2006-2011 Mission Kearney Foundation of Soil Science: Understanding and Managing Soil-Ecosystem
Functions Across Spatial and Temporal Scales Final Report: 2006015, 1/1/2008-12/31/2008
1Department of Environmental Sciences, University of California, Riverside
For more information contact Dr. Lisa Stein ([email protected]).
Activity and Diversity of Nitrogen-Cycling Microbial Communities in Soil Sequences Around California
Lisa Y. Stein*1, Brian D. Lanoil1, Suk Kyun Han1
Objectives
The cycling of inorganic nitrogen in soils via nitrifying and denitrifying microbial
communities provides essential nutrients that support primary productivity and plant growth.
Nitrogen is often the limiting nutrient for primary productivity and is therefore a major regulator
of the carbon cycle. This project investigated the compositions and activities of nitrifying and
denitrifying microbial communities in California’s diverse wildland soils sampled across large
spatial scales. Our main questions were: 1) how does the diversity of N-cycling microorganisms
vary at different spatial scales and across wildland soil sequences, 2) can the structure and
activities of N-cycling microbial communities be predicted based on chemical or physical
features of the soil, and 3) does acetate-consuming denitrification drive a significant component
of carbon and nitrogen cycling in wildland soils? The data derived from this project are unique in
representing a large range of unperturbed wildland soils rather than the forest or managed soils
that are the common target of nitrogen cycle studies.
Approach and Procedures
We collected physicochemical, biochemical activity, and microbial diversity data across
four soil chronosequences and one climosequence located in different regions of California
(Table 1). Soils were sampled in May 2007. Five soil cores (0-10 cm) were collected in a
randomized sampling pattern from plant-free regions at previously described sites within each
soil sequence (following the sampling schemes outlined in references for each sequence). Air
and ambient soil temperatures were recorded on site. Soil samples were kept on ice for shipping
back to the lab. The five soil cores collected from each site were homogenized together by sieve
and air-dried to represent a composite sample. Major ions, pH, water content, and total organic
carbon content were determined for the composite samples (data reported in 2008 progress
report). Activity measurements were initiated within a week of sample collection. Potential
denitrification activity (PDA) of native and substrate-amended soils was determined by
incubating soils (5 g) in 50 mL sodium phosphate buffer (1 mM, pH 7.2) with potassium nitrate
(1 mM) with or without acetate or glucose additions (50 µmol C-source). The vials were sparged
with N2 to achieve anaerobicity, and acetylene (10% v/v) was added to block nitrous oxide
reductase activity. Vials were incubated with shaking at 28 ºC and N2O was measured via gas
chromatograph (TCD; Hayesep D column) periodically over 90 h. PDA was defined as the linear
increase in N2O production over time. To assess the active denitrifying community, 13
C-labeled
acetate or glucose was used as the sole C-source in replicate anaerobic incubations without
acetylene amendment for 3 or 7 days. This procedure is known as “stable isotope probing.”
Potential nitrification activity (PNA) was measured by incubating soils (5 g) with 50 mL of 1.5
mM NH4Cl in sodium phosphate buffer (pH 7.2) with or without acetylene (1% v/v). Acetylene
treatment inhibits only chemolithotrophic nitrifiers, but not heterotrophic nitrifiers. Thus, we
Activity and Diversity of Nitrogen-Cycling Microbial Communities in Soil Sequences Around California—Stein
were able to discriminate between heterotrophic and chemolithotrophic nitrification activities.
Vials were incubated with shaking at 28 ºC and nitrate accumulation was measured by
Technicon autosampler in the slurry over 90 h. Since nitrification causes acidification, the pH
was maintained by periodic addition of NaOH throughout the experiment. PNA was defined as
the linear increase in nitrate production over time. DNA was extracted from soils by bead-
beating following manufacturers’ protocols (MO Bio Laboratories, Carlsbad CA). DNA
extracted from soils incubated with 13
C-labeled substrates was separated on a Cs-TFA gradient
via ultracentrifugation as described elsewhere (Neufeld et al 2007). The 13
C-labeled band was
recovered from the tube using a needle, precipitated, and resuspended in TE buffer for analysis.
Diversity of the total bacterial and archaeal populations (16S rRNA genes), select denitrifying
(nirK and nirS nitrite reductase) and nitrifying (bacterial and archaeal ammonia monooxygenase,
amoA) genes, and active denitrifying bacterial populations (nirK and nirS genes from 13
C-labeled
DNA) were analyzed by denaturing gradient gel electrophoresis (DGGE) of PCR-amplified
products using DNA recovered from the soil samples (Muyzer et al 1993). Bands from DGGE
gels were extracted, cloned, and sequenced. Sequences were analyzed for similarity to their
nearest relatives as described elsewhere (Kulp et al 2006). PCR primers used in this study are
listed in Table 2.
Results
Question #1: How does the diversity of N-cycling microorganisms vary at different
spatial scales and across wildland soil sequences? We addressed this question by performing
multivariate statistical analysis on the diversity of functional genes in correlation with
physicochemical parameters measured across each soil sequence. The collection of
physicochemical parameters measured within each soil sequence was largely congruent with that
of prior observations (from references in Table 1), indicating long-term stability of soils at each
site. Exceptions included local soil pH, temperature, and water content, which varied
significantly between our collections from 2005 and 2007 (data in prior Kearney progress
reports). These differences were expected due to seasonal fluctuations and differences in weather
and annual precipitation patterns.
PCR amplification products were obtained from the majority of DNA extracted from the
soils, although two of the four sites in Los Osos did not yield amplifiable PCR products from the
native soils (Table 3). Dice similarity coefficients of DGGE banding patterns from PCR
amplification products from four functional genes (nirK, nirS, BamoA, AamoA) showed more
similarity of nitrifying and denitrifying microbial populations within the Mendocino, Sierra, and
Los Osos sequences, and more diversity within the Merced and Shasta soil sequences (Fig. 1).
However, principle components analysis, correlating all soil physicochemical parameters with
functional gene DGGE banding patterns showed clustering of soils within their own sequences
(Fig. 2). Thus, soils within a sequence were largely congruent (i.e. less diverse) and distinct from
other soil sequences. This result leads us to conclude that diversity of N-cycling microbial
populations increases with physical distance.
Significant correlations were found between Merced soil DGGE banding patterns with
potential nitrification activity (PNA) and nitrate (Fig. 2). All of the Merced soils except the one
lacking measurable PNA (Merced 4) had PCR-amplifiable amoA gene products from bacteria,
whereas Merced soils 2 and 4 did not have amplifiable amoA gene products from archaea (Fig.
3). Although we are still in the process of quantifying bacterial and archaeal amoA genes from
Activity and Diversity of Nitrogen-Cycling Microbial Communities in Soil Sequences Around California—Stein
these soils, the lack of archaeal amoA in Merced 2 suggests that bacteria may be the more
significant ammonia-oxidizers in these soils. Similarly, in the Sierra climo-sequence, bacterial
amoA genes were detected in all soils across the sequence, but archaeal amoA genes were only
found in Sierra 1 and 3, suggesting that bacterial ammonia oxidizers play the more significant
role. No other concrete conclusions could be drawn regarding the presence or absence of amoA
genes in correlation with PNA or other soil factors in the absence of relative gene abundance
data.
Together, the data suggest that the diversity of N-cycling microbial communities is less
within a soil sequence than between soil sequences. The results suggest that physicochemical
parameters within a relatively restricted geographical area allows for adaptation and selection of
particular groups of nitrifiers and denitrifiers. However, as observed below, there is some
heterogeneity of microbial communities within soil sequences that can be correlated to specific
physicochemical parameters.
Question #2: Can the structure and activities of N-cycling microbial communities be
predicted based on chemical or physical features of the soil? We addressed this question by
correlating specific gene diversity with soil physicochemical parameters without specific regard
to site or soil sequence. Canonical correspondence analysis (CCA), a multivariate method
designed to indicate potential relationships between environmental parameters and DGGE bands,
was statistically verified by LOGIT (P
Activity and Diversity of Nitrogen-Cycling Microbial Communities in Soil Sequences Around California—Stein
in our stable isotope probing experiments, denitrifiers containing nirK genes tend to out-compete
those with nirS genes in the majority of soils.
In conclusion, our data suggest that the presence and diversity of some microbes –
archaeal ammonia oxidizers and nirS-encoding denitrifiers – are more driven by specific
physicochemical variables than bacterial ammonia oxidizers and nirK-encoding denitrifiers.
Interestingly, only one taxonomic cluster of bacterial amoA genes was identified in all the
wildland soils, indicating very limited diversity. The presence of Nitrosospira cluster 3A amoA
genes across soils sequences exhibiting a range of PNA rates suggests that the organisms persist
in soils even in the absence of substrate and are not very sensitive to physicochemical variation.
For the denitrifying communities, the data indicate strong correlation of nirS, but not nirK, genes
with denitrifying activities, which was further explored in the remaining experiments.
Question #3: Does acetate-consuming denitrification drive a significant component
of carbon and nitrogen cycling in wildland soils? By providing 13
C-labeled acetate or glucose
to soil samples under denitrifying conditions, we labeled the biomass of the initial heterotrophic
consumers (3 day incubation) and organisms that are competent in utilization of these substrates
(7 day incubation). DGGE of nirK and nirS marker genes showed the diversity of particular
denitrifying functional guilds. The lack of amplification of amoA genes from the 13
C-labeled
DNA indicated that we accurately separated it from unlabeled 12
C-DNA as amoA-encoding
organisms are aerobic chemolithoautotrophs and are unable to assimilate organic carbon. Unlike
DNA extracted from non-enriched soils, 13
C-labeled DNA yielded nirK PCR product from
nearly all of the samples whereas only a few nirS PCR products were attained (Tables 3&5).
Although more analysis remains to be done, it appears that both non-enriched and 13
C-labeled
soils had the same distribution of nirS genes. Thus, the above observation that nirS-encoding
denitrifiers are active only in soils where denitrifying conditions are optimal will be further
verified by statistically comparing data between the non-amended and 13
C-labled soils. Although
some sites and soil sequences showed similar DGGE banding patterns regardless of carbon
source or incubation time, such patterns were not consistent across all sites or soil sequences
(Figs. 6-11). Note that while we report the identity of the nearest cultured relative where
available, functional genes are not necessarily indicative of phylogeny or organism identity, and
thus these identities should be taken as provisional and showing association with particular
clusters of nirK or nirS genes found in other environmental samples.
Merced chronosequence. The diversity of nirK and nirS was the highest in the Merced sites
of all the soil sequences examined. Within this soil sequence, the nirK DGGE patterns were
most similar within sampling sites regardless of carbon source or incubation time although more
band richness (i.e. numbers of bands) was seen with the longer incubation time (Fig. 6). Based
on sequence analysis, the majority of DGGE bands from all sites within this soil sequence were
affiliated with the same phylogenetic group, which shows a close relationship to genes from
denitrifying strains of Sinorhizobium spp. (Alphaproteobacteria) (Table 6). nirK DGGE bands
related to Paracoccus, Alcaligenes, and Rhizobium were found only at the Merced 1 site with
acetate as a substrate (Table 6). Thus, while detectable diversity was present in the DGGE
analysis, sequences were generally clustered together indicating limited diversity at a broader
level within the soil sequence. These data indicate that the parent material may be a major driver
of overall nirK diversity while microdiversity might be determined by site-specific
environmental factors such as carbon substrate utilization. DGGE band patterns of nirS genes
were very similar for the four Merced sites that gave nirS PCR product (Fig. 11). Most nirS
Activity and Diversity of Nitrogen-Cycling Microbial Communities in Soil Sequences Around California—Stein
DGGE band sequences were related to the Alicycliphilus sp. R-24604 and Paracoccus sp. R-
26897 (Table 7). Therefore, nirK sequences were much more diverse than nirS sequences and
were found in soils with relatively high levels of PDA (Table 5) suggesting that nirK-encoding
denitrifiers are likely the dominant active microbes in these soils. Although there may be a
positive correlation between band richness and potential denitrification activity, this hypothesis
remains to be tested statistically.
Sierra climosequence. Most of the sites in this soil sequence had low nirK diversity, i.e.
few DGGE bands (Fig. 7). Most of the DGGE band sequences matched environmental clones
from agroecosystem soils and activated sludge, although a single band position was highly
similar to Bradyrhizobium sp. BTAi (99.3% similar, 426bp)(Table 6). nirS DGGE bands were
only detected after a 7 day incubation with glucose in the Sierra 3 and 5 samples (Figure 11 and
Table 7). Both Sierra and Shasta soil sequences had very few nirS DGGE bands, indicating that
denitrifiers using nirS were more limited in these two soil sequences relative to the others.
Shasta chronosequence. DGGE banding patterns of amplified nirK gene products showed
very low band richness with a total of ca. 17 bands from all samples and no sample having more
than 5 bands (Fig. 8). Acetate stimulated PDA much more than glucose (Table 5), and as a result
more nirK DGGE bands were detected from DNA isolated from the 13
C-acetate than the 13
C-
glucose enrichment (Fig. 8). Most DGGE band sequences were most closely related to
environmental clones from agroecosystem soils (Table 6). nirS gene products were only found
in two of the samples and diversity was quite low (Fig. 11). This again supports the idea that
NirK is the dominant gene product used by denitrifying microbes in these wildland soils, but that
NirS is active under optimal conditions. Furthermore, denitrification activity in the majority of
the wildland soils was largely stimulated by the presence of acetate, but not by glucose.
Mendocino chronosequence. The nirK DGGE banding patterns in this soil sequence
showed the second highest level of diversity next to Merced soils (Fig. 9). All DGGE band
sequences were related to Rhizobiales (Sinorhizobium and Bradyrhizobium;
Alphaproteobacteria). Similar to the Merced soil sequence, nirS amplification products were
found in most of the soil samples from Mendocino, but again, the community had very low
diversity (Fig. 11). Unlike the other soil sequences, glucose amendment either had no effect on
rates of PDA or reduced PDA below that of unamended soil at many of the sites (Table 5). In
contrast, acetate had a stimulatory effect on the majority of PDA measurements in these soils.
Thus, more in-depth analysis will be required to correlate the denitrifying community with
measurements of PDA in these soils and why these soils might be controlled by different factors
than other wildland soils.
Los Osos chronosequence. DGGE banding patterns of amplified nirK genes showed low
diversity and few changes with carbon enrichment (Fig. 10). Furthermore, DNA sequences of
DGGE bands from Los Osos were highly similar to those found in the Mendocino samples
(Table 6). This result corresponds to the analysis of non-enriched soil DGGE banding patterns
with physicochemical parameters in which the Mendocino and Los Osos samples grouped
together in our PCA plot (Fig. 2). Interestingly, we could not detect nirS gene products in any of
the Los Osos soil samples (Table 5). Thus, the active denitrifying community in soils at Los
Osos soils is likely a subset of the nirK-encoding community in Mendocino soils.
Activity and Diversity of Nitrogen-Cycling Microbial Communities in Soil Sequences Around California—Stein
Discussion
The first part of this study examined the diversity of gene markers for nitrification and
denitrification across a series of different wildland soil sequences. Thus far, we have been able to
see that ammonia-oxidizing archaea and nirS-encoding denitrifiers correlate to specific
physicochemical variables more consistently than ammonia-oxidizing bacteria and nirK-
encoding denitrifiers. Nevertheless, the second part of the study utilizing 13
C-labeled substrates
to access the active component of the denitrifying consortium showed that the portion of the
denitrifying community utilizing acetate and sometimes glucose as a substrate is likely more
driven by nirK-encoding than nirS-encoding denitrifiers, although the latter organisms can
apparently compete well when denitrifying conditions are optimal. The first part of the study also
revealed that although each soil sequence has a range of physicochemical parameters (e.g.
organic carbon content with age, temperature/moisture with elevation, etc.), N-cycling microbial
communities at different sites within a soil sequence were very similar to one another. We also
found that some soil sequences (i.e. Mendocino and Los Osos) shared similar N-cycling
microbial communities even though they were relatively distant geographically. This similarity
could likely be due to the coastal proximity of both the Mendocino and Los Osos sites.
We are only beginning to analyze data obtained from stable isotope probing experiments in
context of the broader studies reported above. Nonetheless, we are beginning to see some
patterns. First, nirK is by far the dominant nitrite reductase gene encoded by denitrifiers in
wildland soils. Second, in most cases the carbon source and incubation time made little
difference in which organisms were detected, indicating that the denitrifiers are capable of
consuming new organic carbon relatively quickly (i.e. in less than 3 days), despite our prior
studies of the substrate utilization efficiency and substrate utilization velocity indicating that the
rate of organic carbon consumption varied significantly from soil to soil (see previous Kearney
reports for details). Also, denitrifiers appear to be site or soil sequence specific, are not uniformly
distributed throughout the California soils, and have variable responses to carbon addition (as
judged by PDA rates). Third, the sequence identities of DGGE bands were highly similar to
those from agricultural soils, sewage sludge, and other highly managed environments. Thus, the
denitrifiers in wildland soils may not be unique and may be similar to those found in managed
environments. Alternatively, we have such short sequences from the DGGE method that it may
be difficult in our final analysis to assign gene sequences to discrete taxonomic units.
The differences between SIP experiments and studies performed on non-enriched soils
are that the SIP experiments focus attention on the most active component of the anaerobic
denitrifying community. Furthermore, the SIP experiments were carried out under anaerobic,
denitrifying conditions while the non-enriched soils were aerobic. Thus, the two data sets are not
directly comparable. However, our final analysis will include comparison of the denitrifier
community as defined by SIP with that found in non-enriched soils. Already we have seen
similar properties of Mendocino and Los Osos soils including physicochemical, activity, and
community data. We intend to carry out more detailed analyses of denitrifier gene distribution
patterns from non-enriched soils to determine if any environmental factors are specifically
correlated with the patterns seen in the SIP data (e.g. PDA rates with nirK band richness).
Together, this data set represents the first in-depth assessment of nitrifying and
denitrifying microbial communities across a broad range of wildland soils. Nearly all other
published studies have been carried out in managed, grassland, or forest soils. In answer to our
original questions, we have found that: 1) diversity of N-cycling microbial communities is less
Activity and Diversity of Nitrogen-Cycling Microbial Communities in Soil Sequences Around California—Stein
within a soil sequence than between soil sequence, although some soil sequences appear to be
quite similar to one another, 2) the structure of some N-cycling communities, particularly the
ammonia oxidizing archaea and the nirS-encoding denitrifiers, can be predicted by particular
physicochemical features, although this correlation may not be completely applicable to the
active component of the microbial community, and 3) acetate-consuming denitrifiers appear to
be more important in wildland soils than glucose-consuming denitrifiers. Furthermore, the active
denitrifiers in wildland soils tend to encode nirK nitrite reductase. The correlations found in this
study will establish a baseline of N-cycling microbial communities in wildland soils to compare
with the ecology and N-cycling in perturbed ecosystems. Perhaps the comparison between
wildland and perturbed or managed soils will allow us to understand how N-cycling microbial
communities adapt to environmental changes.
5. References
Braker G, Fesefeldt A, Witzel K-P. 1998. Development of PCR primer systems for amplification
of nitrite reductase genes (nirK and nirS) to detect denitrifying bacteria in environmental
samples. Appl. Environ. Microbiol. 64: 3769-75
Brenner DL, Amundson R, Baisden WT, Kendall C, Harden JW. 2001. Soil N and 15
N variation
with time in a California annual grassland ecosystem. Geochim. Cosmochim. Acta 65:
4171-86
Dahlgren RA, Boettinger JL, Huntington GL, Amundson R. 1997. Soil development along an
elevational transect in the western Sierra Nevada, California. Geoderma 78: 207-36
Dickson BA, Crocker RL. 1953. A chronosequence of soils and vegetation near Mt. Shasta,
California. I. Definition of the ecosystem investigated and features of the plant succession.
J. Soil Sci. 4: 123-41
Hallin S, Lindgren P-E. 1999. PCR detection of genes encoding nitrite reductase in denitrifying
bacteria. Appl. Environ. Microbiol. 65: 1652-7
Harden JW. 1988. Genetic interpretations of elemental and chemical differences in a soil
chronosequence, California. Geoderma 43: 179-93
Hornek R, Pommerening-Röser A, Koops H-P, Farnleitner AH, Kreuzinger N, et al. 2006.
Primers containing universal bases reduce multiple amoA gene specific DGGE band
patterns when analyzing the diversity of beta-ammonia oxidizers in the environment. J.
Microbiol. Methods 66: 147-55
Kulp TR, Hoeft SE, Miller LG, Saltikov C, Murphy JN, et al. 2006. Dissimilatory arsenate and
sulfate reduction in sediments of two hypersaline, arsenic-rich soda lakes: Mono and
Searles lakes, California. Appl. Environ. Microbiol. 72: 6514-26
Lilienfein J, Qualls RG, Uselman SM, Bridgham SD. 2003. Soil formation and organic matter
accretion in a young andesitic chronosequence at Mt. Shasta, California. Geoderma 116:
249-64
Lilienfein J, Qualls RG, Uselman SM, Bridgham SD. 2004. Adsorption of dissolved organic and
inorganic phosphorous in soils of a weathering chronosequence. Soil Sci. Soc. Am. J. 68:
620-8
Merritts D, Chadwick O, Hendricks D. 1991. Rates and processes of soil evolution on uplifted
marine terraces, northern California. Geoderma 51: 241-75
Moody LE, Graham RC. 1995. Geomorphic and pedogenic evolution in coastal sediments,
Central California. Geoderma 67: 181-201
Activity and Diversity of Nitrogen-Cycling Microbial Communities in Soil Sequences Around California—Stein
Muyzer G, De Waal EC, Uitterlinden AG. 1993. Profiling of complex populations by denaturing
gradient gel electrophoresis analysis of polymerase chain reaction -amplified genes
coding for 16S rRNA. Appl. Environ. Microbiol. 59: 695-700
Neufeld JD, Vohra J, Dumont MG, Lueders T, Manefield M, et al. 2007. DNA stable-isotope
probing. Nat. Prot. 2: 860-6
Øvreås L, Forney L, Daae FL, Torsvik V. 1997. Distribution of bacterioplankton in meromictic
Lake Saelenvannet, as determined by denaturing gradient gel electrophoresis of PCR-
amplified gene fragments coding for 16S rRNA. Appl. Environ. Microbiol. 63: 3367-73
Purkhold U, Wagner M, Timmermann G, Pommerening-Röser A, Koops H-P. 2003. 16S rRNA
and amoA-based phylogeny of 12 novel betaproteobacterial ammonia-oxidizing isolates:
extension of the dataset and proposal of a new lineage within the nitrosomonads. Int. J.
Syst. Evol. Microbiol. 53: 1485-94
Sollins P, Spycher G, Topik C. 1983. Processes of soil organic-matter accretion at a mudflow
chronosequence, Mt. Shasta, California. Ecology 64: 1273-82
Trumbore SE, Chadwick O, Amundson R. 1996. Rapid exchange between soil carbon and
atmospheric carbon dioxide driven by temperature change. Science 272: 393-6
White DC, Stair JO, Ringelberg DB. 1996. Quantitative comparisons of in situ microbial
biodiversity by signature biomarker analysis. J. Industrial Microbiol. 17: 185-96
Wuchter C, Abbas B, Coolen MJL, Herfort L, van Bleijswijk J, et al. 2006. Archaeal nitrification
in the ocean. Proceedings of the National Academy of Sciences of the United States of
America 103: 12317-22
Yu Z, Kraus TEC, Dahlgren RA, Horwath WR, Zasoski RJ. 2003. Mineral and dissolved organic
nitrogen dynamics along a soil acidity-fertility gradient. Soil Sci. Soc. Am. J. 67: 878-88
Activity and Diversity of Nitrogen-Cycling Microbial Communities in Soil Sequences Around California—Stein
Table 1. Description of soil sequences
Location # of
sites
Sequence
Type
Ecological Unit Parent material/
geomorphology
Vegetation Refs.
Merced 5 Chrono Great Valley Dry
Steppe
Granitic alluvium Annual grasses (Brenner et al 2001, Harden 1988,
White et al 1996)
Central
Sierra
6 Climo Sierra Nevada Quartz diorite to
granodiorite
Ponderosa pine, mixed
conifers, true fir, lodgepole
pine, oaks, annual grasses
(Dahlgren et al 1997, Trumbore et
al 1996)
Mt. Shasta 4 Chrono Southern Cascades Andesitic mudflows Ponderosa pine (Dickson & Crocker 1953,
Lilienfein et al 2003, Lilienfein et
al 2004, Sollins et al 1983)
Jug Handle
Reserve,
Mendocino
9 Chrono Coastal Steppe Beach sands to
marine terraces
Annual grasses, redwood,
Douglas fir, bishop pine,
cypress
(Merritts et al 1991, Yu et al
2003)
Los Osos 4 Chrono Central Coast
Chaparral
Beach sands to
marine terraces
Shrubs, annual grasses (Moody & Graham 1995)
Activity and Diversity of Nitrogen-Cycling Microbial Communities in Soil Sequences Around California—Stein
Table 2. Primer sequences used in this study
Target Gene Name Sequence (5’→3’) Ref.
Bacteria 16S rDNA 341F* CCTACGGGAGGCAGCAG 1
518R ATTACCGCGGCTGCTGG 1
Bacteria nirK F1aCu ATCATGGTSCTGCCGCG 2
R3Cu* TCGATCAGRTTGTGGTT 2
Bacteria nirS nirS1F* CCTAYTGGCCGCCRCART 3
nirS6R CGTTGAACTTRCCGGT 3
Bacteria amoA amoAf-i* GGGGITTITACTGGTGGT 4
amoAr-i CCCCTCIGIAAAICCTTCTTC 4
Archaea 16S rDNA pArch340F* TACGGGGYGCASCAG 5
pArch519R TTACCGCGGCKGCTG 5
Archaea amoA Arch-amoA forward CTGAYTGGGCYTGGACATC 6
Arch-amoA reverse* TTCTTCTTTGTTGCCCAGTA 6
“*” GC-Clamp added for DGGE-PCR.
References: 1. (Muyzer et al 1993), 2. (Hallin & Lindgren 1999), 3. (Braker et al 1998), 4.
(Hornek et al 2006), 5. (Øvreås et al 1997), 6. (Wuchter et al 2006)
Activity and Diversity of Nitrogen-Cycling Microbial Communities in Soil Sequences Around California—Stein
Table 3. PCR amplification products from each soil.
Site Bacteria Archaea Bac-amoA Arch-amoA NirK NirS
Merced1 + + + + + +
Merced2 + + + + + +
Merced3 + + + + + +
Merced4 + + + +
Merced5 +
Sierra1 + + + + + +
Sierra2 + +
Sierra3 + + + + + +
Sierra4 + + + + +
Sierra5 + + + + +
Sierra6 + + + + +
Mt. Shasta1 + + + + +
Mt. Shasta2 + + + +
Mt. Shasta3 + +
Mt. Shasta4 + + + + +
Mendocino1 + + +
Mendocino2 + + + + +
Mendocino3 + + + + +
Mendocino4 + + +
Mendocino5 + + + + + +
Mendocino6 + + + +
Mendocino7 + + + +
Mendocino8 + + +
Mendocino9 + +
Los Osos1
Los Osos2 + + + +
Los Osos3 + + +
Los Osos4
Activity and Diversity of Nitrogen-Cycling Microbial Communities in Soil Sequences Around California—Stein
Table 4. Presence of archaeal DGGE bands that correlating with specific physicochemical
parameters within soil sequences.
pH/salinity PNA/nitrate Ammonia/water Merced A21, A26, A28 A23, A24, A25, A28
Sierra A26 A23, A24, A25
Shasta A26 A25 A48
Mendocino A21, A26, A28, A33 A23, A24, A25, A27 A46, A47, A48
Los Osos A21, A26, A28, A33 A23, A24, A25, A27
Activity and Diversity of Nitrogen-Cycling Microbial Communities in Soil Sequences Around California—Stein
Table 5. PCR amplification of nirK and nirS genes from soils incubated with different 13
C-substrates under denitrifying (anaerobic)
conditions. (+: PCR detected, blank: no amplification)
sample# site
nirK nirS PDA
acetate
3day
acetate
7day
glucose
3day
glucose
7day
acetate
3day
acetate
7day
glucose
3day
glucose
7day No C Acetate Glucose
1 merced1 + + + + + + + + 48.89 175.13 73.78
2 merced2 + + + + + + + + 28.47 165.77 178.32
3 merced3 + + + + + + + + 25.28 169.47 88.81
4 merced4 + + + + + + 10.21 124.71 60.49
5 merced5 + + + + + + 11.11 127.76 121.96
6 Sierra1 + + + + 27.10 113.54 155.16
7 Sierra2 + + + + 13.87 157.11 111.53
8 Sierra3 + + + + + 32.56 262.77 187.78
9 Sierra4 + + + + 30.99 57.04 70.36
10 Sierra5 + + + + + 36.17 239.37 231.51
11 Sierra6 + + + + 55.31 201.86 52.93
12 Shasta1 + + + + 13.42 169.52 63.79
13 Shasta2 + + + + 13.40 89.70 31.84
14 Shasta3 + + + + + 29.70 136.24 27.33 15 Shasta4 + + + + + 0.00 122.34 23.66
16 mendocino1 + + + + 11.16 135.30 131.50
17 mendocino2 + + + + + + 238.05 231.18 120.36
18 mendocino3 + + + + + + + + 148.27 182.18 95.94
19 mendocino4 + + + + + 80.33 223.46 95.45
20 mendocino5 + + + + 176.98 175.92 62.97
21 mendocino6 + + + 112.91 167.13 139.19
22 mendocino7 + + + + + + + + 48.92 270.35 120.30
23 mendocino8 + + + + + + + + 174.39 237.84 134.19
24 mendocino9 + + + + 118.65 163.62 87.96
25 Los Osos1 + + + + 11.60 85.05 52.28
26 Los Osos2 + + + + 115.33 357.23 138.09
27 Los Osos3 + + + + 29.17 327.93 140.91
28 Los Osos4 + + + + 14.39 164.65 149.14
Activity and Diversity of Nitrogen-Cycling Microbial Communities in Soil Sequences Around California—Stein
Table 6. Nearest neighbor of nirK DGGE band DNA sequences in 13
C-acetate and glucose
assimilating bacterial populations in all soil sequences.
Site DGGE band Nearest neighbor Accession# Similarity
merced 1 K01A7D-1 Paracoccus denitrificans copper dependent nitrite reductase (nir)
gene AF114788
88.2
(380/431)
merced 1 K01A7D-2 Alcaligenes sp. STC1 nirK gene for dissimilatory nitrite
reductase, complete cds AB046603
89.6
(389/434)
merced 1 K01A7D-3 Paracoccus denitrificans copper dependent nitrite reductase (nir)
gene AF114788
88.9
(384/432)
merced 1 K01G3D-1 Clone Ag08-69 putative nitrite reductase (nirK) gene DQ304300 83.2
(326/392)
merced 1 K01G3D-2 Clone T8R2_0-7cm_061 NirK (nirK) gene DQ784011 84.4
(342/405)
merced 2 K02A3D-1 Partial nirK gene for copper containing nitrite reductase, clone
HlS3-226 AM235266
95.5
(386/404)
merced 2 K02A3D-2 Partial nirK gene for copper containing nitrite reductase, clone
HlS3-226 AM235266
95.3
(385/404)
merced 2 K02G3D-1 Partial nirK gene for copper containing nitrite reductase, clone
HlS3-226 AM235266
95.3
(385/404)
merced 2 K02G3D-2 Partial nirK gene for copper containing nitrite reductase, clone
HlS3-226 AM235266
95.5
(386/404)
merced 2 K02G7D-1 Partial nirK gene for copper containing nitrite reductase, clone
HlS3-226 AM235266
87.3
(344/394)
merced 3 K03A7D-1 Partial nirK gene for copper-containing nitrite reductase, clone AgMA36
AJ487549 99.5 (410/412)
merced 3 K03A7D-2 Partial nirK gene for copper-containing nitrite reductase, clone
AgMA36 AJ487549
100.0
(412/412)
merced 3 K03A7D-3 Partial nirK gene for copper-containing nitrite reductase, clone AgMA36
AJ487549 99.5 (411/413)
merced 3 K03A7D-4 Partial nirK gene for copper-containing nitrite reductase, clone
AgMA36 AJ487549
99.3
(409/412)
merced 4 K04A7D-1 Clone T7R1_13-20cm_075 NirK (nirK) gene DQ783580 91.0 (375/412)
merced 4 K04A7D-2 Clone T7R1_13-20cm_075 NirK (nirK) gene DQ783580 90.8
(374/412)
merced 4 K04G3D-2 Clone DGGE band AK2B nitrite reductase (nirK) gene AY583382 89.0 (365/410)
merced 5 K05A7D-1 Partial nirK gene for copper containing nitrite reductase, clone
HlS3-226 AM235266
88.3
(354/401)
merced 5 K05A7D-2 Partial nirK gene for copper containing nitrite reductase, clone HlS3-226
AM235266 88.3 (354/401)
merced 5 K05A7D-3 Sinorhizobium sp. R-25078 nirK gene for nitrite reductase AM230841 84.1
(344/409)
merced 5 K05G7D-1 Clone DGGE band AK2B nitrite reductase (nirK) gene AY583382 89.2 (370/415)
merced 5 K05G7D-2 Clone DGGE band AK2B nitrite reductase (nirK) gene AY583382 89.0
(365/410)
sierra 1 K06G7D-1 Clone T8R1_13-20cm_094 NirK (nirK) gene DQ783944 95.3 (324/340)
sierra 2 K07A3D-1 Clone KRF50 putative nitrite reductase (nirK) gene DQ182214 98.0 (50/51)
sierra 2 K07A7D-2 Clone T8R2_13-20cm_063 NirK (nirK) gene DQ784089 100.0 (49/49)
sierra 4 K09G3D-1 Clone T8R1_0-7cm_012 NirK (nirK) gene DQ783858 94.1 (48/51)
sierra 5 K10A7D-1 Clone T7R1_13-20cm_075 NirK (nirK) gene DQ783580 91.1 (378/415)
sierra 5 K10A7D-2 Clone T7R1_13-20cm_075 NirK (nirK) gene DQ783580 91.3
(387/424)
sierra 5 K10G3D-1 Clone KEP51 putative nitrite reductase (nirK) gene DQ182211 90.9 (60/66)
sierra 5 K10G7D-1 Clone DGGE band AK2B nitrite reductase (nirK) gene AY583382 89.5 (376/420)
sierra 6 K11A3D-1 Bradyrhizobium sp. BTAi1, complete genome CP000494 99.3
(426/429)
sierra 6 K11A3D-2 Bradyrhizobium sp. BTAi1, complete genome CP000494 99.3 (427/430)
Activity and Diversity of Nitrogen-Cycling Microbial Communities in Soil Sequences Around California—Stein
mt.shasta 2 K13A7D-1 Clone T8R1_13-20cm_031 NirK (nirK) gene DQ783959 91.6 (391/427)
mt.shasta 2 K13G7D-1 Clone T8R2_0-7cm_017 NirK (nirK) gene DQ784006 95.5 (63/66)
mt.shasta 3 K14G7D-1 Clone T8R1_13-20cm_049 NirK (nirK) gene DQ783964 94.4
(404/428)
mt.shasta 4 K15A3D-1 Bradyrhizobium sp. BTAi1, complete genome CP000494 98.5 (66/67)
mt.shasta 4 K15A3D-2 Bradyrhizobium sp. BTAi1, complete genome CP000494 94.6
(368/389)
mt.shasta 4 K15G3D-1 Clone T1R1_0-7cm_045 NirK (nirK) gene DQ783227 90.3 (56/62)
mendocino 1 K16A3D-1 Bradyrhizobium sp. BTAi1, complete genome CP000494 99.3 (426/429)
mendocino 1 K16A3D-2 Bradyrhizobium sp. BTAi1, complete genome CP000494 100.0
(410/410)
mendocino 1 K16A7D-1 Clone C1-15 putative nitrite reductase (nirK) gene DQ304147 93.2 (400/429)
mendocino 1 K16A7D-2 Clone C1-15 putative nitrite reductase (nirK) gene DQ304147 97.0
(419/432)
mendocino 1 K16G3D-1 Clone C1-15 putative nitrite reductase (nirK) gene DQ304147 90.1 (393/436)
mendocino 1 K16G3D-2 Clone C1-15 putative nitrite reductase (nirK) gene DQ304147 92.1
(396/430)
mendocino 1 K16G3D-3 Clone C1-15 putative nitrite reductase (nirK) gene DQ304147 91.2 (393/431)
mendocino 1 K16G7D-1 Clone M9 nitrite reductase (nirK) gene AY121534 86.1
(348/404)
mendocino 1 K16G7D-2 Bradyrhizobium sp. BTAi1, complete genome CP000494 95.5 (399/418)
mendocino 2 K17G3D-1 Clone MW00049 nitrate reductase (nirK) gene AY249374 90.1
(391/434)
mendocino 2 K17G3D-2 Clone T7R1_0-7cm_043 NirK (nirK) gene DQ783512 91.0 (394/433)
mendocino 2 K17G3D-3 Clone MW00049 nitrate reductase (nirK) gene AY249374 91.7
(396/432)
mendocino 3 K18A3D-1 Clone U65 nitrite reductase (nirK) gene AY121516 95.2 (412/433)
mendocino 3 K18A7D-1 Clone K30O29 putative copper nitrite reductase (nirK) gene EF644998 94.7
(413/436)
mendocino 3 K18A7D-2 Clone T8R2_0-7cm_034 NirK (nirK) gene DQ783992 90.4 (368/407)
mendocino 5 K20G3D-2 Clone SJY-17 copper-containing dissimilatory nitrite reductase
(nirK) gene AY683863
97.7
(260/266)
mendocino 6 K21A7D-1 Bradyrhizobium sp. BTAi1, complete genome CP000494 99.1 (425/429)
mendocino 6 K21A7D-2 Bradyrhizobium sp. BTAi1, complete genome CP000494 99.1
(425/429)
mendocino 6 K21G3D-1 Clone SJY-17 copper-containing dissimilatory nitrite reductase (nirK) gene
AY683863 93.5 (286/306)
mendocino 7 K22A3D-1 Sinorhizobium sp. R-31759 partial nirK gene for copper-
containing nitrite reductase AM403563
96.9
(406/419)
mendocino 7 K22A3D-2 Sinorhizobium sp. R-31759 partial nirK gene for copper-containing nitrite reductase
AM403563 95.9 (401/418)
mendocino 7 K22A3D-3 Clone C1-15 putative nitrite reductase (nirK) gene DQ304147 96.0
(411/428)
mendocino 7 K22A7D-1 Clone N16 NirK (nirK) gene DQ996545 87.1
(296/340)
mendocino 8 K23A7D-1 Bradyrhizobium sp. BTAi1, complete genome CP000494 85.2
(345/405)
mendocino 9 K24A7D-1 Bradyrhizobium sp. BTAi1, complete genome CP000494 95.6
(411/430)
mendocino 9 K24A7D-2 Bradyrhizobium sp. BTAi1, complete genome CP000494 97.7
(422/432)
Los Osos 1 K25A3D-1 Clone KRF7 putative nitrite reductase (nirK) gene DQ182217 85.6
(267/312)
Los Osos 1 K25A3D-2 Clone T1R1_0-7cm_069 NirK (nirK) gene DQ783223 93.5
(402/430)
Activity and Diversity of Nitrogen-Cycling Microbial Communities in Soil Sequences Around California—Stein
Los Osos 1 K25A3D-3 Clone T8R1_13-20cm_101 NirK (nirK) gene DQ783924 93.2 (398/427)
Los Osos 1 K25A3D-4 Clone T8R1_13-20cm_101 NirK (nirK) gene DQ783924 94.0
(405/431)
Los Osos 1 K25A7D-1 Clone T1D2_0-7cm_039 NirK (nirK) gene DQ783183 87.1 (373/428)
Los Osos 1 K25A7D-2 Clone T1D2_0-7cm_008 NirK (nirK) gene DQ783186 87.2
(353/405)
Los Osos 1 K25G3D-1 Clone T1R1_0-7cm_069 NirK (nirK) gene DQ783223 91.6 (393/429)
Los Osos 2 K26A7D-1 Clone N16 NirK (nirK) gene DQ996545 87.8
(266/303)
Los Osos 2 K26G3D-1 Sinorhizobium sp. R-31759 partial nirK gene for copper-containing nitrite reductase
AM403563 93.1 (392/421)
Los Osos 3 K27A3D-1 Clone T8R2_13-20cm_068 NirK (nirK) gene DQ784059 90.5
(380/420)
Los Osos 4 K28A7D-2 Clone T1R1_0-7cm_022 NirK (nirK) gene DQ783219 85.7 (361/421)
Los Osos 4 K28G3D-1 Clone SJY-27 copper-containing dissimilatory nitrite reductase
(nirK) gene AY683873 97.3 (71/73)
Los Osos 4 K28G7D-1 Bradyrhizobium sp. BTAi1, complete genome CP000494 99.1 (425/429)
Activity and Diversity of Nitrogen-Cycling Microbial Communities in Soil Sequences Around California—Stein
Table 7. Nearest neighbor of nirS DGGE bands in 13
C-acetate and glucose assimilating
bacterial populations in California soils.
DGGE band Nearest neighbor Accession# Similarity
nirS-1 NirS gene for cytochrome cd1 nitrite reductase, clone: NS69 AB378618 88.6 (302/341)
nirS-2 NirS gene for cytochrome cd1 nitrite reductase, clone: NS69 AB378618 88.6 (303/342)
nirS-3 NirS gene for cytochrome cd1 nitrite reductase, clone: NS18 AB378605 93.9 (324/345)
nirS-4 NirS gene for cytochrome cd1 nitrite reductase, clone: NS18 AB378605 93.6 (320/342)
nirS-5 NirS gene for cytochrome cd1 nitrite reductase, clone: NS18 AB378605 94.1 (335/356)
nirS-6 NirS gene for cytochrome cd1 nitrite reductase, clone: NS62 AB378616 90.7 (312/344)
nirS-7 NirS gene for cytochrome cd1 nitrite reductase, clone: NS18 AB378605 95.7 (334/349)
nirS-8 NirS gene for cytochrome cd1 nitrite reductase, clone: NS69 AB378618 87.5 (273/312)
nirS-9 NirS gene for cytochrome cd1 nitrite reductase, clone: NS18 AB378605 87.9 (290/330)
nirS-10 NirS gene for cytochrome cd1 nitrite reductase, clone: NS62 AB378616 90.7 (321/354)
nirS-11 NirS gene for cytochrome cd1 nitrite reductase, clone: NS69 AB378618 89.0 (316/355)
nirS-12 NirS gene for cytochrome cd1 nitrite reductase, clone: NS18 AB378605 92.7 (318/343)
Activity and Diversity of Nitrogen-Cycling Microbial Communities in Soil Sequences Around California—Stein
Fig. 1. Prevalence and diversity of functional genes (bacterial amoA, archaeal amoA, nirK, nirS) among all sites as determined by denaturing gradient gel electrophoresis (DGGE). The similarities between samples are shown in a dendrogram of Dice similarity coefficients (unweighted pair group method with arithmetic mean). This method only takes band position, not intensity, into consideration. The scale bar indicates the level of similarity between sites.
Activity and Diversity of Nitrogen-Cycling Microbial Communities in Soil Sequences Around California—Stein
Fig. 2. Principle Components Analysis (PCA) of functional gene composition and diversity with soil physicochemical parameters at each sampling site. 45% of the variability among the sites could be described by components in the two primary axes.
Activity and Diversity of Nitrogen-Cycling Microbial Communities in Soil Sequences Around California—Stein
Fig. 3. Potential nitrification activity and presence of AOA and/or AOB at each site within the soil sequences. Direction of arrow denotes increase in parameter (age, elevation, or organic material). Presence of AOA or AOB determined by ability to amplify amoA genes with specific PCR primers (see Table 3).
0
1
2
3
4
5
μg N
O3
-·
mL
slu
rry -
1 d
ay
-1
- + - -
- - - -
+ - + - +
+ + + - +
+ - + - - -
+ + + + + +
+ - - +
- + + -
- + + - +
- + + - +
AOA
AOB
NA - + NA
NA - - NA
Merced Sierra Shasta
Mendicino
South Los OsosNorth
Age AgeOrganicsElev.
Age and Elevation
Heterotrophic
Combined
Chemolithotrophic
Activity and Diversity of Nitrogen-Cycling Microbial Communities in Soil Sequences Around California—Stein
Fig. 4. Canonical correspondence analysis (CCA) of bacterial amoA DGGE bands with soil physicochemical parameters.
-1.0 1.0
-1.0
1.0
BamoA29BamoA30
BamoA34
BamoA36
BamoA37 BamoA38BamoA38
BamoA42 BamoA43
BamoA45
BamoA46
BamoA47BamoA48BamoA49
BamoA51
BamoA52
BamoA53
BamoA73
Chloride
NH4
Nitrate
K
pH
LOI
tempsoiltemp
PDA_NOC
PDA_ACET
PDA_GLUC
PNA_Acet
PNA
Activity and Diversity of Nitrogen-Cycling Microbial Communities in Soil Sequences Around California—Stein
Fig. 5. CCA analysis of archaeal amoA DGGE bands with soil physicochemical parameters.
-0.6 1.0
-0.8
0.8
AamoA21
AamoA23AamoA24AamoA25
AamoA26
AamoA27
AamoA28
AamoA33
AamoA46
AamoA_47
AamoA_48
Chloride
Sulfate
Phosphou
NH4
Nitrate
Nitrite
Ca
K
Mg
NapH
water co
LOI
tempsoiltemp
PDA_NOC
PDA_ACET
PDA_GLUC
PNA_AcetPNA
conducti
Activity and Diversity of Nitrogen-Cycling Microbial Communities in Soil Sequences Around California—Stein
Fig. 6. Band presence/absence (Dice) based cluster analysis of the nirK DGGE band patterns of 13C-DNA extracted from 13C-acetate or -glucose enriched Merced soil samples.
Activity and Diversity of Nitrogen-Cycling Microbial Communities in Soil Sequences Around California—Stein
Fig. 7. Band presence/absence (Dice) based cluster analysis of the nirK DGGE band patterns of 13C-DNA extracted from 13C-acetate or -glucose enriched Sierra soil samples.
Activity and Diversity of Nitrogen-Cycling Microbial Communities in Soil Sequences Around California—Stein
Fig. 8. Band presence/absence (Dice) based cluster analysis of the nirK DGGE band patterns of 13C-DNA extracted from 13C-acetate or -glucose enriched Mt. Shasta soil samples.
Activity and Diversity of Nitrogen-Cycling Microbial Communities in Soil Sequences Around California—Stein
Fig. 9. Band presence/absence (Dice) based cluster analysis of the nirK DGGE band patterns of 13C-DNA extracted from 13C-acetate or -glucose enriched Mendocino soil samples.
Activity and Diversity of Nitrogen-Cycling Microbial Communities in Soil Sequences Around California—Stein
Fig. 10. Band presence/absence (Dice) based cluster analysis of the nirK DGGE band patterns of 13C-DNA extracted from 13C-acetate or -glucose enriched Los Osos soil samples.
Activity and Diversity of Nitrogen-Cycling Microbial Communities in Soil Sequences Around California—Stein
Fig. 11. Band presence/absence (Dice) based cluster analysis of the nirS DGGE band patterns of 13C-DNA extracted from 13C-acetate or -glucose enriched samples from all soil sequences.
This research was funded by the Kearney Foundation of Soil Science: Understanding and
Managing Soil-Ecosystem Functions Across Spatial and Temporal Scales, 2006-2011 Mission
(http://kearney.ucdavis.edu). The Kearney Foundation is an endowed research program created
to encourage and support research in the fields of soil, plant nutrition, and water science within
the Division of Agriculture and Natural Resources of the University of California.
http://kearney.ucdavis.edu/