Date post: | 20-Jan-2016 |
Category: |
Documents |
Upload: | stuart-owens |
View: | 221 times |
Download: | 3 times |
+
>=Bioinformatics: from Sequence to Knowledge
Outline:• Introduction to bioinformatics• The TAU Bioinformatics unit • Useful bioinformatics issues and databases: the use of genome browsers, identifying gene splicing, pseudogenes, mutation severity prediction, PCR utilities, other useful tools• In brief: High-throughput technologies and experimental options• The protein space1
Dr. Metsada Pasmanik-Chor, Bioinformatics Unit, Tel Aviv University
The biotechnology revolution creates high-throughput data
http://chagall.med.cornell.edu/BioinfoCourse/presentations2010/Lecture1_2010.pdf
Late 60’s, early 70’s 1980s 21st century
2Dr. Metsada Pasmanik-Chor, Bioinformatics Unit, Tel Aviv University
The human genome project (HGP)
Francis Collins (chairman of the international project from the NIH): “I think this is probably the most important scientific effort that mankind has ever mounted. That includes splitting the atom and going to the moon”.
1990-2003: Aim: to reveal the blueprint of human biology (3,000,000,000 letters).
3Dr. Metsada Pasmanik-Chor, Bioinformatics Unit, Tel Aviv University
Dr. Metsada Pasmanik-Chor, Bioinformatics Unit, Tel Aviv University4
The human genome project (HGP): sequencing strategies
Dr. Metsada Pasmanik-Chor, Bioinformatics Unit, Tel Aviv University5
Genomes for everyone
2014
+>=
>=
http://www.advances-in-genomics.org/presentations/Flicek.pdf
Huge amount of data
What do we do with all
this???
6Dr. Metsada Pasmanik-Chor, Bioinformatics Unit, Tel Aviv University
Goal: Make sense of bio-medical data using computer tools, and thereby bridge the gap between molecular biology and computer
science .
Data produced by Bio-Med labs &
stored in database
Analysis & better understanding
BioinformaticsBioinformaticsAlgorithmsAlgorithms and Toolsand Tools
Enables large scale analysis and interpretation of data. Provides computational methods for global understanding of biological data.
Why Bioinformatics?
7Dr. Metsada Pasmanik-Chor, Bioinformatics Unit, Tel Aviv University
Dr. Metsada Pasmanik-Chor, Bioinformatics Unit, Tel Aviv University8
Bioinformatics topics are all linked together
• – Bioinformatics helpdesk (phone or e-mail) for short and urgent questions
• - Extended consultation, usually sets of appointments and many discussions are required before analysis is complete
• - Research is done as part of collaboration with Bio-Med labs., resulting in joined papers or/and grant proposal submission
Consultation at TAU Bioinformatics Unit
Dr. Metsada Pasmanik-Chor, Bioinformatics Unit, Tel Aviv University
9
Why use consultation when many databases and tools are free and easy-to-use ?
Dr. Metsada Pasmanik-Chor, Bioinformatics Unit, Tel Aviv University
10
• Bioinformatics is a huge and dynamic field• New databases and tools are published every day, not all are good or even working, updates are crucial !• Choosing parameters for bioinformatics tools can be tricky and may change results dramatically !!!• Not always there ISIS a bioinformatics solution to every question, if not today, maybe tomorrow !
Rules of thumb !
Dr. Metsada Pasmanik-Chor, Bioinformatics Unit, Tel Aviv University
• Use bioinformatics ! Google for new tools !
• It is best to use bioinformatics tools at the planning stage of experiment, and
not after performing it
• Make sure you use at least 2-3 different algorithms, with different
parameters, rely mainly on results that agree using different analyses
• Stick to mainstream databases and tools, as databases vary in content,
reliability, updates and handiness
• When you compare experiments, you are comparing the combination of the
experiment and the analysis, which may vary
•Do not hesitate to contact us if you have questions, as experience may save
you time and efforts11
Name Tel.Activity
Dr. Metsada Pasmanik-Chor
x 6992Genomics, DNA and proteins sequence analysis, microarray and Next Generation design and analysis
Adva Yeheskelx 6840Proteomics and structural biologyDr. Orly Yaron and Dr. Shira Modai
x 5251Microarray and next generation sequencing design and experiments (wet lab)
Bioinformatics students, projects
Collaborations in student projects on various subjects
Goals: bioinformatics teaching, scientific research and grant proposal collaborations
Dr. Metsada Pasmanik-Chor, Bioinformatics Unit, Tel Aviv University
TAU Bioinformatics UnitWeb-page :http://www.tau.ac.il/lifesci/bioinformatics.html
12
Dr. Metsada Pasmanik-Chor, Bioinformatics Unit, Tel Aviv University13
TAU Bioinformatics UnitWeb-page :http://www.tau.ac.il/lifesci/bioinformatics.html
Dr. Metsada Pasmanik-Chor, Bioinformatics Unit, Tel Aviv University14
Sequence analysis: a multistep process
http://genome.cshlp.org/content/13/1/1.long
Homolog genes: derived from a common ancestral gene
Ortholog genes: rising from speciation
Paralog genes: duplication of a chromosomal segment
HomoloGene database:http://www.ncbi.nlm.nih.gov/homologene
Homologues and Sequence Conservation = Functionality
http://www.pgaeducation.org/tutoria/WUSTL/BerkeleyPGACompGeno_Boffelli.2.ppt#325,4,Slide
AGTTGAAACCTATAAATGCGTGATGGAGCGGTGGGATAGTTGAAACCTATAAATGCGTGATGGAGCGGTGGGAT
TACATTTCGACTATAAATGCGTATCGCCTCGCAACCCAATACATTTCGACTATAAATGCGTATCGCCTCGCAACCCAA
Conservationscale
sequence
AA
AA
diverged
CTATAAATGCGTCTATAAATGCGT
CTATAAATGCGTCTATAAATGCGT
conserved
80 m
illio
n ye
ars
potential functional region
Metsada Pasmanik-Chor, Ph.D. TAU Bioinformatics Unit
15
Dr. Metsada Pasmanik-Chor, Bioinformatics Unit, Tel Aviv University16
http://www.ncbi.nlm.nih.gov/homologene/47906
Dr. Metsada Pasmanik-Chor, Bioinformatics Unit, Tel Aviv University17
Working example: the human estrogen receptor alphaRefSeq Genes:
NM_001122742.1NM_001122741.1NM_001291230.1NM_001122740.1NM_000125.3
NM_001291230.1: [provided by RefSeq, Mar 2014].
UCSC: http://genome-euro.ucsc.edu/index.html http://genome-euro.ucsc.edu/cgi-bin/hgTracks?db=hg19&position=chr6%3A152128814-152424408&hgsid=197277749_7mr2oIF1falEKD09ZDOn6oa4DEl5
Splicingevents
Dr. Metsada Pasmanik-Chor, Bioinformatics Unit, Tel Aviv University18
The UCSC genome browser
Dec. 2013 (GRCh38/hg38) Assembly ?
ESR1 [NM_001122742]chr6:152011631-152424408, strand +Genomic length: 412778 bps, 10 exons
Inetrgenic regionIntronic regionTransposons and repeatsCoding exons
http://ecrbrowser.dcode.org/ UTRUTR
* D538G
Dr. Metsada Pasmanik-Chor, Bioinformatics Unit, Tel Aviv University19
ECR Browser
Dr. Metsada Pasmanik-Chor, Bioinformatics Unit, Tel Aviv University20
- An integrated database of human genes that includes automatically-mined genomic, proteomic and transcriptomic information, as well as orthologies, disease relationships, SNPs, gene expression, gene function, and service links for ordering assays and antibodies. A collection of useful information concerning all human genes.
http://www.genecards.org/cgi-bin/carddisp.pl?gene=ESR1&search=esr1
Dr. Metsada Pasmanik-Chor, Bioinformatics Unit, Tel Aviv University21GeneAtlas: http://genatlas.medecine.univ-paris5.fr/fiche.php?symbol=ESR1
UCSC Genome Browser on Human Mar. 2006 (NCBI36/hg18)
Dr. Metsada Pasmanik-Chor, Bioinformatics Unit, Tel Aviv University22
https://fenix.tecnico.ulisboa.pt/downloadFile/3779571263334/intro_bioinformatica_55.pdf
Today’s workshop