Darlene Campos THE DAILY COUGAR For the first time, UH joined in the Health Equity Week of Action, which focuses on health disparities among minorities in the United States. Thursday’s event at the Honors College Commons was sponsored by the American Medical Students Associa- tion, which holds the Health Equity Week of Action in Harvard and Stanford. The event hosted guest speaker Lovell Jones, the direc- tor of the Center for Research on Minority Health in the Department of Health Disparities Research at the M.D. Anderson Cancer Center. “The mortality rate for an African-American woman with breast cancer is four times higher than a white woman’s,” Jones said. “People who have disposable income have more access to medical technology than those without disposable income. “One-third of Houston residents do not have health care. One-fourth of Texans do not have health insurance. That’s two and a half times the national average,” Jones said. According to a handout given at the event put together by the makers of a documentary on health care dispari- ties, “Unnatural Causes: Is Equality Making Us Sick,” Sweden has a child poverty rate of four percent, while the rate for the US is 22 percent. Taylor McGilvray THE DAILY COUGAR Through poetry, comedy and music, a New Yorker performer used her story of discovering her male persona, Dred, as a way to educate her audience about sexuality and gender roles while also entertaining them. Traditional ideas of gender and sexual- ity were discussed and challenged in “I Am the One I Always Wanted to Marry,” a one-woman show performed by Haitian American performer Mildred Gerestant Thursday in Dudley Recital Hall. “When I first saw Mildred/Dred per- form a couple of months ago, I absolutely loved the way in which she/he disrupts the binaries of sex and gender and ques- tions the taken-for-granted ideals of masculinity and femininity through her performance,” said Sima Shakhsari, a postdoctoral fellow of women’s, gender and sexuality studies. Gerestant recently moved to Houston from New York, and has been helping pave the way for drag performers since the 1990s. “I thought her performance would be a perfect way to make theories of gender THE DAILY COUGAR THE DAILY COUGAR ® ® the official student newspaper of the university of houston since 1934 the official student newspaper of the university of houston since 1934 Issue , Volume Monday April , news line CAMPUS Student organizations and non- prots visit volunteer fair Tuesday UH’s Metropolitan Volunteer Program is hosting the Revolution of Heroes Volunteer Fair from 11:30 a.m. to 1 p.m. on Tuesday at the outdoor arbor in the University Center. The fair provides an opportunity to meet non-prot and student organizations and learn about the various volunteer service initia- tives available. “MVP has the opportunity to reach out to the community to place our students in contact with community service agencies,” MVP director Daray Olaleye said in a press release. For additional information, contact Daray Olaleye at 713-743- 5200 or email [email protected]. — Cordero Jennings/The Daily Cougar BAUER Business students practice leadership skills with employers The C.T. Bauer College of Business is hosting the Leadership & Ethics Week until Thursdayto show students how to implement the practical skills learned in the classroom and apply them to the corporate world. “Leadership & Ethics Week has been around for more than ten years now, and it’s always a hit with students and employers,” said Jamie Belinne, Assistant Dean at Rockwell Career Center. “It’s a great way not only to develop leadership skills but also to network with employers and practice professionals skills students will need for success in business.” For more information please visit http://www.bauer.uh.edu/ leadership/Leadership-Ethics-Week.php. — Miguel Cortina/The Daily Cougar CORRECTIONS Report errors to [email protected]. Corrections will ! ! appear in this space as needed. thedailycougar.com @thedailycougar facebook.com/thedailycougar Sign up for daily e-mail alerts Read. Recycle. Repeat daily. Cougars find three wins in the Big Easy life+arts sports Got news? E-mail [email protected] or call 713-743-5314 Students perfect recline design MILDRED continues on page 3 MINORITIES continues on page 3 EVENTS Bracket Town The last day of NCAA Final Four festivi- ties will be from noon to 7 p.m. at the George R. Brown Convention Center. Some of the events are free, and others cost up to $10. Houston Career Fair Companies from around the Houston area are going to be at the Houston Career Fair from 11 a.m. to 2 p.m. at the Crowne Plaza in River Oaks. HI HI 7 78 8 LO 50 today TUE 73/ 53 TU TU TU UE E E 73/ / / / / / 5 53 3 WED 80/ 68 WED 8 / / 68 THU 82/ 72 TH THU 82/ / / / 72 FRI 87/ 70 FR FRI 87/ / / 70 Chilly with possible morning and afternoon showers... FOR MORE EVENTS, CHECK OUT thedailycougar.com/calendar Gender roles challenged Visiting performer inspires discussion about traditional ideas of sexuality Guest speaker pinpoints di erences in countries, poverty and cancer Meet the new boss B rand-new SGA President Michael Harding shakes hands with Rep. Sheila Jackson Lee as former SGA President Prince Wilson applauds. Harding was formally inaugurated Friday night in the UC Houston Room. | Nine Nguyen/The Daily Cougar HEALTH CAMPUS Inequalities in minorities Inspired by performer Mildred Gerestant’s poetry, comedy and music, students discussed traditional ideas of gender and sexuality. | Nine Nguyen/The Daily Cougar
Transcript
Darlene CamposTHE DAILY COUGAR
For the fi rst time, UH joined in the Health Equity Week of Action, which focuses on health disparities among minorities in the United States.
Thursday’s event at the Honors College Commons was sponsored by the American Medical Students Associa-tion, which holds the Health Equity Week of Action in Harvard and Stanford.
The event hosted guest speaker Lovell Jones, the direc-tor of the Center for Research on Minority Health in the Department of Health Disparities Research at the M.D. Anderson Cancer Center.
“The mortality rate for an African-American woman with breast cancer is four times higher than a white woman’s,” Jones said. “People who have disposable income have more access to medical technology than those without disposable income.
“One-third of Houston residents do not have health care. One-fourth of Texans do not have health insurance. That’s two and a half times the national average,” Jones said.
According to a handout given at the event put together by the makers of a documentary on health care dispari-ties, “Unnatural Causes: Is Equality Making Us Sick,” Sweden has a child poverty rate of four percent, while the rate for the US is 22 percent.
Taylor McGilvrayTHE DAILY COUGAR
Through poetry, comedy and music, a New Yorker performer used her story of discovering her male persona, Dred, as a way to educate her audience about sexuality and gender roles while also entertaining them.
Traditional ideas of gender and sexual-ity were discussed and challenged in “I Am the One I Always Wanted to Marry,” a one-woman show performed by Haitian American performer Mildred Gerestant Thursday in Dudley Recital Hall.
“When I first saw Mildred/Dred per-form a couple of months ago, I absolutely loved the way in which she/he disrupts the binaries of sex and gender and ques-tions the taken-for-granted ideals of masculinity and femininity through her performance,” said Sima Shakhsari, a
postdoctoral fellow of women’s, gender and sexuality studies.
Gerestant recently moved to Houston from New York, and has been helping pave the way for drag performers since
the 1990s. “I thought her performance would be
a perfect way to make theories of gender
THE DAILY COUGARTHE DAILY COUGAR®®
t h e o f f i c i a l s t u d e n t n e w s p a p e r o f t h e u n i v e r s i t y o f h o u s t o n s i n c e 1 9 3 4t h e o f f i c i a l s t u d e n t n e w s p a p e r o f t h e u n i v e r s i t y o f h o u s t o n s i n c e 1 9 3 4Issue !"#, Volume $%
MondayApril !, "#$$
newslineCAMPUSStudent organizations and non-pro% ts visit volunteer fair Tuesday
UH’s Metropolitan Volunteer Program is hosting the Revolution of Heroes Volunteer Fair from 11:30 a.m. to 1 p.m. on Tuesday at the outdoor arbor in the University Center.
The fair provides an opportunity to meet non-pro! t and student organizations and learn about the various volunteer service initia-tives available.
“MVP has the opportunity to reach out to the community to place our students in contact with community service agencies,” MVP director Daray Olaleye said in a press release.
For additional information, contact Daray Olaleye at 713-743-5200 or email [email protected].
— Cordero Jennings/The Daily Cougar
BAUERBusiness students practice leadership skills with employers
The C.T. Bauer College of Business is hosting the Leadership & Ethics Week until Thursdayto show students how to implement the practical skills learned in the classroom and apply them to the corporate world.
“Leadership & Ethics Week has been around for more than ten years now, and it’s always a hit with students and employers,” said Jamie Belinne, Assistant Dean at Rockwell Career Center. “It’s a great way not only to develop leadership skills but also to network with employers and practice professionals skills students will need for success in business.”
For more information please visit http://www.bauer.uh.edu/leadership/Leadership-Ethics-Week.php.
EVENTSBracket Town The last day of NCAA Final Four festivi-ties will be from noon to 7 p.m. at the George R. Brown Convention Center. Some of the events are free, and others cost up to $10.
Houston Career Fair Companies from around the Houston area are going to be at the Houston Career Fair from 11 a.m. to 2 p.m. at the Crowne Plaza in River Oaks.
HIHI 7788LO 50today
TUE
73/53
TUTUTUUEEE
73//////5533
WED
80/68
WED
8 //68
THU
82/72
THTHU
82////72
FRI
87/70
FRFRI
87///70
Chilly with possible morning and afternoon showers...
FOR MORE EVENTS, CHECK OUTthedailycougar.com/calendar
Gender roles challengedVisiting performer inspires discussion about traditional ideas of sexuality
Guest speaker pinpoints di& erences in countries, poverty and cancer
Meet the new bossBrand-new SGA President Michael Harding
shakes hands with Rep. Sheila Jackson Lee as former SGA President Prince Wilson applauds. Harding was formally inaugurated Friday night in the UC Houston Room. | Nine Nguyen/The Daily Cougar
HEALTH
CAMPUS
Inequalities in minorities
Inspired by performer Mildred Gerestant’s poetry, comedy and music, students discussed traditional ideas of gender and sexuality. | Nine Nguyen/The Daily Cougar
Applications for theJACK & D’ANN BURKE
INTERNATIONAL SCHOLARSHIP&
CECELIA EICHENBERG MEMORIAL SCHOLARSHIP
Available Online at:issso.uh.edu/PDF/ScholarshipsApp.pdf
Applications must be submitted to the InternationalStudent and Scholar Services Office no later than 5:00 pm
t h e o f f i c i a l s t u d e n t n e w s p a p e r o f t h e u n i v e r s i t y o f h o u s t o n s i n c e 1 9 3 4
years
Men’s basketball rolls on with
dominant win over ECU SPORTS !Google has plans to revolutionize phone industry LIFE & ARTS !
HI 72 LO 61
Issue !", Volume !#
Tuesday, January !", #$!$thedailycougar.com
WEATHER !
Forecast, Page 2
THEDAILYCOUGAR.COM
Speaking up
ZUHAIR SIDDIQUI THE DAILY COUGAR
Alumna leaves legacy in artsBy Amenah Khalil
THE DAILY COUGAR
Prominent alumna and
philanthropist Cynthia Woods
Mitchell, died Dec. 27 at age 87,
after almost a decade of living with
Alzheimer’s disease.
Mitchell was a valued donor to
various projects and causes, most of
which involved her love for the arts.
“She was a visionary
philanthropist whose dedication
to the arts was apparent in the
founding of the Cynthia Woods
Mitchell Center,” Karen Farber,
director of UH’s Cynthia Woods
Mitchell Center for the Arts, said in
an e-mail.
Mitchell was an enthusiastic
supporter of the arts and believed
that everyone, not just the wealthy,
should be able to enjoy musical
performances. This desire became
a reality when the Cynthia Woods
Mitchell Pavilion was created in The
Woodlands.
Mitchell’s philanthropy extends
throughout Houston, Galveston
and College Station.
For UH, the Cynthia Woods
Mitchell Center for the Arts remains
her greatest legacy.
With a $20 million donation from
Mitchell, the center has been able
to cultivate collaborations between
performing, visual and literary arts.
“Just as she lived a productive
and creative life with extraordinary
commitment to our community,
she has left a legacy that will fuel
creativity for future generations in
our community and far beyond,”
UH President Renu Khator said in a
release. The Cynthia Woods Mitchell
Center for the Arts went through
renovations in 2005 and 2006 and
was renamed in October 2006 to
honor Mitchell’s long-standing
support for the arts.
“Mrs. Mitchell’s and the
Mitchell family’s commitment to
create the Cynthia Woods Mitchell
Center for the Arts — a center that
celebrates the arts and encourages
collaboration — has helped to
position UH arts as one of the
University’s key priorities,” Khator
said.Mitchell was also a generous
donor to UH’s Texas Music Festival
and the Gerald D. Hines College of
Architecture. She also created UH’s
Distinguished Authors Program.
“Mrs. Mitchell and her family’s
generosity has made dozens of
significant new artworks possible
and left a lasting legacy that will
continue to infuse the entire
University and City of Houston with
creativity and innovation. On behalf
of the Mitchell Center board and
staff, I extend the deepest sympathy
and gratitude to the Mitchell
family,” Faber said in an e-mail.
d tFraternity to help
id i Haiti reliefsee MITCHELL, page 3
A group of local and national pro-
life advocates gathered to protest
the opening of a new Planned
Parenthood facility. The 78,000-sq. ft. facility
will be the largest Planned Parenthood
building in the nation and will be located at
4600 Gulf Freeway. Keith Fry, right, traveled
from Abilene to be among the thousands of
participants in the demonstrations, which
occurred Sunday and Monday.
TTTTTHHHHHEEEEE DDDDDAAAAAIIIIILLLLLYYYYY CCCCCOOOOOUUUUUGGGGGAAAAARRRRR®®t h e o f f i c i a l s t u d e n t n e w s p a p e r o f t h e u n i v e r s i t y o f h o u s t o n s i n c e 1 9 3 4
years
Men’s basketball rolls on with
dominant win over ECU SPORTS !Google has plans to
revolutionize phone
industry LIFE & ARTS !
HI 72 LO 61
Issue !", Volume !#
Tuesday, January !", #$!$
thedailycougar.com
WEATHER !
Forecast, Page 2
UH rewards football coach Kevin Sumlin with new six-year contract
THEDAILYCOUGAR.COM
Speaking up
ZUHAIR SIDDIQUI THE DAILY COUGAR
Alumna leaves
legacy in artsBy Amenah Khalil
THE DAILY COUGAR
Prominent alumna and
philanthropist Cynthia Woods
Mitchell, died Dec. 27 at age 87,
after almost a decade of living with
Alzheimer’s disease.
Mitchell was a valued donor to
various projects and causes, most of
which involved her love for the arts.
“She was a visionary
philanthropist whose dedication
to the arts was apparent in the
founding of the Cynthia Woods
Mitchell Center,” Karen Farber,
director of UH’s Cynthia Woods
Mitchell Center for the Arts, said in
an e-mail.
Mitchell was an enthusiastic
supporter of the arts and believed
that everyone, not just the wealthy,
should be able to enjoy musical
performances. This desire became
a reality when the Cynthia Woods
Mitchell Pavilion was created in The
Woodlands.
Mitchell’s philanthropy extends
throughout Houston, Galveston
and College Station.
For UH, the Cynthia Woods
Mitchell Center for the Arts remains
her greatest legacy.
With a $20 million donation from
Mitchell, the center has been able
to cultivate collaborations between
performing, visual and literary arts.
“Just as she lived a productive
and creative life with extraordinary
commitment to our community,
she has left a legacy that will fuel
creativity for future generations in
our community and far beyond,”
UH President Renu Khator said in a
release. The Cynthia Woods Mitchell
Center for the Arts went through
renovations in 2005 and 2006 and
was renamed in October 2006 to
honor Mitchell’s long-standing
support for the arts.
“Mrs. Mitchell’s and the
Mitchell family’s commitment to
create the Cynthia Woods Mitchell
Center for the Arts — a center that
celebrates the arts and encourages
collaboration — has helped to
position UH arts as one of the
University’s key priorities,” Khator
said.Mitchell was also a generous
donor to UH’s Texas Music Festival
and the Gerald D. Hines College of
Architecture. She also created UH’s
Distinguished Authors Program.
“Mrs. Mitchell and her family’s
generosity has made dozens of
significant new artworks possible
and left a lasting legacy that will
continue to infuse the entire
University and City of Houston with
creativity and innovation. On behalf
of the Mitchell Center board and
staff, I extend the deepest sympathy
and gratitude to the Mitchell
family,” Faber said in an e-mail.
d ntsFraternity to help
aid in Haiti reliefsee MITCHELL, page 3
A group of local and national pro-
life advocates gathered to protest
the opening of a new Planned
Parenthood facility. The 78,000-sq. ft. facility
will be the largest Planned Parenthood
building in the nation and will be located at
4600 Gulf Freeway. Keith Fry, right, traveled
from Abilene to be among the thousands of
participants in the demonstrations, which
occurred Sunday and Monday.
OOOOOUUUUUOOOOOUUUOUo fo f
witPOR
AAAAARRRRAARRe e
OOOUUUUUUUUUUGGGGGAAAAAOOOUUUUUUUUUUGGGGUUUUGGGGGAAAGAAAAAf h o u s t o n o u h o uh o uf h o u soh o uh oo uh o uoh
s i n c ef hhhhhh ooooooo uuuuuuuu ss t o n s i n c e
ith RTS !
Missed a print edition?You can now browse recent publications in our virtual newsstand @thedailycougar.com/print-edition
2 ! Monday, April !, "#$$ ONLINE The Daily Cougar
ISSUE STAFF
ABOUT THE COUGAR The Daily Cougar is published Monday through Friday during the fall and spring semesters, and Tuesday and Thursday during the summer, at the University of Houston Printing Plant and online at http://www.thedailycougar.com. The University seeks to provide equal educational opportunities without regard to race, color, religion, national origin, sex, age, disability or veteran status, or sexual orientation. The Daily Cougar is supported in part by Student Service Fees. The ! rst copy of the Cougar is free; each additional copy is 25 cents.
SUBSCRIPTIONS Rates are $70 per year or $40 per semester. Mail subscription requests to: Mail Subscriptions, The Daily Cougar, University of Houston, Houston, TX, 77204-4015.
NEWS TIPS Direct news tips and story ideas to the News Desk. Call (713) 743-5314, e-mail [email protected] or fax (713) 743-5384. A “Submit news item” form is also available online at thedailycougar.com.
COPYRIGHT No part of the newspaper in print or online may be reproduced without the written consent of the director of the Student Publications Department.
!"Copy editing Julian Jimenez!"Production Ben Muths!"Closing editor Jack Wehman
Business Office!"Phone (713) 743-5350!"Fax (713) 743-5384!"Mailing addressRoom 7, UC SatelliteStudent PublicationsUniversity of HoustonHouston, TX 77204-4015
contact us:
online The best stu! from our website, comments and blogs. See what you’re missing: thedailycougar.com
TOP READSMiddle East news isn’t fairly covered1. Respect the right to free press, ideas2. Guns on-campus don’t make any 3. senseBoy who stood up for himself not 4. at faultFighting Words: Who will top Final 5. Four?!
FEATURED COMMENTSRe: Guns on-campus don’t make any sense
“Campus security is more for keeping the campus secure as a whole and cannot ensure the security of each individual student on campus. This law is going to give people the right to ensure their own safety.”
— user “CHL safety”
Re: Middle East news isn’t fairly covered
“There are many activists in Houston who actively oppose REAL neo-nazis and racists and those same activists are unafraid to criticize governments, whether the US, Israeli, or Egyptian. People must call out oppression where ever they see it. The Israelis and the US are the ones in power, you can’t have the money, power and weapons and claim to be victimized by people who are constantly under occupation and live largely in poverty.”
— user “Elizabeth”
Re: Modest bill reaches to both politi-cal parties
“Immigration laws are civil laws- not criminal. It is not a federal crime to be unlawfully present in the United States- it is a civil violation.”
— user “Sara Dady”
Re: Fighting Words: Who will top Final Four?
“Hmmm, there’s no number one or number two seeds, so I’ll choose the number three. Just as I’m sure you were when Louisville, Kansas, Duke and Pitt all went down before expected, prepare to be surprised again.”
— user “chris”
Re: Budget cuts should affect UH equally
“When UH is no longer able to pay competitively we’ll also have the added bonus of not having to pay for other luxuries like desks, textbooks, and power because no one will want to attend. I agree some academics are over-paid, but if we don’t overpay, someone else likely, which means forgetting not only about Tier One (not that that’s a big loss) but also a decent education altogether.”
— user “Neil A. Dorr”
The Daily Cougar NEWS Monday, April !, "#$$ ! 3
and sexuality tangible for students and the community at large and decided to take advantage of the fact that this wonderful artist lives in Houston,” Shakhasari said.
The show challenged the audi-ence to think beyond socially con-structed gender roles and question what it means to be male or female, regardless of how society labels people from their biological sex.
“Her performance is more than a drag show,” Shakhsari said. “As an educator, she makes her audi-ence think about the meanings of manhood and womanhood and the racial connotations of these categories.
By creating the social norm of what makes a person male or female, society labels people who don’t fit into those norms as “unnatural” or “abnormal.” This is why it is important to have performers like Gerestant discuss these topics in their works, Shakh-sari said.
Gerestant’s performance was brought to the University by the joint effort of the Women’s, Gen-der, and Sexuality Studies Program, the Women’s Resource Center, the Cynthia Woods Mitchell Center for the Arts and the LGBT Resource Center.
Americans spend around $2 trillion a year in doctor visits, an amount more than twice of the average developed country, according to the handout.
Unequal income distribution is currently at its highest since the 1920s. Life expectancy in the United States is 29th in the world, followed by infant mortality at 30th place. Middle class people are twice as likely to die a pre-mature death compared to upper class people. Low-income citizens are four times as likely to die prematurely.
According to Jones, America has many health issues because health care is not a national priority.
“Your generation will have a shorter lifespan than your parents’ generation and it could continue to get shorter,” Jones said. “Infant mortality hasn’t changed in the past 100 years. In Texas, the number one risk group for pre-menopausal breast cancer is African American women. The second group is Hispanic women, who are getting breast cancer at younger ages.”
Jones gave his opinions on fi xing the health issues in the US.
“We have tended to look for other people to make a change,” Jones said. “No one center or one institution or profession will solve the problems we face. Do one brave thing today, then run because someone’s going to be after you.”
Mildred Gerestant performed Thursday thanks to an invitation from the Women’s Gender and Sexuality Studes Program, the Wom-en’s Resource Center, the Cynthia Woods Mitchell Center for the Arts, and the LGBT Resource Center. | NIne Nguyen/The Daily Cougar
Speak up whenever you want.
Register with the Web site and comment on any article at thedailycougar.com
Covering UH’s quest for greatness since 1934.Watch UH’s story unfold at thedailycougar.com
4 ! Monday, April !, "#$$ The Daily Cougar
STAFF EDITORIAL
T he Texas Legislature is in full swing now, and the budget cuts are coming together.
Although lawmakers are forced to make tough choices, some of the decisions being made are unfair.
Last Friday House members passed an amend-ment to the budget offered by Rep. Wayne Christian, R-Nacogdoches, who is a prominent Conservative activist.
The amendment states that universities “shall use an amount of appropriated funds to support a family and traditional values center for students of the institution that is not less than any amount of appropriated funds used by the institution to support a gender and sexuality center.”
Basically, because UH has a GLBT center, it will now have to fund a center for “traditional family values” with the same amount of money provided to the GLBT center. And while that sounds all right in theory, it’s irresponsible of the Legislature to impel universities to spend money in a specifi c way — especially with the amount of cuts public schools in Texas are about to endure.
It’s a policy that’s fair in words only. The reason the GLBT center exists in the fi rst place is to provide minority students with a voice on campus. The majority already has a voice, because it simply is the majority. Requiring equal funding for a majority voice center is somewhat ridiculous, because the University will most likely have to lower funding for both centers to appease lawmakers.
However, while some budget decisions aren’t being debated enough, some of the extreme measures proposed are being vetoed. The Windham School District, which provides higher education opportunities to prisoners, did not have its funding stripped. Instead, the district will only receive a $1.3 million cut in funds.
Two motions to introduce amendments, one which would have cut all of Windham’s funding and another that would have taken nearly half, were tabled.
The budget bill is now in the hands of the state Senate, as the House passed its draft of the bill 98-49 Sunday night. Let’s hope the Senators are a bit more realistic when it comes time to vote.
Budget amendment seeks fake equality
STAFF EDITORIAL The Sta! Editorial re" ects the opinions of The Daily Cougar Editorial Board (the members of which are listed above the editorial). All other opinions, commentaries and cartoons re" ect only the opinion of the author. Opinions expressed in The Daily Cougar do not necessarily re" ect those of the University of Houston or the students as a whole.
LETTERS TO THE EDITOR The Daily Cougar welcomes letters to the editor from any member of the UH community. Letters should be no more than 250 words and signed, including the author’s full name, phone number or e-mail address and a# liation with the University, including classi$ cation and major. Anonymous letters will not be published. Deliver letters to Room 7, University Center Satellite; e-mail them to [email protected]; send them via campus mail to STP 4015; or fax them to (713) 743-5384. Letters are subject to editing.
ADVERTISEMENTS Advertisements published in The Daily Cougar do not necessarily re" ect the views and opinions of the University or the students as a whole.
GUEST COMMENTARY Submissions are accepted from any member of the UH community and must be signed with the author’s name, phone number or e-mail address and a# liation with the University, including classi$ cation and major. Commentary should be kept to less than 500 words. Guest commentaries should not be written as replies to material already printed in the Cougar, but rather should present independent points of view. Rebuttals should be sent as letters. Deliver submissions to Room 7, University Center Satellite; e-mail them to [email protected]; or fax them to (713) 743-5384. All submissions are subject to editing.
THE DAILY COUGARE D I T O R I A L B O A R DEDITOR IN CHIEF Jack WehmanMANAGING EDITORS Newton Liu, Christopher LoseeNEWS EDITORS Jose Aguilar, Cristi GuerraSPORTS EDITORS John Brannen, Joshua SiegelLIFE & ARTS EDITOR Mary BaakOPINION EDITOR Andrew Taylor
E D I TO R I A L P O L I C I E S
opinion EDITOR Andrew TaylorE-MAIL [email protected] www.thedailycougar.com/opinion
Religious freedom is considered one of America’s greatest virtues, but there are times when we are forced to
recognize that some rights protections go too far — to the point where they overstep public and logical acceptance and must be
limited or prohibited.The Followers of
Christ Church in Oregon City, Ore., are the subject of a number of widely publicized cases where children died after their parents and caretakers
refused medical help for treatable ill-nesses in favor of prayers and a variety of other faith healing practices.
A bill being proposed in Oregon would disallow religious conviction as an excuse against homicide charges for these types of cases, though it doesn’t forbid them from relying solely on faith healing now and in the future.
This bill, along with those with similar
aims, should pass in Oregon and be given support on a national scale. Religion should get no more irrational free rides because they fl y under the banner of religious freedom — that right, much like others with underlying complexities, is not absolute.
When discussing the legal responsibility of Followers of Christ Church, is murder too severe of a charge? If not, is there a bet-ter basis on which they could be held? The situation is a murky one.
A problem arises concerning how such cases will be handled, and it is diffi cult to know if courts can reach a fair ruling that will establish an acceptable precedence for similar cases that will be tried in the future.
The key is making sure that govern-ments tackle the correct issues and avoid the dangers of a slippery-slope ruling. Clearer boundaries and defi nitions need to be set defi ning what is unacceptable — a delicate balance must be struck so that parents still have the right to raise and
educate their children the best way they see fi t, regardless of religious upbringing and infl uence.
Where can the line be drawn such that it aligns religious practices with reason, holds people responsible, and still leaves space for religious freedom?
In these modern times, what does it truly mean for religion to be free? Some would defi ne it as holding to a doctrine you cannot act upon.
Regardless, the fact remains: It was not the children who died that were members of Followers of Christ Church, but their parents. This is an important distinction because the cases deal with the fact that an adult is making a religious decision for both themselves and their children.
In decisions concerning life and death, the law and the societal standards take precedence over individual beliefs.
Marcus Smith is an English freshman and may be reached at [email protected].
T he United State’s recent action in Libya has sparked much controversy from all sides of the
political spectrum, and not all of it has been uniform with party lines. Since our
forces were deployed in late March, many debates have erupted over whether or not the US should intervene at all.
In addition, President Barack Obama bypassed Congress in the decision to send in our military. Though the adminisration argues that we are not at war with Libya and these actions are Constitutional, many are angry that the President ordered our mili-tary in without consulting Congress and, by extension, the people.
Our country has a $14.2 trillion debt and a $1.5 trillion defi cit, according to the Congressional Budget Offi ce. The Pentagon has said that the Libyan action cost us $600 million in 6 days. This cost stems from 191
Tomahawk cruise missiles, 455 precision guided bombs and the downed F-15E fi ghter jet, in addition to other supplies.
We are coming up on two weeks of what the administration calls “kinetic military action,” and if the trend continues we will spend $1.2 billion intervening in another country’s civil war.
Can we afford to initiate ‘kinetic military action’ in countries that have problems? Obama said in his March 28 speech that we must act when our interests and values are at stake. So what about Syria, and Yemen, and Iran? In the Iranian protests in 2009, there were reports of 72 deaths of peaceful protestors caused by the government. Where was the US backing then?
What about Darfur? Genocide and brutal civil war has been going on there for years. Why is the US not helping out there?
Obama promised that we would have no troops on the ground in Libya, yet the 22nd MEU from Camp Lejeune left US shores to
be deployed on the Libyan coast.The administration has even hinted that
we would give arms to these rebels. These rebels, according their commander, have Al-Qaeda ties, and some have even been found to have fought against the US in Iraq and Afghanistan.
Obama said that we have succeeded in pushing Qaddafi back on the military front, but in the hours after he made those remarks reports came out that stated that rebel forces were being pushed back — Qaddafi ’s forces have taken one strategic oil town after another.
We have wasted over $1 billion in aid to a country in civil war with little tangible effect, and now, thanks to Obama’s rhetoric, we’re obligated to help other countries in similar trouble around the world? Mission Accomplished, Mr. president.
Warren Lauderdale is a journalism freshman and may be reached at [email protected].
Religious practices must be rational
Libya situation leaves budget worse off
MarcusSmith
THE PRESIDENTIAL SPOTLIGHT Courtesy of USBICEF
WarrenLauderdale
The Daily Cougar Monday, April !, "#$$ ! 5
sports EDITORS John Brannen, Joshua SiegelE-MAIL [email protected] www.thedailycougar.com/sports
overtimeSOFTBALLUH sweeps Marshall
The Cougars continued their string of successes, sweep-ing Marshall in a weekend series that helped the Cougars extended their winning streak to six.
Pitching and a well-executed o! ense powered the Cougars (24-12, 8-4 Conference USA), as they allowed the Thunder-ing Herd (13-20, 1-8 C-USA) to score only three times for the series.
The series opened Friday with a double-header. The Cougars eked out a 3-2 comeback victory.
Down 2-1, the Cougars tied the game up in the seventh inning on an Angela Splitter pinch-hit home run and picked up the victory with a walko! shot by Jennifer Klinkert.
The Cougars won the second game of the double-header with greater ease, pulling out to a 2-0 lead in the " rst inning and " nishing o! the Herd 4-0 on the strength of a shutout by Donna Bourgeois.
Bourgeois only allowed three baserunners and struck out six.
The Cougars again jumped out to an early 2-0 lead in the " nal game of the series Sunday. Amanda Crabtree went the distance for the Cougars, allowing one earned run and fanning a dozen to improve to 13-6 as UH won 4-1.
As a team, the Cougars are the league leaders in ERA for C-USA play at 0.82. Crabtree leads C-USA with 73 strikeouts in 38 innings. Bourgeois is second in C-USA play with an ERA of 0.32.
The Cougars opened conference play getting swept by UAB, but have since won eight of their last nine. They look to extend their success at 4 p.m. Tuesday against Houston Baptist.
— Cougar Sports Services
TRACK AND FIELDCougars perform steady at Shirley Crown Invitational
The women’s team dominated the sprints and beat Prarie View by eight points to claim the title at the Humble ISD High School and College meet Saturday. They team had eight first-place performances.
Grecia Bolton won the 100-meter dash in 11.43 seconds; Tai’Shea Reese was the runner-up in 11.66 seconds. Kalyn Floyd won the gold in the 200-meter dash, clocking in at 24.04 seconds, and Brittany Wallace was second with a 24.68-second split. The quarter mile was claimed by Whitney Harris with a 54.80-second finish. Ciera Johnson was the runner-up in the 400, with a 55.14-second finish. Amber Sellers was third with a 56.94-second performance. Both 4x100-meter relay teams and 4x400-meter relay teams won their respective events.
The men’s team placed second behind Prarie View with 157 points. There were seven first-place performances, with dominance in the throws and jumps.
— Cougar Sports Services
GOLFUH places low at Augusta
The Cougars finished fifteenth in the Insperity Augusta State Invitational with a final score of 904.
The Cougars finished seven shots back of fourteenth place Washington in the 17-school field.
The Cougars did improve each round, shooting a 310 to open the tournament, whittling that down to 298 and clos-ing with a 296.
Will Dusenbury placed highest for the Cougars, tying for forty-fifth. Dusenbury shot 223, seven-over.
— Cougar Sports Services
MEN’S BASKETBALL
Cougars celebrate their Guy
John BrannenTHE DAILY COUGAR
Forward thinking and Five Final Four appearances still hasn’t granted former head coach Guy Lewis access to the Nai-smith Hall of Fame.
As former player Otis Birdsong pointed out Lewis, 89, does not publicize his omis-sion. But that doesn’t mean Director of Athletics Mack Rhoades and former players like Elvin Hayes and Clyde Drexler won’t.
“I have no idea why Coach Lewis isn’t in the Hall of Fame,” Drexler said. “There’s no plausible explanation for him not being there. None. I don’t want to take anything away from anyone who’s in there because they all deserve to be there, but I think as
much as any other coach in the history of college basketball, Guy Lewis deserves to be there.
“When you leave out a guy like Guy Lewis, what you’re saying is we don’t respect his accomplishments.”
Lewis was praised for his contributions to UH and college basketball in a ceremony Friday at the John O’Quinn Great Hall in the Athletics/Alumni Center.
Lewis was known as an innovator for basketball on and off the court. The coach recruited Hayes and Don Chaney, the fi rst two African-American players at UH. He fought for the 1968 Game of the Century in the Astrodome to be nationally-televised. In the 1980s his up-tempo philosophy took UH to three consecutive Final Fours.
Apart from that, though, his former players said that he was a father fi gure, and knew how to fi re up his team.
“Before the games, he was the most inspirational speaker I’ve ever heard, and I’ve heard some great coaches,” Drexler
said. “If you were not fi red up to play after listening to him speak for about fi ve min-utes, you did not have a pulse.”
Hayes said the guidance of Lewis assisted him into becoming one of the greatest players in NBA history.
“When I met coach Guy Lewis, every-thing I worked on in my back yard, he polished and shined it into the most beauti-ful color,” Hayes said.
During the ceremony it was announced that next year the Greater Houston Bas-ketball Committee will give out an award named for Lewis to the best player in the greater-Houston area.
“Coach Lewis set this level of greatness,” Rhoades said. “We’re going to fi ght like heck to get there again. One day, hopefully sooner than later, coach Lewis becomes a member of the Naismith Hall of Fame. But whether he does or doesn’t that will never diminish his greatness.”
The Cougars used solid pitching and timely hitting to turn the tide and sweep the Tulane Green Wave on Sunday in New Orleans.
UH was assisted by three games of consistent pitching where all of the starters pitched a minimum of seven innings and career-long outings.
“We’ve been talking to the pitching staff about going late into games for us,” head coach Todd Whitting said. “When you throw strikes and manage counts, it gives you the ability to go deep into games.”
With the wins, the Cougars (15-14, 3-0 C-USA) put an end to their three-game skid and sit on top of the early conference standings.
The sweep marks the seventh straight year that the Cougars have won their conference series opener and their fi rst conference road sweep since April 2009.
“To start league play 3-0 gives the team a lot of confi dence going into this week,” Whitting said. “It’s a huge boost for our ball club. We have to learn from what we did good and bad this weekend.”
In the series fi nale Sunday the Cougars erupted offensively to beat Tulane 9-0. Pitcher Mo Wiley (2-1) had eight innings while shutting out Tulane (18-10, 1-5 C-USA) on nine hits.
The UH offense opened up the scoring in the third with four runs when Caleb Ramsey hit a two-RBI double with the bases loaded. Chase Jensen then followed suit and hit a two-RBI single to right fi eld.
The Cougars added two runs in the fourth, one run in the fi fth and two in the seventh to balloon the lead to 9-0.
Taylor Hammack pitched a scoreless ninth frame to preserve the UH victory.
Saturday’s game featured the second impressive UH pitching performance in as many days as the Cougars downed Tulane 5-2.
Jordan Lewis (3-0) pitched seven-and-one-third innings and allowed two runs on nine hits. Dakota Dill entered the game in relief of Lewis and pitched a scoreless fi nal one-and-two-thirds of an inning to cement the win and earn his fourth save.
UH got on the scoreboard right away, scoring one run in the fi rst inning. They added another run in the fourth and then two in the fi fth after M.P. Cokinos hit an RBI double and John Cannon hit a sacrifi ce fl y.
Tulane scored once in the sixth inning and once in the eighth, but the UH pitch-ers shut down any inklings of a rally.
Landon Appling led the way for the Cougars offensively, going three-for-four at
the plate and scoring two runs.The series opener featured the fi rst of
the UH brilliant pitching performances as Matt Creel (4-3) and the Cougars shut out Tulane 2-0. Creel set the tone for the pitching staff when he went seven innings, allowing no runs and only three hits.
Jordan Mannisto relieved Creel, going the fi nal two innings without giving up a hit and earning his second save of the season.
UH will need to continue its strong play as they travel to take on No. 5 Texas A&M at 5:05 Tuesday in College Station.
UH greats, fans rally for iconic coach’s inclusion into Basketball Hall of Fame
After losing ! ve of six, pitcher Taylor Hammack and the Cougars opened up the conference portion of their schedule in convincing fashion with a weekend sweep against Tulane. The Cougars continue their road trip tomorrow against Texas A&M. | Newton Liu/The Daily Cougar
BASEBALL
UH opens C-USA play with sweep
EMPLOYMENT SEMINAR
FRIDAY, APRIL 8, 20112-5 PM
170 Melcher HallC.T. Bauer College of Business
For International Students, Scholars & UH Staff
Work Options »Practical Training ( CPT/ OPT) »The Job Search »H-1B Visas »Employment Based Immigration »Immigration Lawyer »
Sponsored by the International Student & Scholar Service Office
classifieds jobs, housing, services & more !"#-!$#-%#%& classi'[email protected] thedailycougar.com/classi'eds
HELP WANTEDHELP WANTED HELP WANTED HELP WANTED HELP WANTEDBULLETIN BOARD
Jobs. Apartments. Ó Get more Classi!eds daily at thedailycougar.com/classi!eds
ENERGETIC FEMALE to attend 13 year old disabled
girl evening or weekends, Bellaire. Swim, bike, grooming, meals. Must jog 1 mile. Child is sweet and toilet trained. $10/hr
713-628-6677 Will train.
BARTENDERS/SERVERS New Heights bar/restaurant
seeks fun intelligent staff. Focus on quality & hospitality. Please
FIND YOUR NEXT JOB. Read The Daily Cougar classifieds every day — in print or online.
6 ! Monday, April !, "#$$ LIFE&ARTS The Daily Cougar
The Daily Cougar on Facebook. FTW.
Get news, updates and more in your Facebook feed. Become a fan at facebook.com/thedailycougar
MOVIE REVIEW
Gyllenhaal cracks the ‘Code’ of box o! ce hitsJorge PorrasTHE DAILY COUGAR
Imagine a movie that combines elements from older movies with the likes of “Groundhog Day,” “Déjà vu” and “Inception,” and you’ll be able to begin wrapping your head around “Source Code,” starring Jake Gyllenhaal and Michelle Monaghan.
The story is centered around Gyl-lenhaal’s character, Captain Stevens.
A helicopter pilot turned science experiment guinea pig, he fi nds himself to be part of a government funded project known only as Source Code, where science has found a way for a person to relive the last eight minutes of another person’s life over and over.
In the movie, the Source Code is used to place Captain Stevens in the last moments of someone who was killed by a bomb that destroyed a Chicago commuter train. With only eight minutes at his disposal at a time, he is put in charge of fi nding both the bomb and the bomber, though as the story moves forward it becomes a bit more complicated.
This is defi nitely a solid movie to kick off the summer blockbuster season this year. The suspense grips viewers from the fi rst line to the last frame. Even though 85 percent of the movie revolves around the same eight minute window, it is written and shot in a way where you almost don’t notice the repetition.
Though this may not be an Academy Award-winner by any stretch, it is still a great ride, and the performances are on point. For the most part, there really aren’t any dull moments in the movie.
One characteristic about the fi lm is that the theme is always evolving.What the movie starts out as in the beginning will have changed into something else by the end, but the logic or tempo of the story is never sacrifi ced.
This is one of those movies you need to see with a friend — you will be talking about it for hours after it’s over.
The Daily Cougar COMICS & MORE Monday, April !, "#$$ ! 7
crosswordcomics
sudokuHow to play Each row must contain the numbers 1 to 9; each column must contain the numbers 1 to 9; and each set of 3-by-3 boxes must also contain the numbers 1 to 9.
LIMBO by Paolo Aninag
Must Be Something in the Water by Brandon Alexander
ACROSS 1 Jungle crushers 5 Give shape to 9 Meditation
practice 12 La senorita 13 Outlying
community 15 Ambiance 16 Lascivious look 17 Exactness 18 Wife of Geraint 19 Found 21 Red powdery
condiment 23 Fail to win 24 Give — — shot 25 Twang or drawl 28 Explosive 33 Giggle (hyph.) 34 Cotton pod 35 Arden and Curie 36 — kwon do 37 As — — (usually) 38 Possibilities 39 Now! 41 Flaky mineral 42 Garbo 44 Cut back 46 Somewhat
formal 47 Tucked away 48 Hat attachment 49 Valor 53 Lobster part 57 Connery
of 007 fame 58 Ax and adz 60 Volkswagen kin 61 Solidi! es 62 — done it this
time! 63 Close violently 64 NFL scores 65 Wedding cake
layer 66 Yellowstone
sight
DOWN 1 Steeple feature 2 Diet spread 3 Obi-Wan
portrayer 4 Cheesecake
brand (2 wds.) 5 Least 6 Rust or patina
7 Drag along 8 Stop dating 9 Pueblo people 10 Norse name 11 Goose egg 14 Tactile
language 15 Tend the
aquarium 20 Color variation 22 Harper Valley
org. 25 Perfume base 26 Refrain from 27 Not play fair 28 Swear to 29 Earthenware jar 30 Wall climbers 31 Boxing jabs 32 Term paper 34 — -a-brac 37 General pardon 40 Shrimps 42 Coarse sand 43 Software
version 45 Monsieur’s
summer 46 Slower mentally 48 Faucet 49 Discreet
summons 50 Plant
in a swamp 51 Nutritious grains 52 Carbon deposit 54 Empty, in math 55 Minn. neighbor 56 Prepares
C H A P P R I O R S O R TR A R E B U G L E A L E ET I L E S T O I C L E A DS L O P E R O O F T O P
E A C H S U R FF I N D S O U T P O L K AA D E E A G E R M A I D SW E E D L E X U S T R O TN A D E R R A B I D O B IL Y R E S S E A R O V E R
I N I T S M O GP I V O T A L P L A C E
J O V I C H I D E E G A DI M A N O O Z E S R U N GF E N G M E A N T S A S E
Promotional. EXPIRES: 04/30/2011. Present this coupon at Front Desk to redeem. Limit one coupon per customer. Barcode valid for one use only. Minor policies vary by location – please check www.daveandbusters.com/locations for details. Not valid with any other offers, including Eat & Play Combo and Special Price Game Days. Not valid with Special Events Packages. Coupon must be surrendered at time of redemption and may not be photocopied or duplicated. Non negotiable. Power Card activation fee is $2. ($3 Times Square). NOT FOR RESALE.
Richmond @ Fountainview • 713.952.2233
NCAACHAMPIONSHIPFind out who won our Bracket Challenge in Wednesday's Daily Cougar!
Get the inside scoop on the Final Four at overtime.thedailycougar.com
8 ! Monday, April !, "#$$ LIFE&ARTS The Daily Cougar
ARCHITECTURE
Industrial design students featured in annual Design FairMichelle Leigh SmithSPECIAL TO THE DAILY COUGAR
Looking for the leading edge in the art world? Art afi cionados need look no further than the Lawndale Art Center, located at 4912 Main in the heart of the Museum District.
Sculptor James Surls started the collective in the late ’70s.
“I just found myself in a situa-tion what I was not in control of, I just assumed control of,” Surls said in a 2009 interview with the Houston Chronicle’s Doug Britt. “I just kind of took over. I started appointing people in positions. Someone who liked photography, I would just say, ‘OK, you’re the curator of photography.’
“People loved it. They loved
doing it, and God almighty, they worked, they worked, they worked.”
From the beginning, the stu-dents were the backbone.
“We had a space, and we had a labor force and we had a com-munity that was receptive,” Surls said. “You couldn’t ask for a better kind of scenario, and it just caught on fi re. Lawndale started off a fi ve- or six- or seven-year era, that was when Houston was ready; the times were right; everything was — you know, Houston was just on fi re.”
UH juniors Ya-Han Chen and Meredith Tucker designed an easily manufactured interchangeable sofa/bed that can be sold for around $2800.
“The students had to project the retail costs and include the cost of all materials,” Adam Wells, Profes-sor of Industrial Design in the UH School of Architecture, said.
UH has the only Industrial Design program in Texas. Another Lawndale entry, Viera, was designed by UH juniors Umbelina Cantu, Sergio Aleman, Thi Vu and Kellee Kimbra.
Viera examines the function of sitting among humans, and can be manufactured in many colors, including sky blue, charcoal, bright red or olive.
Michael Guidry serves as cura-tor for Lawndale and curator for UH’s public art collection.
UH juniors Thi Vu, Umbelina Cantu and Sergio Aleman designed Viera, a furniture piece that represents the informal casual function and requirements of human sitting behav-ior. Kellee Kimbro is also part of the Raw Collective team. | Photo by David Lidsky
Sign up for daily e-mail updates: www.thedailycougar.com
