molecular Therapy—Nucleic Acids, 2013. 2(1): p. e67.
130. Hoon, S., et al., Aptamer selection by high-throughput sequencing and
informatic analysis. Biotechniques, 2011. 51(6): p. 413-416.
131. Cho, M., et al., Quantitative selection of DNA aptamers through microfluidic
selection and high-throughput sequencing. Proceedings of the National Academy of Sciences,
2010. 107(35): p. 15373-15378.
132. Berezhnoy, A., et al., Isolation and optimization of murine IL-10 receptor
blocking oligonucleotide aptamers using high-throughput sequencing. Molecular Therapy,
2012.
133. Zimmermann, B., et al., Monitoring genomic sequences during SELEX using
high-throughput sequencing: neutral SELEX. PLoS One, 2010. 5(2): p. e9169.
54
134. Beier, R., E. Boschke, and D. Labudde, New strategies for evaluation and
analysis of SELEX experiments. BioMed research international, 2014. 2014.
135. Ditzler, M.A., et al., High-throughput sequence analysis reveals structural
diversity and improved potency among RNA inhibitors of HIV reverse transcriptase. Nucleic
acids research, 2012: p. gks1190.
136. Hoinka, J., et al., Identification of sequence–structure RNA binding motifs for
SELEX-derived aptamers. Bioinformatics, 2012. 28(12): p. i215-i223.
137. Ruckman, J., et al., 2'-Fluoropyrimidine RNA-based aptamers to the 165-amino
acid form of vascular endothelial growth factor (VEGF165). Inhibition of receptor binding and
VEGF-induced vascular permeability through interactions requiring the exon 7-encoded
domain. J Biol Chem, 1998. 273(32): p. 20556-67.
138. Bruno, J.G., Predicting the Uncertain Future of Aptamer-Based Diagnostics and
Therapeutics. Molecules, 2015. 20(4): p. 6866-6887.
139. Kawakami, J., et al., In vitro selection of aptamers that act with Zn 2+. Journal
of Inorganic Biochemistry, 2000. 82(1): p. 197-206.
140. Neff, C.P., et al., An aptamer-siRNA chimera suppresses HIV-1 viral loads and
protects from helper CD4(+) T cell decline in humanized mice. Sci Transl Med, 2011. 3(66):
p. 66ra6.
141. Bruno, J.G., et al., Competitive FRET-aptamer-based detection of
methylphosphonic acid, a common nerve agent metabolite. Journal of fluorescence, 2008.
18(5): p. 867-876.
55
142. Ruckman, J., et al., 2′-Fluoropyrimidine RNA-based aptamers to the 165-amino
acid form of vascular endothelial growth factor (VEGF165) Inhibition of receptor binding and
VEGF-induced vascular permeability through interactions requiring the exon 7-encoded
domain. Journal of Biological Chemistry, 1998. 273(32): p. 20556-20567.
143. Tang, Z., et al., Generating aptamers for recognition of virus-infected cells.
Clinical chemistry, 2009. 55(4): p. 813-822.
144. Chen, F., et al., CS-SELEX generates high-affinity ssDNA aptamers as
molecular probes for hepatitis C virus envelope glycoprotein E2. PloS one, 2009. 4(12): p.
e8142.
145. M Bompiani, K., et al., Antidote control of aptamer therapeutics: the road to a
safer class of drug agents. Current pharmaceutical biotechnology, 2012. 13(10): p. 1924-1934.
146. Group, E.S., Preclinical and phase 1A clinical evaluation of an anti-VEGF
pegylated aptamer (EYE001) for the treatment of exudative age-related macular degeneration.
Retina, 2002. 22(2): p. 143-152.
147. Foy, J.W.-D., et al., Local tolerance and systemic safety of pegaptanib sodium
in the dog and rabbit. Journal of Ocular Pharmacology and Therapeutics, 2007. 23(5): p. 452-
466.
148. Meng, L., et al., Targeted delivery of chemotherapy agents using a liver cancer-
specific aptamer. PLoS One, 2012. 7(4): p. e33434.
149. Liu, Z., et al., Novel HER2 aptamer selectively delivers cytotoxic drug to
HER2-positive breast cancer cells in vitro. J Transl Med, 2012. 10(1): p. 148.
56
150. Subramanian, N., et al., Target-specific delivery of doxorubicin to
retinoblastoma using epithelial cell adhesion molecule aptamer. Molecular vision, 2012. 18: p.
2783.
151. Zhang, M.-Z., et al., Targeted quantum dots fluorescence probes functionalized
with aptamer and peptide for transferrin receptor on tumor cells. Nanotechnology, 2012.
23(48): p. 485104.
152. Hong, H., et al., Molecular imaging with nucleic acid aptamers. Current
medicinal chemistry, 2011. 18(27): p. 4195.
153. Song, Y., et al., Selection of DNA aptamers against epithelial cell adhesion
molecule for cancer cell imaging and circulating tumor cell capture. Analytical chemistry,
2013. 85(8): p. 4141-4149.
154. Talbot, L.J., et al., Pharmacokinetic characterization of an RNA aptamer against
osteopontin and demonstration of in vivo efficacy in reversing growth of human breast cancer
cells. Surgery, 2011. 150(2): p. 224-230.
155. Cho, S.-J., et al., Novel system for detecting SARS coronavirus nucleocapsid
protein using an ssDNA aptamer. Journal of bioscience and bioengineering, 2011. 112(6): p.
535-540.
156. Toscano-Garibay, J.D., M.L. Benítez-Hess, and L.M. Alvarez-Salas, Isolation
and characterization of an RNA aptamer for the HPV-16 E7 oncoprotein. Archives of medical
research, 2011. 42(2): p. 88-96.
157. Tombelli, S., et al., Aptamer-based biosensors for the detection of HIV-1 Tat
protein. Bioelectrochemistry, 2005. 67(2): p. 135-141.
57
158. Negri, P., et al., Direct optical detection of viral nucleoprotein binding to an
anti-influenza aptamer. Analytical chemistry, 2012. 84(13): p. 5501-5508.
159. Binning, J.M., et al., Development of RNA aptamers targeting Ebola virus
VP35. Biochemistry, 2013. 52(47): p. 8406-8419.
160. Huang, Z., X. Wang, and G. Gao, Analyses of SELEX-derived ZAP-binding
RNA aptamers suggest that the binding specificity is determined by both structure and
sequence of the RNA. Protein & cell, 2010. 1(8): p. 752-759.
161. Wang, R. and Y. Li, Hydrogel based QCM aptasensor for detection of avian
influenzavirus. Biosensors and Bioelectronics, 2013. 42: p. 148-155.
162. Labib, M., et al., Aptamer-based viability impedimetric sensor for viruses.
Analytical chemistry, 2012. 84(4): p. 1813-1816.
163. Lee, S., et al., Chip-based detection of hepatitis C virus using RNA aptamers
that specifically bind to HCV core antigen. Biochemical and biophysical research
communications, 2007. 358(1): p. 47-52.
164. Fletcher, S.J., et al., Toward specific detection of Dengue virus serotypes using
a novel modular biosensor. Biosensors and Bioelectronics, 2010. 26(4): p. 1696-1700.
165. Bai, H., et al., A SPR aptasensor for detection of avian influenza virus H5N1.
Sensors, 2012. 12(9): p. 12506-12518.
166. Luo, Q., et al., An indirect sandwich ELISA for the detection of avian influenza
H5 subtype viruses using anti-hemagglutinin protein monoclonal antibody. Veterinary
microbiology, 2009. 137(1): p. 24-30.
58
167. Dhumpa, R., et al., Rapid detection of avian influenza virus in chicken fecal
samples by immunomagnetic capture reverse transcriptase–polymerase chain reaction assay.
Diagnostic microbiology and infectious disease, 2011. 69(3): p. 258-265.
168. Sidoti, F., et al., Development of real time RT-PCR assays for detection of type
A influenza virus and for subtyping of avian H5 and H7 hemagglutinin subtypes. Molecular
biotechnology, 2010. 44(1): p. 41-50.
169. Szpechciński, A. and A. Grzanka, [Aptamers in clinical diagnostics]. Postepy
biochemii, 2005. 52(3): p. 260-270.
170. Cohen, C., et al., An aptamer that neutralizes R5 strains of HIV-1 binds to core
residues of gp120 in the CCR5 binding site. Virology, 2008. 381(1): p. 46-54.
171. Dey, A.K., et al., An aptamer that neutralizes R5 strains of human
immunodeficiency virus type 1 blocks gp120-CCR5 interaction. Journal of virology, 2005.
79(21): p. 13806-13810.
172. DEY, A.K., et al., Structural characterization of an anti-gp120 RNA aptamer
that neutralizes R5 strains of HIV-1. Rna, 2005. 11(6): p. 873-884.
173. Jeon, S.H., et al., A DNA aptamer prevents influenza infection by blocking the
receptor binding region of the viral hemagglutinin. Journal of Biological Chemistry, 2004.
279(46): p. 48410-48419.
174. Choi, S.K., et al., DNA aptamers against the receptor binding region of
hemagglutinin prevent avian influenza viral infection. Molecules and cells, 2011. 32(6): p.
527-533.
59
175. WANG, J., H. JIANG, and F. LIU, In vitro selection of novel RNA ligands that
bind human cytomegalovirus and block viral infection. Rna, 2000. 6(04): p. 571-583.
176. Gopinath, S.C., K. Hayashi, and P.K. Kumar, Aptamer that binds to the gD
protein of herpes simplex virus 1 and efficiently inhibits viral entry. Journal of virology, 2012.
86(12): p. 6732-6744.
177. Moller-Tank, S. and W. Maury, Ebola virus entry: a curious and complex series
of events. PLoS pathogens, 2015. 11(4): p. e1004731.
178. Ksiazek, T.G., et al., ELISA for the detection of antibodies to Ebola viruses.
The Journal of infectious diseases, 1999. 179(Supplement_1): p. S192-S198.
179. Su, S., et al., Diagnostic strategies for Ebola virus detection. The Lancet
Infectious Diseases, 2016. 16(3): p. 294-295.
180. Kanai, A., K. Tanabe, and M. Kohara, Poly (U) binding activity of hepatitis C
virus NS3 protein, a putative RNA helicase. FEBS letters, 1995. 376(3): p. 221-224.
60
CHAPTER 2
A 2’FY-RNA EPITOPE FORMS AN APTAMER FOR EBOLAVIRUS sGP:
SELECTION AND CHARACTERIZATION
Shambhavi Shubhama,b, Jan Hoinkac, Emma Swansona, Teresa M. Przytyckac,
Wendy Mauryd, Soma Banerjee a,b and Marit Nilsen-Hamiltona,b
aIowa State University, Ames IA, bAptalogic Inc., Ames IA, cNational Institutes of Health,
Bethesda, DC, dUniversity of Iowa, Iowa City IA
Short title: A 2’FY-RNA Epitope Selectively Binds Ebola Virus sGP
Experimental contributions to this manuscript:
SELEX against sGP, identification of sequence structure motif, binding assays to determine
poly U and 2’FY modification dependent high affinity binding, truncation of parent aptamer
to determine the RNA binding epitope, antisense hybridization assay and binding assays to
determine the Kd of aptamer 39SGP1A against sGP were performed by Shambhavi Shubham
Analysis of Next Gen Sequencing data and the identification of top 10 clusters was done by
Jan Hoinka.
Emma Swanson repeated the binding assays of 39SGP1A against sGP and performed binding
assays to determine the affinity of 39SGP1A against serum proteins.
Soma Banerjee determined the binding affinity of 39SGP1A against sGP using an Aptamer
Sandwich Binding Assay that she developed.
61
ABSTRACT
Nucleic acid aptamers have advantages over antibodies for incorporation into sensing
devices. These advantages include stability to storage in the dehydrated state, structural
stability for repetitive use, and compatibility with many sensing/transducing mechanisms.
Such capability is important for detecting Ebola virus (EBOV) for which epidemics frequently
start in locations that lack sophisticated equipment. sGP (soluble glycoprotein), a nonstructural
Ebola viral glycoprotein, is an EBOV biomarker that is secreted in abundance in the blood
stream even during the early stages of infection. Here, we report the selection of 39SGP1A, a
2’flouro pyrimidine (2’FY)-modified RNA aptamer that specifically binds to sGP and does not
bind human serum albumin, the most abundant protein in human blood. We demonstrate by
computational and biochemical analysis that the recognition motif of 39SGP1A is a novel
polypyrimidine-rich sequence. The replacement of the F group in the 2’ position of the ribose
with an OH group resulted in complete loss of affinity for sGP. Computational structural
modeling suggests that this motif could form a compact surface for protein interaction for
which modification by fluorine increases molecular hydrophobicity.
62
INTRODUCTION
Ebola virus, in the family of Filoviridae, is a highly virulent enveloped RNA virus that
causes hemorrhagic fever with 50-90% fatality and for which early detection is the key to
controlling epidemics such as have occurred in the recent past. The Ebola virus GP gene
encodes two glycoproteins with the surface exposed trimeric glycoprotein (GP1,2) being the
minor product. The major translated product is sGP (soluble glycoprotein), which is conserved
amongst the five Ebola virus species (1,2). sGP shares its first 295 amino acids with GP1,2
but has a unique 28 amino acid carboxy terminus. Monomers are disulphide linked (at C53 and
C306) in a parallel orientation and appear in the blood as homodimers. It is N glycosylated at
6 positions and C-mannosylated at W288. Due to their sequence homology sGP and GP1,2
have similar monomeric structures (3). Although, the role of sGP in pathogenesis is not yet
established, antibodies elicited during infection cross react with sGP and GP1,2. This
observation supports role for sGP as a decoy for antibodies against GP1,2 on the virus particle
(4). Consistent with this hypothesis is the observation that sGP is secreted in abundance in the
early stages of infection. Thus, it is an excellent choice as an Ebola virus biomarker.
Despite its clear advantage as a biomarker for Ebola virus infections, sGP has been so
far overlooked for this purpose. Here we describe the application of SELEX (5-7) combined
with Next Gen Sequencing (NGS) and analysis by APTAGUI to select a 2’FY-RNA aptamer
(39SGP1A) with high affinity and specificity for sGP. Aptamer 39SGP1A binds sGP tightly
with a Kd of 27nM. By contrast, 39SGP1A does not bind human serum albumin. The
requirement for structure in the binding of 39SGP1A to sGP is evident by the lack of affinity
for sGP of the RNA (2’OH) version of this aptamer, which distinguishes the 39SGP1A motif
63
from the RNA recognition domain of the polypyrimidine tract binding protein (8-10). 2’F
modification, which provides resistance against endonucleases (11) also results in
conformational differences from the 2’OH RNA. The 2’F-modified ribose sugar tends to adopt
the C3’ endo conformation and stabilizes the RNA structure (12). In addition, the inclusion of
fluorine modifications increases molecular hydrophobicity. Here, we describe the aptamer and
characterize its interaction with sGP, identifying a novel 2’FY-RNA binding domain as a poly-
2’F-U loop with GAGC in the stem.
RESULTS
Selection of 2’FY-RNAs with High Affinity for sGP
2’FY-RNAs with high affinity for sGP were selected by SELEX from an
oligonucleotide pool, consisting of a 53nt random region sequence flanked by 25 bases 5’ and
3’ constant regions with a starting complexity of 1015 molecules of RNA. The protocol
followed a mathematically defined approach of starting with a relatively high molar ratio of
2:1 (RNA: sGP) followed by harmonic reductions in the sGP concentration (13) to increase
the stringency of selections (Fig.1B). To eliminate non-specific sequences binding to the
nitrocellulose membrane, negative selections were performed at rounds 2 and 4. After 9 rounds
of selection, enrichment of the pools was analyzed by nitrocellulose filter capture assay and
EMSA. The binding curve of the initial pool did not reach saturation, whereas the binding
curve of the final pool was biphasic with saturation achieved at ~100 nM and ~1uM
respectively suggesting selection of high and low affinity RNA binders (data not shown). The
filter binding results were corroborated by the results from electrophoretic mobility shift assay
64
(EMSA) results using the pools from the 1st and 9th rounds RNA pools. The 1st, 4th, 6th and 9th
rounds pools were given for Next Gen Sequencing Analysis and simultaneously 9th round pool
was sub-cloned and sequenced by TOPO-TA cloning.
Sequencing Analysis and Identification of Conserved Sequence Motifs
APTA GUI (14), an open source graphical user interface was used for the Next Gen
Sequencing data analysis. APTAGUI provides essential information regarding the quality of
the data by separating the reads into several rounds and extracting randomized sequences.
APTA GUI also generates enrichment ratios across the selection cycles, which helps in
selecting prospective sequences for further analysis. In addition to individual sequences it also
provides information about various aptamer clusters and sequence families. The APTAGUI
platform allows the user to study the mutation count on each individual sequence. Due to its
extensive analysis of the aptamer families, it greatly facilitates the identification of aptamers.
Next Gen Sequencing Analysis (Figs. 1A, C, D). The top 10 Sequence clusters obtained by
TOPO TA cloning were identical to the Top 10 clusters obtained from Next Gen Sequencing
analysis.
Analysis of the sequences in the top 10 clusters from NGS with MEME (15) identified
a conserved sequence motif of a stretch of U’s and GAGC (Fig. 1E). No other sequence
structure motifs were found in other enriched clusters. In all the secondary structures predicted
for the sequence motif by MFold (16) the poly 2’F-U’s were in a loop followed by GAGC in
a stem.
65
The poly2’F-U-GAGC Sequence Motif Identifies A High Affinity Aptamer
The affinities of 2’FY-RNA oligonucleotides 5183, 5177, 5179 and 5182 containing
the poly 2’F-U-GAGC sequence motif were compared with oligonucleotides 4789, 5181 from
the top sequence cluster that did not contain the motif. In the initial titrations, we observed
saturation at 100nM for all sequences containing U rich motif suggesting high affinity binding.
The results, demonstrated for 2’FY-RNA-5183 and 2’FY-RNA-4789 revealed high affinities
(Kd = 20-50 nM) for oligonucleotides containing the poly 2’F-U-GAGC sequence motif and
low affinities (Kd = 0.5 to 1uM) for sequences that did not contain the motif (Fig. 2 A-D). That
the 2’FY modification is essential for 2’FY-RNA-5183 binding to sGP is demonstrated by the
observation that the same sequence in the form of an RNA (with 2’OH) did not bind sGP (Fig.
2A). sGP binding by 2’FY-RNA 5183 was confirmed by electrophoretic mobility shift assay
(EMSA, Fig. 2E).
The specificity of 2’FY-RNA-5183 binding to sGP in the presence and absence of an
unrelated RNA aptamer (RNA-569) that recognizes mouse Lcn2 (17). RNA-569, in 10 molar
excess, did not compete for 2’FY-RNA-5183 binding to sGP (Fig. 2E). These results are
consistent with the hypothesis that 2’FY-RNA-5183 binds sGP with specificity and high
affinity. Cluster containing 2’FY-RNA-5183 was examined for base frequency at each position
by APTAGUI to establish a “mutation rate” through the selections (14). 5’ end stem loop,
which contains the poly 2’F-U-GAGC sequence motif, was identified as the most stable
sequence. Truncations of the 2’FY-RNA-5183 were tested for binding sGP (Fig. 3A, B, D).
These results showed that the high affinity binding element in 2’FY-RNA-5183 contains the
poly 2’F-U-GAGC sequence motif.
66
A 2’FY-RNA-5199, a 39nt truncated version of 5199 containing the poly 2’F-U-GAGC
sequence motif that binds sGP with Kd of 27nM was given the aptamer name of 39SGP1A.
Further truncation to 2’FY-RNA-5199 containing only 6 U’s within the loop (Oligo 5015) had
lower affinity for sGP, supporting the hypothesis that the structure of the U rich loop, rather
than just the presence of a series of 2’FY modified Us, is important for binding (Fig. 3F). We
also tested the binding of 39SGP1A with sGP by performing UV crosslinking and observed a
clear mobility shift when the RNA and protein were combined. We confirmed that the shifted
band was an RNA-protein photo-adduct by digestion with Proteinase K (Fig. 3C). We also
tested involvement of the poly 2’F-U loop by hybridizing it with antisense oligonucleotide
DNA-5196. The presence of a 10-fold molar excess of DNA-5196 over 39SGP1A resulted in
50% reduction in the sGP-RNA shifted band after crosslinking. These results demonstrate that
39SGP1A is a 2’FY-RNA aptamer that bind sGP with high affinity.
How Many Epitopes On sGP Are Recognized By The Selected 2’FY-RNA
Oligonucleotides?
Several RNA oligonucleotide families were identified from the NGS results that are
not homologous in sequence. Whereas members of the family identified by the poly 2’F-U-
GAGC sequence motif bound sGP with high affinity, members of other families bound with
lower affinity (example in Fig. 2). To establish if these oligonucleotides bound to the same or
different protein epitopes, we tested the ability of a representative of another family to compete
for binding of 39sGP1A with sGP.
67
The 39SGP1A aptamer, 2’FY RNA oligonucleotides 4789, 5179 and oligonucleotide
6011, a DNA oligo that binds sGP, were used as competitors of 32P-39SGP1A for binding sGP.
Competition was observed with all the oligonucleotides, which varied in affinity for sGP. This
observation suggests that sGP has one favored nucleic acid binding epitope and the high
affinity and low affinity binding is determined by the tertiary structure of the RNA (Fig.4).
Specificity of 39SGP1A
To establish if 39SGP1A is suitable as a sensor for early diagnosis of sGP in patient
serum, we tested its affinity for human serum albumin (HSA). HSA is highly abundant in
blood, reaching concentrations up to 300 μM. The 2’FY-RNA oligonucleotide-5183, from
which 39SGP1A was derived, bound HSA with a Kd of 400 nM (Fig. 5A). However, once
isolated from the remainder of 2’FY-RNA-5183, 39SGP1A did not bind HSA up to 68 μM
(Fig. 5B). 39SGP1A was also found not to bind two other highly abundant serum proteins,
alpha 2 macroglobulin and fibrinogen (Fig. 5C).
DISCUSSION
In this study, we identified an RNA aptamer that binds sGP with high affinity and
specificity. sGP is a non-structural Ebola virus 70 KDa glycoprotein that forms a parallel
homodimer linked by disulfide bonds, which is responsible for immune modulation during
infection (4). The choice of sGP as a SELEX target was motivated by the fact that it is secreted
in abundance in blood early during infection, which makes it an excellent biomarker for Ebola
infection (2). An aptamer that binds sGP could be incorporated onto a biosensor platform for
68
early infection detection. 39SGP1A is the first RNA aptamer reported to be specific for sGP.
For our selections, we began with a complexity of 1015 2’FY modified RNA oligonucleotides.
2’F ribose modification provides nuclease resistance and has widely been used in aptamer
selections. After eight rounds of selection we compared the binding of the final pool with the
starting pool by the filter capture assay. The initial RNA pool showed no evidence of saturation
at 5 μM, whereas in the final round RNA pool the sGP titration indicated the presence of two
groups of oligonucleotides identified by high and low affinities. We used conventional TOPO
TA cloning for high throughput sequencing of the 8th round and performed Next Gen
Sequencing on 1st, 4th, 6th and 8th Round pools. Clusters obtained from high throughput
sequencing utilizing TOPO TA cloning were identical to the clusters identified by Next Gen
Sequencing.
To identify potential aptamers, we searched for conserved motifs within the top 10
clusters and identified a consensus sequence of poly U and GAGC. In the predicted secondary
structures, the poly U stretch of 18 nts resided in the loop region followed by GAGC’s in the
stem region. Oligonucleotides containing the poly U motif demonstrated high affinity binding
(Kds = 20-34 nM), whereas oligonucleotides from the top ten selected clusters that did not
contain the poly U motif bound sGP with low affinity. Certain cellular proteins to bind to
poly(U) rich RNA sequences (18-20). However, the selected oligonucleotides in this study
contained 2’F- modified pyrimidines, which alters the structure by holding the sugar ribose in
the C3’ endo conformation. This conformation is usually favored in RNA duplexes, increasing
the helical stability. When oligonucleotide 5183 was prepared with 2’OH uracil and 2’F
69
cytosine or 2’ OH cytosine binding to sGP was lost, showing that 2’F-U modification is
essential for this oligonucleotide to bind sGP with high affinity.
A comparison of selected aptamers from libraries of RNA molecules containing
2'amino and 2'fluoro deoxy pyrimidines resulted in higher affinity aptamers from the 2’FY
selection. From this it was speculated that the increased affinity of 2’FY modified RNA is due
to formation of thermodynamically stable helices and rigid structures in 2’FY RNA compared
to the 2'amino modified RNA (12). However, X ray crystallography studies with 2’F modified
and unmodified duplexes demonstrated that the presence of 2’F modification does not alter the
overall helical structure of the duplex (21). The increased thermodynamic stability of the
helices is due to the highly electronegative fluorine polarizing the nucleobases, which enhances
the Watson-Crick pairing. Osmotic stress and X ray crystallography studies show that the
presence of 2’Fluorine also significantly reduces the hydration of the duplex, increasing its
hydrophobicity (22) (21). In our study also, we observed increased retention of 2’F poly U
sequences to the hydrophobic nitrocellulose membranes in the absence of target protein in
comparison to 2’OH RNA. Increased retention of nucleic acids to nitrocellulose membranes
was predominantly observed with oligonucleotides containing the poly U rich sequences
whereas past studies have reported the presence of Multi G Motifs (MGM’s) that exhibit
significant nonspecific nitrocellulose retention (23,24).
To localize the aptamer sequence in oligo 5183, we tested truncations, which identified
the 5’ poly U hairpin region, which was truncated to 39 nucleotides and tested for binding to
sGP by filter capture and EMSA assays and for the ability of a DNA oligo (5196)
70
complementary to the poly U loop reduce binding to sGP. These results confirmed that
oligonucleotide 5199 is an aptamer with high affinity for sGP and it was name 39SGP1A.
7\
and hydrogen bonding interactions among uracil (25) in comparison to GNRA (N any
nucleotide and R purine) loops or UUCG loops, which have interactions within loop bases(26).
39SGP1A contains an 18-nucleotide loop region comprised of 77% uracils with intermittent
purines and pyrimidines. The effect of 2’Fluoro modification on the structure of a loop is
unknown but, based on the reported effects of 2’FY substitution on helical stability due to base
polarization and increased hydrophobicity, we speculate that the high affinity of the 2’FY
modified 39SGP1A aptamer might be aided by strong intermolecular hydrogen bonding
interactions and π-π stacking interactions between the available 2’F uracils with sGP residues.
In addition, the 2’F- dependent structural organization within the loop is also expected to
contribute to enhanced affinity.
We investigated several of the selected oligonucleotides to to determine if they bind
the same epitope on sGP in a competition assay with 32P-39SGP1A and unlabeled low affinity
(oligo 4789), and high affinity (oligo 5179) and a DNA aptamer independently isolated
(manuscript in preparation). These three oligonucleotides competed with 39SGP1A for
binding sGP, which suggests that the protein has an epitope that is preferred for RNA binding.
39SGP1A was selected as a potential sensor for early EbolaVirus infection (27), which
would be performed with samples of patient blood. To obtain a significant signal to noise ratio
the aptamer should not bind other serum proteins. The most abundant serum protein is albumin
which is present in blood at concentrations as high as 300 μM. Although the selected
71
oligonucleotide, 5183, from which 39SGP1A was derived, bound to HSA with a Kd of 500
nM, 39SGP1A did not bind HSA. Thus, truncating the oligonucleotide to a minimal critical
sequence, appears to have eliminated structures that could bind HSA. 39SGP1A also did not
bind α2 macroglobulin and fibrinogen, two other serum proteins which could contribute to the
background noise.
In summary, we report the selection of a 2’FY-RNA aptamer that binds the Ebola virus
sGP glycoprotein with high affinity and specificity and demonstrate that the 2’F modification
is required for binding to sGP.
MATERIALS AND METHODS
SELEX library construction
A DNA single stranded oligonucleotide library named 487 was synthesized by IDT (Integrated
DNA Technologies, Coralville, IA) with the following sequence:
5’CCTGTTGTGAGCCTCCTGTCGAA (53N) TTGAGCGTTTATTCTTGTCTCCC 3’, and
N symbolizes equimolar mixture of A, C, G and T. The following primers were used for reverse
transcription and PCR reactions: Oligo484:5’-
TAATACGACTCACTATAGGGAGACAAGAATAAACGCTCAA-3’ and Oligo 485: 5’-
GCCTGTTGTGAGCCTCCTGTCGAA-3.
72
Conversion of ssDNA SELEX library to dsDNA
To generate starting RNA pool, an extension reaction was performed using primer 484
and the starting ssDNA pool. 10 reactions of 1000uls each containing 2 μM 487 pool, 3.3 μM
484 primer, 0.5 mM dNTP mix, 0.03 U/μl DNA Taq Polymerase (GenScript) in reaction buffer
containing 50 mM KCl, 10 mM Tris-HCl (pH 8.55), 1.5 mM MgCl2, 0.1% TritonX-100 was
incubated at 94°C for 5 min, 65°C for 15 min and 72°C for 99 min using the Multi GENE II
PCR minicycler. The generated dsDNA was run on 2% agarose gel and purified using Qiagen
PCR purification kit. Purified DNA was quantified via Nanodrop.
RNA synthesis and purification
RNA was prepared by in-vitro transcription using DurascribeTM T7 transcription kit
from (Epicentre, Madison). Around 2nmoles of dsDNA from pool generated from extension
is incubated with 5 mM ATP, 5 mM GTP,5 mM 2’FY UTP,5 mM 2’FYCTP, 5 mM DTT,
0.2U/μL T7 Enzyme in a total volume of 2.8 mL and 5% DMSO and incubated at 37°C for 4
h. DNA mixture was then digested with 1 MBU DNAse I. The RNA was resolved through a
7M urea 8% (19:1 acrylamide:bisacrylamide) gel in 1X Tris Borate EDTA buffer, pH 9.1 to
separate the residual NTPs and abortive transcripts. Transcribed RNA was eluted in TE buffer
(10 mM Tris-HCl, 1 mM EDTA pH 8.0) for 18 h at 37°C.
In-vitro selection of RNA aptamers against sGP (soluble glycoprotein)
In vitro selection of an aptamer for sGP was carried out by SELEX (Systematic
Evolution of Ligands by EXponential enrichment). Prior to the first round of selection, a
73
dsDNA pool was generated from a library of ssDNAs (487D pool) by primer extension.
Starting RNA pool was generated by in-vitro transcription using dsDNA (487D) pool as
template. RNA pool (1X1015 molecules) 2nmoles was incubated with sGP and the non-binding
RNA sequences were partitioned by passing it through nitrocellulose membrane. For each
positive selection, to increase the stringency of selection ratio of RNA pool: sGP was
increased. To remove nonspecific membrane binders negative selections were performed
against the nitrocellulose membrane. Reverse transcribed polymerase chain reaction (RT-PCR)
amplification was used to generate DNA for subsequent selection rounds. 8 rounds of
selections were performed including negative and positive selections. Enriched pool from the
10th SELEX round was cloned into the TOPO XL PCR cloning plasmid for sequencing, in
addition PCR libraries were prepared for Next Gen Sequencing using Illumina sequencing
primers.
Nitrocellulose capture assay
To determine the binding affinity of sGP to RNA aptamers, 5’P32 end labeled RNA
was firstly prepared. 2’FY modified RNA was transcribed using Durascribe transcription kit
(Epicentre Technologies), transcribed RNA was electrophoresed in an 8% polyacrylamide–7
M urea gel, and eluted from the gel. RNA was dephosphorylated with calf intestine
phosphatase for 1 h at 37°C, extracted with phenol, and precipitated with ethanol. The RNA
was end-labeled with [γ-32P] ATP and T4 polynucleotide kinase. To determine the binding
affinity of the RNA aptamer 5183 to sGP, binding studies were performed by first denaturing
the 2nM RNA at 95 degrees for 5 mins followed by refolding in binding buffer [137 mM NaCl,
74
2.7 mM KCl, 10 mM Na2HPO4, 2 mM KH2PO4, 5 mM MgCl2, pH 7.4] at RT for 30 min. RNA
was incubated with varying concentrations of sGP (10 nM-1 μM) at RT for 30 min. The RNA
sGP complex was passed through nitrocellulose membranes (HAWP 02500) and filters were
washed with 3 mL binding buffer and later quantified using Liquid Scintillation Counter. The
data was fit to F=Fmin+(Fmax*L^n)/(L^n+Kd^n) to determine the Kd.
Electrophoretic mobility shift assay (EMSA)
Binding reactions performed by firstly by denaturing of 32P- 5’ end labeled RNA at 95
degrees for 5mins followed by slow cooling in binding buffer [137 mM NaCl, 2.7 mM KCl,
10 mM Na2HPO4, 2 mM KH2PO4, 5 mM MgCl2, pH 7.4] for 30 min. Refolded RNA was
incubated with sGP in binding buffer for 30 min at room temperature. The mixtures were
analyzed for complex formation by resolution through a 6% native polyacrylamide gels run in
Tris HEPES EDTA buffer (33 mM Tris, 66 mM HEPES, 0.1 mM EDTA-Na, pH 7.5) at 200V
and the 32P was visualized using a phosphor imager.
Competition binding assay
Competitive binding reactions were performed by incubating 4 μM sGP with 18 μM
competitor RNA sequences for 30 min at RT in binding buffer. Following the preincubation
period, 32P-labeled 39sGP1A 2’FY-RNA was added to the reaction mix to a final concentration
of 200 nM and the samples were incubated for 15 min. The RNA protein complexes were then
UV crosslinked at 365 nm for 15 min. Crosslinked products were run on 10% SDS PAGE
reducing gel, the gel was dried and later imaged by Typhoon scanner and quantification was
75
performed using Image J software. 39sGP1A RNA aptamer was tested individually against
39sGP1A, 5179, 4789 and 6011 oligonucleotides.
Incorporation of 4 Thio UTP and RNA protein UV crosslinking
RNA was invitro transcribed in the presence of 2’F-UTP and 4-thio-uridine
5’triphosphate (Trilink Biotechnologies) at a molar ratio of 1:1) and radiolabeled with P32-γ-
ATP by T4 polynucleotide kinase. 3 pmol of RNA was denatured at 95°C for 5 min followed
by snap cooling on ice for 5 min. The RNA was folded in PS Buffer (137 mM NaCl, 2.7 mM
KCl, 10 mM Na2HPO4, 2 mM KH2PO4, 5 mM MgCl2, pH 7.4) for 10 min at RT. To link sGP
to the 2’FY-RNA aptamer 5183, 3 pmol 2’FY-RNA was incubated with 15 mol sGP in 15 μL
binding buffer for 20 min at RT for complex formation. This mixture was irradiated for 6 min
and 12 min under a UV lamp (365 nm) with the samples placed 3 cm from the lamps. RNA-
sGP samples were treated with proteinase K for 30 min. The samples were later resolved
through a 10% reducing SDS PAGE gel to separate the 2’FY-RNA-protein complex, free
2’FY-RNA and free protein. The 32P on the gel was visualized using a phosphor imager.
Antisense competition assay with DNA oligo
39sGP1A RNA aptamer was transcribed using Durascribe T7 transcription kit, RNA
transcript was dephosphorylated using alkaline phosphatase (Promega 1U) at 37°C for 1 h,
followed by phenol chloroform extraction. The dephosphorylated 2’FY-RNA was 5’ end
labeled with 32P by incubating with T4 polynucleotide kinase (NEB) at 37°C for 30 min
followed by 65°C for 15 min to inactivate the enzyme. The labeled RNA aptamer was
76
denatured at 95°C for 5 min followed by snap cooling on ice for 5 min and then incubated at
RT for 10 min in (137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 2 mM KH2PO4, 5 mM
MgCl2, pH 7.4). The folded RNA was incubated in the presence and absence of 5-fold excess
of oligonucleotide 5196 for 20 min then sGP was added and the samples incubated for 30 min.
The samples were then irradiated for 15 min UV (365nm) at 3 cm distance from the lamp. The
samples were later resolved through a 10% reducing SDS PAGE gel to separate the 2’FY-
RNA aptamer-protein complex, free RNA and free protein. The 32P on the gel was visualized
using phosphor imager.
ACKNOWLEDGEMENT
We thank Lee Bendickson and Muslum Ilgu for helpful discussions and advice. This
work was funded by NIH grant 5R43AI118139-02 to Aptalogic Inc.
77
LEGENDS TO FIGURES
Figure 1. Next Gen Sequencing Analysis and Consensus Motif Identification. A) The
frequency of singletons, enriched and unique sequences for each SELEX round B) The SELEX
protocol for selecting 2’FY-RNA aptamers with high affinity for sGP C, D) The frequency of
base occurrence in each position for the 1st and 9th round pools showing evidence of sequence
enrichment during selection E) A conserved sequence motif is identified among the top
identified clusters.
Figure 2. The Affinities of Selected 2’FY-oligonucleotides for sGP. A) The concentration
dependence of sGP binding to 2 nM 32P-5183 as a 2’FY-RNA and an RNA oligonucleotide.
The estimated Kd was for the 2’FY-RNA was 50 nM. B) An extended sGP titration up to 3
μM against 2nM nM oligonucleotide 32P-5183 to validate saturation of the binding curve, C)
The concentration dependence of sGP binding to 20 nM
32P- oligonucleotide 4789. The estimated Kd was 500 nM. D) M fold predicted secondary
structures of oligonucleotide s 4789 and 5183 E) Electrophoretic mobility shift assay with 100
nM 32P- oligonucleotide 5183. Buff, buffer only. sGP, buffer plus 2 μM sGP. comp, buffer
plus 2 μM sGP and 10 μM Lcn2 aptamer.
Figure 3. Determining the Binding Epitope for sGP on the 2’FY RNA aptamer.
A) A mutation count chart created in APTAGUI to determine the mutation frequency for 5183
at each nucleotide position, B) The M-fold predicted secondary structures of truncations of
5183, C) UV crosslinking of 200 nM 32P 39SGP1A to 2.5 uM sGP followed by treatment with
or without proteinase K, D) Binding of 10nM 32P-oligo 5183 truncated oligonucleotides to
50nM and 500nM sGP, E) Binding of 0.5 uM 32P-39SGP1A to 10uM sGP in the presence of
78
5 uM antisense oligonucleotide 5196, which is complimentary to the loop region of
oligonucleotide 39SGP1A, F) Concentration dependence of sGP binding to 10nM 32P-
oligonucleotide 39SGP1A and 10 nM 32P- oligonucleotide 5015. The estimated Kd was 27nM
for 39SGP1A
Figure 4. Competition Binding Assay to Determine if the Selected Aptamers Bind to the
Same Protein Epitope. 32P- oligonucleotide 39SGP1A (0.2 μM) was incubated for 15 min at
23°C with a 10-fold excess of the identified oligonucleotides. The samples were stabilized by
UV crosslinking and resolved by SDS-PAGE.
Figure 5. Specificity of 2’FY-5183 and 39SGP1A for sGP. A) Binding of 2 nM 2
’FY 5183 protoaptamer to human serum albumin (HSA) B) Binding of the 10nM 32P 2’FY
39SGP1A aptamer to HSA C) Lack of affinity of 10 nM 2’FY 39SGP1A for human serum
albumin (200 nM to 50 μM), fibrinogen (200 nM to 4 μM) or α2macroglobulin (200 nM to 5
μM).
79
REFERENCES
1. Sanchez, A., Trappier, S. G., Mahy, B., Peters, C. J., and Nichol, S. T. (1996)
The virion glycoproteins of Ebola viruses are encoded in two reading frames and are expressed
through transcriptional editing. Proceedings of the National Academy of Sciences 93, 3602-
3607
2. Volchkov, V. E., Feldmann, H., Volchkova, V. A., and Klenk, H.-D. (1998)
Processing of the Ebola virus glycoprotein by the proprotein convertase furin. Proceedings of
the National Academy of Sciences 95, 5762-5767
3. Pallesen, J., Murin, C. D., de Val, N., Cottrell, C. A., Hastie, K. M., Turner, H.
L., Fusco, M. L., Flyak, A. I., Zeitlin, L., and Crowe Jr, J. E. (2016) Structures of Ebola virus
GP and sGP in complex with therapeutic antibodies. Nature microbiology 1, 16128
4. de La Vega, M.-A., Wong, G., Kobinger, G. P., and Qiu, X. (2015) The multiple
roles of sGP in Ebola pathogenesis. Viral immunology 28, 3-9
5. Tuerk, C., and Gold, L. (1990) Systematic evolution of ligands by exponential
enrichment: RNA ligands to bacteriophage T4 DNA polymerase. Science 249, 505-510
6. Ellington, A. D., and Szostak, J. W. (1990) In vitro selection of RNA molecules
that bind specific ligands. Nature 346, 818-822
7. Robertson, D. L., and Joyce, G. F. (1990) Selection in vitro of an RNA enzyme
that specifically cleaves single-stranded DNA. Nature 344, 467-468
8. Auweter, S., and Allain, F. H.-T. (2008) Structure-function relationships of the
polypyrimidine tract binding protein. Cellular and Molecular Life Sciences 65, 516-527
80
9. Pérez, I., Lin, C.-H., McAFEE, J. G., and Patton, J. G. (1997) Mutation of PTB
binding sites causes misregulation of alternative 3'splice site selection in vivo. Rna 3, 764-778
10. Singh, R., Valcarcel, J., and Green, M. R. (1995) Distinct binding specificities
and functions of higher eukaryotic polypyrimidine tract-binding proteins. Science 268, 1173
11. Pieken, W. A., Olsen, D. B., Benseler, F., Aurup, H., and Eckstein, F. (1991)
Kinetic characterization of ribonuclease-resistant 2'-modified hammerhead ribozymes. Science
253, 314-318
12. Pagratis, N. C., Bell, C., Chang, Y.-F., Jennings, S., Fitzwater, T., Jellinek, D.,
and Dang, C. (1997) Potent 2′-amino-, and 2′-fluoro-2′-deoxyribonucleotide RNA inhibitors
of keratinocyte growth factor. Nature biotechnology 15, 68-73
13. Levine, H. A., and Nilsen-Hamilton, M. (2007) A mathematical analysis of
SELEX. Computational biology and chemistry 31, 11-35
14. Hoinka, J., Dao, P., and Przytycka, T. M. (2015) AptaGUI—A graphical user
interface for the efficient analysis of HT-SELEX data. Molecular therapy. Nucleic acids 4,
e257
15. Bailey, T. L., Boden, M., Buske, F. A., Frith, M., Grant, C. E., Clementi, L.,
Ren, J., Li, W. W., and Noble, W. S. (2009) MEME SUITE: tools for motif discovery and
searching. Nucleic acids research 37, W202-W208
16. Zuker, M., Mathews, D. H., and Turner, D. H. (1999) Algorithms and
thermodynamics for RNA secondary structure prediction: a practical guide. in RNA
biochemistry and biotechnology, Springer. pp 11-43
81
17. Zhai, L., Wang, T., Kang, K., Zhao, Y., Shrotriya, P., and Nilsen-Hamilton, M.
(2012) An RNA aptamer-based microcantilever sensor to detect the inflammatory marker,
mouse lipocalin-2. Anal Chem 84, 8763-8770
18. Bhaskar, V., Roudko, V., Basquin, J., Sharma, K., Urlaub, H., Séraphin, B., and
Conti, E. (2013) Structure and RNA-binding properties of the Not1–Not2–Not5 module of the
yeast Ccr4–Not complex. Nature structural & molecular biology 20, 1281-1288
19. Luo, G. (1999) Cellular proteins bind to the poly (U) tract of the 3′ untranslated
region of hepatitis C virus RNA genome. Virology 256, 105-118
20. Kanai, A., Tanabe, K., and Kohara, M. (1995) Poly (U) binding activity of
hepatitis C virus NS3 protein, a putative RNA helicase. FEBS letters 376, 221-224
21. Pallan, P. S., Greene, E. M., Jicman, P. A., Pandey, R. K., Manoharan, M.,
Rozners, E., and Egli, M. (2010) Unexpected origins of the enhanced pairing affinity of 2′-
fluoro-modified RNA. Nucleic acids research, gkq1270
22. Patra, A., Paolillo, M., Charisse, K., Manoharan, M., Rozners, E., and Egli, M.
(2012) 2′‐Fluoro RNA Shows Increased Watson–Crick H‐Bonding Strength and Stacking
Relative to RNA: Evidence from NMR and Thermodynamic Data. Angewandte Chemie
International Edition 51, 11863-11866
23. Shi, H., Fan, X., Ni, Z., and Lis, J. T. (2002) Evolutionary dynamics and
population control during in vitro selection and amplification with multiple targets. RNA 8,
1461-1470
82
24. Tuerk, C., MacDougal, S., and Gold, L. (1992) RNA pseudoknots that inhibit
human immunodeficiency virus type 1 reverse transcriptase. Proceedings of the National
Academy of Sciences 89, 6988-6992
25. Sashital, D. G., Venditti, V., Angers, C. G., Cornilescu, G., and Butcher, S. E.
(2007) Structure and thermodynamics of a conserved U2 snRNA domain from yeast and
human. Rna 13, 328-338
26. Sheehy, J. P., Davis, A. R., and Znosko, B. M. (2010) Thermodynamic
characterization of naturally occurring RNA tetraloops. RNA
27. Bruno, J. G. (2015) Predicting the Uncertain Future of Aptamer-Based
Diagnostics and Therapeutics. Molecules 20, 6866-6887
83
Figure 1
Next Gen Sequencing Analysis And Consensus Motif Identification
84
Figure 2
The Affinities of Selected 2’FY-oligonucleotides for sGP.
85
Figure 3
Determining the Binding Epitope for sGP on the 2’FY RNA Aptamer.
86
Figure 4
Competition Binding Assay to Determine if the Selected Aptamers Share a
Protein Epitope
87
Figure 5
Specificity of 2’FY-5183 and 39SGP1A for sGP.
88
CHAPTER 3
SELECTING A FUNCTIONAL ANTI–VIRAL RNA APTAMER AGAINST
EBOLAVIRUS SURFACE GLYCOPROTEIN
Shambhavi Shubhama,b, Jan Hoinkac, Emma Swansona, Teresa M. Przytyckac,
Wendy Mauryd, and Marit Nilsen-Hamiltona,b
aIowa State University, Ames IA, bAptalogic Inc., Ames IA, cNational Institutes of Health,
Bethesda, DC, dUniversity of Iowa, Iowa City IA
Experimental contributions to manuscript:
SELEX and identification of potential sequences and binding assays to identify oligonucleotide
sequences that bind to GP1,2 Δmucin was done by Shambhavi Shubham.
Analysis of Next Gen Sequencing data was performed by Jan Hoinka alongwith the
identification of top ten clusters.
Emma Swanson performed the binding assays for oligonucleotide sequences that bind to GP1,2
full length.
89
ABSTRACT
Ebola viruses (EBOV) cause severe disease in humans and in non-human primates in the form
of viral hemorrhagic fever. Ebola virus is also of public health concern as a potential
bioterrorism organism for which no vaccine or anti-viral is available. Fast-acting and
prophylactic therapeutics are needed to reduce mortality. In view of the paucity of current
antiviral therapies for EBOV we undertook to select an aptamer against the EBOV surface-
exposed glycoprotein, GP1. Here we described the selection and characterization of several
2’FY RNA aptamers that recognize the GP1,2 heterotrimer. One aptamer recognizes the
heterotrimer with the mucin domain included, which is the form of the protein found on the
circulating virion. Another aptamer recognizes the GP1,2 heterotrimer lacking the mucin
domain of GP1, which is the form of the protein in the endosomes that mediates entry into the
cytoplasm. Thus, these aptamers target the virion in two stages of infection and together might
be effective in preventing the interaction between virus and the host cell and viral entry into
the cytoplasm, thereby reducing viremia and spread of the virus to others.
90
INTRODUCTION
Ebola Virus (EBOV) and Marburg Virus (MARV) are members of the family Filoviridae of
enveloped viruses with a non-segmented negative strand RNA genome. Filoviruses cause
sporadic outbreaks of hemorrhagic fever in human and non-human primates in Africa with
fatality rates up to 90%. Filovirus hemorrhagic fever is associated with high levels of
inflammatory cytokines and coagulation disorders resulting in septic shock and multiorgan
failure (1). The virus is transmitted through contact with bodily fluids and can infect various
cell types across different host species. They typically infect hepatocytes, dendritic cells,
endothelial cells, macrophages, and monocytes (2). The viral genome encodes seven structural
proteins: envelope glycoprotein (GP), major matrix protein (VP40), nucleoprotein (NP),
polymerase cofactor (VP35), replication/transcription protein (VP30), minor matrix protein
(VP24), and RNA dependent DNA polymerase (L) (3). The viral replication cycle involves
attachment of the virus to its receptors, uptake of the virus, intracellular trafficking of the virus
in the endosome and release of the nucleocapsid into the cytoplasm, synthesis of viral proteins,
assembly and budding from the cell surface (4).
Viral glycoprotein (GP1) is a homotrimer, forming spikes on the surface of the virus and is the
only protein on the EBOV viral particle surface. Folding and assembly of GP1 occurs
independently of other viral proteins (5). It is initially synthesized as a precursor that is later
cleaved by the proprotein convertase, furin, into GP1 (140kD) and GP2 (26kD) that are linked
by disulfide bonds (6). The GP2 subunit contains two heptad repeat regions, which facilitate
assembly of GP into trimers, a transmembrane anchor sequence, and the fusion loop (5). The
GP1 subunit contains the receptor binding site and a heavily glycosylated mucin domain. The
91
residues responsible for mediating interactions between GP1 and the host cell are in the 230-
residue N-terminal domain of GP1. The crystal structure of EBOV GP demonstrates that the
receptor binding site of GP1 is masked by the glycan cap created by the mucin domain (7).
Consistent with this structure is the observation that deletion of the C-terminal mucin domain
enhances viral infectivity in vitro (8-10).
Ebola viruses infect a broad range of cells and a host of proteins are known to enhance viral
entry into the host cells including the C-type lectins L-SIGN, DC-SIGN and the tyrosine kinase
receptor Axl (11-14). Infectivity involves at least two recognition events 1) endocytosis at the
host cell surface and 2) cytoplasmic entry in the endosome. The cell surface receptor for EBOV
is believed to be the T-cell immunoglobulin and mucin domain 1 (TIM-1) receptor (15). The
usual function of the TIM-1 receptor is to bind phosphatidyl serine on the surface of apoptotic
cells and facilitate their phagocytosis (16). TIM-1 also facilitates the entry of Dengue Virus by
directly interacting with the virion-associated phosphatidylserine (17). Structural studies of the
TIM immunoglobulin domain have demonstrated that phosphatidyl serine binds in a cavity
built up by the CC’ and FG loops termed the metal ion-dependent ligand binding site (MILIBS)
(17). By contrast with the Dengue virus interaction, TIM-1-mediated Ebola infection depends
on a direct interaction between the viral glycoprotein GP through residues in the ARD5
domain, which is outside of the TIM-1 phosphatidylserine binding pocket and does not include
the MILIBS (15). This specificity was demonstrated by showing that the anti-TIM antibody,
which binds the ARD5 epitope, completely blocked EBOV entry to Vero cells, whereas A6G2
antibody, which prevents TIM-1 binding to phosphatidyl serine, was much less effective in
blocking the viral transduction (15). Co-immunoprecipitation studies also showed that there is
92
direct interaction between Ebola GP and TIM-1 that depends on the receptor binding domain
(15). However, later it was discovered that phosphatidyl serine on the virus surface directly
binds TIM-1 thereby promoting virion internalization (18).
The endosomal receptor for EBOV is believed to be Niemann-Pick C1(NPC1), a lysosomal
cholesterol transporter (19). The binding site for C1(NPC1) is exposed after endosomal
cysteine proteases cleave EBOV GP1 to remove the heavily glycosylated C terminal region to
generate an entry intermediate comprising of the N terminal of GP1 and GP2 (19,20).
Mutations in the C1(NPC1) binding site on GP1 decrease viral entry (19).
In this study, we report the selection and characterization of 2’FY RNA aptamers against
GP1,2 delta mucin and full length GP1,2 glycoproteins. Together these aptamers are expected
to thwart interactions between virion and host at two stages. The GP1,2 delta mucin
conformation with exposed RBD interacts with NPC-1 in the endosome. Therefore, an RNA
aptamer against the GP1,2 delta mucin could intercept the viral host interaction at that step. In
addition, TIM-1 is not expressed by all EBOV permissive cell lines ,(18), which suggests the
occurrence of other unidentified cellular receptors for EBOV. In this situation, an RNA
aptamer against of GP1,2 full length will be effective in preventing viral replication.
RESULTS
SELEX and Analysis
To identify aptamers that bind Ebola GP1,2 we performed two SELEX experiments in which
early rounds selected against the purified recombinant protein and later rounds were against
the protein in the context of the viral particle (Fig. 1). GP1,2 lacking the mucin domain
93
(GP1,2Δmucin) was used in the early rounds of SELEX 1280 and the full length GP1,2 was
used in the early rounds of SELEX 1281 (Fig. 1A,D). In both protocols, later rounds were
selected against Vesicular Stomatitis Virus (VSV) pseudotyped with GP1,2Δmucin
(SELEX1280) or GP1,2 (SELEX1281).Next Gen Sequencing results from both protocols
showed evidence of expanding potential aptamer populations with a reduction in unique
sequences from early to late rounds, which indicates population expansions (Fig. 1B, E). The
progress of oligonucleotide selection evaluated from frequency plots for each round in which
the number (counts) of each base (Y axis) is plotted for each base position in the
oligonucleotide length (X axis). The frequency plots show that a different population emerged
in SELEX1280 after switching the selection from the protein to the virus particles, whereas
this did not happen in SELEX1281 (Fig. 1C, F). We selected the top 10 enriched classes from
each SELEX experiment for further study.
From the SELEX experiments we identified clusters of selected sequences families using the
APTAGUI web application. To further identify which clusters likely contained high affinity
aptamers, oligonucleotides representing the top 10 sequence clusters found for SELEX 1280
were mixed in equal amounts and incubated for 15 min with VSV alone or VSV pseudotyped
with GP1,2Δmucin (RNA/Protein =10:1). The samples were then spun through a sucrose
cushion to separate the RNAs bound to the virus particles from the unbound RNAs. The
collected RNAs were cloned and sequenced. Oligonucleotides 4789 and 4796 were the most
highly represented of oligonucleotides that remained associated with the virus particles through
the sucrose cushion, summing to 47% of the clones from the GP1,2Δmucin-VSV population
(Fig. 2). These oligonucleotides also had the highest selective binding to the GP1,2Δmucin-
94
VSV captured population, being represented 3-4.5 times as much with GP1,2Δmucin-VSV
than with the VSV control particles.
The Dissociation Constant (Kd) of Selected Proto-Aptamers
Oligonucleotides 4789 and 4796 (SELEX 1280), identified from the sucrose centrifugation
assay, were tested for their affinities for the GP1,2 delta mucin recombinant and GP1,2 full
length recombinant proteins using the nitrocellulose filter capture assay. Oligonucleotide 4789
bound GP1,2Δmucin with a Kd of 140nM but did not bind the full length GP1,2 glycoprotein
(Fig. 3A). These results suggest that 4789 binds to an epitope on GP1,2 that is inaccessible in
the presence of mucin domain. The interaction between oligonucleotide 4789 and GP1,2 was
also demonstrated by EMSA in which a shifted band was observed when the RNA was
incubated with GP1,2Δmucin. The specificity of oligonucleotide 4789 binding for
GP1,2Δmucin was also testing with BSA for which no binding was observed. (Fig. 3B).
4797 oligonucleotide sequence appeared in the top clusters of both SELEX 1280 and 1281
and was tested for its binding to GP1,2 full length and GP1,2 delta mucin recombinant protein.
Interestingly, it bound neither protein. This sequence appeared in the top clusters, which were
performed over different time periods. This might be an example of the evolution of a “sticky”
oligonucleotide that binds nonspecifically to many surfaces such as the nitrocellulose
membrane used for particle capture. The “sticky” nature of this oligonucleotide is also
consistent with the observation that 4797 pelleted predominantly with VSV control particle
when passed through a sucrose gradient.
95
Oligonucleotides 5185, 5186, 5187 and 5188 sequences selected in SELEX 1281 in but not in
SELEX 1280 were tested for binding to the GP1,2 full length protein. The affinities (Kd) of
these oligonucleotides were 50 nM, 120 nM, 560 nM and 300 nM for 5185, 5186, 5187 and
5188 respectively. These oligonucleotides tested for binding to the isolated GP1,2 proteins
were further evaluated for their ability to bind virus particles pseudotyped with full-length
GP1,2 and with control virus particles lacking GP1,2. Oligonucleotide 5185 bound GP1,2 full
length glycoprotein with a Kd of 50 nM and it also bound the GP1,2 pseudotyped virus
particles in a titration that achieved saturation. (Fig.4).
DISCUSSION
Aptamers have notable advantages over antibodies that include non-immunogenicity, in-vitro
production and stability (21).A variety of aptamers have been selected to counter host-virus
interactions by targeting different viral proteins (21-23). Examples include: 1) An RNA
aptamer that recognizes HIV-GP120 that effectively neutralizes clinical isolates of HIV (24),
2) Viral RNA-dependent RNA polymerases with basic patches that permit easier selection of
an RNA aptamer (25), and 3) the internal ribosome entry site (IRES), a structured RNA region
in the viral mRNA that binds the ribosome and initiates cap-independent translation to favors
viral protein translation. Aptamers targeting the IRES inhibit IRES-dependent translation of
HCV proteins (26). These cited aptamers were selected to counter host–virus interactions by
targeting viral components.
In this study 2’FY modified RNA aptamers were identified that bind to two conformations of
Ebola glycoproteins which could be used to thwart viral host cell interactions. SELEX 1280
96
was performed against GP1,2 Δmucin and SELEX1281 was performed against full length
GP1,2. We employed Next Gen Sequencing (NGS) of the random region of several SELEX
populations to identify expanding potential aptamer populations. NGS has the advantage over
conventional sequencing that it provides up to 130 million sequence reads and, with barcoding,
multiple rounds can be sequenced simultaneously. In these SELEX experiments, reduction in
unique sequences from 87% to 23% of the total between the 2nd and 5th rounds demonstrated
selection for a subset of sequences. The 9th round involved selection against virus particles and
the frequency plot showed that a different population emerged in this round for SELEX 1280.
This change in dominant populations may be due to the elimination of oligonucleotides that
bound to surfaces on the viral protein other than the protein surface exposed on the virus
particles. In contrast, there wasn’t much increase in the percentage of unique sequences in
round 9. The unique oligonucleotide sequences are expected to be oligonucleotides that bind
weakly to the protein or that do not bind and that were therefore retained through the washing
during filter capture.
For SELEX 1281, 1st, 4th, 5th, 8th and 10th rounds were barcoded by PCR and sequenced. 27
million reads were obtained with same number of sequences obtained from each round. The
uniqueness declined from each round, with the first round having 99.6% in the unique fraction
and the percent of unique sequences reduced with each cycle. The last round of selection had
25.9% unique sequences. Reduction in the unique fraction in both SELEX experiments clearly
suggests that sequences were enriched as we moved along in the selection process. In contrast
to SELEX1281, in which there was change in the frequency plot when the target was changed
97
from protein to virus particle expressing protein, no change in population was observed when
the target was changed from recombinant GP1,2 to virus particles expressing GP1,2.
Our overall goal was to obtain RNA aptamers that can be applied in the blood in which they
must remain associated with the viral particles in the presence of shear stress. Therefore,
selection was performed under conditions that apply sheer to the aptamer-viral complexes. The
RNAs bound to viral particles were spun through a sucrose cushion to identify RNAs retained
on the virus particles after subjection to shear stress. For this assay the top ten potential
aptamers identified from SELEX 1280 were mixed at concentrations to achieve high
RNA/Protein (10:1). Centrifugation was for an hour to select for aptamers that form complexes
with slower koffs (27). The kinetic half-lives of aptamer protein complexes with pM Kd’s
range from 6 min to 60 mins.
Using this method, we selected for oligonucleotides with the sequences 4789 and 4796 that
preferentially bound to the GP1,2Δmucin pseudotyped VSV virus particles. Oligonucleotide
4789 bound to GP1,2 Δmucin with a Kd of 143 nM and it showed concentration dependent
saturation binding against GP1,2Δmucin virus particles. We did not observe any binding with
the VSV control virus particles. From the top clusters obtained from SELEX 1281, we tested
the binding of oligonucleotides 5185, 5186, 5187 and 5188 to full length GP1,2. All the
oligonucleotides bound to full length GP1,2 with different affinities. Among these,
oligonucleotide 5185 bound full length GP1,2 with high affinity (50 nM) Kd and also bound
the GP1,2 pseudotyped virus particles. Thus, from the binding assay and sucrose centrifugation
assay we can conclude that oligonucleotides 4789 and 5185 are sequences that bind to
98
GP1,2Δmucin and full length GP1,2 conformations, in recombinant form and when expressed
on virus particles.
GP1,2 interacts with the NPC-1 receptor in endosome in low pH conditions therefore the next
step in the development of these aptamers will be to test the sensitivity of the aptamer-GP1,2
interaction at low pH. The identified oligonucleotides that bind full-length GP1,2 pseudotyped
virus particles will be tested to determine if they prevent viral replication using an in vitro
transduction assay. Once an aptamer that reduces viral infectivity in vitro has been identified,
the efficacy of these aptamers against the viruses will be determined in an in vivo assay. If
these identified oligonucleotides that bind to the GP1,2 proteins do not prevent viral
transduction they could still be used as drug and anti-viral agent carriers to tag along with the
virus particles and target the cells that are also targeted by the virus (28,29). They could also
be developed for diagnostic purposes (21,30). For EBOV, a rapid diagnosis of infection is
required because, after the appearance of symptoms, the patient succumbs to infection in 10
days. The current methods for diagnosis of EBOV are RT-PCR and ELISA (31). But these are
time consuming assays that require sophisticated and expensive equipment. The necessary
equipment for these assays is generally lacking in regions of EBOV occurrence. Aptamers are
compatible with inexpensive analytical equipment that could be readily used in field to detect
EBOV and other analytes.
99
MATERIALS AND METHODS
SELEX library construction
DNA single stranded oligonucleotide library named 487 was generated
5’CCTGTTGTGAGCCTCCTGTCGAA (53N) TTGAGCGTTTATTCTTGTCTCCC 3’, and
N symbolizes an equimolar mixture of A, C, G and T. It was synthesized by Integrated DNA
Technologies, Coralville, IA. Primers given below were used for reverse transcription and PCR
reactions.
484:5’TAATACGACTCACTATAGGGAGACAAGAATAAACGCTCAA-3’ and
485: 5’-GCCTGTTGTGAGCCTCCTGTCGAA-3.
Conversion of ssDNA SELEX library to dsDNA
To generate a starting RNA pool, an extension reaction was performed using primer
484 and the starting ssDNA pool. 10 reactions of 1000 μL each containing 2uM 487 pool,
3.3uM 484 primer, 0.5 mM dNTP mix, 0.03 U/μL DNA Taq Polymerase (GenScript) in
reaction buffer containing 50 mM KCl, 10 mM Tris-HCl (pH 8.55), 1.5 mM MgCl2, 0.1%
TritonX-100 was incubated at 94°C for 5 min, 65°C for 15 min and 72°C for 99 min using the
Multi GENE II PCR minicycler. The generated dsDNA was run on 2% agarose gel and purified
using Qiagen PCR purification kit. Purified DNA was quantified using a Nanodrop
spectrophotometer.
100
RNA Synthesis and Purification
RNA was prepared by in-vitro transcription using a DurascribeTM T7 transcription kit
(Epicentre, Madison). Around 2 nmole of dsDNA from a pool generated from extension was
incubated with 5 mM ATP, 5 mM GTP, 5 mM 2’FY UTP, 5 mM 2’FY CTP, 5 mM DTT, 0.2
U/μL of T7 polymerase in a total volume of 2.8 mL and 5% DMSO and incubated at 37°C for
4 h. The DNA was then digested with 1MBU of DNAse I and the remaining RNA was resolved
through an 8% (19:1 acrylamide:bisacrylamide) acrylamide gel in 7M urea, Tris Borate EDTA
buffer (TBE buffer 89 mM Tris, 89 mM Boric acid and 2 mM EDTA) pH 9.1 to separate
residual NTPs and abortive transcripts. The transcribed RNA was eluted in 10 mM Tris-HCl,
1 mM EDTA pH 8.0 for 18 h at 37°C and concentrated by ethanol precipitation.
In-Vitro Selection of RNA Aptamers That Bind Ebola Virus Particles and Glycoproteins
SELEX was performed against GP1,2 full length glycoprotein SELEX 1281 and GP1,2
mucin domain deleted glycoprotein (SELEX1280). A ssDNA pool with a complexity of 453
sequences from IDT Technologies was used as starting pool. This pool was designated as 487,
with each draw from the tube identifying the subset of oligonucleotides with a different letter
(487A and 487D were used here). Constant regions that flank the 53-base central region of
random sequence in pool 487 are complementary to primers 484 and 485. In the first round of
SELEX, DNA polymerase catalyzed extension copied the ssDNA to produce dsDNA from the
forward primer TAATACGACTCACTATAGGGAGACAAGAATAAACGCTCAA (484),
which contains a T7 promoter. The DNA was in-vitro transcribed using T7 RNA polymerase,
2’ fluoro-labeled pyrimidine triphosphates, and unmodified purine triphosphates. The resulting
101
complexity was about 1015 RNA sequences. The RNA pool was incubated with the GP1 full
length and mucin domain deleted trimer at a 1:1 ratio and the complexes collected on a
nitrocellulose filter that allowed the free RNA (non-binders) to pass through. RNA bound to
the protein was eluted from nitrocellulose membranes by 7M urea was purified through ethanol
precipitation. Purified RNA was reverse transcribed and the cDNA was amplified by PCR
under conditions that promote low fidelity transcription.
For SELEX 1280 in each of the successive rounds the concentration of the protein was
reduced by 10% to increase the selection stringency. Nine rounds of selection were performed
of which the first 7 rounds were done with soluble trimers followed by three rounds of negative
selections and the final selection was done using GP1,2 pseudotyped VSV virus particles. The
2nd, 5th, 8th and 9th rounds were barcoded by PCR amplification using primers containing the
barcode sequences and obtained 97 million sequences from the sequencing.
Similarly, for SELEX 1281 for each successive round the concentration of protein was
reduced by 10%, 4 rounds of positive selections were performed including negative selections
against the nitrocellulose membrane. 8th and 9th round involved selection against VSV virus
particles pseudotyped with GP1,2 full length glycoprotein. Final 10th round selection was
against virus particles lacking GP1,2 to eliminate nonspecific binders. 1st, 4th, 5th, 8th and 10th
rounds were barcoded by PCR amplification and we obtained 24 million sequences from
sequencing.
102
Filter Capture Assay
To determine the binding affinity of GP1,2 recombinant proteins to RNA aptamers, 5’
32P end labeled RNA was prepared. The 2’FY modified RNA was transcribed using a
Durascribe transcription kit (Epicentre Technologies), separated by electrophoresis through an
8% polyacrylamide gel in the presence of 7 M urea, and eluted from the gel. The RNA was
dephosphorylated by incubation with calf intestine phosphatase for 1 h at 37°C, extracted with
phenol, and precipitated with ethanol. The RNA was 5’ end-labeled with [γ-32P] ATP and T4
polynucleotide kinase. In preparation to determine its binding affinity for GP1,2 and other
proteins, the RNA (2 nM) was incubated at 95°C for 5 min followed by refolding in binding
buffer [137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 2 mM KH2PO4, 5 mM MgCl2 pH 7.4]
at room temperature (RT; 22-24 degree Celsius) for 30 min. The folded RNA was incubated
with varying concentrations of GP1,2 (10 nM-1 μM) at RT for 30 min. The RNA GP1,2
complex was captured by passing the reaction mixture through nitrocellulose membranes
(HAWP 02500) and washing with filters 3 mL of binding buffer. Quantification of
RNA/protein captured on the filter was by liquid scintillation counting. To determine the Kd
the data was fit to F=Fmin+(Fmax*L^n)/(L^n+Kd^n) (32).
Electrophoretic Mobility Shift Assay (EMSA)
Binding reactions performed with 5’ end labeled RNA that is first denatured at 95°C
for 5 min followed by slow cooling in binding buffer (137 mM NaCl, 2.7 mM KCl, 10 mM
Na2HPO4, 2 mM KH2PO4, 5 mM MgCl2, pH 7.4) for 30 min. 5uM Refolded RNA was
incubated with 0.5uM of recombinant GP1,2 delta mucin or 0.5uM BSA in binding buffer for
103
30 min at room temperature. Mixtures were analyzed for complex formation by resolving them
through a 6% (37.5:1 acrylamide:bisacrylamide) )native polyacrylamide gels run in Tris
Acetate EDTA buffer (6.75 mM TrisCl, 1 mM EDTA, 3.3 mM sodium acetate) (pH 7.4) @
200V followed by quantification of the 32P on the gel using an X ray film.
Determination of Total Protein and Percent Glycoprotein on Virus Particles
Total viral protein content was measured using Bradford assay using a standard series
of BSA concentrations 1:150 dilutions of GP1,2 pseudotyped virus particles (in duplicates).
The pseudotyped virus particles were also resolved by 10% SDS PAGE along with a known
concentration of recombinant EBOV GP1, 2 (Purchased from BPS biosciences). The gels were
stained with Coomassie blue and the bands quantified by Image J. The amount of GP1,2 in the
particles was determined relative to the control the GP1,2 control and then converted to a
percent of total protein on the virus particles using the results from the Bradford (Coomassie
blue) assay for total protein.
ACKNOWLEDGEMENT
Financial support for this study was provided by NIH grant R21AI106329-01 to MNH.
104
LEGENDS TO FIGURES
Figure 1 Comparison of top 10 sequences from SELEX experiments to select aptamers
that recognize GP1,2Δmucin and full length GP1,2
A,D) Flow charts depicting the sequential selection steps for each SELEX experiment.
Downward arrows represent positive selection steps and horizontal arrows represent negative
selections. B,E) Frequency chart of SELEX 1280 (B) and SELEX 1281 (E) depicting the
frequency of singletons, enriched and unique fraction. C,F) Frequency chart of the random
region of each round of SELEX 1280 (C) and SELEX 1280 (F)
Figure 2 Selection through a sucrose cushion
The oligonucleotides listed in the abscissa were spun through a 20% sucrose cushion in the
presence of either control VSV particles or VSV particles pseudotyped with GP1,2Δmucin.
The oligonucleotides in the pellet were sequenced to determine the fractional frequency of
each oligonucleotide. The dashed at 0.1 represents the fractional frequency expected if an
oligonucleotide were not preferentially pelleted with the particle. The asterisks identify two
oligonucleotides that preferentially pelleted with the VSV particles pseudotyped with
GP1,2Δmucin
Figure 3 Filter capture assay to estimate the affinity of oligonucleotide 4789 for
GP1,2Δmucin
A) Titration of full length GP1,2 and GP1,2Δmucin recombinant proteins against 2 nM 32P-
4789 2’FY-RNA by filter capture assay to establish the Kds, which was ND (not determined)
for GP1,2 and 143nM GP1,2Δmucin, respectively B) EMSA analysis with 5uM 32P-4789
105
2’FY-RNA and 0.5 μM BSA, 0.5 μM GP1,2 delta mucin or 64 ng/ul VSV –GP1,2Δmucin
virus particles. The arrows show the positions of the mobility shifted RNA associated with
virus particles (V) and recombinant protein (P). C) Titration of GP1,2Δmucin-pseudotyped
VSV virus particles or VSV virus particles lacking GP1,2 against 10nM 32P-4789 2’FY-RNA
by filter capture.
Figure 4 Filter capture assay to determine the affinity of oligonucleotide 5185 and 5187
for GP1,2
A) Titration of full length GP1,2 against 10 nM 32P-5185 2’FY RNA measured by the filter
capture assay from which the estimated Kd was 50nM. B) Titration of full length GP1,2
pseudotyped VSV particles against 10 nM 32P-5185 2’FY RNA measured by the filter capture
assay. C) Titration of full length GP1,2 against 10 nM 32P-5187 2’FY RNA measured by the
filter capture assay from which the estimated Kd was 560nM.
106
REFERENCES
1. Dolnik, O., Kolesnikova, L., and Becker, S. (2008) Filoviruses: Interactions with the
host cell. Cell Mol Life Sci 65, 756-776
2. Aleksandrowicz, P., Wolf, K., Falzarano, D., Feldmann, H., Seebach, J., and Schnittler,
H. (2008) Viral haemorrhagic fever and vascular alterations. Hamostaseologie 28, 77-
84
3. Feldmann, H., Jones, S., Klenk, H. D., and Schnittler, H. J. (2003) Ebola virus: from
discovery to vaccine. Nat Rev Immunol 3, 677-685
4. Noda, T., Ebihara, H., Muramoto, Y., Fujii, K., Takada, A., Sagara, H., Kim, J. H.,
Kida, H., Feldmann, H., and Kawaoka, Y. (2006) Assembly and budding of Ebolavirus.
PLoS Pathog 2, e99
5. Sanchez, A., Yang, Z. Y., Xu, L., Nabel, G. J., Crews, T., and Peters, C. J. (1998)
Biochemical analysis of the secreted and virion glycoproteins of Ebola virus. J Virol
72, 6442-6447
6. Volchkov, V. E., Feldmann, H., Volchkova, V. A., and Klenk, H. D. (1998) Processing
of the Ebola virus glycoprotein by the proprotein convertase furin. Proc Natl Acad Sci
U S A 95, 5762-5767
7. Lee, J. E., and Saphire, E. O. (2009) Ebolavirus glycoprotein structure and mechanism
of entry. Future Virol 4, 621-635
8. Manicassamy, B., Wang, J., Jiang, H., and Rong, L. (2005) Comprehensive analysis of
ebola virus GP1 in viral entry. J Virol 79, 4793-4805
107
9. Jeffers, S. A., Sanders, D. A., and Sanchez, A. (2002) Covalent modifications of the
ebola virus glycoprotein. J Virol 76, 12463-12472
10. Brindley, M. A., Hughes, L., Ruiz, A., McCray, P. B., Jr., Sanchez, A., Sanders, D. A.,
and Maury, W. (2007) Ebola virus glycoprotein 1: identification of residues important
for binding and postbinding events. J Virol 81, 7702-7709
11. Ji, X., Olinger, G. G., Aris, S., Chen, Y., Gewurz, H., and Spear, G. T. (2005) Mannose-
binding lectin binds to Ebola and Marburg envelope glycoproteins, resulting in
blocking of virus interaction with DC-SIGN and complement-mediated virus
neutralization. J Gen Virol 86, 2535-2542
12. Takada, A., Fujioka, K., Tsuiji, M., Morikawa, A., Higashi, N., Ebihara, H., Kobasa,
D., Feldmann, H., Irimura, T., and Kawaoka, Y. (2004) Human macrophage C-type
lectin specific for galactose and N-acetylgalactosamine promotes filovirus entry. J
Virol 78, 2943-2947
13. Simmons, G., Reeves, J. D., Grogan, C. C., Vandenberghe, L. H., Baribaud, F.,
Whitbeck, J. C., Burke, E., Buchmeier, M. J., Soilleux, E. J., Riley, J. L., Doms, R. W.,
Bates, P., and Pohlmann, S. (2003) DC-SIGN and DC-SIGNR bind ebola glycoproteins
and enhance infection of macrophages and endothelial cells. Virology 305, 115-123
14. Brindley, M. A., Hunt, C. L., Kondratowicz, A. S., Bowman, J., Sinn, P. L., McCray,
P. B., Jr., Quinn, K., Weller, M. L., Chiorini, J. A., and Maury, W. (2011) Tyrosine
kinase receptor Axl enhances entry of Zaire ebolavirus without direct interactions with
the viral glycoprotein. Virology 415, 83-94
108
15. Kondratowicz, A. S., Lennemann, N. J., Sinn, P. L., Davey, R. A., Hunt, C. L., Moller-
Tank, S., Meyerholz, D. K., Rennert, P., Mullins, R. F., Brindley, M., Sandersfeld, L.
M., Quinn, K., Weller, M., McCray, P. B., Jr., Chiorini, J., and Maury, W. (2011) T-
cell immunoglobulin and mucin domain 1 (TIM-1) is a receptor for Zaire Ebolavirus
and Lake Victoria Marburgvirus. Proc Natl Acad Sci U S A 108, 8426-8431
16. Kobayashi, N., Karisola, P., Pena-Cruz, V., Dorfman, D. M., Jinushi, M., Umetsu, S.
E., Butte, M. J., Nagumo, H., Chernova, I., Zhu, B., Sharpe, A. H., Ito, S., Dranoff, G.,
Kaplan, G. G., Casasnovas, J. M., Umetsu, D. T., Dekruyff, R. H., and Freeman, G. J.
(2007) TIM-1 and TIM-4 glycoproteins bind phosphatidylserine and mediate uptake of
apoptotic cells. Immunity 27, 927-940
17. Meertens, L., Carnec, X., Lecoin, M. P., Ramdasi, R., Guivel-Benhassine, F., Lew, E.,
Lemke, G., Schwartz, O., and Amara, A. (2012) The TIM and TAM families of
phosphatidylserine receptors mediate dengue virus entry. Cell Host Microbe 12, 544-
557
18. Moller-Tank, S., Kondratowicz, A. S., Davey, R. A., Rennert, P. D., and Maury, W.
(2013) Role of the phosphatidylserine receptor TIM-1 in enveloped-virus entry.
Journal of virology 87, 8327-8341
19. Miller, E. H., Obernosterer, G., Raaben, M., Herbert, A. S., Deffieu, M. S., Krishnan,
A., Ndungo, E., Sandesara, R. G., Carette, J. E., Kuehne, A. I., Ruthel, G., Pfeffer, S.
R., Dye, J. M., Whelan, S. P., Brummelkamp, T. R., and Chandran, K. (2012) Ebola
virus entry requires the host-programmed recognition of an intracellular receptor.
EMBO J 31, 1947-1960
109
20. Chandran, K., Sullivan, N. J., Felbor, U., Whelan, S. P., and Cunningham, J. M. (2005)
Endosomal proteolysis of the Ebola virus glycoprotein is necessary for infection.
Science 308, 1643-1645
21. Binning, J. M., Leung, D. W., and Amarasinghe, G. K. (2012) Aptamers in virology:
recent advances and challenges. Front Microbiol 3, 29
22. James, W. (2007) Aptamers in the virologists' toolkit. J Gen Virol 88, 351-364
23. Gopinath, S. C. (2007) Antiviral aptamers. Arch Virol 152, 2137-2157
24. Khati, M., Schuman, M., Ibrahim, J., Sattentau, Q., Gordon, S., and James, W. (2003)
Neutralization of infectivity of diverse R5 clinical isolates of human immunodeficiency
virus type 1 by gp120-binding 2'F-RNA aptamers. J Virol 77, 12692-12698
25. Biroccio, A., Hamm, J., Incitti, I., De Francesco, R., and Tomei, L. (2002) Selection of
RNA aptamers that are specific and high-affinity ligands of the hepatitis C virus RNA-
dependent RNA polymerase. J Virol 76, 3688-3696
26. Kikuchi, K., Umehara, T., Fukuda, K., Kuno, A., Hasegawa, T., and Nishikawa, S.
(2005) A hepatitis C virus (HCV) internal ribosome entry site (IRES) domain III-IV-
targeted aptamer inhibits translation by binding to an apical loop of domain IIId.
Nucleic Acids Res 33, 683-692
27. Klussman, S. (ed) (2005) The Aptamer Handbook, Wiley-VCH
28. Neff, C. P., Zhou, J., Remling, L., Kuruvilla, J., Zhang, J., Li, H., Smith, D. D.,
Swiderski, P., Rossi, J. J., and Akkina, R. (2011) An aptamer-siRNA chimera
suppresses HIV-1 viral loads and protects from helper CD4(+) T cell decline in
humanized mice. Sci Transl Med 3, 66ra66
110
29. Farokhzad, O. C., Karp, J. M., and Langer, R. (2006) Nanoparticle-aptamer
bioconjugates for cancer targeting. Expert Opin Drug Deliv 3, 311-324
30. Zhai, L., Wang, T., Kang, K., Zhao, Y., Shrotriya, P., and Nilsen-Hamilton, M. (2012)
An RNA aptamer-based microcantilever sensor to detect the inflammatory marker,
mouse lipocalin-2. Anal Chem 84, 8763-8770
31. Saijo, M., Niikura, M., Ikegami, T., Kurane, I., Kurata, T., and Morikawa, S. (2006)
Laboratory diagnostic systems for Ebola and Marburg hemorrhagic fevers developed
with recombinant proteins. Clin Vaccine Immunol 13, 444-451
32. Huang, H., Suslov, N. B., Li, N.-S., Shelke, S. A., Evans, M. E., Koldobskaya, Y., Rice,
P. A., and Piccirilli, J. A. (2014) A G-quadruplex–containing RNA activates
fluorescence in a GFP-like fluorophore. Nature chemical biology 10, 686-691
111
Figure 1
Comparison of top 10 sequences from SELEX experiments to select aptamers that
recognize GP1,2Δmucin and full length GP1,2 .
112
Figure 2
Selection through a sucrose cushion
113
Figure 3
Filter capture assay to estimate the affinity of oligonucleotide 4789 for GP1,2Δmucin
114
Figure 4
Filter capture assay to determine the affinity of oligonucleotide 5185 and 5187 for GP1,2
115
CHAPTER 4
CONCLUSION AND DISCUSSION
Ebola viruses are highly pathogenic viruses that infect humans and non-human
primates with very high mortality rates. The first Ebola virus outbreak was reported in 1976
and there have been sporadic outbreaks reported over the years. However, there still aren’t any
commercially available vaccine or therapeutic drugs against Ebola viruses. During the
devastating outbreak of Ebola Viruses in 2014, many candidate vaccines were introduced and
are still in clinical trials. In addition to vaccines, several therapeutic drugs against Ebola virus
were also expeditiously put under investigation for efficacy that are still in clinical trials. Aside
from the lack of tested therapeutics for Ebola virus, another pressing concern is the inability to
detect early virus infections. The available diagnostic kits are mostly antibody based and detect
the serum antibodies against Ebola virus, which take time to appear, or the viral RNA, which
requires correct timing of blood sampling. [1, 2]. Due to limitations, such as those just
mentioned, associated with the current detection kits there is still a need for robust, cost
effective and sensitive technique for early detection of Ebola viruses. Aptamers have been
established as a potent alternative to antibodies. Several aptamers have been selected by others
to function either as an antiviral or for biomolecule detection [3-5].
This thesis describes efforts to select and characterize 2’FY-RNA aptamers to Ebola
Glycoproteins (sGP and GP1,2) with the expectation that the aptamers will have applications
for intervention of viral host interaction and/or integration onto a biosensor platform. We chose
the full-length GP1,2 recombinant protein, GP1,2 mucin domain deleted glycoprotein and sGP
116
as the target proteins for selection to obtain aptamers that could target both the surface exposed
GP1,2 and the intracellular mucin domain deleted GP1,2. Three SELEX experiments were
performed 1280 (GP1,2Δmucin), 1281 (full-length GP1,2) and 1282 (sGP). Each SELEX
experiment was performed using an oligonucleotide pool with a 53-nucleotide random region.
Three separate pools were used and at different time intervals. Enrichment of unique clusters
was evident in all three SELEX experiments when the frequency plots of initial round pool and
final round pool was compared. A sequence comparison of the results of the three SELEX
experiments revealed identical sequences in all three. Most of the sequences in SELEX 1281
(Chapter 3) and SELEX 1282 (Chapter 2) were identical. Oligonucleotide (4797) was found
in all three selections but bound none of the targets. Thus, oligonucleotide 4797 is likely to
bind the background matrix that was common to all three SELEX experiments. One reason for
the appearance of identical sequences in 1281 and 1282 was the similar tertiary structures of
full length GP1,2 and sGP.
The observation of the same sequences appearing in two SELEX experiments was
unexpected and led to the question of the probability that same sequence could appear in two
separate DNA pools in the absence of evolution of the sequences driven by selection. The
probability of having oligonucleotides with identical sequences in separate pools is very low.
The frequency plots of the RNA pools were 99% unique, which eliminates the hypothesis that
sequences of oligonucleotides in the starting pools were redundant due to bias in the synthesis
step. Another source of bias could be in the sequencing step. The complexity of the pool is
1015 oligonucleotides representing a subset of the possible 1031 sequences and the NGS results
average a million reads per pool. Other points of bias that could increase the representation of
117
certain sequences are the transcription and PCR steps. However, none of these sources of bias
provide a credible explanation for the fact that many of the same sequences were isolated in
two independently run SELEX experiments, which started with different RNA pools. The
results could be explained by the combination of selection against target and the variations in
sequence imposed by low fidelity amplification protocol. If this is the explanation, it also
suggests that the initial selections (round 1 and 2) are very efficient in capturing
oligonucleotides with some affinity for the target. The remaining rounds of SELEX may be
dominated by the evolution of sequences due to errors in replication and transcription, which
expands the oligonucleotide populations that bind with high affinity. These results also suggest
that the selected aptamers are either unique or amongst very few possible oligonucleotides that
are capable of binding sGP with high affinity.
Chapter 2 discusses the selection of high affinity 2’F RNA aptamers that bind to sGP
with high affinity and specificity. MEME software was used to search for sequence structure
motifs in the oligonucleotides for which sequences were found in the SELEX 1281 and
SELEX1282 top clusters. We identified polyU rich sequences in the selected oligonucleotides
from both SELEX experiments. Poly U rich sequences are known to bind intracellular
regulatory RNA binding proteins [6]. We found that the oligonucleotides 5177, 5182, 5183
and 5179 with poly U rich sequences bound sGP with high affinity, whereas oligonucleotides
4789 and 5181 lacking poly U rich sequences bound with low affinity. We tested the
dependency on 2’FY modification for high affinity binding and found that unmodified 2’OH,
5183 RNA did not bind sGP. From this result, we concluded that binding of oligonucleotide
5183 to sGP depends on the 2’fluoro modification of the pyrimidines. This observation is
118
consistent with earlier reports of enhanced affinity of RNA aptamers to target proteins due to
2’F modification [7].
To identify the aptamer sequence in the larger 5183 oligonucleotide, oligonucleotides
with sequences that were truncations of the parent 5183 sequence were tested for binding to
sGP. These results confirmed the central role of the polyU-rich loop in binding sGP as the
truncated 39mer containing the hairpin U loop sequence bound sGP most effectively. This
39mer was demonstrated to bind sGP with high affinity and was given the aptamer name
39SGP1A. Our long-term goal is to integrate the selected aptamer on a detection platform.
Therefore, we tested the affinities of this aptamer for the serum proteins, human serum
albumin, fibrinogen and α2-macroglobulin.
It is important for the application of 39SGP1A to diagnostics that it not bind to other
proteins in the blood. The parent proto-aptamer, 5183 binds sGP with a Kd of 400 nM
compared with a Kd of 40 nM for sGP. The concentration of human serum albumin (HSA) in
blood is 300 μM, which means that the 5183 oligonucleotide would be saturated with HSA if
incubated with a sample of serum. However, once the sGP binding element was isolated to the
poly U stem and 5183 truncated to create the aptamer 39SGP1A there was no remaining
affinity for HSA.
In chapter 3, for selections against GP1,2 in SELEX 1280 and 1281 no conserved
sequence structural motif was found. Therefore, the affinity of oligonucleotides with sequences
in the SELEX 1280 selected families and unique sequences from SELEX 1281 were tested for
binding to GP1,2 with and without the mucin domain attached. From these tests,
oligonucleotide 4789 was found to bind GP1,2Δmucin with high affinity whereas it did not
119
bind the full length GP1,2 glycoprotein. This oligonucleotide also bound sGP (Chapter1).
Therefore, oligonucleotide 4789 appears to bind a domain that is common between sGP and
GP1,2Δmucin, which is in the N terminal portion of the GP1,2 protein sequence. The N
terminal region of GP1,2 and sGP is the conserved receptor binding domain suggesting that
4789 binds the receptor binding domain of the glycoprotein. This aptamer might have the
capability of intercepting viral host interactions. Tests of other oligonucleotides selected in
SELEX 1281for binding to the full length GP1,2 (including the mucin domain) identified two
sequences 5185 and 5187 that bound the full length GP1,2 and virus particles pseudotyped
with the full length GP1,2.
My thesis describes the development and characterization of sGP and GP1,2 specific
2’FY-modified RNA aptamers. Additional studies are needed to determine if the aptamers
selected against GP1,2 might provide therapeutic options. First, the specificity of these 2’FY-
RNA aptamers must be determined by testing their ability to bind other proteins and to bind
GP1,2 in the presence of blood proteins. The selected aptamers to full length GP1,2 could
target extracellular virus and the aptamers that recognize GP1,2 lacking the mucin domain
might target the cleaved GP1,2 protein in the endosome. Because Ebola viruses have GP1,2
independent mechanisms for entry, full length GP1,2 and GP1,2Δmucin aptamer chimeras
could be effective. The GP1,2 RNA aptamer when bound with full length GP1,2 glycoprotein
can facilitate the entry of both aptamers into the endosomes where the second aptamer to
GP1,2Δmucin could thwart viral entry into the cytoplasm. The challenge at this step could be
if these aptamers are unable to survive low pH endosomal conditions, which has not yet been
tested. An alternative approach could be to conjugate these aptamers to known therapeutic
120
drugs for intervention of viral entry. An aptamer that neutralizes EBOV will provide a means
for rapid, albeit transient, protection as a stop-gap measure prior to further treatment including
isolation of the infected individual from others who might be susceptible.
Our future goal for the selected aptamer 39SGP1A is to use it to detect sGP. The
aptamer will be integrated onto microcantilever a platform that is equipped with a system to
detect RNA aptamer-sGP interaction with high sensitivity and specificity such as was
previously demonstrated with mouse lipocalin-2 [8] . Although, we have tested the aptamers
for its specificity against human serum albumin, there are many known proteins present at
various concentrations in the serum. Therefore, binding of these aptamers to sGP in the
presence of serum should be evaluated. Aptamer efficiency is also determined by its tertiary
folding, therefore following the integration of the selected aptamer onto a platform, it must be
ensured that folding of the aptamer hasn’t been compromised.
In summary, the work presented in this thesis focuses on the selection and
characterization of 2’FY-RNA aptamers against Ebola viral glycoproteins. Results from the
selections reveal various important factors responsible for the selection of high affinity
aptamers. These include considerations with respect to designing the pool, ensuring evolution
of oligonucleotide sequences and the importance of the 2’F modification in mediating high
affinity interactions with proteins. These studies resulted in the identification of aptamers that
bind sGP and GP1,2, which can be developed as antivirals or for detection of Ebola virus.
121
REFERENCES
1. Ksiazek, T.G., et al., ELISA for the detection of antibodies to Ebola viruses. The Journal
of infectious diseases, 1999. 179(Supplement_1): p. S192-S198.
2. Su, S., et al., Diagnostic strategies for Ebola virus detection. The Lancet Infectious
Diseases, 2016. 16(3): p. 294-295.
3. Gopinath, S.C., Antiviral aptamers. Arch Virol, 2007. 152(12): p. 2137-57.
4. Bruno, J.G., Predicting the Uncertain Future of Aptamer-Based Diagnostics and
Therapeutics. Molecules, 2015. 20(4): p. 6866-6887.
5. Szpechciński, A. and A. Grzanka, [Aptamers in clinical diagnostics]. Postepy
biochemii, 2005. 52(3): p. 260-270.
6. Kanai, A., K. Tanabe, and M. Kohara, Poly (U) binding activity of hepatitis C virus
NS3 protein, a putative RNA helicase. FEBS letters, 1995. 376(3): p. 221-224.
7. DEY, A.K., et al., Structural characterization of an anti-gp120 RNA aptamer that
neutralizes R5 strains of HIV-1. Rna, 2005. 11(6): p. 873-884.
8. Zhai, L., et al., An RNA aptamer-based microcantilever sensor to detect the
inflammatory marker, mouse lipocalin-2. Anal Chem, 2012. 84(20): p. 8763-70.