Post on 28-Nov-2014
description
transcript
2. www.neuromds.com/lohe-faqs_ brain _ tumors .htm Brain Tumor 3. BRAIN TUMORS
4. Background
5. BENIGN BRAIN TUMORS
6. MALIGNANT BRAIN TUMORS
7. TYPES OF BRAIN TUMORS:
8. Symptoms
9. Glioma
10. Astrocytoma
11. Oligodendrogliomas
12. Ependymomas
13. WHO GETS BRAIN TUMORS?
14. Bain Cancers in Adults
15. Stem Cells in the Nervous System 16. Brain tumor stem cells were identified by intracranial transplantation ofCD133 +cells into adult NOD/SCID mouse forebrain. Singh et al. 2004 Nature 432: 396-401 CD133 + CD133 + CD133 - 17. CD133 neuronal stem cell marker Brain tumor stem cells were identified from human brain tumor samples byin vitroneurosphere assays normally used to isolate normal neural stem cells Singh et. al2003 Cancer Research 63: 5821-5828. GFAP = glial fibrillary acidic protein Brain Tumor Stem Cells: CD133 + 18. Risk Factors
19. Malignant neoplasms of the brain and central nervous system
20. Electric and Magnetic Field Exposure and Brain Cancer
21. Environmental exposures Ionizing radiation N - nitrosocompounds Pesticides Tobacco Electromagnetic frequencies Infectious agents Trauma Parental occupation Medications Vitamins 22. Childhood Brain Tumors (CBT)
23. Childhood Cancers
24. Childhood Cancers
25. Childhood Cancers
26. Susceptibility Refers to something that has responsiveness and sensitivity; susceptibility genes confer a higher than normal risk associated with some pathology. Source: http://www.niehs.nih.gov/engenom/glossary.htm Gene-Environment Interaction The interaction between specific environmental exposure(s) and a specific gene (or genes) and their subsequent impact on human health. 27. Few genetic studies exist on pediatric brain tumors, in part because tissue from low-grade and brain stem tumors is not readily available, and also because individual centers have relatively few cases.Genetic changes in infiltrating astrocytomas involve genes in the p53 and RB pathways, and show alterations that are similar to infiltrating astrocytomas in adults.The PTC gene is mutated in a subgroup of medulloblastomas, and may lead to increased proliferation in granule cells that normally express this receptor.Further studies are needed to identify genetic alterations in pilocytic and low-grade astrocytomas, which account for 40% of brain tumors in children. 28. The absence of the tumor suppressor gene p53 has been demonstrated to play a role in the development of brain tumors in mice exposed transplacentally to a neurocarcinogen. When p53 heterozygous pregnant mice were administered intraperitoneal injections of ENU, 70% of the p53 null offspring rapidly developed primary brain tumors of glial origin ( Odaet al., 1997 ). 29. Inactivation of the common tumor suppressor protein p53 is believed to contribute to brain carcinogenesis in human astrocytomas and glioblastomas ( Santariuset al., 1997 ;ShiraishiandTabuchi , 2003andZupanskaandKaminska , 2002 ).Approximately one-third of malignant pediatric gliomas have mutations of p53, and these mutations are much less common in individuals under the age of three ( ShiraishiandTabuchi , 2003 ).P53 gene mutations and increased expression of the p53 protein are associated with shorter survival in these patients. 30. It has been demonstrated that adult glioblastomas can have amplification of the epidermal growth factor receptor (EGFR), mdm2, cyclin-dependent kinase 4 (CDK4), and platelet-derived growth factor receptor (PDGFR) (Di Sapio et al., 1992). One histochemical evaluation of pediatric astrocytic gliomas showed a pattern, similar to adults, of mutually exclusive p53 mutation or (EGFR) amplification (Di Sapio et al., 1992). There was minimal or no amplification of the genes for PDGFR, mdm2, and CDK4.In another histochemical study, 80% of high-grade pediatric gliomas were found to have EGFR activity, but only 7% had gene amplification ( Bredelet al., 1999 ).In a similar study of pediatric high-grade astrocytoma (anaplastic astrocytoma and glioblastoma), investigators found p53 mutations in 53% of the tumors and EGFR amplification in none, a pattern that differs from adult malignancies and some of the other results reported ( Cheng et al., 1999 ). 31. In adult tumors, ependymomas are associated with a loss of 22q ( Santariuset al., 1997 ) and rarely with p53 mutations, but when present, altered p53 expression is only found in high-grade ependymomas ( ShiraishiandTabuchi , 2003 ).Neurofibromatosis (NF) is linked to alterations in the tumor suppressor NF 1 and 2 genes on chromosomes 17q and 22q, respectively ( Santariuset al., 1997 ).Mutations in the von Hippel Lindau disease gene located on 3p are found with hemangioblastomas ( Santariuset al., 1997 ). 32. L oss of 17p Material in Childhood CNStumours I sochromosome17q inMedulloblastoma L oss of 22q Material in Childhood CNStumours - ERBB2 and ChildhoodMedulloblastoma 17q11.2-q12ERBB2( HER2 , NEU )- ChildhoodGliomaand NF1 17q11.2NF1 - NTRK3 andMedulloblastoma 15q25NTRK3( TRKC )10q25.1NEURL( H-NEU )- PTEN andastrocytoma 10q23.3PTEN( MMAC1 , MHAM , BZS )- PTCH andMedulloblastoma 9q22.3PTCH( PTC )- MYC andMedulloblastoma 8q24.12-q24.13MYC( CMYC , C-MYC )- VIPR2 Expression in Childhood PNET 7q36.3VIPR2 - VIPR1 Expression in Childhood PNET 3p22VIPR1( RCD1 , HVR1 )- ERBB4 and ChildhoodMedulloblastoma 2q34ERBB4 - GLUT1 Expression inEmbryonalCNSTumours 1p35-p31.3SLC2A1( GLUT1 )Topics Location Gene Mutated Genes and Abnormal Protein Expression 33. http://www.ehponline.org/members/2005/7986/7986.html The enzyme-aminolevulinic acid dehydratase (ALAD) , which catalyzes the second step of heme synthesis, can be inhibited by several chemicals, including lead, a potential risk factor for brain tumors, particularly meningioma. In this study we examined whether theALAD G177Cpolymorphism in the gene coding for ALAD is associated with risk of intracranial tumors of the brain and nervous system. We use data from a case-control study with 782 incident brain tumor cases and 799 controls frequency matched on hospital, age, sex, race/ethnicity, and residential proximity to the hospital. Blood samples were drawn and DNA subsequently sent for genotyping for 73% of subjects.ALADgenotype was determined for 94% of these samples (355 glioma, 151 meningioma, 67 acoustic neuroma, and 505 controls) . Having one or more copy of theALAD2allele was associated with increased risk for meningioma [odds ratio (OR) = 1.6 ; 95% confidence interval (CI) , 1.0-2.6], with the association appearing stronger in males (OR = 3.5 ; 95% CI, 1.3-9.2) than in females (OR = 1.2 ; 95% CI, 0.7-2.2) . No increased risk associated with theALAD2variant was observed for glioma or acoustic neuroma. These findings suggest that theALAD2allele may increase genetic susceptibility to meningioma.Key words: ALAD ,brain ,case-control ,meningioma ,polymorphism ,tumor .Environ Health Perspect113:1209-1211 (2005) . doi:10.1289/ehp.7986 available viahttp:// dx.doi.org /[Online 10 May 2005] 34. They found that theALAD2allele of the G177C polymorphism was associated with increased risk of meningioma, especially in males. Confirmation of their findings will require replication in other studies with a larger number of meningioma cases. If risk of meningioma is truly increased in individuals with theALAD2allele, the question arises as to whether the effect depends upon exogenous chemical exposures that act on the heme synthesis pathway or is independent of such exposures. A direct effect of theALAD2polymorphism might be indicated if theALAD2allele has lower enzyme activity than theALAD1allele, given that the precursor ALA is thought to be neurotoxic and genotoxic (Silbergeld 2003). However, ALAD enzyme activity does not appear significantly different for the two alleles (Battistuzzi et al. 1981). Alternatively, it is possible that the increased risk of meningioma inALAD2individuals arises in the presence of chemicals that influence the heme synthesis pathway. Several chemicals have been shown to inhibit ALAD enzyme activity, including lead, trichloroethylene, bromobenzene, and styrene (Fujita et al. 2002). Polymorphic differences in enzyme binding or chemical uptake have been examined most extensively for lead, and individuals with theALAD2allele are generally reported to have higher blood lead levels than are individuals with theALAD1allele (Alexander et al. 1998; Bergdahl et al. 1997; Fleming et al. 1998; Hsieh et al. 2000; Shen et al. 2001; Wetmur et al. 1991; Ziemsen et al. 1986). 35. Probe1 (TGTGAAGCGGCTGG), specific to theALAD1allele, contained the FAM dye reporter. Probe 2 (TGTGAACCGGCTGG) was specific to theALAD2allele and contained the VIC dye reporter. The primers used were primers F (TGCCTTCCTTCAACCCCTCTA) and R (CAAGGGCCTCAGCATCTCTT). Step 1 of the assay-specific thermocycling process involved 2 min of UNG (uracil-DNA glycosylase) activation using AmpErase UNG (Applied Biosystems) at 50C. This was followed by 10 min of enzyme activation at 95C (step 2), 0.30 sec of template denaturation at 92C if using 3MGB quencher, or at 95C if using 3TAMRA quencher (step 3), and 1 min of assay-specific annealing at 60C (step 4). Steps 3 and 4 were repeated 49 times, after which the reaction was held at 4C. The plate was then read on the ABI 7900HT sequence detection system (Applied Biosystems), and the results of the allelic discrimination were graphed as a scatter plot of allele 1 reaction versus allele 2 reaction (SDS Software; Applied Biosystems), with each well of the 384-well plate represented as a spot on the graph. Four distinct clusters on the allelic plot represented the NTCs and three possible genotypes,ALAD1-1 ,ALAD2-2,andALAD1-2 , respectively. 36. Four distinct clusters on the allelic plot represented the NTCs and three possible genotypes,ALAD1-1 ,ALAD2-2,andALAD1-2 , respectively.Using a conservative call strategy that labeled a call as missing if the genotype was unclear,ALADgenotyping was successfully conducted for 94% of samples (93% of gliomas, 96% of meningiomas, 94% of acoustic neuromas, and 94% of controls). Missing values (noncalls) were generally equally likely to be from case or control samples. 37. Statistical analysis.We assessed statistically significant departure from Hardy-Weinberg equilibrium for controls using the chi-square test. Unconditional logistic regression was used to estimate odds ratios (ORs) and calculate 95% confidence intervals (CIs) for the effect of the variantALAD2allele, adjusting for study matching factors. We entered adjustment variables as indicator variables in the following categories: age in years (18-29, 30-39, 40-49, 50-59, 60-69, 70-79, 80-99); race/ethnicity (non-Hispanic white, Hispanic, African-American, other); sex (male, female); hospital (Phoenix, Boston, Pittsburgh); and residential proximity to the hospital in miles (0-4, 5-14, 15-29, 30-49, 50). Because the small number ofALAD2-2homozygotes precluded accurate estimation of risk forALAD1-2heterozygotes andALAD2-2homozygotes separately, these categories were combined for analysis.ALAD1-1homozygotes were the reference group. 38. 39. 40. Glutathione S-transferases GSTM1, GSTT1, and GSTP1 are phase II biotransformation enzymes that function on detoxification of a wide range of exogenous agents including carcinogens. In this study, the association between polymorphisms in these genes and primary brain tumor incidence was investigated in 228 Turkish individuals (75 patients with primary brain tumor and 153 controls). The prevalence of GSTM1 null genotype in the case group was 43%, compared to 24% in the control group, giving an odds ratio (OR) of 2.33 (95% confidence interval CI=1.24-4.39). No association was observed between the GSTT1 or GSTP1 Ile105Val polymorphism and brain tumor incidence. Polymorphisms in GSTM1, GSTT1, and GSTP1 did not show association with histopathologic type of brain tumor (glioma or meningioma). Analysis of the polymorphisms in the studied genes and smoking status of the brain tumor patients revealed no statistically significant association. The presented data clearly suggest a relation between brain tumor incidence with GSTM1 null genotype but not with GSTT1 or GSTP1 gene variants. 41. Population-based study of glutathione S-transferase mu gene deletion in adult glioma cases and controls. Carcinogenesis. 1997 Jul;18(7):1431-3Gene deletion at the glutathione S-transferase mu locus (GSTM1) has previously been associated with increased risk for environmentally-induced cancers (e.g. smoking-related lung cancer). Authors compared the prevalence of the GSTM1 homozygous deletion polymorphism in 158 Caucasian adults with gliomas with 157 controls. Cases and controls were drawn from a large population-based case-control study of brain cancers in six San Francisco Bay area counties. Overall, the prevalence of the GSTM1 deletion was similar in cases (83/158; 53%) and controls (78/157; 50%). Among brain tumor cases, analysis of variance modeling indicated a significant interaction of GSTM1 genotype and gender associated with age at diagnosis (P = 0.02). This effect was due to the fact that women with GSTM1 deletion were younger on average at diagnosis than women who were GSTM1 positive (43.9 years versus 52.4 years, respectively). Age at diagnosis among men was similar for those who were GSTM1 deleted and GSTM1 positive (49.4 years and 47.2 years, respectively). The younger age at diagnosis of GSTM1 null female cases compared with GSTM1 positive cases was observed in astrocytoma as well as the higher grade tumors (e.g. glioblastoma multiforme).