+ All Categories
Home > Documents > 1 Tiktaalik Discovered in 2004 on Ellesmere Island, Canada. Fossil dated to 385 - 359 million years...

1 Tiktaalik Discovered in 2004 on Ellesmere Island, Canada. Fossil dated to 385 - 359 million years...

Date post: 17-Jan-2016
Category:
Upload: dora-anthony
View: 213 times
Download: 1 times
Share this document with a friend
Popular Tags:
14
1 Tiktaalik Tiktaalik Discovered in 2004 on Ellesmere Island, Canada. Fossil dated to 385-359 million years ago
Transcript
Page 1: 1 Tiktaalik Discovered in 2004 on Ellesmere Island, Canada. Fossil dated to 385 - 359 million years ago.

1

Tiktaalik

TiktaalikDiscovered in 2004 on Ellesmere Island, Canada.

Fossil dated to 385-359 million years ago

Page 2: 1 Tiktaalik Discovered in 2004 on Ellesmere Island, Canada. Fossil dated to 385 - 359 million years ago.

2

Archaeopteryx

Fossil dated to 150 Million years ago

Page 3: 1 Tiktaalik Discovered in 2004 on Ellesmere Island, Canada. Fossil dated to 385 - 359 million years ago.

3

Nostrils

Source: evolution.berkeley.edu

Page 4: 1 Tiktaalik Discovered in 2004 on Ellesmere Island, Canada. Fossil dated to 385 - 359 million years ago.
Page 5: 1 Tiktaalik Discovered in 2004 on Ellesmere Island, Canada. Fossil dated to 385 - 359 million years ago.

“Fossil” beta globinScientists have discovered that The Antarctic Ice Fish (Chaenocephalus aceratus) does not have any red blood cells. Instead of transporting oxygen through their blood, they absorb oxygen from the water through their skin and large gills.

It is discovered that the ice fish genome contains a segment that looks like the beta globin gene found in closely-related fish, but is not functional.

Ice fish genome

Looks like a broken down beta globin gene

Page 6: 1 Tiktaalik Discovered in 2004 on Ellesmere Island, Canada. Fossil dated to 385 - 359 million years ago.

6

Human chromosome 2

Human chromosome 2

Chimp chromosomes 2q and 2p

Looks like a centromere

Humans have 23 pairs of chromosomes. All other ape species have 24 pairs.

centromeres

Page 7: 1 Tiktaalik Discovered in 2004 on Ellesmere Island, Canada. Fossil dated to 385 - 359 million years ago.

Vestigial parts• Humans have much smaller appendices than herbivorous animals. • In herbivorous animals, but not in humans, the appendix serves to aid digestion of plant material. • It is still unclear what function, if any, the appendix serves in humans.

• Humans have a small immobile tail made up of four fused vertebrae.• In other primates, these vertebrae are not fused and allow the tail to move, aiding in balance and mobility.

Page 8: 1 Tiktaalik Discovered in 2004 on Ellesmere Island, Canada. Fossil dated to 385 - 359 million years ago.
Page 9: 1 Tiktaalik Discovered in 2004 on Ellesmere Island, Canada. Fossil dated to 385 - 359 million years ago.

Guppy experiment #1

Initial observations: Scientists observe that male guppies that stand out from their surroundings attract more females

evolution.berkeley.edu

Page 10: 1 Tiktaalik Discovered in 2004 on Ellesmere Island, Canada. Fossil dated to 385 - 359 million years ago.

Guppy experiment #2

evolution.berkeley.edu

Page 11: 1 Tiktaalik Discovered in 2004 on Ellesmere Island, Canada. Fossil dated to 385 - 359 million years ago.

Staphylococcus aureus

• Bacteria commonly found on mucous membranes and skin

• Can cause infections (Staph infections)• Penicillin introduced as antibiotic in 1940– very effective against Staph in the early 1940’s

• 95% of staph strains now resistant to penicillin• Many strains are now resistant to multiple

antibiotics: penicillin, methicillin, tetracycline– MRSA: Methicillin-resistant Staphylococcus aureus

Page 12: 1 Tiktaalik Discovered in 2004 on Ellesmere Island, Canada. Fossil dated to 385 - 359 million years ago.
Page 13: 1 Tiktaalik Discovered in 2004 on Ellesmere Island, Canada. Fossil dated to 385 - 359 million years ago.

Nested traitsNucleus Chloroplast Seeds Nervous

systemJaws Placenta Feathers

Bacteria

Algae X X

Corn X X X

Palm Tree X X X

Jellyfish X

Starfish X X

Human X X X X

Cow X X X X

Crocodile X X X

Robin X X X X

Cardinal X X X X

Page 14: 1 Tiktaalik Discovered in 2004 on Ellesmere Island, Canada. Fossil dated to 385 - 359 million years ago.

Comparing DNA

Species Partial sequence of beta globin gene

Human ATGGTGCATCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGG

Macaque ATGGTGCATCTGACTCCTGAGGAGAAGAATGCCGTCACCACCCTGTGG

Mouse ATGGTGCACCTGACTGATGCTGAGAAGGCTGCTGTCTCTGGCCTGTGG

Rat ATGGTGCACCTGACTGATGCTGAGAAGGCTGCTGTTAATGGCCTGTGG

Dog ATGGTGCATCTGACTGCTGAAGAGAAGAGTCTTATCTCCAGCATGTGG


Recommended