Post on 18-Apr-2018
transcript
Degradation of 2,3-dihydroxybenzoateby a novel meta-cleavage pathway.
Item Type Article
Authors Marín, Macarena; Plumeier, Iris; Pieper, Dietmar H
Citation Degradation of 2,3-dihydroxybenzoate by a novel meta-cleavagepathway. 2012, 194 (15):3851-60 J. Bacteriol.
DOI 10.1128/JB.00430-12
Journal Journal of bacteriology
Rights Archived with thanks to Journal of bacteriology
Download date 05/06/2018 13:16:37
Link to Item http://hdl.handle.net/10033/252493
This is a pre- or post-print of an article published inMarín, M., Plumeier, I., Pieper, D.H.
Degradation of 2,3-dihydroxybenzoate by a novel meta-cleavage pathway
(2012) Journal of Bacteriology, 194 (15), pp. 3851-3860.
1
Degradation of 2,3-dihydroxybenzoate by a novel meta-cleavage 1
pathway 2
3
Macarena Marín1, Iris Plumeier, and Dietmar H. Pieper* 4
5
Microbial Interactions and Processes Research Group, HZI – Helmholtz Centre for 6
Infection Research Inhoffenstr. 7, 38124 Braunschweig, Germany 7
8
Running title: Degradation of 2,3-dihydroxybenzoate 9
10
1Present address: Institute of Genetics, LMU-University of Munich, 82152 11
Martinsried, Germany 12
13
*To whom correspondence should be addressed: Dietmar H. Pieper, Microbial 14
Interactions and Processes Research Group, HZI – Helmholtz Centre for Infection 15
Research, Inhoffenstraße 7, 38124 Braunschweig, Germany. Phone: +49 (531) 16
61814200, Fax: +49 (531) 61814499. E-mail: dpi@helmholtz-hzi.de 17
18
19
Keywords: biodegradation; 2,3-dihydroxybenzoate; Pseudomonas reinekei 20
21
2
ABSTRACT 22
23
2,3-Dihydroxybenzoate is the precursor in the biosynthesis of several siderophores 24
and an important plant secondary metabolite that in bacteria can be degraded via 25
meta-cleavage of the aromatic ring. The dhb cluster of Pseudomonas reinekei MT1 26
encodes a chimeric meta-cleavage pathway involved in the catabolism of 2,3-27
dihydroxybenzoate. While the first two enzymes, DhbA and DhbB, are 28
phylogenetically related to those involved in 2,3-dihydroxy-p-cumate degradation, the 29
subsequent steps are catalyzed by enzymes related to those involved in catechol 30
degradation (DhbCDEFGH). Characterization of kinetic properties of DhbA extradiol 31
dioxygenase identified 2,3-dihydroxybenzoate as the preferred substrate. Deletion of 32
the encoding gene impedes growth of P. reinekei MT1 on 2,3-dihydroxybenzoate. 33
DhbA catalyzes a 3,4-dioxygenation with 2-hydroxy-3-carboxymuconate as product, 34
which is then decarboxylated by DhbB to 2-hydroxymuconic semialdehyde. This 35
compound is then subject to dehydrogenation and further degraded to citrate cycle 36
intermediates. Transcriptional analysis revealed genes of the dhB gene cluster to be 37
highly expressed during growth with 2,3-dihydroxybenzoate, whereas a downstream 38
localized gene encoding 2-hydroxymuconic semialdehyde hydrolase, dispensable for 39
2,3-dihydroxybenzoate metabolism but crucial for 2,3-dihydroxy-p-cumate 40
degradation, was only marginally expressed. This is the first report describing a 41
gene cluster encoding enzymes for the degradation of 2,3-dihydroxybenzoate. 42
43
3
INTRODUCTION 44
45
Bacteria synthesize small iron chelating molecules, called siderophores, in order 46
to facilitate iron uptake. As the availability of this element in many environments is 47
limited, siderophores are crucial for bacterial fitness and virulence (12). One of the 48
best-studied siderophores is enterobactin, which is produced by enterobacteria such 49
as Salmonella enterica and E. coli (43). A central intermediate in the synthesis of this 50
siderophore is 2,3-dihydroxybenzoate (2,3-DHB), which is also a precursor in the 51
synthesis of anguibactin and vibriobactin (12). Moreover, 2,3-DHB is recognized as 52
an important plant secondary metabolite (5), However, despite its similarity to central 53
intermediates of bacterial aromatic degradative pathways such as 3,4-54
dihydroxybenzoate (protocatechuate), only limited information is available on 2,3-55
DHB degradation. 56
It has previously been shown that P. fluorescens 23D-1 can degrade this 57
compound (44) and that metabolism is initiated by an extradiol dioxygenase, 58
probably cleaving the substrate between the C3 and C4 carbon atoms (45). Extradiol 59
(meta-) cleavage of 2,3-DHB has also been observed in a Pseudomonas putida 60
strain (3). However, whether the observed subsequent decarboxylation of the ring-61
cleavage product to yield 2-hydroxymuconic semialdehyde was spontaneous or 62
enzyme catalyzed has not yet been elucidated. Alternative pathways have been 63
described in fungi such as Trichosporum cutaneum, where 2,3-DHB degradation is 64
initiated by a decarboxylase (2) or in plants such as Tecoma stans, where 65
degradation proceeds via intradiol cleavage (49). In the current report, we elucidated 66
the degradation of 2,3-DHB by Pseudomonas reinekei MT1 and were able to identify 67
a gene cluster involved in this metabolic route. 68
69
4
MATERIALS AND METHODS 70
71
Bacterial strains, plasmids and growth conditions. The bacterial strains and 72
plasmids used in this study are listed in Table 1. P. reinekei strain MT1 was grown in 73
minimal medium as previously described (39), with 2 mM 2,3-dihydroxybenzoate as 74
the sole carbon source. Luria-Bertani (LB) medium was used as rich medium for 75
Escherichia coli and P. reinekei strains. For selection of mutants, ABC medium (AB 76
medium (11) supplemented with trace metals (17) and 20 mM citrate was used. 77
Antibiotics were used at the following concentrations: for E. coli; ampicillin (Ap, 200 78
µg/ml), carbenicillin (Cb, 100 µg/ml), gentamycin (Gm, 10 µg/ml) and tetracycline 79
(Tc, 10 µg/ml), and for P. reinekei; Gm (200 µg/ml) and Tc (15 µg/ml). 80
81
Sequencing and sequence analysis. The dhb gene cluster was localized by 82
sequencing downstream of the previously described sal cluster of P. reinekei MT1, 83
which is harbored on a fosmid from a previously constructed fosmid library (9). Direct 84
sequencing was performed using the ABI PRISM BigDye Terminator v1.1 Ready 85
Reaction Cycle Sequencing Kit (Applied Biosystems, Foster City, CA) and an ABI 86
PRISM 3100 Genetic Analyzer (Applied Biosystems, Foster City, CA). Raw 87
sequence data from both strands were assembled manually. DNA and protein 88
similarity searches were performed using BLASTX and BLASTP programs from the 89
NCBI website (1). Translated protein sequences were aligned with MUSCLE using 90
default values (19). Phylogenetic trees were constructed with MEGA5 (53) using the 91
neighbor-joining algorithm (47) with p-distance correction and pairwise deletion of 92
gaps and missing data. A total of 100 bootstrap replications were performed to test 93
for branch robustness. 94
5
95
Nucleotide sequence accession number. The nucleotide sequence reported in 96
this study has been deposited in the GenBank database under GenBankAccession 97
Number JN638999. 98
Construction of a dhbA deletion mutant. A deletion mutant of the dhbA gene 99
encoding 2,3-dihydroxybenzoate 3,4-dioxygenase was constructed with the 100
previously described Flp-FTR recombination strategy (29). PCR fragments were 101
amplified using primer pairs upstream (KOC23OAF and KOC23OAR, Table 2) and 102
downstream (KOC23OBF and KOC23OBR3, Table 2) of the targeted gene (∼700 103
bp) carrying PstI-BamHI and BamHI-Acc65l restriction sites, respectively. 104
Subsequently, they were cloned into the PstI-Acc65l restriction site of the pEX18Ap 105
vector, forming plasmid pABdhbA (Table 1). A 1.8 kb BamHI fragment from pS858 106
plasmid carrying a GmR-GFP cassette was cloned into the BamHI restriction site 107
formed, resulting in the pAGBdhbA suicidal plasmid (Table 1). This suicide plasmid 108
was transferred to P. reinekei MT1 by biparental mating using E. coli S17λpir as 109
donor strain. The transconjugants generated by single crossover were selected on 110
ABC medium supplemented with Gm and merodiploids were resolved by additional 111
plating on ABC medium supplemented with 5% sucrose. Deletion of the GmR-GFP 112
cassette was achieved by conjugation of the Flp-expressing pBBFLP plasmid into 113
the resulting strains by biparental mating using E. coli CC118λpir as donor and 114
selection on ABC medium containing Tc. Plasmid pBBFLP was cured by streaking 115
strains on ABC medium supplemented with 5% sucrose. Integrity of the mutant was 116
verified by growth on ABC medium supplemented with different antibiotics, PCR 117
amplification and sequencing of regions flanking the deleted gene. 118
119
6
Cloning of the dhbA gene and expression of the encoded protein. A 995 bp 120
region harboring the dhbA gene was PCR amplified using primers pGC23OR and 121
pGC23OF (Table 2) and cloned in the pGEM-T Easy vector (Promega, Germany) 122
generating plasmid pGC23O. The plasmid was used to transform E. coli JM109 and 123
positive clones were selected by resistance to ampicillin. A clone termed E. coli 124
JM109 (pGC23O) was selected and the integrity of the insert verified by sequencing. 125
E. coli JM109 (pGC23O) was grown at 37ºC in LB medium containing 200 mg 126
ampicillin ml-1. For induction IPTG (0.5 mM) was added when cultures reached an 127
A600nm= 0.6. Cells were harvested after 2 h incubation at 37ºC and the cell pellet 128
resuspended in 50 mM phosphate buffer pH 8.0. 129
130
Real-time-PCR. P. reinekei MT1 was grown overnight in minimal medium with 10 131
mM gluconate or 2 mM 2,3-DHB as a carbon source. During exponential growth 132
(A600nm= 0.8 in case of growth with gluconate and 70% of 2,3-DHB depletion, as 133
followed by HPLC analysis during growth on 2,3-DHB), three 2 ml aliquots were 134
pelleted and supplemented with 1 ml of RNAprotect (QIAGEN). Total RNA was 135
isolated using the RNeasy minikit (Qiagen), according to the manufacturer’s 136
instructions. The resulting RNA was treated with the Turbo DNase kit (Ambion, 137
Austin, TX) to remove any DNA contamination and quantified using a Nanodrop 138
2000c (Peqlab). cDNA was synthesized from 230 - 580 ng total RNA using 139
SuperScript III reverse transcriptase (Invitrogen) according to the procedure from the 140
manufacturer, followed by purification of cDNA using a Qiaquick PCR purification kit 141
(Qiagen). 142
Transcripts of dhbA, dhbE, dhbH, dhbI, mmlL and orf4 were quantified with 143
primer pairs given in Table 2 and the ribosomal rpsL gene was chosen as a 144
7
housekeeping reference gene (9). Each reaction was performed in duplicate in a 145
final volume of 20 μl containing 2.5 µl of each primer (10 pmol), 10 µL QuantiTect 146
SYBR Green PCR Master Mix (Qiagen) and 5 μl of cDNA template (corresponding to 147
1 – 10 ng). Amplification was carried out in a LightCycler® 480 Real-Time PCR 148
System programmed to hold at 95 °C for 10 min, and to complete 50 cycles of 94 °C 149
for 15 s, 57 °C for 40 s and 72 °C for 40 s. The PCR results were analysed by the 150
LightCycler® 480 Software (Roche Applied Science, USA). Standard curves were 151
generated from serial dilutions of known concentrations of P. reinekei MT1 genomic 152
DNA (containing between 2 and 2X106 copies of the target gene µl-1) by plotting 153
threshold cycles (CT values) versus copy number assuming that 1 ng of DNA 154
contains 9.8 x 105 copies of the entire P. reinekei MT1 genome (estimated as 6 Mbp 155
based on reported genome sizes of sequenced Pseudomonas strains) where the 156
target genes are assumed to be present as a single copy. 157
Enzymatic assays. Cell extracts of P. reinekei MT1 and of E. coli JM109 158
(pGC23O) were prepared as previously described (39). Catalytic activities were 159
recorded at 25ºC in 50 mM air-saturated phosphate buffer pH 8.0 on a UV 2100 160
spectrophotometer (Shimadzu Corporation). 2,3-DHB 3,4-dioxygenase activity was 161
followed by measuring transformation of catechol or 3-methylcatechol to 2-162
hydroxymuconic semialdehyde (HMS, ε375nm= 36000 M-1 cm-1) or 2-hydroxy-6-oxo-163
2,4-heptadienoate (HOPDA, ε388nm= 13800 M-1 cm-1), respectively. Extinction 164
coefficients of the ring-cleavage products of 2,3-DHB or 2,3-dihydroxy-p-cumate 165
were determined as ε343nm= 31600 M-1cm-1 or ε347= 27400 M-1cm-1, respectively, after 166
incubation of 25 - 50 µM of substrate with cell free extract until complete turnover. 167
Activities with protocatechuate and pyrogallol were followed by recording changes in 168
UV-visible spectra (250 - 400nm) after addition of cell extract for up to 30 min. 169
8
Catalytic activities of 2-hydroxy-3-carboxymuconic semialdehyde (HCMS) 170
decarboxylase were recorded at 375 nm based on the difference in extinction at 171
λ=375 nm of the substrate (ε375nm= 16400 M-1 cm-1) and the HMS product. HMS 172
hydrolase activity was measured by determining the NAD+-independent decrease in 173
concentration of HOPDA at 388 nm. HMS dehydrogenase activity was measured by 174
determining the NAD+-dependent decrease in concentration of HMS at 375 nm. 175
NAD+ was added to a final concentration of 0.5 mM. Specific activities are expressed 176
as units per gram of protein. Vmax and Km values were determined using 1–100 μM 177
(2,3-DHB dioxygenase) or 0.2 - 10 μM of substrate (2-hydroxy-3-carboxymuconic 178
semialdehyde decarboxylase and HMS dehydrogenase) in air-saturated buffer and 179
kinetic data were calculated from the initial velocities using the Michaelis-Menten 180
equation by non-linear regression (KaleidaGraph, Synergy Software). 181
182
Analytical methods. Transformation of 2,3-DHB was monitored by HPLC 183
analysis. Aliquots of 10 ml of cell-free supernatants were analysed with a Shimadzu 184
HPLC system (LC-10AD liquid chromatograph, DGU-3 A degasser, SPD-M10A 185
diode array detector and FCV-10AL solvent mixer) equipped with a Lichrospher RP8 186
column (125 mm by 4.6 mm, Bischoff, Leonberg, Germany) using an aqueous 187
solvent system (flow rate, 1 ml min-1) containing 0.01% (v/v) H3PO4 (87%) and 40% 188
(v/v) methanol, where 2,3-DHB exhibited a retention volume of 3.0 ml. 189
For 1H NMR analysis, the 2,3-DHB ring-cleavage product was prepared by 190
quantitative transformation of 1 mM 2,3-DHB in 50 mM phosphate buffer (pH 8.0) 191
with cell extract of E. coli JM109 (pGC23O) preinduced for the induction of DhbA. 192
After complete substrate transformation as evidenced by HPLC 0.56 ml of the 193
reaction mixture were supplemented with 0.14 ml of D2O. One-dimensional and two-194
9
dimensional correlation spectroscopy (COSY) 1H NMR spectra were recorded at 300 195
K on an AVANCE DMX 600 NMR spectrometer (Bruker, Rheinstetten, Germany). 196
The center of the suppressed water signal (δ = 4.80 ppm) was used as an internal 197
reference. 198
199
Chemicals. 2,3-dihydroxy-p-cumate was a kind gift from Richard Eaton (18). 2-200
Hydroxy-3-carboxymuconic semialdehyde and 2-hydroxy-3-carboxy-6-oxo-7-201
methylocta-2,4-dienoate were prepared in situ by incubation of a solution containing 202
0.1 mM 2,3-dihydroxybenzoate or 2,3-dihydroxy-p-cumate in 50 mM phosphate 203
buffer (pH 8.0) with cell extract of E. coli JM109 (pGC23O) preinduced for the 204
induction of DhbA, whereas HMS and HOPDA (0.1 mM) were prepared with cell 205
extracts of E. coli JM109 (pC23Ohis218) expressing catechol 2,3-dioxygenase (32). 206
207
10
RESULTS 208
209
Identification and analysis ORFs involved in 2,3-dihydroxybenzoate 210
degradation in P. reinekei MT1. P. reinekei MT1 is able to grow on 2,3-DHB as the 211
sole carbon source. Analysis of a 20.2 kb region of the P. reinekei MT1 genome 212
revealed the presence of 19 hitherto unknown ORFs. This region is framed by the 213
previously described mmlI and sal gene clusters and is located upstream of a 214
previously identified ORF encoding a putative HMS hydrolase (9, 38) (Fig. 1, Table 215
3) now termed dhbI. Eight of the identified ORFs can be assumed to encode proteins 216
homologous to those involved in the degradation of dihydroxylated aromatics via 217
meta-cleavage. The first ORF identified in this cluster termed dhbR is transcribed in 218
the opposite direction to the following structural genes and encodes a putative LysR-219
type transcriptional regulator. The following gene, dhbA encodes an extradiol 220
dioxygenase belonging to the type I extradiol dioxygenase family (DhbA). DhbA is 221
homologous to PsbC2, the 2,3-dihydroxy-p-cumate-3,4-dioxygenase from R. 222
palustris (56% identity) (42), and is also related to other proteins previously identified 223
as 2,3-dihydroxy-p-cumate-3,4-dioxygenases (18) (Table 3, Fig. 2A). dhbB encodes 224
a protein of the aldolase II superfamily (cl00214) homologous to CmtD proteins from 225
B. xenovorans LB400 (YP_557489, 55% identity) and P. putida F1 (AAB62290, 54% 226
identity), which catalyze the decarboxylation of the 2,3-dihydroxy-p-cumate ring-227
cleavage product (2-hydroxy-3-carboxy-6-oxo-7-methylocta-2,4-dienoate) to 2-228
hydroxy-6-oxo-7-methylocta-2,4-dienoate (18). DhbB is distantly related to 3,4-229
dihydroxyphthalate 2-decarboxylases (18) (Table 3, Fig. 2B). The putative functions 230
and phylogenetic relationship of DhbA and DhbB suggest that these enzymes are 231
11
involved in the degradation of a carboxylated catechol, which is subject to ring-232
cleavage followed by decarboxylation. 233
The following ORFs (dhbCDEFGH) encode enzymes homologous to those 234
involved in catechol meta-cleavage pathways and evidently encode HMS 235
dehydrogenase (DhbC), 2-oxopent-4-enoate hydratase (DhbD), 4-oxalocrotonate 236
decarboxylase (DhbE), 4-oxalocrotonate tautomerase (DhbF) acetaldehyde 237
dehydrogenase (DhbG) and 4-hydroxy-2-ketovalerate aldolase (DhbH), respectively 238
(Table 3, Fig. 2C and D). Such enzymes are necessary to achieve degradation of 239
catechols via the so-called dehydrogenase branch of the meta-cleavage pathway, 240
which channels catechol via HMS, 2-hydroxymuconate and 4-oxalocrotonate to 2-241
oxopent-4-enoate (Fig. 3) (25). 242
This is in contrast to the organization of the gene clusters for 2,3-dihydroxy-p-243
cumate degradation of P. putida F1 (18) and B. xenovorans LB400 (CP000270: 244
Bxe_A3546-Bxe_A3554), where genes encoding HMS dehydrogenase, 4-245
oxalocrotonate decarboxylase and 4-oxalocrotonate tautomerase were absent (Fig. 246
1). The alternative branch of catechol degradation involves a HMS hydrolase (25). 247
Degradation via this branch is necessary for the degradation of 3-alkylsubstituted 248
catechols, where the ring-cleavage product is a ketone, which cannot be subjected 249
to dehydrogenation, as in 2,3-dihydroxy-p-cumate degradation (Fig. 3) (18). 250
A gene encoding a putative HMS hydrolase (DhbI) was localized 10.7 kb 251
downstream of dhbH (Fig. 1). DhbI is clearly distinct from other hydrolases, such as 252
CmtE involved in the transformation of 2-hydroxy-6-oxo-7-methylocta-2,4-dienoate 253
(24-27% identity) (18), BphD transforming 2-hydroxy-6-phenylhexa-2,4-dienoate (33) 254
or MhpC transforming 2-hydroxy-6-ketonona-2,4-dienedioic acid (up to 35% identity) 255
12
(16). It is however related to HMS hydrolases of catechol meta-cleavage pathways, 256
such as XylF of P. putida mt2 (>50% identity) (31) (Table 3, Fig. 2D). 257
The ten ORFs localized between dhbH and dhbI exhibited no evident function 258
related to aromatic degradation. Interestingly, genes similar to orf4-6 were observed 259
in an identical arrangement in the genomes of Agrobacterium radiobacter K84 260
(NC_011983: Arad_7275-Arad_7279), while genes related to orf7-10 are present in 261
Methylibium petroliphilum PM1 (YP_001020161: Mpe_A0964-Mpe_A0967) and 262
Leptothrix choldni SP-6 (YP_001791193: Lcho_2162-Lcho_2165). Nevertheless, 263
they are separated from the meta-pathway gene clusters harbored in these strains 264
(Table 3, Fig. 1). 265
266
The dhbA gene is essential for growth of P. reinekei MT1 on 2,3-267
dihydroxybenzoate. Based on the putative function and the phylogeny of the 268
enzymes encoded by the dhb cluster, as well as on the gene cluster organization, it 269
was deduced that this cluster could be involved in both 2,3-dihydroxy-p-cumate and 270
also 2,3-DHB degradation. As P. reinekei MT1 is not capable of growing on p-271
cumate, the role of the dhb cluster in the degradation of 2,3-DHB was analyzed. 272
Directed deletion of dhbA, the gene encoding a putative 2,3-DHB 3,4-dioxygenase, 273
was performed. MT1ΔdhbA was unable to grow on 2,3-DHB as the only carbon 274
source, confirming the crucial role of DhbA for degradation of this compound. 275
276
DhbA catalyzes ring-cleavage of 2,3-dihydroxybenzoate. The transformation 277
of 2,3-DHB by cell extracts of 2,3-DHB degrading Pseudomonas strains has 278
previously been described to result in the formation of HMS by ring-cleavage and 279
subsequent decarboxylation (3, 45). Transformation of 2,3-DHB by recombinant 280
13
DhbA resulted in the formation of a product with an absorption maximum of λmax=343 281
nm (Fig. 4), which is clearly different from that of HMS (λmax=375 nm), but similar to 282
that of 2-hydroxy-3-carboxy-6-oxo-7-methylocta-2,4-dienoate formed by extradiol 283
ring-cleavage of 2,3-dihydroxy-p-cumate (λmax=346 nm) (18). This indicates that 284
decarboxylation of the 2,3-DHB ring-cleavage product does not occur 285
spontaneously, but is most probably catalyzed by DhbB. 286
To identify its structure, the reaction product formed by recombinant DhbA was 287
analyzed by 1H NMR analysis (Fig. 4). Only two coupled olefinic protons (δ = 6.69 288
ppm and δ = 7.52 ppm) were present in the product, excluding that a 1,2-289
dioxygenation with 2-hydroxy-6-oxohepta-2,4-dienoate as product had occurred. The 290
vicinal coupling of 14.5 Hz observed for the olefinic unit is characteristic of a trans 291
configuration in an open-chain system (46). An aldehydic proton resonates at 9.03 292
ppm and shows a coupling of 8.9 Hz with the olefinic proton at 6.69 ppm. These 293
characteristics are in accordance with the 2-hydroxy-3-carboxymuconate structure 294
and proof that DhbA catalyzes a 3,4-dioxygenation, and a decarboxylation of the 295
ring-cleavage product does not occur spontaneously. 296
297
DhbA is specialized in 2,3-dihydroxybenzoate ring-cleavage. The activity of 298
recombinant DhbA was assessed against different dihydroxylated aromatic 299
compounds (Table 4). The highest activity was observed with 2,3-DHB. 2,3-300
Dihydroxy-p-cumate was also transformed at a rate of approximately 30% to that of 301
2,3-DHB. Of the other substrates tested, only catechol was transformed. Analysis of 302
kinetic parameters revealed a Km for 2,3-DHB of 2.9 μM, roughly half of that for 2,3-303
dihydroxy-p-cumate. Accordingly, comparison of specificity constants (Vmax/Km) 304
showed 2,3-DHB to be the preferred substrate (Table 4). 305
14
Transformation of 2,3-DHB by cell extracts of 2,3-DHB grown cells of P. reinekei 306
MT1 showed transformation into a product with an absorption maximum λmax=375 307
nm, without any indication of accumulation of 2-hydroxy-3-carboxymuconic 308
semialdehyde (λmax=343 nm, see above). In accordance, 2-hydroxy-3-309
carboxymuconic semialdehyde was transformed rapidly by the extract with a Vmax of 310
731 ± 17 U/g protein into the product with an aborption maximum at 375 nm, 311
indicating decarboxylation of the product to form HMS. Thus, the observed rate of 312
formation of HMS from 2,3-DHB of 37 U/g protein by cell extracts seems to be 313
limited by 2,3-DHB dioxygenase and indicate the activity of this protein in the cell 314
extract. Whereas the activity of HMS hydrolase was below the detection limit, HMS 315
dehydrogenase was active in cell extracts (Table 5). 316
317
Real-time-PCR analysis of MT1 transcripts. To confirm that the dhb genes are 318
specifically transcribed during 2,3-DHB degradation, accumulation of transcripts of 319
dhbA, dhbE and dhbH obviously localized in the same catabolic gene cluster was 320
measured during growth on 2,3-DHB as well as on gluconate as a noninducing 321
negative control. To analyze how far genes downstream of the dhb gene cluster 322
were transcribed, orf4 and dhbI were also included in the analysis. mmlL encoding 4-323
methyl-3-oxoadipate enol-lactone hydrolase, a key enzyme in the degradation of 324
methylaromatics by P. reinekei MT1 (38) was used as negative control. Transcript 325
levels during growth on gluconate were generally low (<100/ng of cDNA, Fig. 5) for 326
all genes of the dhb gene cluster, and only mmlL showed slightly higher transcript 327
levels. Significantly elevated dhbA, dhbE and dhbH transcript levels were observed 328
in 2,3-DHB grown cells. When the relative expression levels between the target and 329
the reference gene (rpsL) were compared to those under noninducing conditions (at 330
15
a ratio of 1), approximately 500 - 1500 fold higher amounts of transcripts were 331
observed (Fig. 5). In contrast, expression levels of orf4 and dhbI were only increased 332
approximately 15-fold, whereas mmlL was not induced (Fig. 5). 333
334
16
DISCUSSION 335
336
Throughout this study, we have been able to demonstrate that P. reinekei MT1 is 337
able to degrade 2,3-DHB using a meta-cleavage pathway encoded by the dhb 338
cluster. DhbA catalyzes the ring-cleavage of 2,3-DHB and is a type I extradiol 339
dioxygenase of the vicinal oxygen chelate family (21). This family is composed of 340
enzymes which are well known for being involved in the degradation of catechol or 341
alkylsubstituted catechols and of bicyclic dihydroxylated aromatics like 2,3-342
dihydroxybiphenyl (25). Enzymes acting on carboxylated catechols such as CmtC of 343
P. putida F1 (18) or DhbA described here evidently form novel branches in the 344
phylogeny of type I extradiol dioxygenases (20). If enzymes of this branch are 345
generally of broad substrate specificity and accept differently substituted 3-346
carboxycatechols as substrates as indicated for an enzyme of p-cymene grown P. 347
putida PL-W as well as shown here for DhbA, remains to be elucidated (15). The 348
channeling of the ring-cleavage products of 2,3-DHB and 2,3-dihydroxy-p-cumate 349
into well documented meta-cleavage pathways is catalyzed by decarboxylases of the 350
class II aldolase family forming HMS or 2-hydroxy-6-oxo-7-methylocta-2,4-dienoate, 351
respectively. The exploration of currently published genomes revealed that at least 352
A. radiobacter K84, R. solanacearum GMI1000, Achromobacter xylosoxidans A8 and 353
Cupriavidus necator N-1 also harbor both genes (Fig. 2) and may thus, also be 354
capable of degrading carboxysubstituted catechols. 355
After extradiol cleavage, the ring-cleavage products are typically processed by 356
one of two distinct meta-cleavage pathway branches. If the ring-cleavage product is 357
an aldehyde (HMS in case of 2,3-DHB), the pathway proceeds via the 358
dehydrogenase branch via dehydrogenation, isomerization and decarboxylation (Fig. 359
17
3), leading to the formation of 2-oxopenta-4-enoate as the central intermediate. In 360
contrast, if the ring cleavage product is a ketone (2-hydroxy-6-oxo-7-methylocta-2,4-361
dienoate in case of 2,3-dihydroxy-p-cumate metabolism) the pathway proceeds via 362
the hydrolytic branch, where the ketone is hydrolyzed to give 2-oxopenta-4-enoate, 363
and an acid. Further transformation of 2-oxopenta-4-enoate, the common 364
intermediate of the hydrolytic and dehydrogenase branches, proceeds by a 2-365
oxopent-4-enoate hydratase leading to the formation of 4-hydroxy-2-oxovalerate, 366
which is subsequently converted into pyruvate and acetaldehyde by a 4-hydroxy-2-367
oxovalerate aldolase (51). Finally, these products can enter the citrate cycle (Fig. 3). 368
Various meta-cleavage pathway gene clusters have been described in the 369
literature. The most extensively studied meta-cleavage pathway is the one encoded 370
on the TOL plasmid pWW0 (8, 23), which harbors genes encoding a ferredoxin 371
(xylT), a catechol 2,3 dioxygenase (C23O) (xylE), and both the hydrolytic (xylF) and 372
the dehydrogenase (xylG, xylH, and xylI) branch of the meta-cleavage pathway (22, 373
50). Although a similar structure is maintained in various catechol meta-cleavage 374
pathway gene clusters, several others such as those involved in the degradation of 375
biphenyl, which require the hydrolytic branch, are devoid of genes encoding the 376
dehydrogenase branch (30). Similarly both the 2,3-dihydroxy-p-cumate degradation 377
gene clusters of P. putida F1 and of B. xenovorans LB400 are devoid of genes 378
encoding enzymes of this branch, and are thus not appropriate to ensure 2,3-DHB 379
degradation (CP000270: Bxe_A3546-Bxe_A3554) (18). The fact that, like CmtC-like 380
extradiol dioxygenases (Fig. 2A), CmtE-like hydrolases constitute a separate branch 381
in their phylogeny (Fig. 3E) indicates co-evolution of genes of the cmt gene clusters 382
for the degradation of p-cumate. 383
18
In contrast, the dhb cluster described here more likely represents a chimeric gene 384
cluster composed of genes encoding enzymes specialized for channeling 2,3-DHB 385
into the meta-cleavage route clustered with genes closely resembling those of 386
archetype meta-cleavage pathway gene clusters. While DhbC, DhbD and DhbE are 387
most closely related to proteins encoded by meta-cleavage pathway clusters 388
involved in phenol degradation by Burkholderiales bacteria, specifically C. necator 389
H16 (h16_B0546- h16_B0552), Verminephrobacter eiseniae EF01-2 (Veis_2781-390
Veis_2787), Leptothrix cholodnii SP-6 (Lcho_3340-Lcho_3356) or Methylibium 391
petrophilum PM1 (Mpe_A2266-Mpe_A2277) (Fig. 2C), DhbG and DhbH are more 392
closely related to enzymes encoded by 2,3-dihydroxyphenylpropionate catabolic 393
gene clusters (Fig. 2D), possibly indicating different origins of these genes too. 394
Investigation of bacterial genomes showed that catabolic gene clusters of a 395
structure identical to that of the dhb gene cluster structure are present in R. 396
solanaecaerum GMI1000 (RSp0888- RSp0895) and C. necator N-1 397
(CNE_BB1p13310-13240 and CNE_p112030-12140) A. radiobacter K84 398
(Arad_7255- Arad_7275). As in P. reinekei MT1 both these gene clusters are devoid 399
of a gene encoding a HMS hydrolase. Similar gene clusters are also present in the 400
genomes of Achromobacter xylosooxidans A8 and Agrobacterium radiobacter K84. It 401
can thus be speculated that these strains have the capability of mineralizing 2,3-DHB 402
and that the dhb type gene cluster may be highly appropriate for 2,3-DHB 403
mineralization and thus wide spread among bacteria. 404
Although a gene encoding a HMS hydrolase is not present in the P. reinekei MT1 405
dhb gene cluster, such a gene termed dhbI was located in its proximity, and 406
expression was observed during growth on 2,3-DHB. If DhbI encodes a functional 407
hydrolase which may serve to extend the range of substrates that can be used by P. 408
19
reinekei MT1 from which source it may have been recruited and if orf4 through orf10 409
may form a transcriptional unit together with dhbI is currently under investigation. 410
The observed gene organization of P. reinekei MT1 may thus still be in evolution to 411
ensure the degradation of various environmentally relevant carboxylated aromatics. 412
413
414
ACKNOWLEDGEMENTS 415
416
We thank Dr. R. Eaton for kindly supplying 2,3 dihydroxy-p-cumate, Dr. V. Wray for 417
support in interpretation of 1H NMR spectra, C. Kakoschke, and B. Jaschok-Kentner 418
for meticulous technical assistance, and Dr R. Vilchez-Vargas and Dr. M Wos-Oxley 419
for support in real-time PCR experiments. This work was supported by the DFG-420
European Graduate College 653. 421
422
423
424
20
REFERENCES 425
426
1. Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, 427
Lipman DJ. 1997. Gapped BLAST and PSI-BLAST: a new generation of 428
protein database search programs. Nucleic Acids Res. 25:3389-3402. 429
2. Anderson JJ, Dagley S. 1981. Catabolism of tryptophan, anthranilate, and 430
2,3-dihydroxybenzoate in Trichosporon cutaneum. J. Bacteriol. 146:291-297. 431
3. Andreoni V, Canonica L, Galli E, Gennari C, Treccani V. 1981. 2,3-432
Dihydroxybenzoate pathway in Pseudomonas putida. 1H n.m.r. study on the 433
ring-cleavage site. Biochem. J. 194:607-610. 434
4. Arai H, Ohishi T, Chang MY, Kudo T. 2000. Arrangement and regulation of 435
the genes for meta-pathway enzymes required for degradation of phenol in 436
Comamonas testosteroni TA441. Microbiology 146:1707-1715. 437
5. Bartsch M, Bednarek P, Vivancos P, Schneider B, von Roepenack-Lahay 438
E, Foyer C, Kombrink E, Scheel D, Parker J. 2010. Accumulation of 439
isochorismate-derived 2,3-dihydroxybenzoic 3-O-β-D-xyloside in Arabidopsis 440
resistance to pathogens and ageing of leaves. J. Biol. Chem. 285:25654-441
25665. 442
6. Bosch R, Garcia-Valdes E, Moore ER. 2000. Complete nucleotide sequence 443
and evolutionary significance of a chromosomally encoded naphthalene-444
degradation lower pathway from Pseudomonas stutzeri AN10. Gene 245:65-445
74. 446
7. Brickman TJ, McIntosh MA. 1992. Overexpression and purification of ferric 447
enterobactin esterase from Escherichia coli. Demonstration of enzymatic 448
21
hydrolysis of enterobactin and its iron complex. J. Biol. Chem. 267:12350-449
12355. 450
8. Burlage RS, Hooper SW, Sayler GS. 1989. The TOL (pWW0) catabolic 451
plasmid. Appl. Environ. Microbiol. 55:1323-1328. 452
9. Camara B, Bielecki P, Kaminski F, dos Santos VM, Plumeier I, Nikodem 453
P, Pieper DH. 2007. A gene cluster involved in degradation of substituted 454
salicylates via ortho cleavage in Pseudomonas sp. strain MT1 encodes 455
enzymes specifically adapted for transformation of 4-methylcatechol and 3-456
methylmuconate. J. Bacteriol. 189:1664-1674. 457
10. Camara B, Strompl C, Verbarg S, Sproer C, Pieper DH, Tindall BJ. 2007. 458
Pseudomonas reinekei sp. nov., Pseudomonas moorei sp. nov. and 459
Pseudomonas mohnii sp. nov., novel species capable of degrading 460
chlorosalicylates or isopimaric acid. Int. J. Syst. Evol. Microbiol. 57:923-931. 461
11. Clark J, Maaloe O. 1967. DNA replication and the division cycle in 462
Escherichia coli. J. Mol. Biol. 23:99-112. 463
12. Crosa JH, Walsh CT. 2002. Genetics and assembly line enzymology of 464
siderophore biosynthesis in bacteria. Microbiol. Mol. Biol. Rev. 66:223-249. 465
13. de las Heras A, Carreno CA, de Lorenzo V. 2008. Stable implantation of 466
orthogonal sensor circuits in Gram-negative bacteria for environmental 467
release. Environ. Microbiol. 10:3305-3316. 468
14. de Lorenzo V, Timmis KN. 1994. Analysis and construction of stable 469
phenotypes in gram-negative bacteria with Tn5- and Tn10-derived 470
minitransposons. Methods Enzymol. 235:386-405. 471
22
15. DeFrank JJ, Ribbons DW. 1977. p-Cymene pathway in Pseudomonas 472
putida: ring cleavage of 2,3-dihydroxy-p-cumate and subsequent reactions. J. 473
Bacteriol. 129:1365-1374. 474
16. Diaz E, Ferrandez A, Prieto MA, Garcia JL. 2001. Biodegradation of 475
aromatic compounds by Escherichia coli. Microbiol. Mol. Biol. Rev. 65:523-476
569. 477
17. Dorn E, Hellwig M, Reineke W, Knackmuss H-J. 1974. Isolation and 478
characterization of a 3-chlorobenzoate degrading pseudomonad. Arch. 479
Microbiol. 99:61-70. 480
18. Eaton RW. 1996. p-Cumate catabolic pathway in Pseudomonas putida F1: 481
Cloning and characterization of DNA carrying the cmt operon. J. Bacteriol. 482
178:1351-1362. 483
19. Edgar RC. 2004. MUSCLE: a multiple sequence alignment method with 484
reduced time and space complexity. BMC Bioinformatics 5:113. 485
20. Eltis LD, Bolin JT. 1996. Evolutionary relationships among extradiol 486
dioxygenases. J. Bacteriol. 178:5930-5937. 487
21. Gerlt JA, Babbitt PC. 2001. Divergent evolution of enzymatic function: 488
Mechanistically diverse superfamilies and functionally distinct suprafamilies. 489
Annu. Rev. Biochem. 70:209-246. 490
22. Ghosal D, You IS, Gunsalus IC. 1987. Nucleotide sequence and expression 491
of gene nahH of plasmid NAH7 and homology with gene xylE of TOL pWWO. 492
Gene 55:19-28. 493
23. Greated A, Lambertsen L, Williams PA, Thomas CM. 2002. Complete 494
sequence of the IncP-9 TOL plasmid pWW0 from Pseudomonas putida. 495
Environ. Microbiol. 4:856-871. 496
23
24. Greenwood KT, Luke RK. 1978. Enzymatic hydrolysis of enterochelin and its 497
iron complex in Escherichia coli K-12. Properties of enterochelin esterase. 498
Biochim. Biophys. Acta 525:209-218. 499
25. Harayama S, Mermod N, Rekik M, Lehrbach PR, Timmis KN. 1987. Roles 500
of the divergent branches of the meta-cleavage pathway in the degradation of 501
benzoate and substituted benzoates. J. Bacteriol. 169:558-564. 502
26. Harayama S, Rekik M. 1993. Comparison of the nucleotide sequences of the 503
meta-cleavage pathway genes of TOL plasmid pWW0 from Pseudomonas 504
putida with other meta-cleavage genes suggests that both single and multiple 505
nucleotide substitutions contribute to enzyme evolution. Mo.l Gen. Genet. 506
239:81-89. 507
27. Herrero M, de Lorenzo V, Timmis KN. 1990. Transposon vectors containing 508
non-antibiotic resistance selection markers for cloning and stable 509
chromosomal insertion of foreign genes in gram-negative bacteria. J. 510
Bacteriol. 172:6557-6567. 511
28. Hickey WJ, Sabat G, Yuroff AS, Arment AR, Perez-Lesher J. 2001. 512
Cloning, nucleotide sequencing, and functional analysis of a novel, mobile 513
cluster of biodegradation genes from Pseudomonas aeruginosa strain JB2. 514
Appl. Environ. Microbiol. 67:4603-4609. 515
29. Hoang TT, Karkhoff-Schweizer RR, Kutchma AJ, Schweizer HP. 1998. A 516
broad-host-range Flp-FRT recombination system for site-specific excision of 517
chromosomally-located DNA sequences: application for isolation of unmarked 518
Pseudomonas aeruginosa mutants. Gene 212:77-86. 519
24
30. Hofer B, Backhaus S, Timmis KN. 1994. The biphenyl/poychlorinated 520
biphenyl-degradation locus (bph) of Pseudomonas sp. LB400 encodes four 521
additional metabolic enzymes. Gene 144:9-16. 522
31. Horn JM, Harayama S, Timmis KN. 1991. DNA sequence determination of 523
the TOL plasmid (pWWO) xylGFJ genes of Pseudomonas putida: implications 524
for the evolution of aromatic catabolism. Mol. Microbiol. 5:2459-2474. 525
32. Junca H, Plumeier I, Hecht HJ, Pieper DH. 2004. Difference in kinetic 526
behaviour of catechol 2,3-dioxygenase variants from a polluted environment. 527
Microbiology 150:4181-4187. 528
33. Kimbara K, Hashimoto T, Fukuda M, Koana T, Takagi M, Oishi M, Yano 529
K. 1989. Cloning and sequencing of two tandem genes involved in 530
degradation of 2,3-dihydroxybiphenyl to benzoic acid in the polychlorinated 531
biphenyl- degrading soil bacterium Pseudomonas sp. strain KKS102. J. 532
Bacteriol. 171:2740-2747. 533
34. Kunze M, Zerlin KF, Retzlaff A, Pohl JO, Schmidt E, Janssen DB, Vilchez-534
Vargas R, Pieper DH, Reineke W. 2009. Degradation of chloroaromatics by 535
Pseudomonas putida GJ31: assembled route for chlorobenzene degradation 536
encoded by clusters on plasmid pKW1 and the chromosome. Microbiology 537
155:4069-4083. 538
35. Lal R, Dogra C, Malhotra S, Sharma P, Pal R. 2006. Diversity, distribution 539
and divergence of lin genes in hexachlorocyclohexane-degrading 540
sphingomonads. Trends Biotechnol. 24:121-130. 541
36. Liang Q, Takeo M, Chen M, Zhang W, Xu Y, Lin M. 2005. Chromosome-542
encoded gene cluster for the metabolic pathway that converts aniline to TCA-543
25
cycle intermediates in Delftia tsuruhatensis AD9. Microbiology 151:3435-544
2446. 545
37. Loper JE, Henkels MD. 1999. Utilization of heterologous siderophores 546
enhances levels of iron available to Pseudomonas putida in the rhizosphere. 547
Appl. Environ. Microbiol. 65:5357-5363. 548
38. Marín M, Pérez-Pantoja D, Donoso R, Wray V, González B, Pieper DH. 549
2010. Modified 3-oxoadipate pathway for the biodegradation of 550
methylaromatics in Pseudomonas reinekei MT1. J. Bacteriol. 192:1543-1552. 551
39. Nikodem P, Hecht V, Schlomann M, Pieper DH. 2003. New bacterial 552
pathway for 4-and 5-chlorosalicylate degradation via 4-chlorocatechol and 553
maleylacetate in Pseudomonas sp strain MT1. J. Bacteriol. 185:6790-6800. 554
40. Park W, Padmanabhan P, Padmanabhan S, Zylstra GJ, Madsen EL. 2002. 555
nahR, encoding a LysR-type transcriptional regulator, is highly conserved 556
among naphthalene-degrading bacteria isolated from a coal tar waste-557
contaminated site and in extracted community DNA. Microbiology 148:2319-558
2329. 559
41. Poole K, McKay GA. 2003. Iron acquisition and its control in Pseudomonas 560
aeruginosa: many roads lead to Rome. Front. Biosci. 8:d661-686. 561
42. Puskas LG, Inui M, Kele Z, Yukawa H. 2000. Cloning of genes participating 562
in aerobic biodegradation of p-cumate from Rhodopseudomonas palustris. 563
DNA Seq. 11:9-20. 564
43. Raymond KN, Dertz EA, Kim SS. 2003. Enterobactin: an archetype for 565
microbial iron transport. Proc. Natl. Acad. Sc.i U S A 100:3584-3588. 566
44. Ribbons DW. 1966. Bacterial oxydation of 2,3-dihydroxybenzoic acid - a new 567
oxygenase. Biochem. J. 99:30P-31P. 568
26
45. Ribbons DW, Senior PJ. 1970. 2,3-Dihydroxybenzoate 3,4-oxygenase from 569
Pseudomonas fluorescens: determination of the site of ring cleavage with a 570
substrate analogue. Biochem. J. 117:28P-29P. 571
46. Riegert U, Heiss G, Fischer P, Stolz A. 1998. Distal cleavage of 3-572
chlorocatechol by an extradiol dioxygenase to 3-chloro-2-hydroxymuconic 573
semialdehyde. J. Bacteriol. 180:2849-2853. 574
47. Saitou N, Nei M. 1987. The neighbor-joining method: a new method for 575
reconstructing phylogenetic trees. Mol. Biol. Evol. 4:406-425. 576
48. Screen J, Moya E, Blagbrough IS, Smith AW. 1995. Iron uptake in 577
Pseudomonas aeruginosa mediated by N-(2,3-dihydroxybenzoyl)-L-serine 578
and 2,3-dihydroxybenzoic acid. FEMS Microbiol. Lett. 127:145-149. 579
49. Sharma HK, Vaidyanathan CS. 1975. A new mode of ring cleavage of 2,3-580
dihydroxybenzoic acid in Tecoma stans (L.). Partial purification and properties 581
of 2,3-dihydroxybenzoate 2,3-oxygenase. Eur. J. Biochem. 56:163-171. 582
50. Shingler V, Franklin FC, Tsuda M, Holroyd D, Bagdasarian M. 1989. 583
Molecular analysis of a plasmid-encoded phenol hydroxylase from 584
Pseudomonas CF600. J. Gen. Microbiol. 135:1083-1092. 585
51. Shingler V, Powlowski J, Marklund U. 1992. Nucleotide sequence and 586
functional analysis of the complete phenol/3,4-dimethylphenol catabolic 587
pathway of Pseudomonas sp. strain CF600. J. Bacteriol. 174:711-724. 588
52. Smith MG, Gianoulis TA, Pukatzki S, Mekalanos JJ, Ornston LN, 589
Gerstein M, Snyder M. 2007. New insights into Acinetobacter baumannii 590
pathogenesis revealed by high-density pyrosequencing and transposon 591
mutagenesis. Genes Dev. 21:601-614. 592
27
53. Tamura K, Dudley J, Nei M, Kumar S. 2007. MEGA4: Molecular 593
Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol. Biol. Evol. 594
24:1596-1599. 595
54. Zhu M, Valdebenito M, Winkelmann G, Hantke K. 2005. Functions of the 596
siderophore esterases IroD and IroE in iron-salmochelin utilization. 597
Microbiology 151:2363-2372. 598
599
600
28
TABLE 1. Strains and plasmids used in this work 601
Bacterial strains or plasmids
Relevant genotype Source / reference
E. coli JM109 e14–(McrA–) recA1 endA1 gyrA96 thi-1 hsdR17 (rK– mK+)
supE44 relA1 Δ(lac-proAB) [F´ traD36 proAB lacIqZΔM15] Stratagene
S17λpir Tpr Smr recA thi pro rK- mK+ RP4:2-Tc:MuKm Tn7 pir (14) CC118λpir (ara-leu) araD lacX74 galE galK phoA20 thi-1 rpsE rpoB
argE(Am) recA1 pir (27)
P. reinekei MT1 Wild Type (10) MT1ΔdhbA Deletion mutant with a 872 bp excision in gene dhbA. This study Plasmids pEX18Ap ApR; oriT+sacB+, gene replacement vector with MCS from
pUC18 (29)
pPS858 ApR, GmR;blunt-ended pPS747 PstI-XbaI fragment ligated into the blunt-ended EcoRI site of pPS856. This plasmid carries a GmR-GFP cassette
(29)
pBBFLP TcR, source of inducible FLP recombinase (13, 29)
pABdhbA ApR; pEX18Ap derivative with PCR-amplified regions flanking the dhbA gene (696 bp upstream and 660 bp downstream) cloned in Acc65l/PstI restriction site.
This study
pAGBdhbA ApRGmR; pABmmlC derivative with GmR-GFP cassette cloned between PCR-amplified regions flanking the dhbA gene
This study
pGEM-T Easy ApR; cloning vector Promega pC23Ohis218 pGEM-T Easy derivative containing the catechol 2,3-
dioxygenase encoding gene from Pseudomonas veronii 1YdBTEX2
(32)
pGC23O ApR; pGEM-T Easy derivative with a 995 bp PCR-amplified region containing the dhbA gene cloned in the T-overhangs.
This study
602
603
29
TABLE 2. Primers used in this study. 604
Primer Sequence Product size
Target
KOC23OAF GGAGACTGCAGGCGCACTTGTACATGTT 718 dhbR KOC23OAR GAGAGGGATCCGCGGCCTCGAACGTTAT KOC23OBF GGAGAGGATCCGTGACCGCCACGGC 682 dhbB KOC23OBR3 GAGAGGGTACCGGCAGTGAGGTAATCCC pGC23OR TCACGCCACTCACGAACGG 995 dhbA pGC23OF TCAGATCGGTTTTCATGGG RT_rpsL_F ATGGCAACTATCAACCAGCTG 280 rpsL RT_rpsL_R ACCCGGAAGGTCTTTTACAC RT_mmlL_F CCAGATGCAGTAACCGGAGT 400 mmlL RT_mmlL_R GGTCATCACCCACCTTCACT RT_dhbI_F AGGTGTTCGCCTATGACCAG 199 dhbI RT_dhbI_R CGTCACGACCATGAATCAAC RT_orf4_F TCTATCGTCAACACGGCATC 205 orf4 RT_orf4_R TTGGCAAAGTTGTCTTCCTG RT_dhbE_F TTGAGGTCGAAGCGAAAGTT 395 dhbE RT_dhbE_R GTGGCCGTGACCAAAATAAC RT_dhbH_F CGGAGTAAGTCGCTCGTTGT 392 dhbH RT_dhbH_R GCAGATCTATCAGCGTCGTG RT_dhbA_F CATGATGTCATCGACGGTTT 389 dhbA RT_dhbA_R CGCAGGTGCTCGAAGATAAT
605 606
30
TABLE 3. Open reading frames (ORFs) and genes of the dhb gene cluster of P. 607 reinekei MT1 and surrounding regions. 608
Related gene
products a
Gene Gene
product (aa)
Putative function of gene product
Name/ size (aa)
Organism %aa
identity Accession nº (reference)
dhbR 320 LysR-type transcriptional regulator
CNE_BB1p12040 (301) C. necator N-1 55 YP_004688643
NahR (300) P. fluorescens Cg5 33 AAM09546 (40)
dhbA 287 2,3-DHB 3,4-dioxygenase
AXYL_02525 (313) A. xylosoxidans A8 71 YP_003978561
PsbC2 (283) R. palustris nº7 56 BAA82122 (42)
dhbB 233
2-Hydroxy-3-carboxy-muconic semialdehyde
decarboxylase
AXYL_02526 (236) A. xylosoxidans A8 65 YP_003978562
CmtD (243) P. putida F1 54 AAB62290 (18)
dhbC 489 2-Hydroxymuconic semialdehyde
dehydrogenase
H16_B0547 (492) C. necator H16 80 YP_728709
NahI (486) P. stutzeri AN10 70 AAD02149 (6)
dhbD 260 2-Oxopent-4-enoate hydratase
H16_B0548 (260) C. necator H16 77 YP_728710
AphE (260) C. testosteroni TA441
68 BAA88502 (4)
dhbE 266 4-Oxalocrotonate decarboxylase
H16_B0549 (262) C. necator H16 82 YP_728711
XylI (264) P. putida mt2 63 AAA25693 (26)
dhbF 63 4-Oxalocrotonate tautomerase
CNE_BB1p11970 (63) C. necator N-1 75 YP_004688636
NahJ (63) P. stutzeri AN10 58 Q9ZI54 (6)
dhbG 312 Acetaldehyde dehydrogenase
MhpF1 (312) P. putida GJ31 78 Q49KG0 (34)
dhbH
345 4-Hydroxy-2-ketovalerate aldolase
Avin_42120 (340) A. vinelandii DJ 88 YP_002801314
XylK (345) P. putida mt2 86 P51019 (26)
orf1 130 Hypothetical protein SrosDRAFT_45540 (120)
S. roseum DSM 43021
39 ZP_04473974
orf2 302 LysR-type transcriptional regulator
SalR1 (308) Pseudomonas reinekei MT1
66 ABH07018 (9)
HybH (231) P. aeruginosa JB2 52 AAC69490 (28)
orf3 312 LysR-type transcriptional regulator
Mmc1_0773 (315) Magnetococcus sp. MC-1
51 YP_864700
A1S_2405 (306) A. baumannii ATCC17978
36 ABO12824 (52)
orf4 253 Short chain dehydrogenase
Arad_7279 (254) A. radiobacter K84 51 YP_002540411
LinC (250) S. paucimobilis 49 AAZ14097 (35)
orf5 152 Hypothetical protein Arad_7278 (151) A. radiobacter K84 39 YP_002540410
orf6 254 Short chain dehydrogenase
Arad_7275 (256) A. radiobacter K84 57 YP_002540408
orf7 563 Hypothetical protein CNE_BB2p00960 (549) C. necator N-1 61 YP_004682758
orf8 458 Hypothetical protein CNE_BB2p00970 (460) C. necator N-1 65 YP_004682759
orf9 366 Hypothetical protein PRK13684 (360) P. fluorescens 49 BAD11010
orf10 831 RND family transporter CNE_BB2p00990 (813) C. necator N-1 68 YP_004682761
dhbI 276 2-Hydroxymuconic semialdehyde
hydrolase
Daro_3786 (274) D. aromatica RCB 65 YP_286985
TadF (286) D. tsuruhatensis AD9 62 AAX47253 (36) a The gene product with the highest amino acid sequence identity, as well as the 609 most closely related gene product of validated function, are given. 610 611
612
31
TABLE 4. Substrate specificity of DhbA. 613
Substrate Activity
(U/g protein)
Km
(μM)
Vmax
(U/g protein)
Vmax/Km
(relative)
2,3-DHB 93.8 2.9 ± 0.2 96.3 ± 2.0 1
2,3-DH-p-cumate 32.7 5.9 ± 0.7 32.7 ± 1.0 0.167
Catechol 6.8 n.d.b n.d.b n.d.b
3-Methylcatechol <1 n.d.b n.d.b n.d.b
Protocatechuate <1 n.d.b n.d.b n.d.b
Pyrogallol <1 n.d.b n.d.b n.d.b
a The specific activity was determined at a concentration of 100 µM of substrate in 614
phosphate buffer (50 mM, pH 8) 615
b n.d.: not determined 616
617
32
TABLE 5. Enzyme activities in cell extracts of P. reinekei MT1 grown on 2,3-DHB. 618
Enzyme Substrate Activity
(U/g protein)
Km
(μM)
Vmax
(U/g protein)
2,3-DHB
dioxygenase
2,3-DHB 37 n.d.b n.d.b
HCMS
decarboxylase
HCMS 640 0.74 ± 0.05 731 ± 17
HMS
dehydrogenase
HMS 141 1.2 ± 0.2 170 ± 7
HMS hydrolase HOPDA <5 n.d.b n.d.b
a The specific activity were determined in phosphate buffer (50 mM, pH 8) at a 619
concentration of 100 µM of 2,3-DHB and 5 µM of HCMS or HMS. 620
b n.d.: not determined 621
622
33
FIGURE LEGENDS 623
624
FIG.1. Chimeric organization of the dhb gene cluster. 625
Organization and comparison of the dhb gene cluster of P. reinekei MT1 with the cmt 626
cluster of P. putida F1 and the phenol catabolic gene cluster comprising meta-627
cleavage pathway genes of C. necator H16. Genes with high similarity to those of 628
the dhb gene cluster are framed in bold. HMS, 2-hydroxymuconic semialdehyde, 629
HCOMODA, 2-hydroxy-3-carboxy-6-oxo-7-methylocta-2,4-dienoate. 630
631
FIG. 2. Dendrograms showing the relatedness Dhb enzymes. 632
A. Extradiol dioxygenases 633
B. decarboxylases of the class II aldolase family acting in aromatic metabolism 634
C. 2-oxopent-4-enoate hydratase and 4-oxocrotonate decarboxylase 635
D. acetaldehyde dehydrogenase and 636
E. 2-hydroxymuconic semialdehyde hydrolases. 637
The evolutionary history was inferred using the Neighbor-joining method and the p-638
distance model after alignment of sequences using MUSCLE (19). All positions 639
containing alignment gaps and missing data were eliminated only in pairwise 640
sequence comparisons. Phylogenetic analysis were conducted in MEGA5 (53). 641
642
643
34
FIG. 3. Proposed pathway for 2,3-DHB degradation by P. reinekei MT1. A putative 644
route for 2,3-dihydroxy-p-cumate metabolism is also shown. 645
Enzymes: DhbA, 2,3-DHB 3,4-dioxygenase; DhbB, 2-hydroxy-3-carboxymuconic 646
semialdehyde decarboxylase; DhbC, 2-hydroxymuconic semialdehyde 647
dehydrogenase; DhbD, 2-oxopent-4-enoate hydratase; DhbE, 4-oxalocrotonate 648
decarboxylase; DhbF, 4-oxalocrotonate isomerase; DhbG, acetaldehyde 649
dehydrogenase; DhbH, 4-hydroxy-2-oxovalerate aldolase; DhbI, 2-hydroxymuconic 650
semialdehyde hydrolase. 651
652
FIG 4. Conversion of 2,3-DHB by extracts of E. coli JM109 (pGC23O) and structure 653
of the ring-cleavage product as deduced by 1H NMR analysis. 654
The sample for photometric analysis contained 50 mM phosphate buffer (pH 8.0) 655
and 50 µM 2,3-DHB. Spectra were recorded before the addition of 15 µL of cell 656
extract for 20 min at 2 min intervals. 1H NMR analysis was performed after 657
transformation of 1 mM 2,3-DHB in 50 mM phosphate buffer (pH 8.0). 658
659
660
35
FIG. 5. Absolute (top) and relative (bottom) expression levels of catabolic genes in 661
2,3-DHB-grown cells of P. reinekei MT1 as determined by quantitative real-time-662
PCR. The number of transcripts/ng of cDNA in gluconate (light grey bars) and 2,3-663
DHB-grown cells (dark grey bars) is shown (top). The error bars indicate standard 664
deviations. Relative expression values (bottom) represent n-fold change in the ratio 665
of gene expression between the target gene and the reference gene (rpsL) 666
compared to expression under noninducing conditions (for rpsL this ratio was set as 667
1). 668