journa l homepage: www.e lsev ier .com/ locate / jv i romet
simple technique for separation of Cowpea chlorotic mottle virusrom Cucumber mosaic virus in natural mixed infections
khtar Ali a,∗, Marilyn J. Roossinckb
Department of Biological Science, University of Tulsa, Tulsa, OK 74104, United StatesPlant Biology Division, The Samuel Roberts Noble Foundation, Ardmore, OK 73401, USA
rticle history:eceived 8 May 2008eceived in revised form 8 July 2008ccepted 17 July 2008
eywords:irus inoculation
a b s t r a c t
A simple technique was developed to separate Cowpea chlorotic mottle virus (CCMV) from Cucumber mosaicvirus (CMV) in natural mixed infections. Sap from cowpea leaves infected naturally with a mixture of CCMVand CMV was inoculated mechanically on the first tri-foliolate leaf of cowpea seedlings. Both inoculatedand non-inoculated upper leaves were sampled 3 or 8 days post-inoculation and tested by reverse tran-scription polymerase chain reaction (RT-PCR) using primers specific to CCMV and CMV. RT-PCR analysisshowed the presence of only CCMV in the inoculated leaf and both viruses in the non-inoculated sys-
irus separationurificationixed infections
temically infected upper leaves. Total RNA from the inoculated leaves positive to CCMV only was furtherconfirmed upon re-inoculation to cowpea seedlings. Typical CCMV symptoms were produced within 1week and RT-PCR analysis showed only the presence of CCMV in both inoculated and non-inoculated sys-temically infected upper leaves. Systemically infected upper leaves of the same plants were used for CCMVpurification. RT-PCR analysis of the purified virion and RNA extracted from the virion further confirmedthe absence of CMV contamination. To our knowledge, this is the first report of a method separating CCMVdirectly from mixed infections with CMV in cowpea.
cia(
amt(f(hCcoc
. Introduction
In nature, it is very common that a single plant is infected by twor more viruses. Several examples of mixed infections have beeneported for various plant viruses in different hosts (Rochow andoss, 1955; Wang et al., 2002; Fukumoto et al., 2003; Martin et al.,004; Wintermantel, 2005; Murphy and Bowen, 2006). Similarly,owpea (Vigna unguiculata), which is an important food and fodderegume, is infected by many viruses in nature (Brunt et al., 1996)hat occur frequently in mixtures (Kuhn and Dawson, 1973; Pio-ibeiro et al., 1978; Taiwo and Akinjogunla, 2006). It is difficulto conduct exacting experiments until the virus mixture has beeneparated into single entities. In addition, complete separation ofiruses is necessary for serological, biochemical and inheritance ofesistance studies.
Natural mixed infections of Cowpea chlorotic mottle virus (CCMV)
nd Cucumber mosaic virus (CMV) have been observed recently inowpea fields in Arkansas. It is easy to separate CMV from CCMVy inoculating the mixture on tobacco and isolating CMV from theystemically infected leaves, because CCMV cannot move systemi-
ally in tobacco. However, CCMV cannot be separated from mixednfections of CMV by a single inoculation event because CMV hasvery wide host range that infects more than 1200 plant species
Edwardson and Christie, 1991).Nearly 40 years ago, a biological method was reported to sep-
rate CCMV from an artificially mixed infection of CMV by severalechanical inoculations in various hosts (Kuhn, 1969). Briefly,
he artificial mixture of both viruses was inoculated to cowpeaV. unguiculata cv. Early Ramshorn) and passaged mechanicallyrom cowpea through tobacco (Nicotiana tabacum), then soybeanGlycine max) and finally back to cowpea. However, this methodas some drawbacks. First, the method was used with a knownCMV isolate that could infect soybean, and a CMV isolate thatould not infect soybean. However, uncharacterized field isolatesf CCMV that are unable to infect soybean, and CMV isolates thatould infect soybean, have been reported (Edwardson and Christie,991; Laguna et al., 2006). Thus, this method is not suitable forhe separation of uncharacterized field isolates. Second, the mix-ure of two viruses was passaged in three different hosts before
n individual culture of CCMV was obtained. The individual cul-ure of CCMV obtained by this method may not be an ideal cultureor studying mutation frequencies where the original culture ofhe virus is needed. The effect of different host passages can alterhe original mutation frequency of a virus as reported for CMV
Fig. 1. Detection of (a) Cowpea chlorotic mottle virus (CCMV) and (b) Cucumber mosaicvirus (CMV) by reverse transcription polymerase chain reaction (RT-PCR) in totalnucleic acid extracted from cowpea seedlings. DNA marker (M), inoculated leafitn(
o(CT
tthCuCuco((
TD
I
C
C
64 A. Ali, M.J. Roossinck / Journal of V
Schneider and Roossinck, 2001). In addition, large numbers ofeedlings of various host species, specific cultivars, space, timend a conducive environment are needed to complete such exper-ments.
A simple, rapid and non-laborious method is described for sep-ration of uncharacterized field isolates of CCMV from CMV in aatural mixed infection of cowpea. This method does not need toassage the mixture in various hosts, which keeps CCMV close to
ts original culture and makes the mixture a suitable source fortudying mutation frequencies of field isolates of CCMV.
. Materials and methods
.1. Virus isolates and inoculation
Two field samples of cowpea plants that contained mixed infec-ions of CCMV and CMV were obtained from Dr. Rose Gergerich,niversity of Arkansas. These samples were designated as Car1-mix
Car1-mix and Car2-mix cultures were ground individually usingpestle and mortar in 50 mM NaH2PO4 (pH 7.0) buffer (1:1, w/v).he extracted sap was mechanically inoculated to the middle leafletf the first tri-foliolate compound leaf of cowpea cv. Black Eye no. 5.he inoculated plants were kept in a greenhouse at approximately5 ◦C and a 16 h photoperiod with supplementary light. Healthyock inoculated plants served as a control.
.2. Total RNA extraction and detection by reverse transcriptionolymerase chain reaction (RT-PCR)
Inoculated leaflets were sampled by taking two to three leafiscs with the lid of 1.5-ml microcentrifuge tube (ISC BioExpress,SA) 3 or 8 days post-inoculation. Non-inoculated upper leavesf cowpea seedlings were also sampled. Total nucleic acids werextracted as described previously (Ali et al., 2006) and used astemplate for reverse transcription-polymerase chain reaction
RT-PCR). RT reaction was primed with a reverse primer, AK1RGGCTGCAGTGGTCTCCTT). The cDNAs were used as templates forCR using the primers AK1F (GATGATTGAGTTAGAGGAGG) andK1R for CCMV, and AK2F (GCTCGCCTGTTGAAGTCG) and AK1R forMV. PCR was carried out in the Rapid Cycler® (Idaho Technology
nc.) for 30 cycles (94 ◦C denaturation for 0 s, 50 ◦C annealing for 0 s,2 ◦C extension for 20 s, 72 ◦C for 5 min, and 37 ◦C for 5 min).
. Results
.1. Separation of CCMV in cowpea
As shown in Fig. 1a, the expected size band of 1.2 kb for CCMVas obtained by RT-PCR in all the inoculated and non-inoculated,pper leaves of cowpea seedlings. However, CMV was detected
3
C
able 1ifferent host species inoculated mechanically with Car1-mix and Car2-mix cultures
noculum Hosts inoculated Inocu
CCMV
ar1-mix culture Cowpea (cv. California Black Eye no. 5) 5a/5Tobacco 5/5N. benthamiana 5/5
ar2-mix culture Cowpea (cv. California Black Eye no. 5) 5/5Tobacco 5/5N. benthamiana 5/5
a Number of plants positive by polymerase chain reaction (PCR)/number of plants teste
nfected with Car1-mix culture (Lane 1), inoculated leaf infected with Car2-mix cul-ure (Lane 2), upper non-inoculated leaf of Car1-mix infected plant (Lane 3), upperon-inoculated leaf of Car2-mix infected plant (Lane 4) and healthy cowpea plantLane 5).
nly in inoculated, systemically infected upper leaves of cowpeaFig. 1b). Except for two samples inoculated with the Car-2 mix,MV could not be detected in inoculated cowpea leaves (Fig. 1b;able 1).
To verify the purity of CCMV, total nucleic acids obtained fromhe inoculated cowpea leaflets, which were positive by RT-PCRo only CCMV, were re-inoculated to the first tri-foliolate leaf ofealthy cowpea seedlings. Five to 7 days post-inoculation, typicalCMV symptoms were visible on inoculated and non-inoculatedpper leaves of cowpea seedlings. When tested by RT-PCR as above,CMV was readily detected in both inoculated and non-inoculatedpper leaves of cowpea seedlings. The absence of CMV again wasonfirmed by RT-PCR (data not shown). Thus, individual culturesf CCMV, separated from CMV in Car1-mix and Car2-mix culturesFig. 2a), were labeled as CCMV-Car1 and CCMV-Car2 isolatesFig. 2b).
.2. Purification of CCMV-Car1 and -Car2 isolates
To confirm further the purity of individual cultures of CCMV-ar1 and -Car2 isolates, symptomatic cowpea leaves infected
lated leaves Systemically infected leaves
CMV CCMV CMV
0/5 5/5 5/55/5 0/5 5/55/5 5/5 5/5
2/5 5/5 5/55/5 0/5 5/55/5 5/5 5/5
d.
A. Ali, M.J. Roossinck / Journal of Virological Methods 153 (2008) 163–167 165
F CowpeC lates a
wpbaalnoC
(ait
TD
I
C
C
ig. 2. Symptoms obtained after inoculation of mixed and individual cultures ofar1-mix and Car2-mix cultures, (b) individual culture of CCMV-Car1 and -Car2 iso
ith CCMV-Car1 and -Car2 isolates were harvested 2–3 weeksost-inoculation and purified virus preparations were obtainedy our newly developed method as described previously (Alind Roossinck, 2007). RT-PCR analysis of the purified virions
nd RNA extracted from virions of CCMV-Car1 and -Car2 iso-ates showed the presence of CCMV only and no CMV (dataot shown). In contrast, RT-PCR analysis of the purified viri-ns and RNA extracted from cowpea plants inoculated withar1-mix and Car2-mix cultures contained both CCMV and CMV
3
C
able 2ifferent cowpea varieties inoculated mechanically with Car1-mix and Car2-mix cultures
noculum Cowpea varieties Inoculated lea
CCMV
ar1-mix culture Cowpea cv. 152 5a/5Cowpea cv. Tuv470 5/5Cowpea cv. Chinese Red 5/5
ar2-mix culture Cowpea cv. 152 5/5Cowpea cv. Tuv470 5/5Cowpea cv. Chinese red 5/5
a Number of plants positive by polymerase chain reaction (PCR)/number of plants teste
a chlorotic mottle virus (CCMV) and Cucumber mosaic virus (CMV) in cowpea. (a)nd (c) individual culture of CMV-Car1 and -Car2 isolates.
data not shown). These results confirmed that both CCMV-Car1nd -Car2 isolates were separated successfully from the mixednfections of CMV in Car1-mix and Car2-mix cultures, respec-ively.
.3. Separation of CCMV in Nicotiana benthamiana
To test whether CCMV can be separated from a mixed culture ofMV in another host, we inoculated both Car1-mix and Car2-mix
ves Systemically infected leaves
CMV CCMV CMV
0/5 5/5 5/50/5 5/5 5/50/5 5/5 5/5
0/5 5/5 5/50/5 5/5 5/50/5 5/5 5/5
d.
1 irological Methods 153 (2008) 163–167
cirwNv
3
eortdanbv
cuT71vlar
3
uiblnIl(
4
flCc
ltaamblttsibeS
Fig. 3. Detection of (a) Cowpea chlorotic mottle virus (CCMV) and (b) Cucumber mosaicvirus (CMV) by reverse transcription polymerase chain reaction (RT-PCR) in totalnucleic acid extracted from tobacco seedlings. DNA marker (M), inoculated leafitn(
mtasTcdaihvtrrl(Rsppwt
twlwmo
66 A. Ali, M.J. Roossinck / Journal of V
ultures to N. benthamiana seedlings. Both inoculated and system-cally infected leaves were sampled and tested as above. RT-PCResults showed that both viruses were detected in inoculated asell as in non-inoculated upper leaves (Table 1), suggesting that. benthamiana may not be a suitable host to separate these twoiruses.
.4. Separation of CCMV in various cowpea varieties
To determine if CCMV can be separated in other cowpea vari-ties, Car1-mix and Car2-mix cultures were inoculated to leavesf the three available cowpea varieties (152; Tuv470 and Chineseed) and both inoculated and non-inoculated upper leaves wereested as above. RT-PCR results (Table 2) showed that CCMV wasetected in both inoculated and non-inoculated upper leaves ofll the three cowpea varieties while CMV was detected only inon-inoculated upper leaves. These results showed that CCMV cane separated successfully from the CMV mixture in other cowpeaarieties.
To further understand whether CMV is moving out quickly whenompared to CCMV from the inoculated leaves of cowpea, we inoc-lated Car1-mix and Car2-mix cultures on cowpea leaves as above.he inoculated leaflets were detached from the plant at 24, 48, and2 h post-inoculation. Non-inoculated upper leaves were sampled0–14 days post-inoculation and tested by RT-PCR as above. Neitherirus could be detected in the plants from which the inoculatedeaves were detached 24 h post-inoculation. However, both CCMVnd CMV were detected in plants when the inoculated leaves wereemoved either 48 or 72 h post-inoculation.
.5. Separation of CMV
For CMV separation, Car1-mix and Car2-mix cultures were inoc-lated to tobacco seedlings. Seven to 8 days post-inoculation both
noculated and systemically infected leaves of tobacco were testedy RT-PCR as above. CCMV was detected only in the inoculatedeaves (Fig. 3a) while CMV was detected in both inoculated andon-inoculated systemically infected leaves of tobacco (Fig. 3b).
ndividual cultures of CMV obtained from the systemically infectedeaves of tobacco were labeled as CMV-Car1 and CMV-Car2 isolatesFig. 2c).
. Discussion
The results showed that CCMV could be successfully separatedrom mixed infections of CMV in cowpea. Based on a search of theiterature, this is the first report of a method that separates directlyCMV from a mixed infection of CMV in the inoculated leaves ofowpea.
The time at which a plant virus moves out of the inoculatedeaf into the rest of the plant varies widely depending on fac-ors such as host species, virus, age of host, method of inoculationnd temperature. For example, in tobacco plants inoculated withmixture of Potato virus X (PVX) and Potato virus Y (PVY), PVYoved ahead of PVX (Hull, 2002). In our study, we observed that
oth CCMV and CMV moved out at the same time from inoculatedeaves to the non-inoculated upper leaves. The plausible explana-ions for the absence of CMV in the inoculated tri-foliolate leaf ishat upon inoculation of the mixture, CCMV established first and
tarted rapid synthesis which retarded the synthesis of CMV innoculated leaves of cowpea. A similar observation was reportedy Kuhn and Dawson (1973) in mixed infection of CCMV and South-rn bean mosaic virus (SBMV), where CCMV became dominant overBMV.
tshps
nfected with Car1-mix culture (Lane 1), inoculated leaf infected with Car2-mix cul-ure (Lane 2), upper non-inoculated leaf of Car1-mix infected plant (Lane 3), upperon-inoculated leaf of Car2-mix infected plant (Lane 4) and healthy tobacco plantLane 5).
Another possibility is that after inoculation, CCMV occupiesost of the area in the inoculated leaf and suppresses cell-
o-cell movement of CMV so that it becomes highly localizednd probably segregates from each other and makes a subdivi-ion of the CCMV and CMV populations in the inoculated leaf.hat is why two samples (Table 2), from the inoculated leaf,ontain both viruses while most of the time only CCMV wasetected. It is possible that spatial competition between CCMVnd CMV in the inoculated leaf of cowpea limits their co-infectionn the same areas which indicate that cowpea is the naturalost for CCMV and CCMV has adapted better than CMV to sur-ive in this host species. Dietrich and Maiss (2003) reportedhat populations of either the same or different potyviruses wereeplicating predominantly in discrete areas and co-infection wasestricted to only a few cells at the border of these clusters. Simi-ar spatial separation patterns have been reported for alfamovirusHull and Plaskitt, 1970) and potexviruses (Diveki et al., 2002).ecently, competitive interactions have also been reported for CMVubgroup-I and subgroup-II isolates in the inoculated leaves of cow-ea (Takeshita et al., 2004). However, nothing has been reportedreviously for mixed infections of CCMV and CMV in any host,hich belong to the genera Bromovirus and Cucumovirus, respec-
ively.In conclusion, a new technique was developed for the separa-
ion of CCMV isolates from mixed infections of CMV. This techniqueas used against two uncharacterized CCMV and CMV field iso-
ates that were naturally infecting cowpea plants in the field. Thisill provide a rapid alternative method to a previous biologicalethod of separating mixed CCMV and CMV infections in vari-
us hosts that has many limitations (Kuhn, 1969). It is hoped that
his technique can be applied not only to other cowpea viruses toeparate them from mixed infections of CMV which has a wideost range but could also be used for other mixed infections oflants viruses that are intended to be used for mutation frequencytudies.
irologi
A
R
A
A
B
D
D
E
F
HH
K
K
L
M
M
P
R
S
T
T
A. Ali, M.J. Roossinck / Journal of V
cknowledgment
We thank Peggy Hill for careful review of the manuscript.
eferences
li, A., Roossinck, M.J., 2007. Rapid and efficient purification of Cowpea chloroticmottle virus by sucrose cushion ultracentrifugation. J. Virol. Methods 141, 84–86.
li, A., Li, H., Schneider, W.L., Sherman, D.J., Gray, S., Smith, D., Roossinck, M.J., 2006.Analysis of genetic bottlenecks during horizontal transmission of Cucumbermosaic virus. J. Virol. 80, 8345–8350.
runt, A.A., Crabtree, K., Dallwitz, M.J., Gibbs, A.J., Watson, L., Zurcher, E.J. (Eds.),1996. Plant Viruses Online: Description and Lists from the VIDA Database. URLhttp://image.fs.uidaho.edu/vide/refs.htm.
ietrich, C., Maiss, E., 2003. Fluorescent labelling reveals spatial separation ofpotyvirus populations in mixed infected Nicotiana benthamiana plants. J. Gen.Virol. 84, 2871–2876.
iveki, Z., Salanki, K., Balazs, E., 2002. Limited utility of blue fluorescent protein (BFP)in monitoring plant virus movement. Biochimie 84, 997–1002.
dwardson, J.R., Christie, R.G., 1991. Cucumoviruses. In: CRC Handbook of Virusesinfecting Legumes. CRC Press, Boca Raton, pp. 293–319.
ukumoto, F., Masuda, M., Hanada, K., 2003. Pea tissue necrosis induced by Cucum-
ber mosaic virus alone or together with Watermelon mosaic virus. Plant Dis. 87,324–328.
ull, R., 2002. Matthews’ Plant Virology, fourth ed. Academic Press.ull, R., Plaskitt, A., 1970. Electron microscopy on the behavior of two strains of
alfalfa mosaic virus in mixed infections. Virology 42, 773–776.uhn, C.W., 1969. Separation of cowpea virus mixtures. Phytopathology 54, 739–740.
W
W
cal Methods 153 (2008) 163–167 167
uhn, C.W., Dawson, W.O., 1973. Multiplication and pathogenesis of Cowpea chloroticmottle virus and Southern bean mosaic virus in single and double infections incowpea. Phytopathology 63, 1380–1385.
artin, E.M., Cho, J.D., Kim, J.S., Goeke, S.C., Kim, K.S., Gergerich, R.C., 2004. Novelcytopathological structures induced by mixed infection of unrelated viruses.Phytopathology 94, 111–119.
urphy, J.F., Bowen, K.L., 2006. Synergistic disease in pepper caused by the mixedinfection of Cucumber mosaic virus and Pepper mottle virus. Phytopathology 96,240–247.
io-Ribeiro, G., Wyatt, S.D., Kuhn, C.W., 1978. Cowpea stunt: a disease caused by asynergistic interaction of two viruses. Phytopathology 68, 1260–1265.
ochow, W.F., Ross, A.F., 1955. Virus multiplication in plants doubly infected bypotato viruses X and Y. Virology 1, 10–27.
chneider, W.L., Roossinck, M.J., 2001. Genetic diversity in RNA virus quasispecies iscontrolled by host–virus interactions. J. Virol. 75, 6566–6571.
aiwo, M.A., Akinjogunla, O.J., 2006. Cowpea viruses: quantitative and qualitativeeffects of single and mixed viral infections. Afr. J. Biotechnol. 5, 1749–1756.
akeshita, M., Shigemune, N., Kikuhara, K., Furuya, N., Takanami, Y., 2004. Spa-tial analysis for exclusive interactions between subgroups I and II of Cucumbermosaic virus in cowpea. Virology 328, 45–51.
ang, Y., Gaba, V., Yang, J., Palukaitis, P., Gal-On, A., 2002. Characterization of synergybetween Cucumber mosaic virus and potyviruses in cucurbit hosts. Phytopathol-ogy 92, 51–58.
intermantel, W.M., 2005. Co-infection of Beet mosaic virus with beet yellowingviruses leads to increased symptom expression on sugar beet. Plant Dis. 89,325–331.
