Allosteric Site Communication Pathways Revealed Using Hybrid ...

R-State AMP Complex Reveals Initial Steps of the Quaternary Transition

of Fructose-1,6-bisphosphatase‡

Cristina V. Iancu, Susmith Mukund, Herbert J. Fromm,

and Richard B. Honzatko*

Department of Biochemistry, Biophysics, and Molecular Biology,

Iowa State University, Ames, IA 50011

Running title: Fructose-1,6-bisphosphatase

This work was supported in part by National Institutes of Health Research Grant NS 10546.

‡Coordinates and structure factors (accession labels 1YXI, 1YYZ and 1YZO) for the structures

described in this paper have been deposited in the Protein Data Bank, Research Collaboratory for

Structural Bioinformatics (RCSB).

*Corresponding author. Telephone: (515) 294-6116. Fax: (515) 294-0453. E-mail:

[email protected].

1

JBC Papers in Press. Published on March 14, 2005 as Manuscript M501011200

Copyright 2005 by The American Society for Biochemistry and Molecular Biology, Inc.

by guest on April 7, 2018

http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Abstract

AMP transforms fructose-1,6-bisphosphatase from its active R-state to its inactive T-state;

however, the mechanism of that transformation is poorly understood. The mutation of Ala54 to

leucine destabilizes the T-state of fructose-1,6-bisphosphatase. The mutant enzyme retains wild-

type levels of activity, but the concentration of AMP that causes 50% inhibition increases 50-

fold. In the absence of AMP, the Leu54 enzyme adopts an R-state conformation nearly identical

to that of the wild-type enzyme. The mutant enzyme, however, grows in two crystal forms in the

presence of saturating AMP. In one, the AMP-bound tetramer is in a T-like conformation,

whereas in the other, a R-like conformation. The latter reveals conformational changes in two

helices due to the binding of AMP. Helix H1 moves toward the center of the tetramer and

displaces Ile10 from a hydrophobic pocket. The displacement of Ile10 exposes a hydrophobic

surface critical to interactions that stabilize the T-state. Helix H2 moves away from the center of

the tetramer, breaking hydrogen bonds with a buried loop (residues 187–195) in an adjacent

subunit. The same hydrogen bonds reform, but only after the quaternary transition to the T-state.

Proposed here is a model that accounts for the quaternary transition and cooperativity in the

inhibition of catalysis by AMP.

2


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Fructose-1,6-bisphosphatase (D-fructose-1,6-bisphosphate 1-phosphohydrolase, EC 3.1.3.11;

FBPase1) catalyzes a tightly regulated step of gluconeogenesis, the hydrolysis of fructose 1,6-

bisphosphate (F16P2) to fructose 6-phosphate (F6P) and inorganic phosphate (Pi) (1,2). AMP

and fructose 2,6-bisphosphate (F26P2), binding to allosteric and active sites, respectively, inhibit

FBPase while simultaneously activating its counterpart in glycolysis, fructose-6-phosphate 1-

kinase (3,4). Biosynthesis and degradation of F26P2 is subject to hormonal control principally

by glucagon and insulin (4,5). F26P2 enhances the binding of AMP to FBPase by up to an order

of magnitude (6). Hence, although intracellular concentrations of AMP remain relatively

constant, AMP should become a more potent inhibitor of FBPase as concentrations of F26P2

increase. AMP binds 28 Å away from the nearest active site, and perhaps not surprisingly

inhibits catalysis noncompetitively with respect to F16P2. Yet, AMP is a competitive inhibitor of

catalysis with respect to essential divalent cations (Mg2+, Mn2+, or Zn2+), all of which are in

proximity to (and probably coordinate with) the 1-phosphoryl group of F16P2 (7−10).

FBPase is a homotetramer [subunit Mr of 37,000 (11)] and exists in at least two distinct

quaternary conformations called R and T (12−13). AMP induces the transition from the active

R-state to the inactive (or less active) T-state. Substrates or products in combination with metal

cations stabilize the R-state conformation. A proposed mechanism for allosteric regulation of

catalysis involves three conformational states of loop 52−72 called engaged, disengaged, and

disordered (14). AMP alone or with F26P2, stabilizes a disengaged loop (15,16), whereas metals

with products stabilize an engaged loop (10,16−18). In active forms of the enzyme, loop 52−72

probably cycles between its engaged and disordered conformations (14,17). Fluorescence from a

tryptophan reporter group at position 57 is consistent with the conformational states for loop

52−72, observed in crystal structures (19,20). Thus far, the engaged conformation of loop 52−72

3


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

has appeared only in R-state crystal structures, and the disengaged conformer only in T-state

structures; however, disordered conformations of the dynamic loop have appeared in both the R-

and T-states (16,17,21,22).

The precise sequence of events that attend the R- to T-state transition in FBPase has been

elusive. Crystal structures of the R- and T-states are the endpoints of the allosteric transition,

and leave much to speculation regarding intermediate conformational states of FBPase. The

immediate consequences of AMP binding to the R-state are unknown. Does the dynamic loop

become disengaged in response to the binding of AMP or in response to the allosteric transition

to the T-state? How does the binding of AMP destabilize the R-state and stabilize the T-state?

A recent study revealed the first intermediate state of porcine FBPase (23), a T-like conformation

due to the binding of an allosteric effector to the center of the tetramer. The results of that study

indicated the potential for trapping intermediate conformational states of FBPase by

crystallization.

The mutation of Ala54 to leucine disrupts key packing interactions of the disengaged loop

conformation. The resulting Leu54 enzyme has wild-type catalytic properties and retains

cooperativity in AMP inhibition, but exhibits a 50-fold increase in the IC50 for AMP. In the

absence of AMP, Leu54 FBPase is in its canonical R-state. Two crystal forms, however, grow in

the presence of saturating AMP. In one crystal form, the enzyme is in its T-state, but with a

disordered dynamic loop. In the other crystal form, the tetramer is in an R-like quaternary state

with an engaged dynamic loop. The latter crystal form reveals the immediate consequences of

AMP association in the absence of an allosteric transition. The observed conformational changes

suggest the mechanism by which AMP leverages the allosteric transition in FBPase.

4


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Experimental

Materials F16P2, F26P2, NADP+ and AMP were purchased from Sigma. DNA-modifying and

restriction enzymes, T4 polynucleotide kinase and ligase were from Promega. Glucose-6-

phophate dehydrogenase and phosphoglucose isomerase came from Roche. Other chemicals

were of reagent grade or equivalent. Escherichia coli strains BMH 71-18 mutS and XL1-Blue

came from Clontech and Stratagene, respectively. The FBPase-deficient E. coli strain DF 657

came from the Genetic Stock Center at Yale University.

Mutagenesis of wild-type FBPase— The mutation of Ala54 to leucine was accomplished by

specific base changes in a double-stranded plasmid containing the gene coding for FBPase using

the Transformer site-Directed Mutagenesis kit (Clontech). The mutagenic primer for

Ala54→Leu was 5'GGCGGGCATCCTGCACCTC3'. (The codon with the point mutation is

underlined in bold typeface). The selection primer for mutagenesis,

5’CAGCCTCGCCTCGAGAACGCCA3’ (digestion site underlined in bold typeface), changed

an original NruI site on the plasmid into a XhoI site. The mutation and the integrity of the

construct were confirmed by sequencing the promoter region and the entire open reading frame.

The Iowa State University sequencing facility provided DNA sequences, using the fluorescent

dye-dideoxy terminator method.

Expression and Purification of wild-type and Leu54 FBPases Cell-free extracts of wild-type

and Leu54 FBPases were subjected to heat treatment (63o C for 7 minutes), followed by

centrifugation. The supernatant solution was loaded onto a Cibracon Blue sepharose column,

previously equilibrated with 20 mM Tris-HCl, pH 7.5. The column was washed first with 20

mM Tris-HCl, pH 7.5. Enzyme was eluted with a solution of 500 mM NaCl and 20 mM Tris-

HCl of the same pH. After pressure concentration (Amicon PM-30 membrane) and dialysis

5


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

against 10 mM Tris-HCl, pH 8.0, the protein sample was loaded onto a DEAE sepharose column

equilibrated with 10 mM Tris-HCl, pH 8.0. Purified enzyme was eluted with a NaCl gradient

(0–0.5 M) in 10 mM Tris-HCl, pH 8.0, and then dialyzed extensively against 50 mM Hepes, pH

7.4, for kinetic investigations and for crystallization experiments. Purity and protein

concentrations of FBPase preparations were confirmed by SDS-polyacrylamide gel

electrophoresis (25) and the Bradford assay (26), respectively.

Kinetic experiments Assays for the determination of kcat, and specific activity ratios at pH

7.5/9.5 employed the coupling enzymes, phosphoglucose isomerase and glucose-6-phosphate

dehydrogenase (1). The reduction of NADP+ to NADPH was monitored by absorbance at 340

nm. All other assays used the same coupling enzymes, but monitored the formation of NADPH

by its fluorescence emission at 470 nm, using an excitation wavelength of 340 nm. Assays were

performed at 22 ºC in 50 mM Hepes, pH 7.5, or in 50 mM Caps, pH 9.5. Assay solutions

contained ethylenediamine tetracetic acid (EDTA) and KCl at concentrations of 10 µM and 150

mM, respectively. Initial rates were analyzed with programs written either in MINITAB, using

an α value of 2.0 (26), or by ENZFITTER (27). The kinetic data for AMP inhibition with

respect to Mg2+ and F26P2 inhibition with respect to F16P2 were fit to several models, but only

parameters associated with the best fitting mechanism of inhibition are reported in the results

section.

Crystallization of the product complex Crystals of Leu54 FBPase were grown by the

method of hanging drops. Equal parts of a protein solution and a precipitant solution were

combined in a droplet of 4 µL total volume. Wells contained 500 µL of the precipitant solution.

R-state crystals grew from a protein solution [Leu54 FBPase (10 mg/ml), Hepes (25 mM, pH

7.4), MgCl2 (5 mM), and F16P2 (5 mM)] combined with a precipitant solution [Hepes (100 mM,

6


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

pH 7.4), polyethylene glycol 3350 (8% (w/v)), glycerol (27% (v/v)), and t-butanol (5% (v/v))].

Crystals of the R-like AMP complex grew from a protein solution [Leu54 FBPase (10 mg/ml),

Hepes (25 mM, pH 7.4), MgCl2 (5 mM), F16P2 (5 mM), and AMP (5mM)] combined with a

precipitant solution [Hepes (100 mM, pH 7.4), polyethylene glycol 3350 (12% (w/v)), glycerol

(23% (v/v)), and t-butanol (5% (v/v))]. Crystals of the T-state AMP complex grew from a

protein solution [Leu54 FBPase (10 mg/ml), Hepes (25 mM, pH 7.4), MgCl2 (5 mM), F16P2 (5

mM), and AMP (5 mM)] combined with a precipitant solution [Hepes (100 mM, pH 7.4),

polyethylene glycol 3350 (14% (w/v)), 2-methyl-2,4-pentanediol (21% (v/v)), and t-butanol (5%

(v/v))]. Crystals were of equal dimensions (0.2–0.4 mm), growing in approximately three days

at 20 °C. Conditions of crystallization include cryoprotectants; crystals can be transferred

directly from droplet to liquid nitrogen.

Data collection Data were collected at Iowa State University from single crystals on a

Rigaku R-AXIS IV++ rotating anode/image plate system, using CuKα radiation from an Osmic

confocal optics system, and a temperature of 110 K. Data were reduced with the program

package CrystalClear, provided with the instrument.

Structure determination, model building and refinement Crystals of Leu54 FBPase are

isomorphous to either the AMP/Zn2+/product complex (16) or the Zn2+/product complex (10).

Phase angles, used in the generation of initial electron density maps, were based on model 1EYJ

or 1CNQ of the PDB, from which water molecules, metal cations, small-molecule ligands, and

residues 52−72 had been omitted. Residues 52−72 were built into the electron density of omit

maps, using the program XTALVIEW (28). Ligands were added to account for omit electron

density at the active site and/or the AMP site. The resulting models underwent refinement, using

CNS (29) with force constants and parameters of stereochemistry from Engh & Huber (30). A

7


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

cycle of refinement consisted of slow cooling from 1000–300 K in steps of 25 K, followed by

120 cycles of conjugate gradient minimization, and concluded by the refinement of individual

thermal parameters. Thermal parameter refinement employed restraints of 1.5 Å2 on nearest

neighbor and next-to-nearest neighbor main chain atoms, 2.0 Å2 on nearest neighbor side chain

atoms, and 2.5 Å2 on next-to-nearest neighbor side chain atoms.

In subsequent cycles of refinement, water molecules were fit to difference electron

density of 2.5σ or better and were added until no significant decrease was evident in the Rfree

value. Water molecules in the final models make suitable donor-acceptor distances to each other

and the protein and have thermal parameters under 60 Å2. Stereochemistry of the models was

examined by the use of PROCHECK (31).

Results

Rationale for the Leu54→Ala mutation— The Cβ atom of Ala54 is at the center of a cluster of

hydrophobic side chains, which forms only when the dynamic loop is in its T-state disengaged

conformation. A mutation at position 54 to a large side chain should disrupt packing interactions

and thereby destabilize the disengaged conformation of the dynamic loop. In contrast, ample

room is available for large side chains at position 54 in the R-state engaged conformation of the

loop. The Ala54→Leu mutation then should shift the equilibrium population of AMP complexes

of FBPase toward the R-state.

Expression and Purification of Wild-Type FBPase Expression and isolation procedures

described above provide wild-type and Leu54 FBPases in at least 95% purity, as judged by SDS-

polyacryamide gel electrophoresis (data not shown). Gels indicated no proteolysis of the

purified enzymes.

Kinetics Experiments Kinetics parameters for Leu54 and wild-type FBPases are in Table I.

8


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

The determination of kcat and Km for F16P2 (listed as KmF16P2 in Table I) at pH 7.5 employed a

saturating concentration of Mg2+ (2 mM for Leu54 FBPase and 5 mM for wild-type FBPase) and

concentrations of substrate ranging from 0.5–20 µM. A fit of the Michaelis-Menten equation to

the data provided values for kcat and KmF16P2 (Michaelis constant for F26P2). Ratios of specific

activities at pH 7.5 to 9.5 for wild-type and Leu54 FBPases (each above 3) are indicative of

tetrameric enzymes with intact (non-proteolyzed) polypeptide chains.

The Hill coefficient for Mg2+ was determined at a saturating concentration of F16P2 (20

µM) and concentrations of free Mg2+ ranging from 0.1–5.0 mM. Data were fit to Eq 1:

v/Vm = 1/[1 + (A0.5/A)n] Eq. 1

where v is the velocity, Vm is the maximum velocity at saturating concentrations of F16P2 and

Mg2+, A is the concentration of Mg2+, n is the Hill coefficient for Mg2+, and A0.5 is the

concentration of Mg2+ that gives v/Vm of one-half.

The Hill coefficient for AMP was determined at saturating F16P2 (20 µM), Mg2+

concentrations of 0.8 and 0.15 mM for wild-type and Leu54 FBPases, and AMP concentrations

ranging from 0–500 µM. Data were fit to Eq. 2:

v/V0 = 1/[1 + (I/I0.5)n] Eq. 2

where v is the velocity, V0 is the velocity at an AMP concentration of zero, I is the concentration

of AMP, n is the Hill coefficient for AMP, and I0.5 is the concentration of AMP that gives v/V0 of

one-half.

The kinetic mechanism of AMP inhibition with respect to Mg2+ was determined from

assays that employed saturating (20 µM) F16P2, five different Mg2+ concentrations ranging from

0.8–3.0 mM for wild-type enzyme or 0.2–0.6 mM for Leu54 FBPase, and five different AMP

concentrations ranging from 0–150 µM. A model for linear competitive inhibition (Eq. 3)

9


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

provided the best result (goodness-of-fit of less than 4%):

Vm/v = 1 + Ka/A2+ (Ka/KiAMP) (I/A)2 Eq. 3

where v is the velocity, Vm is the velocity at an inhibitor concentration of zero, saturating

concentrations of F16P2 and Mg2+, A is the concentration of Mg2+, I the concentration of AMP,

Ka the Michaelis constant for Mg2+, and KiAMP the dissociation constant for AMP from the

enzyme-inhibitor complex. Eq. 3 constrains the Hill coefficients for Mg2+ and AMP to 2,

consistent with independent determinations of these quantities.

The kinetic mechanism of F26P2 inhibition with respect to F16P2 was determined from

assays that employed saturating Mg2+ (5 mM for wild-type enzyme and 2 mM for Leu54

FBPase), five different concentrations (1–6 µM) of F16P2, and five different concentrations (0–

1.0 µM ) of F26P2. A model for linear competitive inhibition provided the best fit to the data

(goodness-of-fit of less than 3%):

Vm/v = 1 + Kb/B+ (Kb/KiF26P2) (I/B) Eq. 4

where Vm is the velocity at an inhibitor concentration of zero and saturating concentrations of

F16P2 and Mg2+, B is the concentration of F16P2, I the concentration of F26P2, Kb the Michaelis

constant for F16P2, and KiF26P2 the dissociation constant for F26P2 from the inhibitor enzyme-

complex

Product complex of Leu54 FBPase (PDB identifier 1YXI) Crystals belong to the space

group I222 (a=52.8, b=82.8 and c=165.5 Å), and are isomorphous to those of wild-type FBPase

in its R-state, containing one subunit of the tetramer in the asymmetric unit of the crystal (10,16–

18). Electron density for residues 1−6 is weak or absent; the model begins at residue 7 and

continues to the last residue of the sequence. Thermal parameters vary from 10 to 70 Å2. The

model has stereochemistry (as determined by PROCHECK (31)) comparable to that of structures

10


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

of equivalent resolution. Statistics for data collection and refinement are in Table II.

The product complex of Leu54 FBPase is identical to that of the wild-type enzyme save

clear electron density showing the leucyl side chain at position 54. One molecule each of F6P

and Pi bind to the active site with three atoms of Mg2+. The dynamic loop (residues 52−72) is in

its engaged conformation. Superposition of the Leu54 subunit onto the wild-type subunit reveals

no deviation in the relative positions of Cα atoms in excess of 0.43 Å. Superposition of the

Leu54 tetramer onto canonical wild-type R- and T-states clearly indicates an R-state complex.

We refer the reader to other descriptions of R-state product complexes (10,16–18) for more

detailed descriptions of comparable structures.

AMP/product R-like complex of Leu54 FBPase (PDB identifier 1YYZ) Crystals belong to the

space group I222 (a=53.8, b=82.6 and c=166.6 Å). They contain one subunit in the asymmetric

unit and are isomorphous to those of wild-type FBPase in its R-state (10,16–18). Electron

density for residues 1−9 is weak or absent; the model begins at residue 10 and continues to the

last residue of the sequence. Thermal parameters vary from 10 to 75 Å2. The model has

stereochemistry comparable to that of structures of equivalent resolution (31).

The subunit of the AMP/product complex of Leu54 FBPase has one molecule each of F6P

and Pi with three atoms of Mg2+ at the active site. In addition, strong electron density is present

in the allosteric inhibitor pocket, which represents a bound molecule of AMP (Fig. 1). The

dynamic loop (residues 52−72) adopts the engaged conformation. Superposition of the Leu54

tetramer onto canonical wild-type R- and T-states reveals a change in quaternary state (Table

III). Subunit pair C1–C2 has rotated 3º relative to C3–C4 (Fig. 2). The subunit rotation lies

between that of the canonical R-state (0º rotation) and T-state (15º rotation), and differs from the

intermediate quaternary state (9º rotation) stabilized by the allosteric inhibitor OC252 (Fig. 2).

11


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Hereafter, we will use the label IR to represent the R-like state of the AMP/product complex of

Leu54 FBPase, and IT to represent the T-like state of the OC252 complex.

The IR structure reveals the effect of AMP binding in the absence of a complete

quaternary transition. The superposition of the IR subunit onto the subunits of the R-state

tetramer removes coordinate displacements due to the partial (3°) rotation of the subunit pairs in

the IR-state, revealing conformational changes at the tertiary level. In such a comparison,

conformational changes are evident only in the N-terminal element and helices H1 and H2. The

6-amino group of AMP draws backbone carbonyl 17 (helix H1) toward itself, while pushing

away the side chain of Val17 in avoiding unacceptable nonbonded contacts (Fig. 3a). The

interactions between AMP and Val17 translate helix H1 by 0.5 Å toward the center of the

tetramer and move C-terminal end of helix H1 approximately 1.0 Å toward the bound AMP

molecule. The movement compresses the N-terminal end of helix H1 into residues 193–195 of

subunit C1, and displaces the side chain of Ile10 from a hydrophobic cluster of residues (Figs.

3b&c). Helix H2 moves along its axis 0.5 Å away from the center of the tetramer. Helix

movements sever hydrogen bonds between Thr14 and Asn35 and between Thr39 and Glu192, the

latter a linkage between subunits C1 and C4 (Table IV). Moreover, the hydrogen bond between

Thr46 and backbone carbonyl 189 (another C1–C4 contact) may be weakened. Lys42 remains in

its inter-subunit salt link with Glu192, with little change to its other hydrogen bonding

interactions. The loss or weakening of hydrogen bonds involving Thr39, Thr46, and Glu192

observed in the IR structure is not evident in a direct comparison of the canonical R- and T-states

(Table IV).

The superposition of the IR-state subunit onto the subunits of the T-state tetramer of wild-

type FBPase reveals tertiary conformational change due to the 12º subunit-pair rotation. This

12


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

includes the movement of the dynamic loop from its engaged to disengaged conformer, a

displacement of more than 30 Å for some Cα carbons of that loop. For the most part, other

conformational changes involve modest displacements in atoms not exceeding 0.5 Å. These

changes involve almost every atom in FBPase in a correlated set of collective movements.

Immediately evident is the additional translation of helix H2, outward from the center of the

tetramer and along its axis, and the occurrence of unacceptable contacts between loops 190 (Fig.

4). The unacceptable contacts are relaxed in the T-state subunit by movements in loops 190 in

subunits C1 and C4 away from a molecular axis of twofold symmetry.

AMP/product T-state complex of Leu54 FBPase (PDB identifier 1YZO) Crystals belong to the

space group P21212 (a=59.7, b=166.1 and c=78.9), and are isomorphous to those of AMP

complexes of FBPase (16,17). The subunit pair C1–C2 is in the asymmetric unit of this crystal

form. Regions of weak or absent electron density include residues 1−8 and 55−72. The model

begins at residue 9 and continues to the last residue of the sequence, but segment 55−72 is

unreliable, as evidenced by thermal parameters as high as 113 Å2. The model has

stereochemistry generally comparable to that of structures derived from data of comparable

resolution (31). Statistics for data collection and refinement are in Table II.

The enzyme in this crystal form is in the T-state (quaternary transition angle of 15º);

however, unlike loop-disengaged AMP complexes of the wild-type enzyme, the dynamic loop in

T-state Leu54 FBPase is disordered. Moreover, hydrogen bonds normally well established in the

T-state of the wild-type enzyme seem to be marginally weaker in T-state Leu54 FBPase. The

active site retains Pi, F6P, and Mg2+ bound to sites 1 and 2.

13


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Discussion

Conformational changes between the R- and IR-states of Leu54 FBPase are consistent with

two models for quaternary change: a concerted model in which AMP drives the quaternary

transition by acting on a set of interconnected levers and a sequential model in which AMP raises

the energy level of the R-state while simultaneously lowering that of the nascent T-state (Fig. 5).

The point of departure for each model is an AMP-induced translation of helices H1 and H2 in

opposite directions, helix H1 toward and helix H2 away from the center of the tetramer. The two

models differ in regard to the consequences of helix H2 movement. For the concerted model,

helix H2 retains its interactions with loops 190, whereas in the sequential model, interactions

between helix H2 and loops 190 are broken.

In the concerted model, two sets of coupling interactions distribute forces throughout the

entire tetramer due to the binding of one AMP molecule. One set of interactions involves Thr39,

Lys42 and Thr46 of helices H2 with Glu192 and backbone carbonyls 189 and 190 of loops 190

(Table IV). These interactions link subunits C1 to C4 and C2 to C3. A second set of interactions

defines the C1–C2 and symmetry-related C3–C4 subunit interfaces (13). The binding of one

molecule of AMP to say subunit C1, results in the aforementioned movements of helices H1 and

H2. The movement in helix H2 of subunit C1 exerts an outward force on loops 190 of subunits

C1 and C4. The C1–C2 and C3–C4 subunit interactions, however, constrain loops 190 to a fixed

distance from the center of the tetramer. Loops 190 can only follow the outward movement of

helix H2 by the rigid body rotations of subunit pairs C1–C2 and C3–C4 (Fig. 5). The two sets of

coupling interactions insure that all loops 190 and their associated subunits undergo rigid-body

motions, and that all helices H2 undergo an outward movement in response to the binding of one

or more molecules of AMP.

14


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

The concerted model suffers from two significant shortcomings. Firstly, the coupling

interactions between helix H2 and loops 190 have weakened in the IR state. Only the interactions

involving Lys42 appear unaffected by movements in helices H2, and we suggest below that even

this critical salt link may rupture during the quaternary transition. The weakened linkages

between helices H2 and loops 190, however, may be the consequence of having four AMP

molecules bound to an R-state tetramer. Two bound molecules of AMP convert R-state hybrid

tetramers of FBPase into their T-states (32). Hence, the IR-state of the Leu54 FBPase may

represent an “over-torqued” tetramer, the existence of which is possible only because the

mutation at position 54 eliminates the T-state as a low-energy alternative. The second

shortcoming of the concerted model is not so easy to dismiss. A concerted mechanism for

FBPase requires cooperativity in the binding of AMP molecules to any pair of sites. A hybrid

tetramer of FBPase that constrains AMP-binding to subunits C1 and C2, however, exhibits non-

cooperative inhibition even though it undergoes a quaternary transition (32).

In considering the sequential model for the quaternary transition, we note first that the

subunit rotation observed in the R- to T-state transition cannot happen as a rigid-body motion. In

the R-state, loop 190 from subunit C1 is in contact with the symmetry-related loop from subunit

C4. Progress toward the T-state results in unacceptable contacts between loops 190 from

subunits C1 and C4. Loop 190 must undergo conformational change, but multiple hydrogen

bonds fix its conformation in both the R- and T-states (Table IV). The movement of helix H2

releases a conformational restraint on loop 190 in a neighboring subunit by the disruption or

weakening of hydrogen bonds involving Thr39 and Thr46. In this environment of fewer restraints,

loop 190 is more likely to relax unfavorable contacts that occur during the quaternary transition.

Moreover, the movement in helix H2 favorably positions Thr39 and Thr46 for the formation of

15


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

strong hydrogen bonds in the T-state. In fact, the hydrogen bond involving Glu192 and Thr39,

ruptured in the R- to IR-state transition, reforms in the T-state. The mechanism is fully

reversible: loss of AMP from the T-state presumably causes helix H2 to move back toward the

center of the enzyme, breaking or weakening hydrogen bonds between subunits C1 and C4, and

repositioning Thr39 and Thr46 in favor of R-state interactions.

The sequential model can accommodate both cooperative and non-cooperative

mechanisms of AMP inhibition. A mixture of hybrid mutants of FBPase that force AMP-

binding to opposite halves of the tetramer exhibits cooperative inhibition (32). Hence, subunit

coupling must exist between top and bottom halves of the tetramer. Coupling interactions

necessarily involve subunits C1 and C4, as subunits C1 and C3 have no direct interactions in the

R-state. The binding of AMP to subunit C1 may not only disrupt hydrogen bonds between helix

H2 of subunit C1 and loop 190 of subunit C4, but it may also weaken symmetry-related

hydrogen bonds between helix H2 of subunit C4 and loop 190 of subunit C1. Hence, a second

molecule of AMP would divert less of its binding energy to the movement of helix H2 in subunit

C4 and, as a consequence, bind with higher affinity. All reported mutations of Lys42, Arg49,

Glu192, Ile190, and Gly191, and some mutations of Lys50, abolish AMP cooperativity (22,33–35).

These residues are part of helix H2 or loop 190, and are near to or part of the coupling

interactions between subunits C1 and C4.

A second coupling pathway between AMP binding sites may involve Arg22. The

mutation of Arg22 to methionine eliminates cooperativity in AMP inhibition (36). Arg22 is near

the AMP pocket, has high thermal parameters in the R-state, and does not participate in inter-

subunit hydrogen bonds in either the R- or T-state structures. Replacing subunit C1 of R-state

Leu54 FBPase with an IR subunit generates a model that approximates FBPase with one bound

16


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

molecule of AMP (Fig. 6). In that model, Arg22 of subunit C1, due to conformational changes

induced by AMP, makes a strong hydrogen bond with backbone carbonyl 108 of subunit C4.

The formation of the symmetry related hydrogen bond involving Arg22 of subunit C4 should

induce conformational changes in subunit C4 that favor the binding of AMP.

The concerted and sequential models both assume an energy barrier between R- and T-

states. In the sequential model, hydrogen bonds involving Thr39 and Thr46 contribute

significantly to the barrier, but not so in the concerted model as these interactions are retained.

At least one other interaction may contribute significantly to the energy barrier between R- and

T-states. Unacceptable contacts between the side chains of Glu192 (subunit C4) and Lys42

(subunit C1) are likely during the quaternary transition (Fig. 4b). A conformational change in

the side chain of Glu192 eliminates bad contacts with Lys42, and re-establishes its hydrogen bond

with Thr39. The conformational change in Glu192 may require a transitory loss or weakening of

its salt-link with Lys42. The presumed loss of this salt-link could favor the dissociation of the

tetramer into subunit pairs (C1–C2 from C3–C4), and thereby represent the first step in FBPase

subunit exchange kinetics (32,37).

The models above have yet to consider conformational change in the dynamic loop

(residues 52–72). In all reported structures of FBPase, the dynamic loop is either engaged or

disordered in R-like states, and either disordered or disengaged in T-like states. The AMP-

induced movement of helix H1, which probably occurs in concert with that of helix H2,

displaces Ile10 from a hydrophobic surface. That surface interacts with side chains of the

dynamic loop in its disengaged T-state conformation (Fig. 4c). In the R-state then, Ile10

effectively blocks the disengaged conformer of the dynamic loop. The formation of the

disengaged conformer appears as a significant thermodynamic driving force in the quaternary

17


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

transition to the T-state. A modest change in the conditions of crystallization (substitution of

glycerol for 2-methy-2,4-pentanediol) transforms the AMP/product complex of Leu54 FBPase

from a loop-disordered T-state to a loop-engaged R-state. Direct interactions between

cryoprotectant and enzyme are unlikely as no bound cryoprotectant molecules appear in either

crystal structure. The AMP/product complex of Leu54 FBPase then probably has substantial

populations of IR- and T-states in solution, allowing the growth of different crystal forms under

nearly identical conditions.

The potential significance of C1–C4 interactions in FBPase has been suggested by others

(13,22), but crystal structures of the R- and T-states did not reveal the transitory loss of hydrogen

bonds across the C1–C4 subunit interface. As a consequence, the basis for a sequential

mechanism of quaternary change remained hidden. The sequential model presented here

reconciles properties of AMP inhibition in wild-type, mutant and hybrid FBPases with known

conformational changes in the tetramer. The present study also suggests that AMP-ligation of

the R-state does not displace the dynamic loop from its engaged conformation. Instead, the

dynamic loop leaves the engaged conformation in the T-state, for reasons now poorly

understood.

18


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

References

1. Benkovic, S. T., and de Maine, M. M. (1982) Adv. Enzymol. Relat. Areas Mol. Biol. 53,

45-82

2. Tejwani, G. A. (1983) Adv. Enzymol. Relat. Areas Mol. Biol. 54, 121-194

3. Van Schaftingen, E. (1987) Adv. Enzymol. Relat. Areas Mol Biol. 59, 45-82

4. Pilkis, S. J., El-Maghrabi, M. R., and Claus, T. H. (1988) Ann. Rev. Biochem. 57, 755-

783

5. Okar, D. A., and Lange, A. J. (1999) Biofactors 10, 1-14

6. Pilkis, S. J., El-Maghrabi, R. M, McGrane, M. M., Pilkis, J., and Claus, T. H. (1981) J.

Biol. Chem. 256, 3619-3622

7. Liu, F., and Fromm, H. J. (1991) J. Biol. Chem. 266, 11774-11778

8. Liu, F., and Fromm, H. J. (1988) J. Biol. Chem. 263, 9122-9128

9. Scheffler, J. E., and Fromm, H. J. (1986) Biochemistry 25, 6659-6665

10. Choe J-Y., Poland B. W., Fromm H. J., and Honzatko R. B. (1998) Biochemistry 33,

11441-11450

11. Stone, S. R., and Fromm, H. J. (1980) Biochemistry 19, 620-625

12. Ke, H., Zhang, Y. Liang, J-Y., and Lipscomb, W. N. (1991) Proc. Natl. Acad. Sci. U.S.A.

88, 2989-2993

13. Zhang, Y., Liang, J-Y., Huang, S., and Lipscomb, W. M. (1994) J. Mol. Biol. 244, 609-

624

14. Nelson, S. W., Kurbanov, F., Honzatko, R. B. and Fromm, H, J. (2001) J. Biol. Chem.

276, 6119-6124

15. Xue, Y., Huang, S., Liang, J-Y. Zhang, Y., and Lipscomb, W. N. (1994) Proc. Natl.

19


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Acad. Sci. USA 91, 12482-12486

16. Choe, J-Y., Fromm, H. J., and Honzatko, R. B. (2000) Biochemistry 39, 8565-8574

17. Choe, J-Y., Nelson, S. W., Fromm, H. J., and Honzatko, R. B. (2003) J. Biol. Chem. 278,

16008-16014

18. Choe, J-Y., Iancu, C. V., Fromm, H. J., and Honzatko, R. B. (2003) J. Biol. Chem. 278,

16015-16020

19. Nelson, S. W., Choe, J-Y., Iancu, C. V., Honzatko, R. B., and Fromm, H. J. (2000)

Biochemistry. 39, 11100-11106

20. Wen, J., Nelson, S. W., Honzatko, R. B., Fromm, H. J., and Petrich, J. W. (2001)

Photochem. Photobiol. 74, 679-685

21. Ke, H. M., Thorpe, C. M., Seaton, B., Lipscomb, W. N., and Marcus F. (1990) J. Mol.

Biol. 212, 513-539

22. Lu, G., Stec, B., Giroux, E. L., Kantrowitz, E. R. (1996) Protein Science 5, 2333-2342

23. Choe, J-Y., Nelson, S. W, Arienti, K. L., Axe, F. U., Collins, T. L., Jones, T. K.,

Kimmich, R. D. A., Newman, M. J., Norvell, K., Ripka, W. C., Romano, S. J., Short, K.

M., Slee, D. H., Fromm, H. J., and Honzatko, R. B. (2003) J. Biol. Chem. 278, 51175-

51183

24. Laemmli, U. K. (1970) Nature 227, 680-685

25. Bradford, M. M. (1976) Anal. Biochem. 72, 248-252

26. Liu, F., and Fromm, H.J. (1990) J. Biol. Chem. 265, 7401-7406.

27. Leatherbarrow, R.J. (1987) ENZFITTER: A Non-Linear Regression Data Analysis

Program for the IBM PC, pp.13-75, Elsevier Science Publishers B.V. Amsterdam.

28. McRee, D. E. (1992) J. Mol. Graph. 10, 44-46

20


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

29. Brünger, A. T., Adams, P. D., Clore, G. M., DeLano, W. L., Gros, P., Grosse-Kunstleve,

R. W., Jiang, J.-S., Kuszewski, J., Nilges, M., Pannu, M. S., Read, R. J., Rice, L. M.,

Simonson, T., Warren, G. L. (1998) Acta Crystallogr. D 54, 905-921

30. Engh, R. A., and Huber, R. (1991) Acta Crystallog. A 47, 392-400

31. Laskowski, R. A., Mac Arthur, M. W., Moss, D. S., and Thornton, J. M. (1993) J. Appl.

Crystallogr. 26, 283-291

32. Nelson, S. W, Honzatko, R. B., and Fromm, H. J. (2002) J. Biol. Chem. 277, 15539-

15545

33. Lu, G., Giroux, E. L., and Kantrowitz, E. R. (1997) J. Biol. Chem. 272, 5076-5081

34. Cárcamo, J. G., Yañez, A. J., Ludwig, H. C., León, O., Pinto, R. O., Reyes, A. M., and

Slebe, J. C. (2000) Eur. J. Biochem. 267, 2242-2251

35. Shyur, L.-F., Aleshin, A. E., Honzatko, R. B., and Fromm, H. J. (1996) J. Biol. Chem.

271, 33301-33307

36. Shyur, L.-F., Aleshin, A. E., Honzatko, R. B., and Fromm, H. J. (1996) J. Biol. Chem.

271, 3005-3010

37. Nelson, S. W., Honzatko, R. B., and Fromm, H. J. (2001) FEBS Lett. 492, 254-258

38. Kraulis, J. (1991) J. Appl. Crystallogr. 24, 946-950

21


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Footnotes

1The abbreviations used are: FBPase, fructose-1,6-bisphosphatase; F16P2, fructose 1,6-

bisphosphate; F6P, fructose 6-phosphate; F26P2, fructose 2,6-bisphosphate; Pi, orthophosphate.

22


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Table I. Kinetic parameters for wild-type and Leu54 FBPases. Parameters are defined in the

results section.

Wild-type Leu54→Ala

Activity ratio, pH 7.5:9.5 3.5±0.5 3.9±0.4

kcat (sec-1) 20±1 11.3±0.6

KmF16P2 (µM) 1.2±0.05 0.94±0.04

A0.5 (mM) 0.84±0.04 0.14±0.03

Hill coefficient Mg2+ 1.7±0.1 2.1±0.2

I0.5 (µM) 1.23±0.04 62±1

Hill coefficient AMP 2.2±0.1 2.5±0.1

Ka (mM2) 0.78±0.2 0.087±0.005

KiAMP (µM2) 0.6±0.1 3000±200

Kb (µM) 2.4±0.4 1.2±0.1

KiF26P2 (µM) 0.23±0.04 0.38±0.04

23


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Table II. Statistics of data collection and refinement for Leu54 FBPase.

Crystalline complexa R-state IR-state T-state

Resolution limit (Å) 2.0 1.85 2.15

Number of measurements 155,545 124,926 193,057

Number of unique reflections 24,972 32,122 41,418

Completeness of data (%):

Overall 99.6 99.1 99.2

Last shell/resolution-range (Å) 96.5/2.07-2.0 91.1/1.96-1.85 98.6/2.25-2.15

Rsymb

Overall 0.066 0.035 0.049

Last shell/resolution-range (Å) 0.228/2.07-2.0 0.211/1.96-1.85

0.197/2.25-2.15

Number of reflections in refinement 22,691 29,277 37,089

Number of atoms 2,796 2,785 5,627

Number of solvent sites 176 296 510

Rfactorc 0.199 0.223 0.212

24


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Rfreed 0.242 0.266 0.261

Mean B (Å2) for protein 30 20 36

Mean B (Å2) for AMP - 38 29/34

Root mean square deviations (deg):

Bond lengths (Å) 0.006 0.005 0.005

Bond angles 1.4 1.3 1.3

Dihedral angles 22.8 22.5 22.9

Improper angles 0.78 0.75 0.72

Table I. Footnotes.

a Space group and unit cell parameters provided in the results section.

b Rsym = ΣjΣi | Iij - <Ij> | /ΣiΣjIij, where i runs over multiple observations of the same intensity, and

j runs over all crystallographically unique intensities.

c Rfactor = Σ || Fobs | - | Fcalc || /Σ | Fobs |, where | Fobs | > 0.

d Rfree based upon 10% of the data randomly culled and not used in the refinement.

.

25


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Table III. Root-mean-squared deviations between conformational states of FBPase. RCSB

identifiers 1EYK and 1CNQ represent the canonical T- and R-states, respectively. IT is the T-

like state of the OC252 complex of FBPase (PDB identifier 1Q9D). IR is the R-like state of the

AMP/product complex of Leu54 FBPase reported here. The determined angle of rotation is

sensitive to the subset of Cα atoms used in the calculation of the rotation matrix. The use of all

Cα atoms, including those of the dynamic loop, results in an angle of 18º for the R- to T-state

transition. In contrast, the use of Cα atoms that deviate by less than 1 Å in the initial

superposition gives an angle of 13º. Superpositions and root-mean squared deviations here are

based on Cα atoms from the following residues: 33-49, 75-265, and 272-330. Values in bold

typeface come from superpositions of tetramers. Other values come from superpositions of C1–

C2 dimers. The latter provide an estimate of coordinate uncertainty due to random and

systematic errors.

IR IT T

R 0.30/0.74 0.48/2.16 0.58/2.7

IR 0.43/1.54 0.48/2.09

IT 0.33/0.64

26


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Table IV. Selected donor-acceptor distances (in Å) for R-, IR- and T-states of FBPase. The

R-state and T-state structures are from the RCSB, accession labels 1CNQ and 1EYK,

respectively. The two values entered for the T-state are from the two subunits in the asymmetric

unit.

Donor–acceptor pair R-state distance IR-state distance T-state distance

Intersubunit C1–C4

Arg22 NH1 – Glu108 O 4.4 4.6 9.9/10.9

Arg22 NE – Glu108 O 4.1 5.7 -

Thr39 OG1 – Glu192 OE1 2.7 3.7 3.0/3.1

Lys42 NZ – Ile190 O 3.0 3.1 3.1/3.1

Lys42 NZ – Gly191 O 3.2 3.1 3.3/3.3

Lys42 NZ – Glu192 OE1 2.9 2.7 2.8/2.7

Thr46 OG1 – Ala189 O 3.2 3.4 2.6/2.8

Intrasubunit

Val11 O – Leu195 N 3.0 2.9 2.9/3.0

Leu13 N – Phe193 O 3.0 2.8 3.0/3.0

Thr14 OG1 – Asn35 OD1 2.5 3.5 6.0/5.2

Thr14 OG1 – Asn35 ND2 3.8 5.4 4.8/6.5

Thr14 OG1 – Glu192 OE2 5.3 4.4 3.7/3.4

Lys42 NZ – Gly191 O 2.9 2.7 3.3/3.4

AMP N6 – Thr31 OG1 - 3.5 3.3/2.7

AMP N6 – Val17 O - 2.7 3.0/2.9

27


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Figure Legends

Fig. 1. Overview of the R-like AMP/product complex of Leu54 FBPase. The four subunits of

the tetramer, labeled C1 through C4, are depicted with one molecule each of bound AMP

(allosteric pocket) and F6P (active site). Active-site bound Pi and Mg2+ and side chains

of Leu54 from subunits C1 and C3 are omitted for clarity. Residues 52–72 (dynamic

loop) and 187–195 (loop 190) are in black. The panel to the right shows electron density

covering the AMP molecule from an omit map contoured at a level of 1-σ with a cutoff

radius of 1 Å. This drawing was prepared with MOLSCIRPT (38).

Fig. 2. Quaternary states of FBPase. Various quaternary states of FBPase differ by rotations

of subunit pair C3–C4 relative to subunit pair C1–C2. Superpositions of FBPase

tetramers, using selected Cα atoms from subunit pair C1–C2, reveals significant

displacements in Cα atoms of C3–C4 subunit pairs in instances or differing quaternary

states. Depicted here are displacements in Cα carbons of β-strands of the AMP domain

of the subunit pairs C3–C4 in the IR complex (bold lines) relative to those of FBPase in

the R-state (A) and IT-state (B), and T-state (C). The magnitude and direction of subunit

rotations that transform the IR-state into the three other quaternary states of FBPase is

indicated. The Cα atoms listed in Table III are the basis for superposition of subunit pair

C1–C2. This drawing was prepared with MOLSCIRPT (38).

Fig. 3. Tertiary conformational changes between R- and IR-states. Dotted lines represent

selected donor-acceptor interactions of 3.2 Å or less. Solid green lines represent potential

non-bonded contacts of 2.5 Å or less. Panels A–C: Superposition of the IR-state subunit

(red) onto each subunit of the R-state tetramer (black) reveals tertiary conformational

changes induced by the binding of AMP and the resulting 3º subunit-pair rotation.

28


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Hydrogen bonds (dotted red lines) involving the 6-amino group of AMP and a non-

bonded contact (green line) with the side chain of Val17 induce helix movement and

shears hydrogen bonds between Thr14 and Asn35 (panel A), as well as Glu192 and Thr39

(panels A–C). In addition, the movement of helix H1 displaces Ile10 from its R-state

hydrophobic contacts (panels B and C). This drawing was prepared with MOLSCIRPT

(38). Inset: Shown are regions of the tetramer (purple) and viewing directions (bold

arrows) corresponding to panels A–C. The viewing direction for panel C is 45º inclined

to the plane of the tetramer.

Figure 4. Tertiary conformational changes between T- and IR-states. Superposition of the

IR-state subunit (red) onto each subunit of the T-state tetramer (black) reveals tertiary

conformational changes induced by the 12º subunit-pair rotation. An additional

translation of helix H2 along its axis is evident (panels A–C). The disengaged loop

(residues 52–72) covers the hydrophobic surface exposed by the displacement of Ile10

(panel C). Close contacts between loops 190 of subunits C1 and C4 and Glu192 and Lys42

(solid green lines) are relaxed by conformational changes. The conformational change in

Glu192 re-establishes its hydrogen bond with Thr39 (panels A–C). Regions of FBPase

depicted and viewing directions are as indicated in Fig. 3. This drawing was prepared

with MOLSCIRPT (38).

Fig. 5. Models of concerted and sequential conformational change. The subunits of the

FBPase tetramer are simplified to helix H2 (rectangle) and loop 190 (oval). The viewing

direction is down a molecular axis of twofold symmetry, with subunit C1 and C2 above

the plane (bold lines) and subunit C3 and C4 below the plane. In the concerted model

(left) AMP molecules bind successively in any order to the subunits of tetramer, until the

29


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

combined torque (represented by open arrows) on each subunit pair exceeds the energy

barrier that separates the R- and T-states. The binding of at least two AMP molecules is

necessary for the concerted conformational change. In the sequential model (right), the

first molecule of AMP can bind to any subunit with equal affinity, causing the outward

movement of helix H2 of only that subunit (filled arrow). If binding occurs at subunit

C1, interactions between subunit C1 and C4 are weakened. The second molecule of

AMP binds to subunit C4, because less binding energy is spent in the movement of helix

H2 in that subunit. The R- to T-state transition can occur in response to the binding of at

least two molecules of AMP. For the sequential mechanism, transition to the T-state

restores hydrogen bonds lost by the AMP-induced movements of helices H2 in the R-

state.

Fig.6. Stereoview of the proposed role of Arg22 in cooperativity of AMP inhibition. The

view is down a molecular twofold axis toward the center of the tetramer. The

superposition of the IR-state subunit (bold lines) onto subunit C1 of the R-state (fine

lines) represents possible relaxation events due to the binding of AMP to subunit C1

(top). AMP-induced conformational change in helix H1 would allow the formation of a

hydrogen bond between Arg22 (subunit C1) and backbone carbonyl 108 (subunit C4), and

stack the side chains of Arg22 and Phe89 (subunit C4). A second superposition of an IR-

state subunit (bold lines) onto subunit C4 of the R-state (fine lines) represents the

relaxation of subunit C4 to the altered conformation of AMP-bound subunit C1 (bottom).

The proposed interaction involving Arg22 (subunit C1) carries over to the symmetry-

related Arg22 (subunit C4). As a consequence, the AMP pocket of subunit C4 may adopt

30


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

a conformation that approximates the AMP-bound conformation of subunit C1, even in

the absence of AMP.

31


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Iancu et al., Fig. 1

32


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


33


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


34


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


35


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


36


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


37


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Cristina V. Iancu, Susmith Mukund, Herbert J. Fromm and Richard B. Honzatkofructose-1,6-bisphosphatase

R-state AMP complex reveals initial steps of the quaternary transition of

published online March 14, 2005J. Biol. Chem.

10.1074/jbc.M501011200Access the most updated version of this article at doi:

Alerts:

When a correction for this article is posted•

When this article is cited•

to choose from all of JBC's e-mail alertsClick here


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/lookup/doi/10.1074/jbc.M501011200

http://www.jbc.org/cgi/alerts?alertType=citedby&addAlert=cited_by&cited_by_criteria_resid=jbc;M501011200v1&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/early/2005/03/14/jbc.M501011200.citation

http://www.jbc.org/cgi/alerts?alertType=correction&addAlert=correction&correction_criteria_value=early/2005/03/14/jbc&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/early/2005/03/14/jbc.M501011200.citation

http://www.jbc.org/cgi/alerts/etoc

http://www.jbc.org/

Date post:	09-Feb-2017
Category:	Documents
Upload:	dotu
View:	218 times
Download:	2 times

Allosteric Site Communication Pathways Revealed Using Hybrid ...

Documents