+ All Categories
Home > Documents > ©2001 Timothy G. Standish Isaiah 40:28 28Hast thou not known? hast thou not heard, that the...

©2001 Timothy G. Standish Isaiah 40:28 28Hast thou not known? hast thou not heard, that the...

Date post: 14-Jan-2016
Category:

Documents
Upload: hubert-roberts
View: 218 times
Download: 0 times
Download Report this document
Share this document with a friend
56
©2001 Timothy G. Standis Isaiah 40:28 28 Hast thou not known? hast thou not heard, that the everlasting God, the LORD, the Creator of the ends of the earth, fainteth not, neither is weary?
Transcript
Page 1: ©2001 Timothy G. Standish Isaiah 40:28 28Hast thou not known? hast thou not heard, that the everlasting God, the LORD, the Creator of the ends of the earth,

©2001 Timothy G. Standish

Isaiah 40:28

28 Hast thou not known? hast thou not heard, that the everlasting God, the LORD, the Creator of the ends of the earth, fainteth not, neither is weary? there is no searching of his understanding.

Page 2: ©2001 Timothy G. Standish Isaiah 40:28 28Hast thou not known? hast thou not heard, that the everlasting God, the LORD, the Creator of the ends of the earth,

©2001 Timothy G. Standish

ReplicationReplicationTimothy G. Standish, Ph. D.

Page 3: ©2001 Timothy G. Standish Isaiah 40:28 28Hast thou not known? hast thou not heard, that the everlasting God, the LORD, the Creator of the ends of the earth,

©2001 Timothy G. Standish

The Information Catch 22The Information Catch 22With only poor copying fidelity, a primitive

system could carry little genetic information without L [the mutation rate] becoming unbearably large, and how a primitive system could then improve its fidelity and also evolve into a sexual system with crossover beggars the imagination."

Hoyle F., "Mathematics of Evolution", [1987], Acorn Enterprises: Memphis TN, 1999, p20

Page 4: ©2001 Timothy G. Standish Isaiah 40:28 28Hast thou not known? hast thou not heard, that the everlasting God, the LORD, the Creator of the ends of the earth,

©2001 Timothy G. Standish

Tools of ReplicationTools of ReplicationEnzymes are the tools of replication:DNA Polymerase - Matches the correct

nucleotides then joins adjacent nucleotides to each other

Primase - Provides an RNA primer to start polymerization

Ligase - Joins adjacent DNA strands together (fixes “nicks”)

Page 5: ©2001 Timothy G. Standish Isaiah 40:28 28Hast thou not known? hast thou not heard, that the everlasting God, the LORD, the Creator of the ends of the earth,

©2001 Timothy G. Standish

More Tools of ReplicationMore Tools of ReplicationHelicase - Unwinds the DNA and melts itSingle Strand Binding Proteins - Keep

the DNA single stranded after it has been melted by helicase

Gyrase - A topisomerase that Relieves torsional strain in the DNA molecule

Telomerase - Finishes off the ends of DNA strands

Page 6: ©2001 Timothy G. Standish Isaiah 40:28 28Hast thou not known? hast thou not heard, that the everlasting God, the LORD, the Creator of the ends of the earth,

©2001 Timothy G. Standish

Leading StrandLeading Strand

Laging StrandLaging Strand

3’

5’3’

5’

Extension - The Replication ForkExtension - The Replication Fork5’

5’5’3’

3’

5’3’3’

5’

Single strand binding proteins - Prevent DNA from re-anealing

DNA Polymerase

Okazaki fragment

RNA Primers

Primase - Makes RNA primers

5’3’

5’

Gyrase - Relieves torsional strain

Helicase - Melts DNA

Page 7: ©2001 Timothy G. Standish Isaiah 40:28 28Hast thou not known? hast thou not heard, that the everlasting God, the LORD, the Creator of the ends of the earth,

©2001 Timothy G. Standish

Extension - Okazaki FragmentsExtension - Okazaki Fragments

The nick is removed when DNA ligase joins (ligates) the DNA fragments.

3’ 5’5’ 3’

RNA PrimerOkazaki Fragment

RNA and DNA Fragments

Nick

DNA Polymerase has 5’ to 3’ exonuclease activity. When it sees an RNA/DNA hybrid, it chops out the RNA and some DNA in the 5’ to 3’ direction.

DNA Polymerase falls off leaving a nick.

DNAPol.

3’ 5’5’ 3’

RNA Primer

DNAPol.

3’ 5’5’ 3’

RNA PrimerLigase

Page 8: ©2001 Timothy G. Standish Isaiah 40:28 28Hast thou not known? hast thou not heard, that the everlasting God, the LORD, the Creator of the ends of the earth,

©2001 Timothy G. Standish

The Role of DNA GyraseThe Role of DNA Gyrase

Helicase

Page 9: ©2001 Timothy G. Standish Isaiah 40:28 28Hast thou not known? hast thou not heard, that the everlasting God, the LORD, the Creator of the ends of the earth,

©2001 Timothy G. Standish

The Role of DNA GyraseThe Role of DNA Gyrase

Helicase

Supercoiled DNA

Gyrase

Page 10: ©2001 Timothy G. Standish Isaiah 40:28 28Hast thou not known? hast thou not heard, that the everlasting God, the LORD, the Creator of the ends of the earth,

©2001 Timothy G. Standish

The Role of DNA GyraseThe Role of DNA Gyrase

Gyrase

Page 11: ©2001 Timothy G. Standish Isaiah 40:28 28Hast thou not known? hast thou not heard, that the everlasting God, the LORD, the Creator of the ends of the earth,

©2001 Timothy G. Standish

The Role of DNA GyraseThe Role of DNA Gyrase

Gyrase

Page 12: ©2001 Timothy G. Standish Isaiah 40:28 28Hast thou not known? hast thou not heard, that the everlasting God, the LORD, the Creator of the ends of the earth,

©2001 Timothy G. Standish

The Role of DNA GyraseThe Role of DNA Gyrase

Gyrase

Page 13: ©2001 Timothy G. Standish Isaiah 40:28 28Hast thou not known? hast thou not heard, that the everlasting God, the LORD, the Creator of the ends of the earth,

©2001 Timothy G. Standish

The Role of DNA GyraseThe Role of DNA Gyrase

Gyrase

Page 14: ©2001 Timothy G. Standish Isaiah 40:28 28Hast thou not known? hast thou not heard, that the everlasting God, the LORD, the Creator of the ends of the earth,

©2001 Timothy G. Standish

The Role of DNA GyraseThe Role of DNA Gyrase

Gyrase

Page 15: ©2001 Timothy G. Standish Isaiah 40:28 28Hast thou not known? hast thou not heard, that the everlasting God, the LORD, the Creator of the ends of the earth,

©2001 Timothy G. Standish

The Role of DNA GyraseThe Role of DNA Gyrase

Gyrase

Page 16: ©2001 Timothy G. Standish Isaiah 40:28 28Hast thou not known? hast thou not heard, that the everlasting God, the LORD, the Creator of the ends of the earth,

©2001 Timothy G. Standish

The Role of DNA GyraseThe Role of DNA Gyrase

Gyrase

Page 17: ©2001 Timothy G. Standish Isaiah 40:28 28Hast thou not known? hast thou not heard, that the everlasting God, the LORD, the Creator of the ends of the earth,

©2001 Timothy G. Standish

The Role of DNA GyraseThe Role of DNA Gyrase

Gyrase

Page 18: ©2001 Timothy G. Standish Isaiah 40:28 28Hast thou not known? hast thou not heard, that the everlasting God, the LORD, the Creator of the ends of the earth,

©2001 Timothy G. Standish

The Role of DNA GyraseThe Role of DNA Gyrase

Gyrase

Page 19: ©2001 Timothy G. Standish Isaiah 40:28 28Hast thou not known? hast thou not heard, that the everlasting God, the LORD, the Creator of the ends of the earth,

©2001 Timothy G. Standish

E. coliE. coli DNA Polymerases DNA Polymerases E. coli has three identified DNA polymerases each of

which has significantly different physical characteristics and roles in the cell

Replication polymerization

10 subunits 600,000 Daltons

II IIIIPolymerase

Major function400 ? 15Molecules/cell

Yes Yes Yes5’- 3’ Polymerization

Yes Yes Yes3’-5’ Exonuclease

Klenow fragment (76,000 Daltons), prepared by mild proteolysis, lacks 5’ to 3’ exonuclease activity and is

used in sequencing

Repair of damaged

DNA

Yes No No5’-3’ Exonulcease

Proofreading/ Removal of

RNA primers109,000 Daltons

Page 20: ©2001 Timothy G. Standish Isaiah 40:28 28Hast thou not known? hast thou not heard, that the everlasting God, the LORD, the Creator of the ends of the earth,

©2001 Timothy G. Standish

Telomere

TelomeraseTelomeraseAt the end of linear chromosomes the lagging strand can’t be completed as the last primer is removed and no 3’ hydroxyl group is available for DNA polymerase to extend from

3’5’5’3’

+

3’5’5’3’

Degradation of RNA primer at the 5’ end

3’5’

5’3’

3’5’5’3’

Next replication

Page 21: ©2001 Timothy G. Standish Isaiah 40:28 28Hast thou not known? hast thou not heard, that the everlasting God, the LORD, the Creator of the ends of the earth,

©2001 Timothy G. Standish

AACCCCAAC

TelomeraseTelomerase

RNA

TelomeraseTelomeraseTelomerase is a ribo-protein complex that adds nucleotides to the end of chromosomes thus restoring their length

GGGTTG5’GACCGAGCCTCTTGGGTTG3’CTGGCTCGG

Page 22: ©2001 Timothy G. Standish Isaiah 40:28 28Hast thou not known? hast thou not heard, that the everlasting God, the LORD, the Creator of the ends of the earth,

©2001 Timothy G. Standish

AACCCCAAC

TelomeraseTelomerase

RNA

TelomeraseTelomeraseTelomerase is a ribo-protein complex that adds nucleotides to the end of chromosomes thus restoring their length

5’GACCGAGCCTCTTGGGTTG3’CTGGCTCGG

GGGTTGGGGTTG

Page 23: ©2001 Timothy G. Standish Isaiah 40:28 28Hast thou not known? hast thou not heard, that the everlasting God, the LORD, the Creator of the ends of the earth,

©2001 Timothy G. Standish

AACCCCAAC

TelomeraseTelomerase

RNA

TelomeraseTelomeraseTelomerase is a ribo-protein complex that adds nucleotides to the end of chromosomes thus restoring their length

5’GACCGAGCCTCTTGGGTTG3’CTGGCTCGG

GGGTTG GGGTTGGGGTTG

Page 24: ©2001 Timothy G. Standish Isaiah 40:28 28Hast thou not known? hast thou not heard, that the everlasting God, the LORD, the Creator of the ends of the earth,

©2001 Timothy G. Standish

TelomeraseTelomeraseThe TTGGGG repeating telomere sequence can form a hairpin due to unusual GG base pairing

5’GACCGAGCCTCTTGGGTTGGGGTTGGGGTTGGGGTTG3’CTGGCTCGG

O

N

HNH

H

N

N

N

Guanine

O

N

HN H

H

N

N

NGuanine

Page 25: ©2001 Timothy G. Standish Isaiah 40:28 28Hast thou not known? hast thou not heard, that the everlasting God, the LORD, the Creator of the ends of the earth,

©2001 Timothy G. Standish

TelomeraseTelomeraseThe TTGGGG repeating telomere sequence can form a hairpin due to unusual GG base pairing

5’GACCGAGCCTCTTGGGTTGGGGTTGGGG3’GTTGGGG3’CTGGCTCGG

TTGGGGTTGDNA

Pol.

Page 26: ©2001 Timothy G. Standish Isaiah 40:28 28Hast thou not known? hast thou not heard, that the everlasting God, the LORD, the Creator of the ends of the earth,

©2001 Timothy G. Standish

TelomeraseTelomeraseThe TTGGGG repeating telomere sequence can form a hairpin due to unusual GG base pairing

5’GACCGAGCCTCTTGGGTTGGGGTTGGGGAGAACCCAACCCGTTGGGG3’CTGGCTCGG

TT

DNAPol.

Endo-nuclease

Page 27: ©2001 Timothy G. Standish Isaiah 40:28 28Hast thou not known? hast thou not heard, that the everlasting God, the LORD, the Creator of the ends of the earth,

©2001 Timothy G. Standish

TelomeraseTelomeraseThe TTGGGG repeating telomere sequence can form a hairpin due to unusual GG base pairing

5’GACCGAGCCTCTTGGGTTGGG3’CTGGCTCGG

Endo-nuclease

AGAACCCAACCCGTTGGGGT

T

GTTGGGG

Page 28: ©2001 Timothy G. Standish Isaiah 40:28 28Hast thou not known? hast thou not heard, that the everlasting God, the LORD, the Creator of the ends of the earth,

©2001 Timothy G. Standish

Page 29: ©2001 Timothy G. Standish Isaiah 40:28 28Hast thou not known? hast thou not heard, that the everlasting God, the LORD, the Creator of the ends of the earth,

©2001 Timothy G. Standish

MutationMutationWhen Mistakes Are MadeWhen Mistakes Are Made

5’ 3’

5’

DNAPol.

5’

5’ 3’

5’ 3’

5’

DNAPol.

DNAPol.

Mism

atch

3’ to 5’ Exonuclease activity

Page 30: ©2001 Timothy G. Standish Isaiah 40:28 28Hast thou not known? hast thou not heard, that the everlasting God, the LORD, the Creator of the ends of the earth,

©2001 Timothy G. Standish

Thim

ine

Dimer

MutationMutationExcision RepairExcision Repair

3’

5’ 3’

5’

5’ 3’

3’ 5’

Endo-Nuclease

Page 31: ©2001 Timothy G. Standish Isaiah 40:28 28Hast thou not known? hast thou not heard, that the everlasting God, the LORD, the Creator of the ends of the earth,

©2001 Timothy G. Standish

5’ 3’

3’ 5’

5’ 3’

3’ 5’

MutationMutationExcision RepairExcision Repair

3’

5’ 3’

5’

Endo-Nuclease

NicksDNAPol.

Page 32: ©2001 Timothy G. Standish Isaiah 40:28 28Hast thou not known? hast thou not heard, that the everlasting God, the LORD, the Creator of the ends of the earth,

©2001 Timothy G. Standish

5’ 3’

3’ 5’

MutationMutationExcision RepairExcision Repair

3’

5’ 3’

5’

5’ 3’

3’ 5’

DNAPol.

Endo-Nuclease

Page 33: ©2001 Timothy G. Standish Isaiah 40:28 28Hast thou not known? hast thou not heard, that the everlasting God, the LORD, the Creator of the ends of the earth,

©2001 Timothy G. Standish

5’ 3’

3’ 5’

5’ 3’

3’ 5’

MutationMutationExcision RepairExcision Repair

3’

5’ 3’

5’

DNAPol.

Ligase

Endo-Nuclease

Nicks

Nick

Ligase

Page 34: ©2001 Timothy G. Standish Isaiah 40:28 28Hast thou not known? hast thou not heard, that the everlasting God, the LORD, the Creator of the ends of the earth,

©2001 Timothy G. Standish

O

N

H

N

H

H

N

N

N

Page 35: ©2001 Timothy G. Standish Isaiah 40:28 28Hast thou not known? hast thou not heard, that the everlasting God, the LORD, the Creator of the ends of the earth,

©2001 Timothy G. Standish

DNA Replication:DNA Replication:How We KnowHow We Know

There are three ways in which DNA could be replicated:

+

NewOld

+

Old

N

ewOld

N

ew

OldConservative - Old double stranded DNA serves as a template for two new strands which then join together, giving two old strands together and two new strands together

OldSemi-conservative - Old strands serve as templates for new strands resulting in double stranded DNA made of both old and new strands

Old

Dispersive - In which sections of the old strands are dispersed in the new strands

+

Old +

N

ewOld +

N

ew

+

Old +

N

ewOld +

N

ew

or

Page 36: ©2001 Timothy G. Standish Isaiah 40:28 28Hast thou not known? hast thou not heard, that the everlasting God, the LORD, the Creator of the ends of the earth,

©2001 Timothy G. Standish

The Meselson-Stahl The Meselson-Stahl ExperimentExperiment

The Meselson-Stahl experiment demonstrated that replication is semiconservative

This experiment took advantage of the fact that nucleotide bases contain nitrogen

Thus DNA contains nitrogen

OH

HOH

P

O

HO ONH2

N N

N N

The most common form of Nitrogen is N14 with 7 protons and 7 neutrons

N15 is called “heavy nitrogen” as it has 8 neutrons thus increasing its mass by 1 atomic mass unit

Page 37: ©2001 Timothy G. Standish Isaiah 40:28 28Hast thou not known? hast thou not heard, that the everlasting God, the LORD, the Creator of the ends of the earth,

©2001 Timothy G. Standish

After 20 min. (1 replication) transfer DNA to centrifuge tube and centrifuge

Disper

sive m

odel

predict

ion

Conservativ

e

model pre

diction

Semi-c

onservativ

e

model pre

diction

The Meselson-Stahl The Meselson-Stahl ExperimentExperiment

Prediction after 2 or more replications

Bacteria grown in N15 media for several replications

Transfer to normal N14 media

X

X

XThe conservative and dispersive models make predictions that do not come true thus, buy deduction, the semi-conservative model must be true.

Page 38: ©2001 Timothy G. Standish Isaiah 40:28 28Hast thou not known? hast thou not heard, that the everlasting God, the LORD, the Creator of the ends of the earth,

©2001 Timothy G. Standish

The Current Eukaryotic The Current Eukaryotic Recombination ModelRecombination Model

Meiosis Prophase I

Homologous chromosomes

Page 39: ©2001 Timothy G. Standish Isaiah 40:28 28Hast thou not known? hast thou not heard, that the everlasting God, the LORD, the Creator of the ends of the earth,

©2001 Timothy G. Standish

The Current Eukaryotic The Current Eukaryotic Recombination ModelRecombination Model

Double strand break

Exo-nuclease

Page 40: ©2001 Timothy G. Standish Isaiah 40:28 28Hast thou not known? hast thou not heard, that the everlasting God, the LORD, the Creator of the ends of the earth,

©2001 Timothy G. Standish

The Current Eukaryotic The Current Eukaryotic Recombination ModelRecombination Model

Exo-nuclease

Page 41: ©2001 Timothy G. Standish Isaiah 40:28 28Hast thou not known? hast thou not heard, that the everlasting God, the LORD, the Creator of the ends of the earth,

©2001 Timothy G. Standish

The Current Eukaryotic The Current Eukaryotic Recombination ModelRecombination Model

Exo-nuclease

Page 42: ©2001 Timothy G. Standish Isaiah 40:28 28Hast thou not known? hast thou not heard, that the everlasting God, the LORD, the Creator of the ends of the earth,

©2001 Timothy G. Standish

The Current Eukaryotic The Current Eukaryotic Recombination ModelRecombination Model

Exo-nuclease

Page 43: ©2001 Timothy G. Standish Isaiah 40:28 28Hast thou not known? hast thou not heard, that the everlasting God, the LORD, the Creator of the ends of the earth,

©2001 Timothy G. Standish

The Current Eukaryotic The Current Eukaryotic Recombination ModelRecombination Model

DNAPolymerase

Page 44: ©2001 Timothy G. Standish Isaiah 40:28 28Hast thou not known? hast thou not heard, that the everlasting God, the LORD, the Creator of the ends of the earth,

©2001 Timothy G. Standish

The Current Eukaryotic The Current Eukaryotic Recombination ModelRecombination Model

DNAPolymerase

Page 45: ©2001 Timothy G. Standish Isaiah 40:28 28Hast thou not known? hast thou not heard, that the everlasting God, the LORD, the Creator of the ends of the earth,

©2001 Timothy G. Standish

The Current Eukaryotic The Current Eukaryotic Recombination ModelRecombination Model

DNAPolymerase

Page 46: ©2001 Timothy G. Standish Isaiah 40:28 28Hast thou not known? hast thou not heard, that the everlasting God, the LORD, the Creator of the ends of the earth,

©2001 Timothy G. Standish

The Current Eukaryotic The Current Eukaryotic Recombination ModelRecombination Model

DNAPolymerase

Page 47: ©2001 Timothy G. Standish Isaiah 40:28 28Hast thou not known? hast thou not heard, that the everlasting God, the LORD, the Creator of the ends of the earth,

©2001 Timothy G. Standish

The Current Eukaryotic The Current Eukaryotic Recombination ModelRecombination Model

Page 48: ©2001 Timothy G. Standish Isaiah 40:28 28Hast thou not known? hast thou not heard, that the everlasting God, the LORD, the Creator of the ends of the earth,

©2001 Timothy G. Standish

Holliday StructureHolliday Structure

Page 49: ©2001 Timothy G. Standish Isaiah 40:28 28Hast thou not known? hast thou not heard, that the everlasting God, the LORD, the Creator of the ends of the earth,

©2001 Timothy G. Standish

Holliday StructureHolliday Structure

Bend

Page 50: ©2001 Timothy G. Standish Isaiah 40:28 28Hast thou not known? hast thou not heard, that the everlasting God, the LORD, the Creator of the ends of the earth,

©2001 Timothy G. Standish

Holliday StructureHolliday Structure

Bend

Twist

Page 51: ©2001 Timothy G. Standish Isaiah 40:28 28Hast thou not known? hast thou not heard, that the everlasting God, the LORD, the Creator of the ends of the earth,

©2001 Timothy G. Standish

Holliday StructureHolliday Structure

Cut

Page 52: ©2001 Timothy G. Standish Isaiah 40:28 28Hast thou not known? hast thou not heard, that the everlasting God, the LORD, the Creator of the ends of the earth,

©2001 Timothy G. Standish

Holliday StructureHolliday Structure

Cut

Page 53: ©2001 Timothy G. Standish Isaiah 40:28 28Hast thou not known? hast thou not heard, that the everlasting God, the LORD, the Creator of the ends of the earth,

©2001 Timothy G. Standish

Holliday StructureHolliday Structure

Cut

Page 54: ©2001 Timothy G. Standish Isaiah 40:28 28Hast thou not known? hast thou not heard, that the everlasting God, the LORD, the Creator of the ends of the earth,

©2001 Timothy G. Standish

Holliday StructureHolliday Structure

Cut

Page 55: ©2001 Timothy G. Standish Isaiah 40:28 28Hast thou not known? hast thou not heard, that the everlasting God, the LORD, the Creator of the ends of the earth,

©2001 Timothy G. Standish

Holliday StructureHolliday Structure

Page 56: ©2001 Timothy G. Standish Isaiah 40:28 28Hast thou not known? hast thou not heard, that the everlasting God, the LORD, the Creator of the ends of the earth,

©2001 Timothy G. Standish

Cutting The Holliday StructureCutting The Holliday Structure


Recommended
PASTORS “SHEPHERDS” Revelation 2: 6. But this thou hast, that thou hatest the deeds of the Nicolaitans, which I also hate. 15. So hast thou also them that.

PASTORS “SHEPHERDS” Revelation 2: 6. But this thou hast, that thou hatest the deeds of the Nicolaitans, which I also hate. 15. So hast thou also them that.

Documents

AUTUMN 19 5 0 (SIjp Enyal fflroaa - cdn.ymaws.com · I gave thee home. And thou hast given Me discontent; I gave thee the boundless future. And thou hast given Me selfish ambition;

AUTUMN 19 5 0 (SIjp Enyal fflroaa - cdn.ymaws.com · I gave thee home. And thou hast given Me discontent; I gave thee the boundless future. And thou hast given Me selfish ambition;

Documents

Thou Hast Testified of Me… .

Thou Hast Testified of Me… .

Documents

  · Web viewI beseech Thee, O my God, by Thy Word which Thou hast made to be the lodestone of the hearts and souls of men, the Word whereby Thou hast drawn Thy servants unto the

  · Web viewI beseech Thee, O my God, by Thy Word which Thou hast made to be the lodestone of the hearts and souls of men, the Word whereby Thou hast drawn Thy servants unto the

Documents

[By Ron Halbrook]. 2 1 My God, my God, why hast thou forsaken me? why art thou so far from helping me, and from the words of my roaring?

[By Ron Halbrook]. 2 1 My God, my God, why hast thou forsaken me? why art thou so far from helping me, and from the words of my roaring?

Documents

PLAYER'S GUIDE - mocagh.orgmocagh.org/ea/standingstone-manual.pdf · ake heed, adventurers, both new and old! Much there is here that thou need'st to be told: If thou hast played

PLAYER'S GUIDE - mocagh.orgmocagh.org/ea/standingstone-manual.pdf · ake heed, adventurers, both new and old! Much there is here that thou need'st to be told: If thou hast played

Documents

SplsrlpkcE[SylsrOSpiosrc[zkp[Sh%˝~[ ]SplsrlpkcE ...€¦ · me. But Thou takest pleasure in truth and Thou hast made known to me the secrets of Thy wisdom. Sprinkle me with Thy hyssop

SplsrlpkcE[SylsrOSpiosrc[zkp[Sh%˝~[ ]SplsrlpkcE ...€¦ · me. But Thou takest pleasure in truth and Thou hast made known to me the secrets of Thy wisdom. Sprinkle me with Thy hyssop

Documents

Ruth 2:13 Then she said, Let me find favour in thy sight, my lord; for that thou hast comforted me, and for that thou hast spoken friendly unto thine.

Ruth 2:13 Then she said, Let me find favour in thy sight, my lord; for that thou hast comforted me, and for that thou hast spoken friendly unto thine.

Documents

The Services of the FEAST...conceived in iniquities, and in sins did my mother bear me. For behold, Thou hast loved truth; the hidden and secret things of Thy wisdom hast Thou made

The Services of the FEAST...conceived in iniquities, and in sins did my mother bear me. For behold, Thou hast loved truth; the hidden and secret things of Thy wisdom hast Thou made

Documents

AND FOR ROGATIONTIDE · Thou hast made manifest to me. Thou shalt sprinkle me with hyssop, and I shall be cleansed; Thou shalt wash me, and I shall be made whiter than snow. ... O

AND FOR ROGATIONTIDE · Thou hast made manifest to me. Thou shalt sprinkle me with hyssop, and I shall be cleansed; Thou shalt wash me, and I shall be made whiter than snow. ... O

Documents

Sir, thou hast nothing to draw with and 4:11 TO DRAW WITH.pdf · 2019-09-08 · "Sir, thou hast nothing to draw with and the well is deep". .John 4:11 "NOTHING TO DRAW WITHn It is

Sir, thou hast nothing to draw with and 4:11 TO DRAW WITH.pdf · 2019-09-08 · "Sir, thou hast nothing to draw with and the well is deep". .John 4:11 "NOTHING TO DRAW WITHn It is

Documents

Moving the Curse. GENESIS 3 17 And unto Adam he said, Because thou hast hearkened unto the voice of thy wife, and hast eaten of the tree, of which I commanded.

Moving the Curse. GENESIS 3 17 And unto Adam he said, Because thou hast hearkened unto the voice of thy wife, and hast eaten of the tree, of which I commanded.

Documents

Psalms 73:23 Nevertheless I am continually with thee: thou hast holden me by my right hand.

Psalms 73:23 Nevertheless I am continually with thee: thou hast holden me by my right hand.

Documents

AGNUS DEI MEDITASIES - ctyc.co.zaclean: thou shalt wash me, and I shall be whiter than snow. Thou shalt make me hear of joy and gladness: that the bones which thou hast broken may

AGNUS DEI MEDITASIES - ctyc.co.zaclean: thou shalt wash me, and I shall be whiter than snow. Thou shalt make me hear of joy and gladness: that the bones which thou hast broken may

Documents

2 Samuel 12:9-10 1. 9 Wherefore hast thou despised the commandment of the LORD, to do evil in his sight? thou hast killed Uriah the Hittite with the sword,

2 Samuel 12:9-10 1. 9 Wherefore hast thou despised the commandment of the LORD, to do evil in his sight? thou hast killed Uriah the Hittite with the sword,

Documents

Documents/Prophetic Bible Documents/Berean Bible College...there is no shadow of turning with thee; thou changest not, thy compassions, they fail not; as thou hast been thou forever

Documents/Prophetic Bible Documents/Berean Bible College...there is no shadow of turning with thee; thou changest not, thy compassions, they fail not; as thou hast been thou forever

Documents

2 Timothy 3:14-15 14. But continue thou in the things which thou hast learned and hast been assured of, knowing of whom thou hast learned them; 15. And.

2 Timothy 3:14-15 14. But continue thou in the things which thou hast learned and hast been assured of, knowing of whom thou hast learned them; 15. And.

Documents

©2000 Timothy G. Standish Psalms 8:4-7 4What is man that thou art mindful of him:” and the son of man, that thou visitest him? 5For thou hast made him.

©2000 Timothy G. Standish Psalms 8:4-7 4What is man that thou art mindful of him:” and the son of man, that thou visitest him? 5For thou hast made him.

Documents