Gene conversion in transgenic maize plants expressing FLP/FRT and Cre/loxP site-specific...

transcript

Plant Biotechnology Journal

(2006)

, pp. 345–357 doi: 10.1111/j.1467-7652.2006.00186x

Gene conversion in transgenic maize plants

Vesna Djukanovic

et al.

Gene conversion in transgenic maize plants expressing FLP/

and Cre/

site-specific recombination systems

Vesna Djukanovic

, Waclaw Orczyk

, Huirong Gao

, Xifan Sun

, Nicole Garrett

, Shifu Zhen

, William Gordon-Kamm

, Joanne Barton

and L. Alexander Lyznik

Pioneer Hi-Bred International, A DuPont Business, Research Center, 7300 NW 62nd Avenue, Johnston, IA 50131-1004, USA

Plant Breeding and Acclimatization Institute, Radzikow, 05-870 Blonie, Poland

Summary

DNA recombination reactions (site-specific and homologous) were monitored in the

progeny of transgenic maize plants by bringing together two recombination substrates

(docking sites and shuttle vectors) in the zygotes. In one combination of transgenic events,

the recombination marker gene (yellow fluorescent protein gene,

) was activated in

2% of the zygotes receiving both substrates. In other crosses, chimeric embryos and

plants were identified, indicative of late recombination events taking place after the first

mitotic division of the zygotes. The docking site structure remained unchanged; therefore,

all recovered recombination events were classified as gene conversions. The recombinant

gene segregated as a single locus in subsequent generations. The recombination

products showed evidence of homologous recombination at the 5

end of the

marker

gene and recombinational rearrangements at the other end, consistent with the conclusion

that DNA replication was involved in generation of the recombination products. Here, we

demonstrate that maize zygotes are efficient at generating homologous recombination

products and that the homologous recombination pathways may successfully compete with

other possible DNA repair/recombination mechanisms such as site-specific recombination.

These results indicate that maize zygotes provide a permissive environment for homologous

recombination, offering a new strategy for gene targeting in maize.

Received 12 September 2005;

revised 15 December 2005;

accepted 21 December 2005.

Correspondence

(fax +1 515 270 3444;

e-mail alex.lyznik@pioneer.com)

Keywords:

DNA recombination, gene

conversion, maize, transgenic plant,

Zea mays

Introduction

The low efficacy of currently used plant genetic transformation

technologies restricts the practical application of more

sophisticated genetic engineering approaches, such as site-

specific or homologous recombination, for transgenic crop

production. At the same time, DNA recombination-based

techniques have been intensively developed, making chro-

mosomal

in vivo

manipulations feasible, if not routine, in

other organisms (Sorrell and Kolb, 2005). A combination of

site-specific and homologous recombination has produced

predesigned chromosomal rearrangements in a variety of

mouse tissues with unprecedented precision (Capecchi,

2001; Yu and Bradley, 2001). These techniques have also

been applied to gene targeting in

Drosophila

2002) and for plastid transformation in tobacco, making the

integration process more accurate and efficient (Lutz

2004).

In plants, most chromosomal DNA rearrangements have

been realized by the application of site-specific recombina-

tion: rice and maize are amongst the crop species used in

such experiments (Srivastava and Ow, 2001; Zhang

2003). FLP- or Cre-mediated chromosomal excisions have

been studied in the progeny of genetic crosses in tobacco and

Arabidopsis

as a flexible means to generate clonal sectors

in embryonic tissues (Kilby

., 1995; Gidoni

., 2001).

Ac/Ds-mediated transposition of

sites has been used in

order to bracket chromosomal fragments destined for

deletion by Cre recombinase (Medberry

., 1995; Coppoolse

., 2005). Chromosomal inversions in the progeny of

Arabidopsis

plants expressing the Cre/

system have been

induced by a similar process (Osborne

., 1995). The

Vesna Djukanovic

et al.

(2006),

, 345–357

feasibility of site-specific recombination for the interspecies

transfer of a chromosome arm has been demonstrated using

Arabidopsis

and tobacco cells (Koshinsky

., 2000).

Locus-specific integration of foreign DNA has been accom-

plished using either site-specific recombination pathways

or homologous recombination mechanisms (Albert

., 1995;

Vergunst

., 1998; Srivastava and Ow, 2001; Terada

2004; Shaked

., 2005).

Gene conversions (transfer of genetic information from

one DNA strand to a recipient, homologous sequence) have

been detected in recombination products of a number of

plant species. One classic genetic approach relies on the

molecular evaluation of recombination events between

naturally occurring observable alleles, such as the genes

involved in pigment deposition (Xiao

., 2000; Li

2001). Such analysis has been complemented by studying

recombination events between ectopic homologous sequences

of transgenic marker genes (

gusA, luc, nptII

) (Tovar and

Lichtenstein, 1992; Shalev and Levy, 1997; Orel

., 2003).

In a recent study, Molinier

. (2004) recovered five

Arabidopsis

plants showing uniform expression of an inter-

chromosomal marker gene (

) amongst 1000 000 pro-

geny, and all were determined to have resulted from gene

conversion events without crossing over.

The frequency of gene conversion is relatively low, but can

be enhanced by double-strand breaks (Puchta, 2005). These

can be introduced by DNA-damaging agents (Tovar and

Lichtenstein, 1992; Molinier

., 2004), excision of tran-

sposable elements (Xiao and Peterson, 2000) or the expression

I restriction endonuclease (Orel

., 2003). As in

other eukaryotic organisms, free DNA ends activate the DNA

repair mechanism, resulting in gene conversions (Gorbunova

and Levy, 1999). DNA repair can take place by non-homologous

end-joining and/or homologous recombination, both of which

are tightly regulated processes (Orel

., 2003). Gene

conversions also include somatic recombination and are

implicated in the creation of genetic diversity (Hu

., 1998;

Puchta, 2005).

DNA replication has been established as yet another

important factor in homologous recombination (Rothstein

., 2000; Kuzminov, 2001). Indeed, there are naturally

occurring mechanisms in maize cells that generate recom-

binant DNA structures upon replication. Recently, Oldenburg

and Bendich (2004) found that maize chloroplast DNA

replicates through a recombination-dependent process with

either template switching or strand invasion occurring in the

inverted repeat sequences. We have previously demonstrated

the enhancement of T-DNA homologous recombination in

maize only when the wheat dwarf virus (WDV) replication

system was incorporated into

Agrobacterium

vectors (Zhao

., 2003). In addition,

transposition/recombination

has been shown to be dependent on DNA replication in

conjunction with strand-nicking transposase activity (Laufs

., 1990; Wirtz

., 1997).

Taking these observations into consideration, we designed

experiments to induce and monitor DNA recombination

reactions in the progeny of transgenic maize plants during

the early stages of embryo development. The recombination

substrates were delivered to the developing plant organism

(newly formed zygotes) rather than to cultured cells. We

show that both site-specific and homologous recombination

can be induced and subsequently detected in the developing

maize embryos and plants.

Results

Maize lines were prepared that contained either a shuttle

vector (SV) or a docking site (DS). SVs were equipped with

sites to induce FLP-mediated intrachromosomal

excisions, one

site for interchromosomal Cre-mediated

integration, 693 bp with homology to the first maize ubiquitin

intron, and the WDV replication-associated protein (Rep) with

its own origin of replication (

). The

sequence provided

the replication function for the excised episomal DNA. The

functionality of the replication elements has been tested

previously and published elsewhere (Zhao

., 2003). The

vectors containing DSs had two functional recombinases, FLP

and Cre, each controlled by converging maize ubiquitin

promoters. The first intron of the ubiquitin promoters were

each modified to contain

sites (Figure 1). The

promoterless yellow fluorescent protein gene (

), contain-

ing the ZsYellow coding sequence, served as a recombination

marker to monitor either site-specific (Cre/

) or homo-

logous recombination between SV and DS. Once the

recombination product was selected (the recombinant

allele), genetic segregation analysis (test-cross) and

polymerase chain reaction (PCR)-based genotyping were

applied to differentiate between the recombination pathways

(either inter-/intrachromosomal or episomal recombina-

tion). A footprint of FLP-mediated excision that segregated

away from

served as an indication of the ectopic gene

targeting event (gene conversion between the episomal

targeting vector and the chromosomal locus, followed by

random integration of the recombined targeting vector).

In addition, Southern blots were used to determine the

structure of the recombination products in order to dis-

criminate between site-specific and homologous recombi-

nation pathways.

Gene conversion in transgenic maize plants

(2006),

, 345–357

A codon-optimized phosphinotricine acetyltransferase

) gene was used as a selectable marker to produce 20

independent transgenic DS and SV plants each. One DS-

containing plant was selected for the subsequent crosses on

the basis of single-copy integration of T-DNA and positive FLP

and Cre recombinase activity (data not shown). This plant was

selfed to produce homozygous progeny. SV-containing plants

were selected on the basis of single-copy T-DNA integration

patterns. The identifiers 7760, 7766 and 7773 were assigned

to the individual SV transformation events (T0 plants).

Parental transgenic plants carrying SV and DV were

crossed to produce F1 embryos (Table 1, Figure 2A). About

20 days after pollination, immature kernels were screened

for the accumulation of YFP, indicating a recombination

event. The DS

7773 crosses produced 2164 kernels. The

seeds, tissues, seedlings and plants derived from this cross

showed a number of different phenotypes. Some kernels were

found to contain YFP uniformly expressed in the endosperm

tissue (Figure 2B, part a). None of these kernels contained

the YFP in embryos, presumably as a result of double fer-

tilization. This result clearly demonstrated the occurrence of

recombination of the SV (whether mobilized or not) before

the first division of fertilized polar nuclei. Recombination also

took place after the first division of polar nuclei producing

sectors of yellow fluorescence within the endosperm tissues

(data not shown).

Embryos were rescued from harvested kernels and 20

embryos were found to be uniformly modified (Table 1,

Figure 1 General strategy for monitoring DNA recombination between a docking site (DS) and a shuttle vector (SV) in maize zygotes. The SV contains the viral replication-associated protein gene (Rep), the viral origin of replication (ori ) and the promoterless yellow fluorescent protein gene (YFP) flanked by two FRT sites in direct orientation for FLP-mediated excision (see also Figures 5 and 7). The DS contains two convergent expression units, one for the expression of FLP recombinase (FLP) and the other for Cre recombinase (cre). The large green arrows represent the maize ubiquitin promoters. Two recombination sites, FRT and loxP, are positioned within the first maize ubiquitin intron (blue box and red circle, respectively). The maize ubiquitin promoter can be placed in front of the YFP gene either by homologous recombination around the loxP site (HR) or Cre-mediated site-specific integration (SSI). There is no homology around the FRT site (red box). The recombinase-mediated cassette exchange (RMCE) should engage both FRT and loxP sites in order to exchange the DNA fragment located between these sites. In the case of either SSI or gene conversion with crossing over, two products of the reciprocal recombination reaction should be identified and the final structure of independent recombination events should be the same (recombination pathway B). The formation of episomal targeting vector was evidenced by detection of the excision footprints and segregation analysis. The recombination pathway documented in this paper is marked by bold red arrows (pathway A).

Vesna Djukanovic

et al.

(2006),

, 345–357

Figure 2B, part b). Assuming that 40% of the zygotes did not

receive the SV on fertilization (based on segregation ratios

and quantitative PCR-based zygosity tests of the T1 SV

plants), recombination occurred in 1%

2% of the zygotes

containing both substrates. The presence of chimeric tissues

in some rescued embryos and seedlings indicated that

recombination also took place after the first division of the

zygote (Figure 2B, parts e and f). Six F1 plants (four YFP

plants and two YFP

plants) were recovered and test-crossed

with untransformed ‘Hi-II’ (A188

B73) plants. Most crosses

between plants expressing YFP and ‘Hi-II’ plants resulted

in progeny with the expected segregation ratio of YFP

the pollen grains and F2 kernels (Figure 2A,B, parts c and d).

One event (Y36) showed silencing of the

locus, as

evidenced by PCR-based detection of the

gene in

the non-fluorescent F2 kernels (seven kernels of the 20

analysed showed a PCR-amplified

fragment).

The presence of points of fluorescence in the scutellar

tissues of the DS

7766 crosses was indicative of numerous YFP

recombination/activation events during embryo develop-

ment (Figure 2B, part g). These events were permanent

genetic modifications, as uniform populations of cells ex-

pressing YFP could be derived from callus induction (Figure 2B,

part h) and the phenotype was passed from generation

to generation. Recombination/activation events were also

observed as occasional streaks or clusters of yellow fluor-

escence in the coleoptiles examined for YFP expression

(Figure 2B, part i).

Experiment Cross No. of crosses No. of embryos

YFP positive embryos

Whole Half Sectors

2003 7773 × DS 3 324 3 nd nd

DS × 7773 3 191 2 nd nd

2004 7773 × DS 10 1219 15 4 12

DS × 7773 4 430 0 2 2

Total 20 2164 20

nd, not determined.

Table 1 Yellow fluorescent protein (YFP) in F1 embryos derived from two sets of genetic crosses between parental plants containing the docking site (DS) and shuttle vectors (7773). The female parental plants are listed first

Figure 2 Activation of yellow fluorescent protein gene (YFP) expression in the progeny of transgenic parental plants containing docking sites (DSs) and shuttle vectors (SVs). (A) DNA recombination activity was tested in the developing embryos by crossing DS-containing plants with SV-containing plants. All YFP+ embryos reported in this paper originated from the DS × 7773 cross. Segregation of the YFP+ phenotype in the F2 progeny kernels is shown in the inserted table. A sample of F2 YFP+ segregating kernels is shown in (B), part (d). The Y38 embryo did not germinate, and no YFP+ kernels were recovered from the Y36 plant. (B) The F1 kernels were screened for YFP+ endosperms (a) and embryos (b). F1 plants produced about 50% yellow fluorescent pollen grains (c). The expression of YFP in half of the scutellum tissue is shown in (e). Such embryos produced chimeric plants, indicating that the recombination events occurred after the first division of the zygotes (f). The DS × 7766 cross resulted in yellow fluorescence sectors scattered around the scutellar tissue (g). The embryos cultivated on callus induction medium produced uniform YFP+ tissue (h). The recombinant YFP+ phenotype was observed only as small sectors, streaks or single cells within the coleoptile tissue (i).

Gene conversion in transgenic maize plants 349

Excision (mobilization) of SVs was monitored by PCR

analysis at the DNA level (Figure 3). Footprints of SV excision

(exc), catalysed by FLP recombinase, were frequently observed

in the progeny of the initial crosses, unless the flanking FRT

sites were truncated during the random integration of T-DNA.

Of 62 progeny seedlings of the DS × 7760 cross, 26 scored

positive for the PCR-amplified excision footprint, giving

an overall 80%−90% efficiency of excision (a subjective

estimation based on PCR data). However, only one of the

samples analysed retained the YFP coding sequence in

the genomic DNA after excision (Figure 3A).

In the Y37 event described in Figure 2, yellow fluorescence

indicated that the recombined SV was retained after excision.

In addition, this material provided evidence that the re-

combinant YFP-r was not linked to the excision footprint (exc),

as shown by segregation of YFP-r and excision footprints in

the progeny of the Y37 test-cross (Figure 3B). The excision

footprints were found in seedlings both with and without

the YFP-r gene (Y37-S vs. Y37-D). There were 11 YFP-r/exc and

13 YFP-r/– seedlings amongst the 48 analysed. In addition,

the recombinant YFP-r gene segregated independently from

the DS in the F2 progeny. The same sample of seedlings

showed 11 YFP-r/FLP, 13 YFP-r /–, 15 –/FLP and nine –/– geno-

types. This observation was verified by segregation of YFP-r

from the Cre coding sequence. In this case, of the 31 analysed

plants, eight, eight, seven and eight seedlings showed YFP-r/cre,

YFP-r/–, –/cre and –/– genotypes, respectively.

A maize ubiquitin promoter driving the expression of YFP

was found in the recombinant progeny of the DS × 7773

cross. The expression pattern of yellow fluorescence in the

leaf tissue resembled that observed in transgenic maize

plants containing the ubi:ZsYellow vectors (the ZsYellow cod-

ing sequence controlled by the maize ubiquitin promoter)

(Figure 4A). PCR analysis of genomic DNA from the re-

combinant progeny (Y37 and Y32) showed a DNA fragment

representing the junction between the YFP coding sequence

and the 5′ segment of the first maize ubiquitin intron (the

junction sequence not present on the SV) (Figure 4B). The

amplified fragment was sequenced to verify that it con-

tained the loxP site as well as the closely linked BamHI

restriction site (Figure 4C). This arrangement of sites was only

found in SVs and the cre gene being a part of the DS. Both

elements shared the 693-bp region of homology and loxP

sites. The region of homology shared by the SVs and other

ubiquitin promoters [endogenous and driving expression of

the selectable marker gene (moPAT )] was restricted to a 15-

bp segment around the junction site of the recombinant

product (Figure 4C, sequences boxed in green).

PCR analysis was combined with Southern blots to map

possible modifications of the DS. Seven pairs of primers with

homologies across the DS were used to amplify the expected

fragments from the genomic DNA of the original parental

plants (before DS) (Figure 5A) and plants containing the

segregated DS locus after recombination (after Y37-D)

(Figure 5C). The same hybridization pattern was observed on

Figure 3 Polymerase chain reaction (PCR)-based screening for the excision footprints in F1 seedlings of the DS × 7760 cross (A) and F2 progeny of the DS × 7773 cross (B). Sixty-two DNA samples from 1-week-old seedlings were used as templates for the amplification of excision footprints. Lane 12 shows the amplification of the footprint sequences from plasmid DNA (top four samples) and four PCRs without a DNA template (bottom four positions). Selected samples (marked by white boxes and numbered according to their plate position) were tested for the presence of the yellow fluorescent protein (YFP) coding sequence (two bottom photographs in A). Lanes M and P represent DNA molecular markers and plasmid DNA used as a template for amplification of the YFP coding sequence, respectively. DNA samples from Y37-S (YFP+) and Y37-D (YFP−) were tested for the presence of the excision footprint (B). The panels marked as ADH show the amplification of the 647-bp fragment of the endogenous alcohol dehydrogenase locus, whereas the lower panels represent the amplification of the 253-bp long fragment originating from the excision footprint (Exc.). As in (A), lane 12 shows the amplification of plasmid DNA containing corresponding sequences.

350 Vesna Djukanovic et al.

Southern blots containing genomic DNA from parents and

progeny regardless of whether the FLP or cre probe was used

in combination with a number of diagnostic digestions

(Figure 5D–F). We also sequenced a genomic fragment of

Y37 containing the 5′ end of the FLP gene, which showed

that the FRT site embedded within the first ubiquitin intron of

the FLP gene remained unchanged (data not shown). These

observations demonstrated that the structure of the DS was

not changed during SV recombination.

Next, we determined the length of the maize ubiquitin pro-

moter fragment that was connected to the YFP-r recombinant

product. Two restriction sites located within the first ubiquitin

intron, XhoI and ApaI, were present in both independently

produced recombinant products: Y32 and Y37 (Figure 6).

The ApaI site was 327 bp from the junction site. The ScaI site

positioned 1.21 kb from the junction site was retained only

in the Y32 recombinant product. The SphI site, from the vec-

tor backbone, was preserved in the Y32 event, but not in the

Y37 event (Figure 6). Taken together, these results indicated

that gene conversion tracks in the isolated events were not

necessarily of the same length. This observation is consistent

with the structural features of gene conversion products

Figure 4 Analysis of the recombinant 5′ junction sequence in the YFP+ events. (A) Expression pattern of yellow fluorescent protein (YFP) in leaves from untransformed seedlings (A188 × B73), transgenic seedlings containing the YFP gene driven by the maize ubiquitin promoter (Ubi::Zs-Yellow) and an F1 seedling identified as the Y32 event (recombinant Y32). (B) The agarose gel shows the polymerase chain reaction (PCR) products obtained from the amplification of the internal YFP fragment using DNA extracted from the shuttle vector (SV), recombinant Y37 and Y32, and untransformed seedlings (underlined segment marked as ‘ZsYellow’). The same DNA templates were used for the amplification of the junction site between the YFP coding sequence and the maize ubiquitin promoter (the underlined segment marked as ‘ZsYellow/ubi promoter junction’). Lane P shows a PCR product originating from the plasmid DNA template containing the corresponding sequences. (C) Sequence of the junction site between YFP-r and the maize ubiquitin promoter. The yellow-boxed sequences were present in the SV, the docking site (DS) and all identified recombinant events (Y32, Y35, Y36, Y37). The blue-boxed sequences could be found in the DS, the endogenous ubiquitin promoters (Ubi) and all recombinant events. The green box highlights the 15-bp fragment present in all sequences under consideration. The left side of the sequence extended into the maize ubiquitin promoter, whereas the right side continued into the YFP coding sequence in the recombinant and SV DNAs.

Figure 5 The structure of the docking site (DS) before and after gene conversion events. Schematic representation of the DS. Red lines represent DNA fragments expected to be amplified by polymerase chain reaction (PCR). Their numbers correspond to the lane numbers on the agarose gels (A, B, C). Panel (A) shows the products of PCR amplification from genomic DNA isolated from the DS-containing parental plants. Panel (C) shows the PCR products amplified from genomic DNA isolated from F2 seedlings containing the segregated DS after a gene conversion (Y37-D). Panel (B) represents the PCRs containing the DNA template from original, untransformed plants (A188 × B73). Southern blot analysis of the DS before and after gene conversion (D,E,F). The restriction enzymes and the size of DNA fragments hybridizing either to FLP or cre probe are shown below the diagram of the DS. Lanes are marked according to the previously described conventions.

generated in other systems, and discounts the possibility of

site-specific recombination as the source of the recombinant

products.

Additional information on DNA rearrangements during the

recombination process was provided by sequences from genomic

DNA fragments amplified by PCR-based genome walking.

Genomic DNA was digested with a number of restriction

sites and adaptors were ligated to blunt-ends (Universal

GenomeWalker, BD Biosciences, San Jose, CA) or the genomic

fragments were religated to form a circular template for

PCR amplification. It was demonstrated, for the 7773 event,

that the SV integrated into the genomic sequence present on

the Zea mays genomic clone ZMMBMa0491I01 (GENBANK

accession number CC649090.1). As a result of integration,

more than 100 bp were removed from the right border of

T-DNA. However, the intact FRT site was preserved (Figure 7A).

A three base pair microhomology (CAC) was identified at

the junction site. A partial left border sequence (12 bp) was

directly ligated into the genomic sequence. Ten overlapping

DNA fragments from the Y37 event (four fragments cut

with XbaI and amplified using the CATGTGGTACTTCATGGT-

CATCTCCTCCTTC/GTACAAGGCCAAGAGCGTGCCCAGCAA-

GAT pair of primers specific to the 5′ and 3′ ends of the YFP

coding sequence, respectively, and six fragments cut

with EcoRI and amplified by the GTGTAAAGCCTGGGGT-

GCCTAATGAGTGAG/GAGATACCAACAGCGTGAGCTATGA-

GAAAG pair of primers) were subcloned and sequenced to

produce the 3′ flanking sequence of the YFP-r recombinant

gene. We found that the 3′ end of the recombinant YFP-r

gene flipped over and reconnected to the 5′ region of the SV

in front of the loxP site within the inverted repeat sequence

of the plasmid backbone (TATGACCATGATTACG)

(Figure 7A). The sequence continued into at least 479 bp of

the pUC origin of replication. The same arrangement of the

recombinant YFP-r was identified in genomic DNA from the

Y32 event. In this case, the genomic DNA was cut with FspI

and the GenomeWalker adaptor was ligated to support PCR

amplification across the fragment with the CAGCTGAC-

CGAGCACGCCATCGCCTT/Ap1/Ap2 primers. In two inde-

pendent sequencing projects, the recombined inverted

repeat sequence was found to be missing 1 bp in the same

location (TATGAC ATGATTACG).

Discussion

The recombination system presented in this report was

complex. Random integration of SVs and DSs, followed by a

crossing strategy that brought these elements together,

provided a variety of potential recombination substrates.

Although inter- or intrachromosomal recombination reactions

were possible, the predesigned substrate was a mobilized

episomal DNA molecule with the potential of being amplified

by the viral WDV replication system. It provided the opport-

unity for recombination between episomal vector DNA

and chromosomal loci.

FLP-mediated site-specific recombination was used to gen-

erate extrachromosomal SVs and, at the same time, to activate

the WDV replication mechanism(s). The 7773 event formed

excision products that subsequently engaged in DNA

recombination reactions, yielding YFP expression in embryos,

endosperms and plants. In a number of other crosses involv-

ing different events containing the same SV, FLP-mediated

excisions occurred at relatively high frequency; however, they

did not lead to the activation of YFP. Instead, the YFP gene

was frequently lost (Figure 3A). Our results show that the FLP/

FRT site-specific recombination system performs similarly to

the Cre/loxP system in chromosomal excisions in the maize F1

embryos after genetic crosses (Zhang et al., 2003).

The reciprocal products of either FLP- or Cre-mediated site-

specific integration (intermolecular site-specific recombination)

Figure 6 Southern blot analysis of the recombinant YFP-r gene. The positions of the restriction sites and the length of the fragments hybridizing to the yellow fluorescent protein gene (YFP) probe are presented along the diagram of the putative gene conversion product. Both blots were hybridized with the 32P-labelled ZsYellow probe and all digestions included the NotI restriction enzyme in addition to that specified for each lane. The ‘vector DNA’ lanes represent the digestion/hybridization pattern of the original vector DNA used to produce transgenic shuttle vector plants. All other descriptions are according to the conventions of this paper.

were not found in the isolated recombination products, and

the promoter fragments attached to the activated YFP-r gene

were of a different size. These results rule out the involve-

ment of the site-specific recombination pathways. The vectors

were designed to monitor Cre-mediated integration reac-

tions, described as the promoter displacement strategy

(Albert et al., 1995), or a variant of the recombinase-

mediated cassette exchange (RMCE) strategy, as described

in Lauth et al. (2002). Such reactions, if they occurred, were

less frequent than gene conversions in maize zygotes under

our experimental conditions. In this context, it is interesting

to note that homologous recombination seems to be a

more efficient tool than Cre recombinase for chromosomal

rearrangements in Drosophila (Egli et al., 2004). The intrinsic

deficiency of FLP and Cre recombinases in catalysing the

intermolecular (interchromosomal) recombination reactions

might contribute to these negative results. It can also be

concluded that the mobilized SVs were not optimal substrates

for site-specific recombination.

We recovered complete gene conversions at the rate of

about 1%−2% in zygotes receiving both substrates. For such

a high frequency of gene conversions, one would have to

assume that physical damage (double-strand breaks) pro-

bably occurred in the recombining homologous regions.

All identified gene conversion events involved the maize

ubiquitin intron containing loxP, suggesting that this site may

have played a role in the initiation of gene conversion events.

One possibility is that site-specific recombinases, such as DNA

topoisomerases, function by making transient breaks in

DNA (Woodfield et al., 2000). When active DNA synthesis

occurs, a nicked loxP site could cause a replication fork to

collapse, resulting in the formation of a double-strand break

(Kuzminov, 2001) and activation of the double-strand break

repair system (Britt and May, 2003). FLP can induce homologous

Figure 7 Sequence analysis of the recombinant YFP-r product. The shuttle vector in the 7773 transformation event integrated into a genomic sequence shown as the upper strand in (A). The wheat dwarf virus (WDV) origin of replication is marked as ori with an arrow pointing towards the replication direction. Two inverted repeats flanking the promoterless yellow fluorescent protein gene (YFP) are depicted as black arrows and the actual sequence is printed below. The inverted repeat sequence in the recombinant product (YFP-r) is shown without one nucleotide (red arrow), the deletion identified through sequencing of Y37 and Y32. The white boxes illustrate either the 5′ or 3′ region of the first maize ubiquitin intron. A proposed chain of events leading to the formation of the YFP-r recombinant product is shown in (B). Newly synthesized DNA is marked as red. FLP-mediated excision of the shuttle vector forms a viral-like replicon. The replication process is hindered by nicking activity of Cre acting on loxP (a). Incomplete DNA molecules engage in homologous recombination at the site of inverted repeats, a process consistent with the replication-dependent recombination (RDR) mechanism as described elsewhere (Jeske et al., 2001) (b). Another round of DNA synthesis generates DNA molecules with 3′ ends invading chromosomal homologous regions (template switching) (c). The relative orientation of the ori site and the YFP marker gene precludes direct engagement of the DNA replicating molecules in generating YFP-r. Moreover, it justifies a need for YFP inversion, as documented by the sequence analysis of YFP-r.

recombination by a single-strand annealing mechanism in

yeast and is able to cut a single FRT site (trans horizontally)

(Prado et al., 2000). Synapsis between two recombination

sites is not required to trigger strand cleavage, thus making

the FLP or Cre proteins capable of generating double-strand

breaks (Voziyanov et al., 1999). The role of the Cre/loxP

system in stimulating homologous recombination in maize is

a subject requiring further evaluation.

Homologous recombination has been studied in Drosophila

using episomal DNA vectors mobilized by heat-shock-inducible

FLP recombinase and activated by I-SceI expression (Gong

and Rong, 2003). In Drosophila, the gene conversions were

non-polar, producing modification to either the gene

targeting vector or the target site (Rong et al., 2002). In this

report, modifications occurred in the SV, which then app-

arently underwent random integration, resulting in subsequent

stable inheritance of the modified locus. The outcome resem-

bles the products of ‘ectopic targeting’ frequently found in

plant gene targeting experiments (Offringa et al., 1993;

Hanin et al., 2001). Although such polarity of gene con-

version events has been observed in maize previously (Li

et al., 2001), more events are needed in order to draw more

general conclusions about the direction of crossover resolu-

tion in our system. The frequency range for Drosophila gene

targeting events was one per 500–30 000 gametes (Rong

et al., 2002). Other factors, such as large regions of homo-

logy, may generate the gene conversion events preferentially

associated with crossovers (Xiao et al., 2000; Li et al., 2001).

Short inverted repeats that flanked the original promoterless

YFP gene were identified as a junction site in the recom-

bined 3′ end of YFP-r. The alteration of the inverted repeat on

recombination (one nucleotide was deleted) is clearly indicative

of the involvement of DNA repair mechanisms in the recom-

bination process. The strategy described in this paper relied

on homologous/site-specific recombination at the 5′ end of

the YFP marker gene to produce seed fluorescence. There

was no homology with the DS at the 3′ end. FLP-mediated

excision of the YFP marker gene should generate the insertion

type of the recombinant substrate. A similar assay based on

the use of a fluorescent seed marker has recently been

described for monitoring homologous recombination in

Arabidopsis (Shaked et al., 2005). Interestingly, the 2.5-kb

homology region at the 3′ end of the green fluorescent pro-

tein marker gene (GFP) was sufficient to generate the 3′ end

homologous recombination events in all selected fluorescent

seeds. This is an encouraging observation, indicating that

the gene replacement type of targeting vectors (a gene of

interest flanked by homologous regions) may produce inser-

tions (crossovers) in maize zygotes/egg cells as well.

In our experiments, the replication function was contingent

on mobilization and we could not dissociate mobilization

and replication; thus, the role of DNA replication in gene con-

version cannot be fully assessed from the experimental data

presented here. Nevertheless, it is possible that the replication

process supplied recombinogenic DNA molecules that

stimulated DNA recombination, as exemplified by the

replication-dependent recombination (RDR) mechanism

(Jeske et al., 2001), and also proposed for the replication of

geminiviruses (Preiss and Jeske, 2003).

The replicated DNA could recombine with genomic DNA,

thus producing gene conversion events after stable integra-

tion into chromatin structures (Figure 7B). There is a striking

similarity between the recombination products reported here

and the recombinant structures formed by the replication

pathways in other organisms. These reactions might utilize

the synthesis-dependent strand annealing (SDSA)-like

mechanism, known to be common in plant recombination

reactions (Orel et al., 2003), and frequently cited to explain

the strong bias for recovery of gene conversions without

crossing over in other eukaryotic cells (Quintana et al., 2001).

The extensive chromosome replication (ECR) model, as proposed

by George and Kreuzer (1996), could also be considered in

the context of our data, as it stipulates that each broken end

initiates recombination and does not reconnect to the other

end. The model was proposed to explain the RDR reactions

between inverted repeats in bacteriophage T4; the same

mechanism was also found in geminiviruses (Preiss and Jeske,

2003). In our system, it seems that one broken end engaged

the inverted repeats, thus producing the inversion of the

promoterless YFP gene, while the other end recombined with

the maize ubiquitin promoter of the DS.

The induction of DNA recombination in the progeny of

genetic crosses has limitations. More time is required to

produce transformation events compared with direct trans-

formation methods, and the identification of desired events

requires the establishment of several independent transgenic

lines. Nevertheless, the ease of cross-pollination, the oppor-

tunity to generate a large quantity of progeny seeds and a

seed-based fluorescent assay can make the genetic crossing

strategy presented here an attractive alternative for studying

and producing gene targeting events in maize.

Experimental procedures

Vector constructions

All expression vectors used in this study contained the pSB11

plasmid backbone integrated into the super-binary vector

pSB1 residing in Agrobacterium strain LBA 4404 (Komari and

Kubo, 1999). The DS vector was created by sequential intro-

duction of the following expression cassettes into the pSB11

vector: the HindIII/XmaI fragment of PHP 17953 containing

the moPAT expression unit driven by the rice actin promoter

ligated into the corresponding sites of the pSB11 vector; the

mocre expression cassette (the PvuII fragment from PHP

17952) cloned into the SmaI site; and the HindIII fragment

from PHP 17958 containing the FLP expression cassette

cloned into the unique HindIII site. The cre expression unit

contained the loxP site integrated into the EcoRI site of the

first maize ubiquitin intron that was a part of the maize

ubiquitin promoter driving the expression of cre. In the same

position, the FLP expression cassette contained a full-length

(599-bp) inverted repeat from the 2 µm plasmid of yeast with

its original FRT site. The SV construction was based on a gusA

expression vector containing the WDV replication unit (the

rep gene and the LIR and SIR elements), as described in Zhao

et al. (2003). First, the synthetic FRT site (GAGTTTTCTGGC-

ACACCGAAGTTCCTATTCCGAAGTTCCTATTCTCTAGAAA-

GATAGGAACTTCCCGTTTTTTCGCTAAGG; the FRT sequence

is in italic) was inserted between LIR and the rep coding

sequence using PCR with the gusA expression vector as a

template and the rep (TGCAGATGTGGTGATCCATC) and the

gusA (CGGCTTTCTTGTAACGCGCT) primers. Second, the gusA

coding sequence was replaced with the cyan fluorescence

protein (AmCyan) coding sequence by double digestion of

the FRT-containing vector with the BamHI/PacI restriction

endonucleases and a direct ligation of the corresponding

fragment containing the cyan coding sequence. Third, the

recombination marker element (loxP-YFP-pinII ) was com-

bined with the CFP/FRT-containing vector by transferring

the entire CFP/LIR/FRT/rep expression unit as the BssHI/KspI

fragment into the corresponding restriction sites of the

pCR2.1-TOPO cloning vector containing the loxP-YFP-pinII

element. The genetic elements of the fluorescent protein

genes were obtained from Clontech Laboratories, Palo Alto,

CA, USA (Matz et al., 1999). Finally, the T-DNA vector with

two FRT sites flanking the recombination marker element

was created by in vitro site-specific recombination catalysed

by the FLP protein, exactly as described in Zhao et al. (2003).

The preparation procedure of the Agrobacterium strains for

embryo cocultivation is also described in the same reference.

Transformation and plant regeneration

Zea mays (‘Hi-II’) immature embryos were transformed by a

modified Agrobacterium-mediated transformation procedure,

as described in Komari and Kubo (1999). Briefly, 10–12-day-old

immature embryos (1–1.5 mm in size) were dissected from

sterilized kernels (20 min in 20% bleach solution containing

4 drops/L Tween-20) into a liquid medium [4.0 g/L N6 Basal

Salts (Sigma C-1416; Sigma, St. Louis, MO, USA), 1.0 mL/L

Eriksson’s Vitamin Mix (Sigma E-1511), 1.0 mg/L thiamine

HCl, 1.5 mg/L 2,4-dichlorophenoxyacetic acid (2,4-D), 0.690 g/L

L-proline, 68.5 g/L sucrose, 36.0 g/L glucose, pH 5.2]. After

embryo collection, the medium was replaced with 1 mL of

Agrobacterium suspension at a concentration of 0.35–0.45

optical density (OD) at 550 nm. After incubating for 5 min at

room temperature, the suspension with embryos was poured

on to a plate containing 4.0 g/L N6 Basal Salts (Sigma C-1416),

1.0 mL/L Eriksson’s Vitamin Mix (Sigma E-1511), 1.0 mg/L

thiamine HCl, 1.5 mg/L 2,4-D, 0.690 g/L L-proline, 30.0 g/L

sucrose, 0.85 mg/L silver nitrate, 0.1 nM acetosyringone,

3.0 g/L Gelrite, pH 5.8. Embryos with their axis down were

incubated in the dark for 3 days at 20 °C, followed by

4 days of incubation in the dark at 28 °C, and then trans-

ferred on to new plates containing 4.0 g/L N6 Basal Salts

(Sigma C-1416), 1.0 mL/L Eriksson’s Vitamin Mix (Sigma

E-1511), 1.0 mg/L thiamine HCl, 1.5 mg/L 2,4-D, 0.69 g/L

L-proline, 30.0 g/L sucrose, 0.5 g/L 2-(N-morpholino)ethanesul-

phonic acid (MES) buffer, 0.85 mg/L silver nitrate, 3.0 mg/L

Bialaphos, 100 mg/L carbenicillin, 6.0 g/L agar, pH 5.8.

Embryos were subcultured every 3 weeks until transgenic

events were identified. Somatic embryogenesis was induced

by transferring a small amount of tissue on to regeneration

medium containing 4.3 g/L Murashige–Skoog (MS) salts

(Gibco 11117; Gibco, Grand Island, NY), 5.0 mL/L MS Vitamins

Stock Solution, 100 mg/L myo-inositol, 0.1 µM abscisic acid

(ABA), 1 mg/L indoleacetic acid (IAA), 0.5 mg/L zeatin, 60.0 g/L

sucrose, 1.5 mg/L Bialaphos, 100 mg/L carbenicillin, 3.0 g/L

Gelrite, pH 5.6. The plates were incubated in the dark for

2 weeks at 28 °C. All material with visible shoots and roots

was transferred on to medium containing 4.3 g/L MS salts,

5.0 mL/L MS Vitamins Stock Solution, 100 mg/L myo-inositol,

40.0 g/L sucrose, 1.5 g/L Gelrite, pH 5.6, and incubated

under artificial light at 28 °C. One week later, plantlets were

moved into glass tubes containing the same medium and

grown until they were transplanted into soil.

Polymerase chain reaction

For screening of a large number of leaf samples, DNA was

extracted by placing two punches of leaf tissue, two stainless

steel beads and 300 µL of Puregene® cell lysis solution

(Gentra Systems, Minneapolis, MN, USA) into each tube of

a Mega titre rack. The samples were homogenized on a

Genogrinder at 1650 r.p.m. for 30–60 s, followed by

incubation at 65 °C for 50 min. After adding 100 µL of

Puregene® protein precipitation solution, plates were cen-

trifuged at 3500 g for 15 min at 15 °C. The supernatants

(200 µL) were mixed with 200 µL of cold isopropanol and

centrifuged at 3500 g for 15 min at 15 °C. The pellets were

rinsed by adding 250 µL of 70% cold ethanol, dried over-

night at room temperature and resuspended in 100 µL of TE

(10 mM Tris-HCl, 1 mM EDTA, pH 7.5) buffer. For the final

PCR evaluation of plant samples, DNA extraction was per-

formed using a Qiagen Dneasy Plant Mini kit according to

the provided protocol (Qiagen Inc., Valencia, NM, USA). PCRs

contained 200 ng of DNA template, 500 nM of each primer

and 10 µL of 2 × RedExtractandAmpPCR mix (R4775, Sigma)

in a total volume of 20 µL. The initial incubation was at 94 °Cfor 4 min, followed by 35 cycles at 94 °C for 1 min, 66 °C for

1 min and 72 °C for 1 min. Ten microlitres of each PCR was

analysed on a 1% agarose gel stained with ethidium bromide.

Southern blots

Leaf tissue (about 1 g fresh weight) was ground into a fine

powder with liquid nitrogen. Fifteen millilitres of cetyltrimeth-

ylammonium bromide (CTAB) extraction buffer (Murray and

Thompson, 1980) [1% CTAB, 0.7 M sodium chloride, 50 mM

Tris-HCl (pH 8.0), 10 mM ethylenediaminetetraacetic acid (EDTA),

140 mM 2-mercaptoethanol] was added to each sample and

heated to 65 °C for 1 h. The extract was mixed with 5 mL of

chloroform–phenol (1 : 1) and the samples were centrifuged

for 10 min at 3500 g. DNA was precipitated from the super-

natant by adding the same volume of isopropanol. After

centrifugation, the pellets were resuspended in 5 mL of TE

buffer, pH 8.0, 0.4 mL of ethidium bromide (10 mg/mL)

and 5 g of caesium chloride. The mixture was centrifuged

overnight (12–17 h) at 390 000 g. The DNA extraction and

ethidium bromide removal were performed essentially as

described in Sambrook et al. (1989). The final DNA pre-

parations were dissolved in 40 µL of TE buffer producing

about 0.2–1.0 µg DNA/µL. Five micrograms of DNA from

each sample was digested overnight with 50 units of

selected restriction enzymes and the DNA fragments were

separated in 1% agarose gel run at 40 mV overnight. A

TurboBlotter and Blotting Stack (Schleicher & Schuell, Keene,

NH, USA) were used to transfer DNA on to a nylon membrane,

as described in the manufacturer’s manual. The DNA frag-

ments were attached to the membrane by ultraviolet (UV)

irradiation at 1.2 kJ/m2 in a UV Stratalinker (Stratagene,

Cedar Creek, TX, USA), and blots were prehybridized for

2–3 h in 25 mL of ExpressHyb hybridization solution (Clontech

Laboratories) at 65 °C. The random prime labelling system

(Amersham Pharmacia Biotech, Piscataway, NJ, USA) was

used with Redivue [32P]dCTP to produce radioactively labelled

DNA fragments according to the supplied protocol. Hybrid-

izations were incubated overnight at 65 °C. Blots were

washed twice with 1 × SSPE (180 mM NaCl, 1 mM EDTA, 10 mM

Na2 HPO4, pH 7.5)/0.1% sodium dodecylsulphate (SDS) solu-

tion for 15 min at 65 °C, followed by two additional washes

with 0.1 × SSPE/0.1% SDS under the same conditions.

Sequencing

DNA sequencing was performed with BigDye Terminator

chemistry on ABI 3700 capillary sequencing machines (Applied

Biosystems, Foster City, CA, USA). Each sample contained

0.4–0.5 µg of plasmid DNA and 6.4 pmol of primer.

Acknowledgements

The authors thank Barbara Stagg and Brandi Carter for

excellent technical support of this research, and Virginia Dress

for comments on the manuscript. We are indebted to Susan

Nilles for taking good care of our plants in the glasshouse.

References

Albert, H., Dale, E.C., Lee, E. and Ow, D.W. (1995) Site-specificintegration of DNA into wild-type and mutant lox sites placed inthe plant genome. Plant J. 7, 649–659.

Britt, A.B. and May, G.D. (2003) Re-engineering plant gene target-ing. Trends Plant Sci. 8, 90–95.

Capecchi, M.R. (2001) Generating mice with targeted mutations.Nat. Med. 7, 1086–1090.

Coppoolse, E.R., de Vroomen, M.J., van Gennip, F., Hersmus, B.J.and van Haaren, M.J. (2005) Size does matter: Cre-mediatedsomatic deletion efficiency depends on the distance between thetarget lox-sites. Plant Mol. Biol. 58, 687–698.

Egli, D., Hafen, E. and Schaffner, W. (2004) An efficient method togenerate chromosomal rearrangements by targeted DNA double-strand breaks in Drosophila melanogaster. Genome Res. 14,1382–1393.

George, J.W. and Kreuzer, K.N. (1996) Repair of double-strandbreaks in bacteriophage T4 by a mechanism that involves exten-sive DNA replication. Genetics, 143, 1507–1520.

Gidoni, D., Bar, M., Leshem, B., Gilboa, N., Mett, A. and Feiler, J.(2001) Embryonal recombination and germline inheritance ofrecombined FRT loci mediated by constitutively expressed FLP intobacco. Euphytica, 121, 145–156.

Gong, M. and Rong, Y.S. (2003) Targeting multi-cellular organisms.Curr. Opin. Genet. Dev. 13, 215–220.

Gorbunova, V.V. and Levy, A.A. (1999) How plants make ends meet:DNA double-strand break repair. Trends Plant Sci. 4, 263–269.

Hanin, M., Volrath, S., Bogucki, A., Briker, M., Ward, E. andPaszkowski, J. (2001) Gene targeting in Arabidopsis. Plant J. 28,671–677.

Hu, W., Timmermans, M.C. and Messing, J. (1998) Interchromo-somal recombination in Zea mays. Genetics, 150, 1229–1237.

Jeske, H., Lutgemeier, M. and Preiss, W. (2001) DNA forms indicaterolling circle and recombination-dependent replication ofAbutilon mosaic virus. EMBO J. 20, 6158–6167.

Kilby, N.J., Davies, G.J., Snaith, M.R. and Murray, J.A. (1995) FLPrecombinase in transgenic plants: constitutive activity in stablytransformed tobacco and generation of marked cell clones inArabidopsis. Plant J. 8, 637–652.

Komari, T. and Kubo, T. (1999) Methods of genetic transformation:Agrobacterium tumefaciens. In Molecular Improvement of CerealCrops (Vasil I.K., ed.), pp. 43–82. Dordrecht: Kluwer AcademicPublishers.

Koshinsky, H.A., Lee, E. and Ow, D.W. (2000) Cre-lox site-specificrecombination between Arabidopsis and tobacco chromosomes.Plant J. 23, 715–722.

Kuzminov, A. (2001) Single-strand interruptions in replicating chro-mosomes cause double-strand breaks. Proc. Natl. Acad. Sci. USA,98, 8461–8468.

Laufs, J., Wirtz, U., Kammann, M., Matzeit, V., Schaefer, S., Schell, J.,Czernilofsky, A.P., Baker, B. and Gronenborn, B. (1990) Wheatdwarf virus Ac/Ds vectors: expression and excision of transposableelements introduced into various cereals by a viral replicon. Proc.Natl. Acad. Sci. USA, 87, 7752–7756.

Lauth, M., Spreafico, F., Dethleffsen, K. and Meyer, M. (2002) Stableand efficient cassette exchange under non-selectable conditionsby combined use of two site-specific recombinases. Nucleic AcidsRes. 30, e115.

Li, Y., Bernot, J.P., Illingworth, C., Lison, W., Bernot, K.M., Eggleston, W.B.,Fogle, K.J., DiPaola, J.E., Kermicle, J. and Alleman, M. (2001)Gene conversion within regulatory sequences generates maizer alleles with altered gene expression. Genetics, 159, 1727–1740.

Lutz, K.A., Corneille, S., Azhagiri, A.K., Svab, Z. and Maliga, P.(2004) A novel approach to plastid transformation utilizes thephiC31 phage integrase. Plant J. 37, 906–913.

Matz, M.V., Fradkov, A.F., Labas, Y.A., Savitsky, A.P., Zaraisky, A.G.,Markelov, M.L. and Lukyanov, S.A. (1999) Fluorescent proteinsfrom nonbioluminescent Anthozoa species. Nat. Biotechnol. 17,969–973.

Medberry, S.L., Dale, E., Qin, M. and Ow, D.W. (1995) Intra-chromosomal rearrangements generated by Cre-lox site-specificrecombination. Nucleic Acids Res. 23, 485–490.

Molinier, J., Ries, G., Bonhoeffer, S. and Hohn, B. (2004) Inter-chromatid and interhomolog recombination in Arabidopsisthaliana. Plant Cell, 16, 342–352.

Murray, M.G. and Thompson, W.F. (1980) Rapid isolation of highmolecular weight plant DNA. Nucleic Acids Res. 8, 4321–4325.

Offringa, R., Franke-van Dijk, M.E., De Groot, M.J., van den Elzen, P.J.and Hooykaas, P.J. (1993) Nonreciprocal homologous recom-bination between Agrobacterium transferred DNA and a plantchromosomal locus. Proc. Natl. Acad. Sci. USA, 90, 7346–7350.

Oldenburg, D.J. and Bendich, A.J. (2004) Most chloroplast DNA ofmaize seedlings in linear molecules with defined ends andbranched forms. J. Mol. Biol. 335, 953–970.

Orel, N., Kyryk, A. and Puchta, H. (2003) Different pathways ofhomologous recombination are used for the repair of double-strand breaks within tandemly arranged sequences in the plantgenome. Plant J. 35, 604–612.

Osborne, B.I., Wirtz, U. and Baker, B. (1995) A system for insertionalmutagenesis and chromosomal rearrangement using the Dstransposon and Cre-lox. Plant J. 7, 687–701.

Prado, F., Gonzalez-Barrera, S. and Aguilera, A. (2000) RAD52-dependent and -independent homologous recombinationinitiated by Flp recombinase at a single FRT site flanked by directrepeats. Mol. Gen. Genet. 263, 73–80.

Preiss, W. and Jeske, H. (2003) Multitasking in replication is commonamong geminiviruses. J. Virol. 77, 2972–2980.

Puchta, H. (2005) The repair of double-strand breaks in plants:mechanisms and consequences for genome evolution. J. Exp. Bot.56, 1–14.

Quintana, P.J., Neuwirth, E.A. and Grosovsky, A.J. (2001) Inter-chromosomal gene conversion at an endogenous human celllocus. Genetics, 158, 757–767.

Rong, Y.S., Titen, S.W., Xie, H.B., Golic, M.M., Bastiani, M.,Bandyopadhyay, P., Olivera, B.M., Brodsky, M., Rubin, G.M. andGolic, K.G. (2002) Targeted mutagenesis by homologous recom-bination in D. melanogaster. Genes Dev. 16, 1568–1581.

Rothstein, R., Michel, B. and Gangloff, S. (2000) Replication forkpausing and recombination or ‘gimme a break’. Genes Dev. 14,1–10.

Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning:A Laboratory Manual. Cold Spring Harbor: Cold Spring HarborLaboratory Press.

Shaked, H., Melamed-Bessudo, C. and Levy, A.A. (2005) High-frequency gene targeting in Arabidopsis plants expressing theyeast RAD54 gene. Proc. Natl. Acad. Sci. USA, 102, 12 265–12 269.

Shalev, G. and Levy, A.A. (1997) The maize transposable elementAc induces recombination between the donor site and anhomologous ectopic sequence. Genetics, 146, 1143–1151.

Sorrell, D.A. and Kolb, A.F. (2005) Targeted modification ofmammalian genomes. Biotechnol. Adv. 23, 431–469.

Srivastava, V. and Ow, D.W. (2001) Biolistic mediated site-specificintegration in rice. Mol. Breed. 8, 345–350.

Terada, R., Asao, H. and Iida, S. (2004) A large-scale Agrobacterium-mediated transformation procedure with a strong positive–negative selection for gene targeting in rice (Oryza sativa L.). PlantCell Rep. 22, 653–659.

Tovar, J. and Lichtenstein, C. (1992) Somatic and meiotic chromo-somal recombination between inverted duplications in transgenictobacco plants. Plant Cell, 4, 319–332.

Vergunst, A.C., Jansen, L.E. and Hooykaas, P.J. (1998) Site-specificintegration of Agrobacterium T-DNA in Arabidopsis thalianamediated by Cre recombinase. Nucleic Acids Res. 26, 2729–2734.

Voziyanov, Y., Pathania, S. and Jayaram, M. (1999) A general modelfor site-specific recombination by the integrase family recom-binases. Nucleic Acids Res. 27, 930–941.

Wirtz, U., Osborne, B. and Baker, B. (1997) Ds excision from extra-chromosomal geminivirus vector DNA is coupled to vector DNAreplication in maize. Plant J. 11, 125–135.

Woodfield, G., Cheng, C., Shuman, S. and Burgin, A.B. (2000)Vaccinia topoisomerase and Cre recombinase catalyze directligation of activated DNA substrates containing a 3′-para-nitrophenyl phosphate ester. Nucleic Acids Res. 28, 3323–3331.

Xiao, Y.L. and Peterson, T. (2000) Intrachromosomal homologousrecombination in Arabidopsis induced by a maize transposon.Mol. Gen. Genet. 263, 22–29.

Xiao, Y.L., Li, X. and Peterson, T. (2000) Ac insertion site affectsthe frequency of transposon-induced homologous recombinationat the maize p1 locus. Genetics, 156, 2007–2017.

Yu, Y. and Bradley, A. (2001) Engineering chromosomal re-arrangements in mice. Nat. Rev. Genet. 2, 780–790.

Zhang, W., Subbarao, S., Addae, P., Shen, A., Armstrong, C.,

Peschke, V. and Gilbertson, L. (2003) Cre/lox-mediated markergene excision in transgenic maize (Zea mays L.) plants. Theor. Appl.Genet. 107, 1157–1168.

Zhao, X., Coats, I., Fu, P., Gordon-Kamm, B. and Lyznik, L.A. (2003)T-DNA recombination and replication in maize cells. Plant J. 33,149–159.

Gene conversion in transgenic maize plants expressing FLP/FRT and Cre/loxP site-specific...

Documents