+ All Categories
Home > Documents > Artistic value in scientific results, a means for science communication creative kings 10-mar-2009 ...

Artistic value in scientific results, a means for science communication creative kings 10-mar-2009 ...

Date post: 28-Mar-2015
Category:
Upload: gabriel-galloway
View: 214 times
Download: 1 times
Share this document with a friend
Popular Tags:
39
artistic value in scientific results, a means for science communication creative king’s 10-mar-2009 http://www.kcl.ac.uk/schools/pse/ bioinform/ christos.ouzounis@kcl.ac.uk QuickTime™ and a TIFF (Uncompressed) decompresso are needed to see this pictur
Transcript
Page 1: Artistic value in scientific results, a means for science communication creative kings 10-mar-2009  christos.ouzounis@kcl.ac.uk.

artistic value in scientific results,a means for science communication

creative king’s10-mar-2009

http://www.kcl.ac.uk/schools/pse/bioinform/

[email protected]™ and a

TIFF (Uncompressed) decompressorare needed to see this picture.

Page 2: Artistic value in scientific results, a means for science communication creative kings 10-mar-2009  christos.ouzounis@kcl.ac.uk.

2

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

structure

• BIOLOGY & BIOINFORMATICS• visualization & interpretation of scientific results• who are we, the centre for bioinformatics• a crash course in biology• a movie: the inner life of a cell

• CREATIVITY IN SCIENCE• creativity, definitions• importance of creativity, co-occurrence of terms• artists on science, scientists on art• science communication, good examples

• ARTISTIC VALUE IN SCIENTIFIC RESULTS• importance of science?• neurobiology of perception• genome evolution, a case study• the importance of scales, and the media

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

Page 3: Artistic value in scientific results, a means for science communication creative kings 10-mar-2009  christos.ouzounis@kcl.ac.uk.

3

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

structure

• BIOLOGY & BIOINFORMATICS• visualization & interpretation of scientific results• who are we, the centre for bioinformatics• a crash course in biology• a movie: the inner life of a cell

• CREATIVITY IN SCIENCE• creativity, definitions• importance of creativity, co-occurrence of terms• artists on science, scientists on art• science communication, good examples

• ARTISTIC VALUE IN SCIENTIFIC RESULTS• importance of science?• neurobiology of perception• genome evolution, a case study• the importance of scales, and the media

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

Page 4: Artistic value in scientific results, a means for science communication creative kings 10-mar-2009  christos.ouzounis@kcl.ac.uk.

4

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

The storage, analysis and distribution of biological information, usually at the molecular but also at the supra-molecular levels of organization

A ‘dirty’ word:• more traditionally…

• sequence analysis• structure prediction• molecular evolution

• and more to the definition…

• data engineering [storage]• computational biology

[analysis]• network services [distribution]

Overlaps with…• all the way from theoretical

biology…• …to medical informatics and any

other -matics or -omics• driving force behind genomics

what is bioinformatics?

Page 5: Artistic value in scientific results, a means for science communication creative kings 10-mar-2009  christos.ouzounis@kcl.ac.uk.

5

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

kcbiking’s college london centre for bioinformatics

structural genomics• fraternali

functional genomics• blanc

statistical genetics• schlitt

systems biology• tsoka

comparative genomics• ouzounis

http://www.kcl.ac.uk/schools/pse/bioinform/

Page 6: Artistic value in scientific results, a means for science communication creative kings 10-mar-2009  christos.ouzounis@kcl.ac.uk.

6

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

School of Physical Sciences and Engineering

Professor Christos Ouzounis

Dr Sophia Tsoka

Paul Keeling, Sr Admin Officer, strategic planning

MRC Centre for Developmental Neurobiology

Dr Eric Blanc

Randall Division of Cell and Molecular Biophysics

Dr Franca Fraternali

Department of Medical and Molecular Genetics

Dr Thomas Schlitt

Department of Computer Science

Professor Maxime Crochemore

Professor Mark Harman

Professor Costas Iliopoulos

Dr Kathleen Steinhöfel

Division of Engineering

Dr Mark Miodownik

School of Medicine

Professor Frank Nestle

Dr Rebecca Oakey

Dr Roli Roberts

Dr Reiner Schulz

Institute of Psychiatry

Professor Simon Lovestone

MRC Centre for Developmental Neurobiology

Dr David Chambers

Mathematics Department

Professor Ton Coolen

Visiting Professors

Ben Blencowe, University of Toronto

Peter D. Karp, SRI International, Benlo Park CA

Nikos Kyrpides, Joint Genome Institute, Berkeley CA

Arthur Lesk, Penn State University, University Park PA

Alfonso Valencia, CNIO Madrid, Spain

core and associate members

Page 7: Artistic value in scientific results, a means for science communication creative kings 10-mar-2009  christos.ouzounis@kcl.ac.uk.

7

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

a visual summary of our work

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

Page 8: Artistic value in scientific results, a means for science communication creative kings 10-mar-2009  christos.ouzounis@kcl.ac.uk.

8

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

the very basics

the biological hierarchy• populations• organisms• systems• organs• tissues• cell types• cells• subcellular compartments• macromolecular complexes• macromolecules• small molecules• atoms• …

http://www.ehponline.org/members/2007/10373/fig1.jpg

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

http://kentsimmons.uwinnipeg.ca/cm1504/Image48.gif

Page 9: Artistic value in scientific results, a means for science communication creative kings 10-mar-2009  christos.ouzounis@kcl.ac.uk.

9

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

from DNA to gene

measuring length:

Units of length for DNA moleculesBecause DNA is double-stranded, the lengths of molecules are described as so many base pairs (bp).A kilobase pair (kb) is 103 bp and a megabase pair (Mb) is 106 bp.A gigabase pair (Gb) is 109 Mb.

In summary:1 kb = 1000 bp1 Mb = 1000 kb = 1 000 000 bp1 Gb = 1000 Mb = 1 000 000 kb = 1 000 000 000 bp

Typically, genome sizes range from Mbs to Gbs - and they contain between 1,000 and 100,000 genes

http://www.ncbi.nlm.nih.gov/books/bv.fcgi?rid=genomes.box.5275

Page 10: Artistic value in scientific results, a means for science communication creative kings 10-mar-2009  christos.ouzounis@kcl.ac.uk.

10

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

a gene in ascii : acgt

ATGCCCGTTGCCCACGTTGCCTTGCCCGTTCCGCTTCCTCGTACCTTTGACTATCTGCTGCCAGAAGGCATGACGGTTAAAGCTGGGTGTCGCGTGCGCGTGCCGTTTGGCAAACAGCAGGAGCGCATCGGGATTGTGGTATCAGTTAGCGATGCCAGCGAACTGCCGCTCAATGAGCTAAAAGCGGTAGTCGAAGTGCTGGATAGTGAGCCGGTGTTTACTCACTCCGTCTGGCGATTGCTGCTATGGGCGGCAGATTACTATCATCATCCGATTGGCGATGTGCTGTTTCATGCCTTGCCGATTTTACTACGCCAGGGGCGGCCTGCGGCGAACGCGCCGATGTGGTACTGGTTTGCCACTGAACAAGGCCAGGCGGTGGATCTGAACAGCCTGAAACGCTCCCCCAAGCAACAACAGGCGCTGGCGGCGTTACGGCAAGGCAAAATCTGGCGCGACCAGGTCGCCACGCTCGAATTTAATGATGCCGCGTTGCAGGCGCTACGCAAAAAAGGTCTGTGTGATTTAGCAAGTGAAACACCAGAGTTTAGCGACTGGCGAACGAACTATGCCGTTTCTGGTGAGCGGTTGCGATTGAATACCGAACAGGCCACCGCCGTTGGCGCAATTCATAGCGCGGCAGATACTTTTTCTGCCTGGCTGCTGGCGGGCGTTACCGGTTCCGGTAAAACGGAGGTTTATCTCAGCGTACTGGAAAACGTGCTCGCTCAGGGCAAACAGGCGCTGGTGATGGTGCCGGAAATCGGCCTGACACCGCAAACTATCGCCCGTTTTCGTGAACGTTTTAATGCCCCCGTGGAAGTTCTGCATTCCGGCCTGAACGACAGCGAGCGTCTTTCGGCGTGGCTGAAAGCGAAAAATGGTGAGGCGGCGATTGTGATCGGCACCCGCTCCGCGCTGTTTACGCCGTTTAAAAATCTCGGCGTGATTGTCATTGATGAAGAGCACGACAGCTCCTACAAGCAGCAGGAAGGCTGGCGCTATCATGCCCGCGACCTGGCGGTGTATCGTGCGCACAGCGAGCAAATCCCGATTATTCTTGGCTCCGCAACGCCCGCGCTGGAAACGTTATGCAACGTCCAGCAGAAAAAATACCGCCTGCTGCGCCTGACCCGTCGGGCAGGGAATGCGCGTCCGGCAATTCAACATGTGCTGGATTTAAAAGGTCAGAAGGTGCAGGCAGGTCTGGCTCCGGCGTTAATCACTCGTATGCGCCAGCATTTACAGGCTGATAACCAGGTCATTCTCTTTCTTAACCGCCGTGGCTTTGCGCCTGCACTGCTGTGCCACGACTGTGGCTGGATTGCCGAATGCCCACGTTGCGATCACTACTACACGCTGCATCAGGCGCAGCACCATCTGCGCTGCCACCACTGTGACAGTCAGCGTCCGGTGCCGCGCCAGTGCCCTTCCTGCGGTTCCACGCACCTGGTCCCCGTGGGGCTGGGCACCGAACAGCTTGAACAGACGCTCGCGCCGTTGTTCCCCGGCGTGCCCATTTCTCGTATCGACCGCGATACCACCAGCCGCAAAGGGGCGCTGGAACAGCAACTGGCAGAAGTACATCGCGGCGGCGCGCGGATTTTGATTGGTACACAAATGCTGGCGAAAGGTCACCATTTCCCGGATGTGACGCTGGTTGCATTACTGGACGTGGACGGCGCGCTGTTTTCTGCCGATTTTCGCTCGGCAGAGCGTTTCGCTCAGCTTTACACCCAGGTCGCCGGTCGTGCCGGGCGTGCGGGTAAACAGGGCGAAGTGGTGCTGCAAACGCACCATCCGGAACATCCTCTGTTGCAAACGTTGCTCTATAAAGGCTACGACGCCTTTGCCGAACAGGCGCTGGCTGAGCGGCGAATGATGCAGCTACCGCCGTGGACCAGCCATGTGATTGTGCGTGCGGAAGATCATAACAATCAGCACGCGCCATTGTTCCTGCAACAACTGCGTAATCTGATCCTCTCCAGCCCACTGGCAGACGAGAAACTGTGGGTTCTCGGTCCGGTTCCGGCTCTGGCACCTAAACGTGGCGGTCGCTGGCGCTGGCAGATATTGTTGCAGCACCCTTCCCGCGTGCGCTTGCAACACATCATTAACGGTACGCTGGCGCTCATCAATACAATACCGGATTCCCGTAAGGTGAAATGGGTGCTGGATGTTGATCCGATTGAGGGTTAA

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

Page 11: Artistic value in scientific results, a means for science communication creative kings 10-mar-2009  christos.ouzounis@kcl.ac.uk.

11

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

a protein in ascii : acdefghiklmnpqrstvwy

MPVAHVALPVPLPRTFDYLLPEGMTVKAGCRVRVPFGKQQERIGIVVSVSDASELPLNELKAVVEVLDSEPVFTHSVWRLLLWAADYYHHPIGDVLFHALPILLRQGRPAANAPMWYWFATEQGQAVDLNSLKRSPKQQQALAALRQGKIWRDQVATLEFNDAALQALRKKGLCDLASETPEFSDWRTNYAVSGERLRLNTEQATAVGAIHSAADTFSAWLLAGVTGSGKTEVYLSVLENVLAQGKQALVMVPEIGLTPQTIARFRERFNAPVEVLHSGLNDSERLSAWLKAKNGEAAIVIGTRSALFTPFKNLGVIVIDEEHDSSYKQQEGWRYHARDLAVYRAHSEQIPIILGSATPALETLCNVQQKKYRLLRLTRRAGNARPAIQHVLDLKGQKVQAGLAPALITRMRQHLQADNQVILFLNRRGFAPALLCHDCGWIAECPRCDHYYTLHQAQHHLRCHHCDSQRPVPRQCPSCGSTHLVPVGLGTEQLEQTLAPLFPGVPISRIDRDTTSRKGALEQQLAEVHRGGARILIGTQMLAKGHHFPDVTLVALLDVDGALFSADFRSAERFAQLYTQVAGRAGRAGKQGEVVLQTHHPEHPLLQTLLYKGYDAFAEQALAERRMMQLPPWTSHVIVRAEDHNNQHAPLFLQQLRNLILSSPLADEKLWVLGPVPALAPKRGGRWRWQILLQHPSRVRLQHIINGTLALINTIPDSRKVKWVLDVDPIEG

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

Page 12: Artistic value in scientific results, a means for science communication creative kings 10-mar-2009  christos.ouzounis@kcl.ac.uk.

12

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

many genomes have been deciphered

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

Page 13: Artistic value in scientific results, a means for science communication creative kings 10-mar-2009  christos.ouzounis@kcl.ac.uk.

13

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

domains of lifethere are three known domains / types of cells: archaea, bacteria, eukarya

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

http://tainano.com/Molecular%20Biology%20Glossary.files/image015.gif

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

http://www.biologyreference.com/Ar-Bi/Archaea.html

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

http://www.garlandscience.com/textbooks/0815341059.asp

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

Page 14: Artistic value in scientific results, a means for science communication creative kings 10-mar-2009  christos.ouzounis@kcl.ac.uk.

14

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

genome trees

better trees are derived from whole-genome comparisons

Page 15: Artistic value in scientific results, a means for science communication creative kings 10-mar-2009  christos.ouzounis@kcl.ac.uk.

15

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

the eukarya, useukarya are very diverse !

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

http://wiki.cotch.net/upload/5/5f/Eukaryoticlife.jpg

Page 16: Artistic value in scientific results, a means for science communication creative kings 10-mar-2009  christos.ouzounis@kcl.ac.uk.

16

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

structure

• BIOLOGY & BIOINFORMATICS• visualization & interpretation of scientific results• who are we, the centre for bioinformatics• a crash course in biology• a movie: the inner life of a cell

• CREATIVITY IN SCIENCE• creativity, definitions• importance of creativity, co-occurrence of terms• artists on science, scientists on art• science communication, good examples

• ARTISTIC VALUE IN SCIENTIFIC RESULTS• importance of science?• neurobiology of perception• genome evolution, a case study• the importance of scales, and the media

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

Page 17: Artistic value in scientific results, a means for science communication creative kings 10-mar-2009  christos.ouzounis@kcl.ac.uk.

17

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

creativity

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

Page 18: Artistic value in scientific results, a means for science communication creative kings 10-mar-2009  christos.ouzounis@kcl.ac.uk.

18

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

creativity, co-occurrence terms

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

Page 19: Artistic value in scientific results, a means for science communication creative kings 10-mar-2009  christos.ouzounis@kcl.ac.uk.

19

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

creativity barometer

education role of the leader

brain innovation leadership innovation manageme

nt

intelligence depression madness mental illness

1

10

100

1000

10000

100000

25300

8610 8270

3120

481 444 421293

233 229

Page 20: Artistic value in scientific results, a means for science communication creative kings 10-mar-2009  christos.ouzounis@kcl.ac.uk.

20

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

creativity in society

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

Page 21: Artistic value in scientific results, a means for science communication creative kings 10-mar-2009  christos.ouzounis@kcl.ac.uk.

21

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

visual arts in sciences

QuickTime™ and aTIFF (Uncompressed) decompressorare needed to see this picture.

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

Page 22: Artistic value in scientific results, a means for science communication creative kings 10-mar-2009  christos.ouzounis@kcl.ac.uk.

22

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

artists on science, scientists on art

• a relevant dialogue, e.g. "Artists on science: scientists on art." Special section in Nature, 17 March 2005, pages 293-323

• distinction of “two cultures”, science & technology vs. art & poetry is somewhat outdated

• “… There is an economy of words and beauty of concept in poetry that is always found in the best science” (Garfield, 1989)• Creativity is a modern concept. Term was not coined until 1875, when it was used to refer to the poetic imagination.

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

Page 23: Artistic value in scientific results, a means for science communication creative kings 10-mar-2009  christos.ouzounis@kcl.ac.uk.

23

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

a piece of art from a famous scientist

“It may seem unusual to include Leonardo da Vinci in a list of paleontologists and evolutionary biologists. Leonardo was and is best known as an artist, the creator of such masterpieces as the Mona Lisa, Madonna of the Rocks, and The Last Supper. Yet Leonardo was far more than a great artist: he had one of the best scientific minds of his time. He made painstaking observations and carried out research in fields ranging from architecture and civil engineering to astronomy to anatomy and zoology to geography, geology and paleontology.”

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

http://www.ucmp.berkeley.edu/history/vinci.html

Page 24: Artistic value in scientific results, a means for science communication creative kings 10-mar-2009  christos.ouzounis@kcl.ac.uk.

24

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

the importance of science communication

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

http://www.auburn.edu/~mathest/nufs2000_clip_image002_0000.jpg

http://www.flickr.com/photos/rafaerts/2817098501/

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

Page 25: Artistic value in scientific results, a means for science communication creative kings 10-mar-2009  christos.ouzounis@kcl.ac.uk.

25

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

structure

• BIOLOGY & BIOINFORMATICS• visualization & interpretation of scientific results• who are we, the centre for bioinformatics• a crash course in biology• a movie: the inner life of a cell

• CREATIVITY IN SCIENCE• creativity, definitions• importance of creativity, co-occurrence of terms• artists on science, scientists on art• science communication, good examples

• ARTISTIC VALUE IN SCIENTIFIC RESULTS• importance of science?• neurobiology of perception• genome evolution, a case study• the importance of scales, and the media

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

Page 26: Artistic value in scientific results, a means for science communication creative kings 10-mar-2009  christos.ouzounis@kcl.ac.uk.

26

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

the importance of science?

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

Science pollPublished: Wednesday, 28 January 2009The public was asked what has the most impact in shaping their futures; 26% said science, putting it ahead of politics, family and religion. When asked to choose which group of people has the most effect on our daily lives, only 3% selected scientists.

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

http://sciencesowhat.direct.gov.uk/

Page 27: Artistic value in scientific results, a means for science communication creative kings 10-mar-2009  christos.ouzounis@kcl.ac.uk.

27

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

neurobiology of perception

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

Elements of perspective, shadows, transparency, reflections: all understood in terms of visual computations in our brain

Page 28: Artistic value in scientific results, a means for science communication creative kings 10-mar-2009  christos.ouzounis@kcl.ac.uk.

28

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

microphotography

http://www.nikonsmallworld.com/

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

Page 29: Artistic value in scientific results, a means for science communication creative kings 10-mar-2009  christos.ouzounis@kcl.ac.uk.

29

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

a sense of scale

Genomes 377

Genes 1,315,558

Annotations 359,482

Similarities 384,579,409

Phylogenetic profiles

181,986

Families 82,692

Interactions 2,192,019

Pathways > 25,000

Page 30: Artistic value in scientific results, a means for science communication creative kings 10-mar-2009  christos.ouzounis@kcl.ac.uk.

30

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

protein classification & similarity graphs

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

http://bioinformatics.icmb.utexas.edu/lgl/Images/scop_hie_full.jpg

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

http://bioinformatics.icmb.utexas.edu/lgl/Images/phg.jpg

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

Page 31: Artistic value in scientific results, a means for science communication creative kings 10-mar-2009  christos.ouzounis@kcl.ac.uk.

31

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

more views of the similarity graph

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

http://bioinformatics.icmb.utexas.edu/lgl/PHN/phn.large.png

Page 32: Artistic value in scientific results, a means for science communication creative kings 10-mar-2009  christos.ouzounis@kcl.ac.uk.

32

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

zooming into the unknown

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

Page 33: Artistic value in scientific results, a means for science communication creative kings 10-mar-2009  christos.ouzounis@kcl.ac.uk.

33

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

a sense of scale

Genomes 377

Genes 1,315,558

Annotations 359,482

Similarities 384,579,409

Phylogenetic profiles

181,986

Families 82,692

Interactions 2,192,019

Pathways > 25,000

Page 34: Artistic value in scientific results, a means for science communication creative kings 10-mar-2009  christos.ouzounis@kcl.ac.uk.

34

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

ancestral gene content

Page 35: Artistic value in scientific results, a means for science communication creative kings 10-mar-2009  christos.ouzounis@kcl.ac.uk.

35

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

1708

Page 36: Artistic value in scientific results, a means for science communication creative kings 10-mar-2009  christos.ouzounis@kcl.ac.uk.

36

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

Gene content reconstruction: ancestral states

Both current and ancient genomes• HGT events on

tree

The enigmatic yellow sphere is the universal ancestor

Featured in Wired, Discover etc.

network of life

Page 37: Artistic value in scientific results, a means for science communication creative kings 10-mar-2009  christos.ouzounis@kcl.ac.uk.

37

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

Page 38: Artistic value in scientific results, a means for science communication creative kings 10-mar-2009  christos.ouzounis@kcl.ac.uk.

38

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

net of life, the movie

http://www.nature.com/embor/journal/v8/n10/full/7401074.html

Page 39: Artistic value in scientific results, a means for science communication creative kings 10-mar-2009  christos.ouzounis@kcl.ac.uk.

39

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

the importance of scales, and the media• for artists, other scales do not provide typical material• there is a beauty in the microcosm, stunning views that need to be captured

• stunning representations of complex phenomena with artistic value• inaccessible in their usual form to wider communities

• including other scientists, artists and the general public

• these representations (“results”) are abstract notions• they do not correspond to the physical world• they do, however, provide the means for effective science communication

with the appropriate use of media and inter-disciplinary collaborations

• results of complex analyses can have both artistic content and scientific accuracy


Recommended