Differentiation 84 (2012) 314–321

Contents lists available at SciVerse ScienceDirect

Differentiation

0301-46

Join the

http://d

n Corr

E-m

journal homepage: www.elsevier.com/locate/diff

A global downregulation of microRNAs occurs in human quiescent satellitecells during myogenesis

Merel Koning a,b, Paul M.N. Werker a, Marja J.A. van Luyn b, Guido Krenning b, Martin C. Harmsen b,n

a Department of Plastic Surgery, University Medical Center Groningen, University of Groningen, The Netherlandsb Department of Pathology and Medical Biology, University Medical Center Groningen, University of Groningen, Hanzeplein 1, 9711 GZ Groningen, The Netherlands

a r t i c l e i n f o

Article history:

Received 25 January 2012

Received in revised form

12 August 2012

Accepted 15 August 2012Available online 27 September 2012

Keywords:

Satellite cells

Skeletal muscle

Quiescence

MicroRNA

MicroRNA microarray

81/$ - see front matter & 2012 International

International Society for Differentiation (ww

x.doi.org/10.1016/j.diff.2012.08.002

esponding author. Tel.: þ31 50 3614776; fax

ail address: m.c.harmsen@umcg.nl (M.C. Harm

a b s t r a c t

During myogenesis, human satellite cells differentiate and form multinucleated myotubes, while a

fraction of the human satellite cells enter quiescence. These quiescent satellite cells are able to activate,

proliferate and contribute to muscle regeneration. Post-transcriptional regulation of myogenesis occurs

through specific myogenic microRNAs, also known as myomiRs. Although many microRNAs are

involved in myotube formation, little is known on the involvement of microRNAs in satellite cells

entering quiescence. This current study aims to investigate microRNA involvement during differentia-

tion of human satellite cells, specifically proliferating satellite cells entering quiescence.

For this, clonally expanded human satellite cells were differentiated for 5 days, after which myotubes

and quiescent satellite cells were separated through FACS sorting. Next, a microRNA microarray

comparison of proliferating satellite cells, myotubes and quiescent satellite cells was performed and

verified through qRT-PCR.

We show that during human satellite cell differentiation, microRNAs are globally downregulated in

quiescent satellite cells compared to proliferating satellite cells, in particular microRNA-106b, microRNA-

25, microRNA-29c and microRNA-320c. Furthermore, we show that during myogenesis microRNA-1,

microRNA-133, microRNA-206 and microRNA-486 are involved in myotube formation rather than

satellite cells entering quiescence. Finally, we show an overall decrease in total mRNA in quiescent

satellite cells, and an indication that RNaseL regulation plays a role in promoting and maintaining

quiescence. Given the importance of quiescent satellite cells in skeletal muscle development and

regenerative medicine, it is imperative to distinguish between myotubes and quiescent satellite cells

when investigating skeletal muscle development, especially in microRNA studies, since we show that

microRNAs are globally downregulated in quiescent human satellite cells.

& 2012 International Society of Differentiation. Published by Elsevier B.V. All rights reserved.

1. Introduction

Muscle tissue has its own endogenous repair and maintenancesystem which is based on myogenic progenitor cells, i.e. satellitecells. In vivo, satellite cells are activated upon tissue damage, theyproliferate and differentiate, fuse with existing myofibers andthereby contribute to the regeneration of damaged muscle(Buckingham and Montarras, 2008; Le and Rudnicki, 2007;Sacco et al., 2008; Ten Broek et al., 2010; Zammit andBeauchamp, 2001). During differentiation in vitro, part of thehuman satellite cells form multinucleated myotubes, and theother part enters quiescence (Fukada et al., 2007,2011). Whilemyotubes are terminally differentiated, these quiescent satellite

Society of Differentiation. Publish

w.isdifferentiation.org)

: þ31 50 3619911.

sen).

cells, also called reserve cells (Carnac et al., 2000), are still able toactivate, proliferate and differentiate to form myotubes andcontribute to muscle regeneration and repair. The ability to adaptto two distinct cell fates, i.e. toward myotube formation orquiescence in the same microenvironment is unique for satellitecells (Cosgrove et al., 2009; Relaix and Marcelle, 2009).

The myogenic differentiation process is transcriptionally regu-lated through factors such as Pax7 and the myogenic regulatorfactors MyoD and Myogenin. Post-transcriptional regulationfurther occurs through specific myogenic microRNAs, also knownas myomiRs (McCarthy, 2008; Sousa-Victor et al., 2011).

MicroRNAs are small, non-coding RNAs, 20–22 nucleotides inlength, involved in post-transcriptional gene regulation throughinhibition of protein translation or enhancing messenger RNAdegradation. MyomiRs have an important role in skeletal muscledevelopment and disease (Cheung et al., 2012; Callis et al., 2008;Chen et al., 2009; Crist and Buckingham, 2009,2010; Guller and

ed by Elsevier B.V. All rights reserved.

M. Koning et al. / Differentiation 84 (2012) 314–321 315

Russell, 2010; Naguibneva et al., 2007). A major effect of micro-RNAs in myogenesis is that they modulate proliferation as well asdifferentiation of satellite cells (Ambros, 2001). MicroRNA-133promotes satellite cell proliferation through repressing the SerumResponse Factor (Chen et al., 2006), but is not essential in skeletalmuscle development (Deng et al., 2011). MicroRNA-1, microRNA-206 and microRNA-486 are strongly upregulated during satellitecell differentiation and subsequent muscle development. Theyimprove muscle differentiation by inhibiting PAX7 translationsuch that MYOD is no longer inhibited and myotube formationprogresses (Chen et al., 2010; Dey et al., 2011; Hirai et al., 2010;Koning et al., 2011). Finally, other microRNAs that improvemyotube formation are microRNA-181 that targets Hox-A11(Naguibneva et al., 2006), microRNA-24 (Sarkar et al., 2010; Sunet al., 2008) and microRNA-27 that facilitates the start of myotubeformation by targeting PAX3 (Crist et al., 2009). Also microRNA-29 improves myotube formation by targeting HDAC4 (Winbankset al., 2011), thereby preventing muscle degeneration (Wanget al., 2011). Although many microRNAs are involved in myotubeformation, little is known on the involvement of microRNAs insatellite cells entering quiescence, which is of importance inskeletal muscle regeneration. Recently, in a hindlimb injurymodel, microRNA-489 was shown to be involved in maintainingquiescence in mouse satellite cells (Cheung et al., 2012). However,how this relates to human satellite cells is unknown. This currentstudy aims to investigate microRNA involvement during differ-entiation of human satellite cells through a microRNA microarrayof proliferating satellite cells, myotubes and quiescent satellitecells to elevate the knowledge of microRNAs during differentia-tion of human satellite cells.

2. Materials and methods

2.1. Satellite cell isolation and culture

A muscle biopsy was obtained from a healthy female donor,undergoing blepharoplasty. The age of the donor was 60 years.The study protocol was approved by the institutional medicalethics committee, and the donor gave her informed consent.Satellite cells were isolated with 0.04 mg/ml (0.16Collagena-se Wunsch units/ml) Liberase Blendzyme 3 (Roche AppliedScience, The Netherlands) as described previously (Koning et al.,2011). Proliferation medium consisted of Dulbecco’s ModifiedEagle Medium (DMEM) (Invitrogen/Gibco, CA, USA), 20% FetalBovine Serum (FBS; Invitrogen/Gibco) and 1% penicillin/strepto-mycin 50 mg/ml (Sigma-Aldrich, St. Louis, USA). Differentiationmedium (DM) contained DMEM, 2% FBS, 1% penicillin/streptomy-cin, 1% Insulin-Transferrin-Selenium-A (100� ; Invitrogen)and 0.4 mg/ml dexamethason (Sigma-Aldrich). The mediumwas refreshed three times per week. Cells were plated at5.0�103 cells/cm2 in culture flasks precoated with 1% gelatine/PBS for 30 min. When cells reached 70% confluence, they wereenzymatically harvested using accutase (Invitrogen) and pas-saged. Passage number (Px) was defined as the xth sequentialharvest of a subconfluent cell population. At passage 8, cells werecloned by sorting single cells in 96 wells plates using a MoFlowFACS. The fraction of human satellite cells that was able toclonally expand was 26.374.0%. A clone that uniformlyexpressed the satellite cell marker Pax7 and the myogenicregulator factors MyoD1 and Myogenin was selected for furtherexperiments.

After 5 day differentiation, we sorted mononuclear cells andmyotubes by first harvesting the whole cell fraction usingaccutase (Invitrogen) and then sieving the cell fraction througha 70 mm sieve. Next, we stained the flowthrough with 5 mg/ml

Hoechst (Invitrogen) for 30 min at room temperature and finallywe performed sorting by FACS to obtain a mononucleated frac-tion, which represents 490% of the quiescent satellite cells.Proliferating satellite cells were handled similarly, and myotubeswere retrieved of the sieve filter.

2.2. Immunofluorescent staining

Cells were cultured on Thermanoxs coverslips, Lab-Tek cham-ber slides or 96 wells plates (all NUNC Brand Products, Roskilde,Denmark) coated with 1% gelatine. At 100% confluence, cells werefixed or cultured for an additional 5 days in DM and subsequentlyfixed in 2% paraformaldehyde (PFA) at room temperature for10 min. A permeabilization step was performed with 0.5% TritonX-100 (Sigma-Aldrich) in PBS at room temperature for 10 min.Non-specific binding-sites were blocked with 10% goat serum inPBS for 30 min. Cells were incubated with the primary antibody inPBS and 2% serum at room temperature for 60 min or at 4 1Covernight. The primary antibody consisted of either (1) a prolif-eration marker, rabbit-anti-human Ki67 (1:100; Sanbio, Uden,The Netherlands), (2) a satellite cell marker, mouse-anti-humanPax7 (1:10; Developmental Studies Hybridoma Bank (DSHB),Iowa, USA), (3) a myogenic marker, rabbit-anti-human desmin(1:100; Novus Biological, Littleton, USA), (4) a myogenic tran-scription factor, mouse-anti-human MyoD (1:100; Dako, Glostrup,Denmark), (5) a myogenic transcription factor, mouse-anti-humanmyogenin (1:100; DSHB), (6) a sarcomere component, mouse-anti-human myosin (MF20; 1:500; DSHB) and (7) mouse-anti-humanRNaseL (1:100; Abcam, Cambridge, UK). After three washes with0.05% Tween in PBS the cells were incubated with a secondaryantibody-cocktail at room temperature for 30 min. The secondaryantibody-cocktail consisted of FITC-conjungated goat-anti-rabbitIgG (1:100; Southern Biotech, AL, USA), Alexa Fluors488 goat-anti-mouse IgM and Alexa Fluors 555 goat-anti-mouse IgG1 or IgG2b

(all Invitrogen; 1:300 in PBS/DAPI containing 10% normal humanserum). Samples were mounted in Citifluor AP1 (Agar Scientific,Essex, UK). Examination was performed by immunofluorescencemicroscopy using a Leica DMRXA microscope and Leica Software(Leica Microsystems, Wetzlar, Germany), and further quantifica-tion was performed by TissueFAXS using a Zeiss AxioObserver.Z1microscope and TissueQuest Cell Analysis Software (TissueGnos-tics, Vienna, Austria).

2.3. Gene transcript analysis

Total RNA was isolated from approximately 200,000 cellsusing the Rneasy Kit (Qiagen Inc., CA, USA), in accordance to themanufacturer’s protocol. Briefly, a cell lysate was made anddiluted with an equal volume of ethanol (70%). RNA was collectedon an RNA binding filter by centrifugation. DNA was removed byincubation with a DNase I solution at 37 1C for 15 min. The RNA-binding filter was washed twice and subsequently the RNA waseluted with 14 ml Elution Buffer. The RNA concentration andpurity were determined by spectrophotometry (NanoDrop Tech-nologies, Wilmington, NC). For qRT-PCR analysis, total RNA wasreverse transcribed using the First Strand cDNA synthesis kit(Fermentas UAB, Lithuania). In summary, 1 mg of total RNA wasdiluted in a final reaction volume of 20 ml containing randomhexamer primer (0.5 mg), RiboLockTM Ribonuclease Inhibitor(20 U), and 1 mM dNTP mix, and incubated at 37 1C for 1 h. Thereverse transcription reaction was terminated by heating themixture to 70 1C for 10 min, after which the samples were placedon ice. Quantitative RT-PCR analysis was performed in a finalreaction volume of 10 ml, consisting of SYBR Green Supermix(Bio-Rad, Hercules, USA), 0.5 mM primer-mix (Table 1) and 5 ngcDNA. Reactions were performed at 95 1C for 15 s, 60 1C for 30 s

M. Koning et al. / Differentiation 84 (2012) 314–321316

and 72 1C for 30 s, for 40 cycles. Analysis of the data wasperformed using Science Detection Software 2.2.2. To determinedifferences in expression, Ct-values were normalized againstGAPDH-expression using the DCt-method (DCt(gene)¼Ct(gene)�

Ct(GAPDH)). Relative expression levels were calculated as 2�(DCt).All cDNA samples were amplified in triplicate.

2.4. MicroRNA analysis

Total RNA was isolated from approximately 200,000 cellsusing the mirVana kit (Ambion), in accordance to the manufac-turer’s protocol. Briefly, a cell lysate was made and diluted with1.25 volumes of ethanol (100%). RNA was collected on a RNAbinding filter by centrifugation. The RNA concentration and puritywere determined by spectrophotometry (NanoDrop Technologies,Wilmington, NC).

Microarray analysis of proliferating satellite cells, myotubesand quiescent satellite cells (N¼3) was performed according tothe manufacturer’s protocol (Agilent, Santa Clara, SA). Briefly, firststrand cDNA was synthesized from 100 ng RNA, followed by cRNAamplification and labeling with Cy3. Samples were hybridized in adye swap design at 65 1C overnight on Agilent microRNA Micro-array 16.0. The following day, slides were washed and signalswere scanned with GenePix 4000B (Agilent). Signal intensitiesfrom scanned images were processed and converted into normal-ized data using Agilent Feature Extraction software version 9.1.Samples were analyzed and a quality control report was gener-ated using GeneSpring GX version 9.0 (Agilent).

cDNA synthesis was performed using the microRNA ReverseTranscription Kit (Applied Biosystems). In summary, 25 ng oftotal RNA was diluted in a final reaction volume of 5 ml with1.25 ml 6 mM microRNA specific RT-primer (Table 2) and 1.25 mlRT-master mix, containing 1 mM dNTP mix, multiscribe RT enzyme,RT Buffer, RNase Inhibitor and water. This was incubated at 16 1Cfor 30 min, 42 1C for 30 min, 85 1C for 5 min, and subsequentlymixed with 0.5 ml 10 mM microRNA specific qRT-primer and 0.5 ml10 mM reverse primer (Table 2). Quantitative RT-PCR analysis wasperformed with 25 ng cDNA-primer mix and 4 ml SYBR GreenSupermix (Bio-Rad, Hercules, USA). Reactions were performed at95 1C for 15 s and 60 1C for 60 s, for 45 cycles. Analysis of the datawas performed using Science Detection Software 2.2.2. To

Table 1Primer sequence quantitative reverse transcription polymerase chain reaction

(qRT-PCR).

Primer Forward Reverse

PAX7 ATCCGGCCCTGTGTCATCTC CACGCGGCTAATCGAACTCA

MYOD AGCACTACAGCGGCGACTCC CACGATGCTGGACAGGCAGT

MYL1 AAGCCCGCAATGCAGAAGAG TTGCTTGCAGTTTGTCCACCA

MYL3 GAACACCAAGCGTGTCATCCA TCAGCAGATGCCAGTTTTCCA

RNASEL CTGGCAGATTTTGATAAGAGCA ATAGAGGACCAGCCGTCCA

GAPDH CTGCCGTCTAGAAAAACCTG GTCCAGGGGTCTTACTCCTT

Table 2Mature microRNA primer sequence for qRT-PCR.

MicroRNA Stemloop primer

mir-106b GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCAC

mir-25 GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCAC

mir-29c GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCAC

mir-320c GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCAC

RNU6B GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCAC

Reverse oligo GTGCAGGGTCCGAGGT

determine differences in expression, Ct-values were normalizedagainst RNU6B-expression using the DCt-method (DCt(microRNA)¼

Ct(microRNA)�Ct(RNU6B)). Relative expression levels were calculatedas 2�(DCt). All cDNA samples were amplified in triplicate.

2.5. Statistics

All data are represented as mean7SEM and statistical com-parison between two groups was performed using Student’s t test.When comparing more than two groups, one way ANOVA wasused followed by the post-hoc Bonferroni multiple comparisontest in Graph-Pad Prism Version 5 (GraphPad Software, Inc.,La Jolla, CA, USA). Results were considered significant for po0.05.

3. Results

3.1. Satellite cells differentiate into myotubes or enter quiescence

Human satellite cells were isolated and cultured from enzy-matically dissociated muscle tissue. Initial passages comprisedheterogeneous cell populations. At passage 8, satellite cells werecloned by single cell sorting. Differential Interference Contrastimaging showed proliferating satellite cells at passage 48, andafter 5 days of differentiation when part of the satellite cells fusedand formed myotubes while another part remained mononuclear(Fig. 1A, B). Clonal satellite cells uniformly expressed Pax7 andDesmin during proliferation (Fig. 1C). Five days after differentia-tion, Pax7 expression was limited to the remaining mononuclearsatellite cells and the mean fluorescence intensity of Pax7increased (Fig. 1D, E). Desmin expression on the other handincreased in myotubes. During proliferation the percentageKi67/Pax7 double positive nuclei was 27.777.2%. Five days afterdifferentiation however, the percentage Ki67/Pax7 double posi-tive nuclei decreased to 2.870.8% (Fig. 1F–H; np¼0.04).

3.2. Myotubes and quiescent satellite cells have distinct regulatory

factors

While the expression of Pax7 was limited to nuclei of mono-nuclear quiescent satellite cells after differentiation (Fig. 1D), theexpression of the transcription factors MyoD and Myogenin waslimited to nuclei in myotubes (Fig. 2A, B). Also the adult musclemarker Myosin was limited to nuclei in myotubes (Fig. 2C). Afterdifferentiation, we separated myotubes from quiescent satellitecells, and analyzed proliferating satellite cells, myotubes andquiescent satellite cells by qRT-PCR. In myotubes PAX7 expressionhad decreased 0.2470.08 fold compared to proliferating satellitecells, and MYOD1 expression had increased 2.4170.23 foldcompared to proliferating satellite cells (Fig. 2D, E; nnpo0.01).In quiescent satellite cells however, PAX7 expression did notchange significantly, while MYOD1 expression also increased1.8970.14 fold compared to proliferating satellite cells(np¼0.02). Though Myosin expression increased in myotubes at

Forward primer

TGGATACGACATCTGCACT TGCGGTAAAGTGCTGAC

TGGATACGACTCAGACCGAG TGCGGCATTGCACTTGT

TGGATACGACTAACCGATTT TGCGGTAGCACCATTTG

TGGATACGACACCCTCTC TGCGGAAAAGCTGGGTT

TGGATACGACAAAAATATGG TGCGGCTGCGCAAGGATGA

Fig. 1. Human satellite cells differentiate into myotubes or go into quiescence. (A, B) Differential Interference Contrast image of (A) cloned proliferating satellite cells (T0)

and (B) at day 5 after differentiation (T5). (C, D) Immunofluorescent staining for Pax7 (red) and Desmin (green) of (C) proliferating satellite cells and (D) at day 5 after

differentiation. All satellite cells at T0 express both Pax7 and Desmin. After differentiation only the mononuclear satellite cells are highly positive for Pax7 while the

myotubes are highly positive for Desmin. (E) Analyses by TissueFAXS shows that the mean fluorecence intensity of Pax7 per nuclei increases after differentiation. (F, G)

Immunofluorescent staining for Pax7 and Ki67 (green) of (F) proliferating satellite cells and (G) 5 day after differentiation. (H) Analyses by TissueFAXS shows that the

percentage Pax7/Ki67 positive nuclei decreased after differentiation. Nuclei are counterstained with DAPI (blue). Scalebars are 100 mm (N¼3; data are represented as

mean7SEM; np¼0.04). (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

M. Koning et al. / Differentiation 84 (2012) 314–321 317

protein level, gene expression of both MYL1 and MYL3 did notchange significantly in either myotubes or quiescent satellite cellscompared to proliferating satellite cells (Fig. 2C, F, G).

3.3. MicroRNA expression in myotubes and quiescent satellite cells

After differentiation, we separated myotubes from quiescentsatellite cells, and compared the microRNA expression fromproliferating satellite cells, myotubes and quiescent satellite cellsby Agilent microRNA microarray. After differentiation of satellitecells, we identified four microRNAs that were highly upregulatedin myotubes compared to proliferating satellite cells (Fig. 3A). Inquiescent cells on the other hand, we did not find any signifi-cantly upregulated microRNAs compared to proliferating satellitecells (Fig. 3B). Strikingly, in general all microRNAs were decreasedin quiescent cells compared to proliferating satellite cells. Amongthese were microRNA-106b, microRNA-25, microRNA-29c andmicroRNA-320c that were significantly downregulated (Table 3).

The downregulation of these microRNAs was confirmed byqRT-PCR; microRNA-106b decreased 0.2370.15 fold, microRNA-25decreased 0.4270.13 fold, microRNA-29c decreased 0.2970.15 fold,microRNA-320c decreased 0.1870.06 fold (Fig. 4; nnpo0.01,npo0.05).

3.4. RNaseL involvement in quiescent satellite cells

Besides this overall decrease of microRNA expression in quiescentsatellite cells, we also found that total mRNA had decreased. Inquiescent satellite cells mRNA decreased 0.2970.07 fold comparedto mRNA in the same number of proliferating satellite cells (p¼0.02).Therefore, another post-transcriptional mechanism might be involvedin regulating quiescence in satellite cells. RNaseL is an activatableendonuclease that cleaves single-stranded virus, ribosomes, andmRNAs and thus causes an overall reduction of protein synthesis(Li et al., 2007). Overexpression of active RNaseL prevents myotubeformation (Bisbal et al., 2000; Bisbal, 1997). Thus, we argued that

Fig. 2. Myotubes and quiescent satellite cells have distinct regulatory factors. (A) Immunofluorescent staining of differentiated satellite cells for MyoD (red) and Desmin

(green) shows that only the nuclei of myotubes expressed MyoD. (B) Immunofluorescent staining of differentiated satellite cells for Myogenin (red) and Desmin (green)

shows that only the nuclei of myotubes expressed Myogenin. (C) Immunofluorescent staining of differentiated satellite cells for Myosin (red) and Desmin (green) shows

that myotubes express both Myosin and Desmin. Nuclei are counterstained with DAPI (blue). Scalebars are 100 mm. (D)–(G) Quantitative gene expression analysis of

proliferating satellite cells (T0), and myotubes and quiescent satellite cells at day 5 of differentiation (T5). (D) This shows a decreased PAX7 expression in myotubes

compared to T0, (E) an increased MYOD expression in both myotubes and quiescent satellite cells compared to T0, and (F) no significant change in MYL1 and (G) MYL3

expression. (N¼6; data are represented as means7SEM; np¼0.02; nnpo0.01). (For interpretation of the references to color in this figure legend, the reader is referred to

the web version of this article.)

Fig. 3. MicroRNA microarray comparing proliferating satellite cells to myotubes and quiescent satellite cells. In myotubes microRNA-1, microRNA-133, microRNA-206 and

microRNA-486 are significantly upregulated compared to proliferating satellite cells (T0). Quiescent satellite cells show a global downregulation of microRNAs,

significantly microRNA-106b, microRNA-25, microRNA-29c and microRNA-320c (N¼3).

M. Koning et al. / Differentiation 84 (2012) 314–321318

M. Koning et al. / Differentiation 84 (2012) 314–321 319

RNaseL could also be involved in maintaining or promoting quies-cence in satellite cells.

In quiescent satellite cells RNaseL was located in the nuclei(Fig. 5A, arrowheads), while RNaseL was not detectable in thenuclei of myotubes (Fig. 5A, arrow). We also analyzed RNASEL byqRT-PCR in the separated cell fractions, proliferating satellitecells, myotubes and quiescent satellite cells. The RNASEL expres-sion had decreased 0.0870.03 fold in myotubes compared toproliferating satellite cells (nnnpo0.001), while quiescent satellite

Table 3Fold change of microRNA expression in myotubes and quiescent satellite cells

compared to proliferating satellite cells.

Myotubes Mononuclear

mir-1 2002.59 (p¼7.68�10�3) ns

mir-133a 316.85 (p¼2.38�10�4) ns

mir-206 75.80 (p¼1.79�10�3) ns

mir-486-5p 33.91 (p¼5.73�10�3) ns

mir-106b ns �27.71 (p¼1.57�10�6)

mir-25 ns �34.82 (p¼6.80�10�5)

mir-29c ns �24.27 (p¼1.71�10�6)

mir-320c ns �28.84 (p¼2.77�10�5)

Fig. 4. MicroRNA expression in quiescent satellite cells. Quantitative microRNA

expression analysis in proliferating satellite cells and quiescent satellite cells

shows a decreased expression of microRNA-106b, microRNA-25, microRNA-29c

and microRNA-320c in quiescent satellite cells compared to proliferating satellite

cells (T0). (N¼6; data are represented as mean7SEM; np¼0.01; nnpo0.01).

Fig. 5. RNaseL expression in quiescent satellite cells. (A) Immunofluorescent staining o

satellite cells express RNaseL (arrowhead), while the nuclei of myotubes do not (arrow

gene expression analysis of RNASEL in proliferating satellite cells (T0), myotubes and qu

proliferating and quiescent satellite cells. (N¼6; data are represented as means7SEM; n

legend, the reader is referred to the web version of this article.)

cells did not change significantly compared to proliferatingsatellite cells (Fig. 5B).

4. Discussion

In the current study, we investigated microRNA involvementin the differentiation of human satellite cells. Our main finding isthat during differentiation of human satellite cells, microRNAs areglobally downregulated in quiescent satellite cells, while inmyotubes the expression of myomiRs is increased.

Another major finding is that upon differentiation, Pax7 posi-tive cells stop proliferating and enter quiescence (Fig. 1C–G).Previously we have shown that Pax7 expression per cell increases(Koning et al., 2011). Taken together, our results suggest that twodistinct populations of Pax 7-expressing satellite cells exist, thatrepresent different stages: proliferative satellite cells versus non-proliferative satellite cells. These non-proliferative satellite cellsarise during myogenesis. They likely have in vivo counterpartswhich are known as reserve cells (Carnac et al., 2000) or quiescentsatellite cells (Cosgrove et al., 2009; Kuang et al., 2008; Le andRudnicki, 2007; Relaix and Marcelle, 2009; Rudnicki et al., 2008).In vivo, these quiescent satellite cells are important in the main-tenance of the regenerative capacity of skeletal muscle. They arecapable of proliferation, and either differentiate to repair damagedmuscle fibers or enter quiescence to maintain the satellite cellpool. Therefore, investigating the regulation of both these distinctcell fates of satellite cells, i.e. myotube formation or enteringquiescence, is important for regenerative medicine. However, toour knowledge, microRNA expression in human quiescent satellitecells had not been addressed yet. Furthermore, most studies onmicroRNAs in differentiating satellite cells do not distinguishmyotubes from quiescent satellite cells. Therefore, the microRNAswhich have been previously described to be involved in satellitecell differentiation, i.e. myomiRs such as microRNA-1 (Koninget al., 2011), microRNA-133 (Chen et al., 2006), microRNA-206(Chen et al., 2010; McCarthy, 2008) and microRNA-486 (Dey et al.,2011), are in fact involved in myotube formation. We confirmedthis by showing that these microRNAs are not involved inquiescent satellite cells as such (Fig. 3; Table 3). We could notshow the involvement of microRNA-489 in quiescence of humansatellite cells. The differences between cultured human satellitecells and primary mouse satellite cells in an injury model mightexplain this. However, both studies by Cheung et al., like thiscurrent study, indicate the importance of identifying microRNAsinvolved in quiescence of satellite cells.

f differentiated satellite cells for RNaseL (red) shows that only nuclei of quiescent

). Nuclei are counterstained with DAPI (blue). Scalebar is 100 mm. (B) Quantitative

iescent satellite cells shows a decreased expression in myotubes compared to both

npo0.01; nnnpo0.001). (For interpretation of the references to color in this figure

M. Koning et al. / Differentiation 84 (2012) 314–321320

Our study further shows that both microRNA-106b andmicroRNA-25 are significantly decreased in quiescent humansatellite cells. In neural stem/progenitor cells isolated from adultmice, it has been shown that an overexpression of the microRNA-106b–25 cluster is involved in promoting proliferation, whereas aknockdown of this cluster decreases proliferation (Brett et al.,2011). However, in human HEK293 cells, microRNA-25 itselfinhibits proliferation (Anton et al., 2011). In our study bothmicroRNA-25 and proliferation are decreased. Therefore, theeffect of microRNA-25 on the proliferation of human satellitecells remains unclear.

It has previously been shown that in primary mice myoblastsand in the murine myoblast cell line C2C12, microRNA-29cpromotes myogenesis (Zhou et al., 2012; Wang et al., 2011;Winbanks et al., 2011). It has also been shown that microRNA-29c and microRNA-320 promote apoptosis in myocardial cells (Zhuand Fan, 2011). Our study shows that both microRNA-29c andmicroRNA-320c are decreased in quiescent human satellite cells;therefore it seems feasible that in quiescent satellite cells bothmyogenesis and apoptosis are not promoted while quiescence ismaintained.

In C2C12 cells it had been shown that RNaseL overexpressioninhibits myotube formation (Bisbal et al., 2000; Salehzada et al.,2009). RNaseL ia activated when a family of 20,50-oligoadenylatesynthetases bind latent RNase-L, resulting in its dimerization andsubsequent activation. This activated RNaseL cleaves single-stranded virus, ribosomes, and mRNAs (Li et al., 2007). In additionto its nuclease function, a role for RNase-L in translationalregulation was recently reported (Le Roy et al., 2007). Further-more, genetic approaches to manipulate RNaseL expression andactivity revealed that it exerts potent antiproliferative, proapop-totic, and senescence inducing activities (Andersen et al., 2007;Andersen et al., 2009; Castelli et al., 1998; Zhou et al., 1998). SinceRNaseL is involved in degrading various RNAs, it might also beinvolved in microRNA degradation. This might explain part of theglobal downregulation of microRNAs in quiescent satellite cells.On the other hand, it might be that due to the global down-regulation of microRNAs that RNaseL is no longer degraded, andtherefore quiescence is induced. Anyhow, the nuclear expressionof RNaseL in quiescent satellite cells as opposed to myotubesindicates RNaseL involvement in either inhibiting myotube for-mation or maintaining quiescence.

5. Conclusion

In the current study, we show that microRNAs are globallydownregulated in human satellite cells entering quiescencecompared to proliferating human satellite cells. Furthermore,several microRNAs which have previously been described to beinvolved in satellite cell differentiation are involved in myotubeformation rather than satellite cells entering quiescence. Giventhe importance of quiescent satellite cells in skeletal muscledevelopment and regeneration, it is imperative to distinguishbetween myotubes and quiescent satellite cells when investigat-ing skeletal muscle development especially in microRNA studies,since this study shows that microRNAs are globally downregu-lated in quiescent human satellite cells.

Acknowledgments

This study was funded by a research grant by the GraduateSchool W.J. Kolff Institute from the University Medical CenterGroningen, University of Groningen, The Netherlands. The anti-bodies MF20 and Pax7 developed by respectively Fischman, D.A.

and Kawakami, A. were obtained from the Developmental StudiesHybridoma Bank developed under the auspices of the NICHD andmaintained by The University of Iowa, Department of Biology,Iowa City, IA 52242. Microscopical imaging was performed at theUMCG Imaging Center (UMIC), which is supported by TheNetherlands Organization for Health Research and Development(ZonMW Grant 40-00506-98-9021).

References

Ambros, V., 2001. MicroRNAs: tiny regulators with great potential. Cell 107,823–826.

Andersen, J.B., Li, X.L., Judge, C.S., Zhou, A., Jha, B.K., Shelby, S., Zhou, L., Silverman,R.H., Hassel, B.A., 2007. Role of 2-5A-dependent RNase-L in senescence andlongevity. Oncogene 26, 3081–3088.

Andersen, J.B., Mazan-Mamczarz, K., Zhan, M., Gorospe, M., Hassel, B.A., 2009.Ribosomal protein mRNAs are primary targets of regulation in RNase-L-induced senescence. RNA Biology 6, 305–315.

Anton, R., Chatterjee, S.S., Simundza, J., Cowin, P., Dasgupta, R., 2011. A systematicscreen for micro-RNAs regulating the canonical Wnt pathway. PloS One 6,e26257.

Bisbal, C., 1997. RNase L: effector nuclease of an activatable RNA degradationsystem in mammals. Progress in Molecular and Subcellular Biology 18, 19–34.

Bisbal, C., Silhol, M., Laubenthal, H., Kaluza, T., Carnac, G., Milligan, L., Le Roy, F.,Salehzada, T., 2000. The 20-50 oligoadenylate/RNase L/RNase L inhibitor path-way regulates both MyoD mRNA stability and muscle cell differentiation.Molecular and Cellular Biology 20, 4959–4969.

Brett, J.O., Renault, V.M., Rafalski, V.A., Webb, A.E., Brunet, A., 2011. The microRNAcluster miR-106b–25 regulates adult neural stem/progenitor cell proliferationand neuronal differentiation. Aging 3, 108–124.

Buckingham, M., Montarras, D., 2008. Skeletal muscle stem cells. Current Opinionin Genetics & Development.

Callis, T.E., Deng, Z., Chen, J.F., Wang, D.Z., 2008. Muscling through the microRNAworld. Experimental Biology and Medicine (Maywood, NJ) 233, 131–138.

Carnac, G., Fajas, L., L’honore, A., Sardet, C., Lamb, N.J., Fernandez, A., 2000. Theretinoblastoma-like protein p130 is involved in the determination of reservecells in differentiating myoblasts. Current Biology: CB 10, 543–546.

Castelli, J.C., Hassel, B.A., Maran, A., Paranjape, J., Hewitt, J.A., Li, X.L., Hsu, Y.T.,Silverman, R.H., Youle, R.J., 1998. The role of 20-50 oligoadenylate-activatedribonuclease L in apoptosis. Cell Death and Differentiation 5, 313–320.

Chen, J.F., Callis, T.E., Wang, D.Z., 2009. MicroRNAs and muscle disorders. Journal ofCell Science 122, 13–20.

Chen, J.F., Mandel, E.M., Thomson, J.M., Wu, Q., Callis, T.E., Hammond, S.M., Conlon,F.L., Wang, D.Z., 2006. The role of microRNA-1 and microRNA-133 in skeletalmuscle proliferation and differentiation. Nature Genetics 38, 228–233.

Chen, J.F., Tao, Y., Li, J., Deng, Z., Yan, Z., Xiao, X., Wang, D.Z., 2010. MicroRNA-1 andmicroRNA-206 regulate skeletal muscle satellite cell proliferation and differ-entiation by repressing Pax7. Journal of Cell Biology 190, 867–879.

Cheung, T.H., Quach, N.L., Charville, G.W., Lui, L., Park, L., Edalati, A., Yoo, B., Hoang, P.,Rando, T.A., 2012. Maintenance of muscle stem-cell quiescence by microRNA-489. Nature 482, 524–528.

Cosgrove, B.D., Sacco, A., Gilbert, P.M., Blau, H.M., 2009. A home away from home:challenges and opportunities in engineering in vitro muscle satellite cellniches. Differentiation; Research in Biological Diversity 78, 185–194.

Crist, C.G., Buckingham, M., 2010. Megarole for microRNA in muscle disease. CellMetabolism 12, 425–426.

Crist, C.G., Buckingham, M., 2009. MicroRNAs gain magnitude in muscle. Cell Cycle(Georgetown, TX) 8, 3627–3628.

Crist, C.G., Montarras, D., Pallafacchina, G., Rocancourt, D., Cumano, A., Conway, S.J.,Buckingham, M., 2009. Muscle stem cell behavior is modified by microRNA-27regulation of Pax3 expression. Proceedings of the National Academy of Sciencesof the United States of America 106, 13383–13387.

Deng, Z., Chen, J.F., Wang, D.Z., 2011. Transgenic overexpression of miR-133a inskeletal muscle. BMC Musculoskeletal Disorders 12, 115.

Dey, B.K., Gagan, J., Dutta, A., 2011. miR-206 and -486 induce myoblast differ-entiation by downregulating Pax7. Molecular and Cellular Biology 31, 203–214.

Fukada, S., Uezumi, A., Ikemoto, M., Masuda, S., Segawa, M., Tanimura, N.,Yamamoto, H., Miyagoe-Suzuki, Y., Takeda, S., 2007. Molecular signature ofquiescent satellite cells in adult skeletal muscle. Stem Cells (Dayton, OH) 25,2448–2459.

Fukada, S., Yamaguchi, M., Kokubo, H., Ogawa, R., Uezumi, A., Yoneda, T., Matev,M.M., Motohashi, N., Ito, T., Zolkiewska, A., Johnson, R.L., Saga, Y., Miyagoe-Suzuki, Y., Tsujikawa, K., Takeda, S., Yamamoto, H., 2011. Hesr1 and Hesr3 areessential to generate undifferentiated quiescent satellite cells and to maintainsatellite cell numbers. Development (Cambridge, England) 138, 4609–4619.

Guller, I., Russell, A.P., 2010. MicroRNAs in skeletal muscle: their role andregulation in development, disease and function. Journal of Physiology 588,4075–4087.

Hirai, H., Verma, M., Watanabe, S., Tastad, C., Asakura, Y., Asakura, A., 2010. MyoDregulates apoptosis of myoblasts through microRNA-mediated down-regula-tion of Pax3. Journal of Cell Biology 191, 347–365.

M. Koning et al. / Differentiation 84 (2012) 314–321 321

Koning, M., Werker, P., Bank, R.A., Harmsen, M.C., 2011. MicroRNA-1 and microRNA-206 improve differentiation potential of human satellite cells: a novelapproach for tissue engineering of skeletal muscle. Tissue Engineering. Part A17 (13–14), 1747–1758.

Koning, M., Werker, P.M., van Luyn, M.J., Harmsen, M.C., 2011. Hypoxia promotesproliferation of human myogenic satellite cells: a potential benefactor intissue engineering of skeletal muscle. Tissue Engineering. Part A 17,1747–1758.

Kuang, S., Gillespie, M.A., Rudnicki, M.A., 2008. Niche regulation of muscle satellitecell self-renewal and differentiation. Cell Stem Cell 2, 22–31.

Le Roy, F., Silhol, M., Salehzada, T., Bisbal, C., 2007. Regulation of mitochondrialmRNA stability by RNase L is translation-dependent and controls IFNalpha-induced apoptosis. Cell Death and Differentiation 14, 1406–1413.

Le, G.F., Rudnicki, M.A., 2007. Skeletal muscle satellite cells and adult myogenesis.Current Opinion in Cell Biology 19, 628–633.

Li, X.L., Andersen, J.B., Ezelle, H.J., Wilson, G.M., Hassel, B.A., 2007. Post-transcriptional regulation of RNase-L expression is mediated by the 30-untranslated region of its mRNA. Journal of Biological Chemistry 282,7950–7960.

McCarthy, J.J., 2008. MicroRNA-206: the skeletal muscle-specific myomiR. Biochimicaet Biophysica Acta 1779, 682–691.

Naguibneva, I., Ameyar-Zazoua, M., Polesskaya, A., Ait-Si-Ali, S., Groisman, R.,Souidi, M., Cuvellier, S., Harel-Bellan, A., 2006. The microRNA miR-181 targetsthe homeobox protein Hox-A11 during mammalian myoblast differentiation.Nature Cell Biology 8, 278–284.

Naguibneva, I., Polesskaya, A., Ameyar-Zazoua, M., Souidi, M., Groisman, R.,Cuvellier, S., Ait-Si-Ali, S., Pritchard, L.L., Harel-Bellan, A., 2007. Micro-RNAsand muscle differentiation. Journal of Society of Biology 201 (4), 367–376.

Relaix, F., Marcelle, C., 2009. Muscle stem cells. Current Opinion in Cell Biology 21,748–753.

Rudnicki, M.A., Le, G.F., McKinnell, I., Kuang, S., 2008. The molecular regulation ofmuscle stem cell function. Cold Spring Harbor Symposia on QuantitativeBiology 73, 323–331.

Sacco, A., Doyonnas, R., Kraft, P., Vitorovic, S., Blau, H.M., 2008. Self-renewal andexpansion of single transplanted muscle stem cells. Nature 456, 502–506.

Salehzada, T., Cambier, L., Vu Thi, N., Manchon, L., Regnier, L., Bisbal, C., 2009.Endoribonuclease L (RNase L) regulates the myogenic and adipogenic potentialof myogenic cells. PloS One 4, e7563.

Sarkar, S., Dey, B.K., Dutta, A., 2010. MiR-322/424 and -503 are induced duringmuscle differentiation and promote cell cycle quiescence and differentiation

by down-regulation of Cdc25A. Molecular Biology of the Cell 21, 2138–2149.Sousa-Victor, P., Munoz-Canoves, P., Perdiguero, E., 2011. Regulation of skeletal

muscle stem cells through epigenetic mechanisms. Toxicology Mechanismsand Methods 21, 334–342.

Sun, Q., Zhang, Y., Yang, G., Chen, X., Zhang, Y., Cao, G., Wang, J., Sun, Y., Zhang, P.,

Fan, M., Shao, N., Yang, X., 2008. Transforming growth factor-beta-regulatedmiR-24 promotes skeletal muscle differentiation. Nucleic Acids Research 36,

2690–2699.Ten Broek, R.W., Grefte, S., Von den Hoff, J.W., 2010. Regulatory factors and cell

populations involved in skeletal muscle regeneration. Journal of CellularPhysiology 224, 7–16.

Wang, X.H., Hu, Z., Klein, J.D., Zhang, L., Fang, F., Mitch, W.E., 2011. DecreasedmiR-29 suppresses myogenesis in CKD. Journal of the American Society ofNephrology 22, 2068–2076.

Winbanks, C.E., Wang, B., Beyer, C., Koh, P., White, L., Kantharidis, P., Gregorevic, P.,2011. TGF-beta regulates miR-206 and miR-29 to control myogenic differ-

entiation through regulation of HDAC4. Journal of Biological Chemistry 286,13805–13814.

Zammit, P., Beauchamp, J., 2001. The skeletal muscle satellite cell: stem cell or sonof stem cell? Differentiation; Research in Biological Diversity 68, 193–204.

Zhou, A., Paranjape, J.M., Hassel, B.A., Nie, H., Shah, S., Galinski, B., Silverman, R.H.,

1998. Impact of RNase L overexpression on viral and cellular growth anddeath. Journal of Interferon & Cytokine Research 18, 953–961.

Zhou, L., Wang, L., Lu, L., Jiang, P., Sun, H., Wang, H., 2012. A novel target ofmicrorna-29, ring 1 and YY1 binding protein (Rybp), negatively regulates

skeletal myogenesis. Journal of Biological Chemistry 287 (30), 25255–25265.Zhu, H., Fan, G.C., 2011. Role of microRNAs in the reperfused myocardium towards

post-infarct remodelling. Cardiovascular Research 94, 284–292.