59
ASSESSMENT OF BIODIESEL PRODUCTION
POTENTIAL OF MICROALGAE COLLECTED FROM
THE BACKWATERS OF KERALA
BACK TO LAB PROGRAMME FOR WOMEN SCIENTISTS
(Sanction No. 1014/2013/KCSTE dated 23/10/2013)
Final Technical Report (26-10-2013 to 25-10-2016)
Submitted To
WOMEN SCIENTISTS DIVISION KERALA STATE COUNCIL FOR SCIENCE, TECHNOLOGY AND ENVIRONMENT
GOVERNMENT OF KERALA
By
Dr. Manju Mary Joseph
Department of Chemical Oceanography
School of Marine Sciences
Cochin University of Science & Technology
June 2017
2 | P a g e
AUTHORIZATION
The work entitled “Assessment of Biodiesel Production Potential of Microalgae Collected
from the Backwaters of Kerala” by Dr. Manju Mary Joseph was carried out under the “Back
to lab programme” of Women Scientists Division, Kerala State Council for Science
Technology and Environment, Govt. of Kerala. The work was carried out at the Department
of Chemical Oceanography, School of Marine Sciences, Cochin University of Science &
Technology, Fine Arts Avenue, Kochi, Kerala - 682 016. The project was initiated wide
Sanction No. 1014/2013/KCSTE dated 23/10/2013, with scheduled completion by 25/10/2016.
The field and laboratory works were completed by October 2016, however an additional
period of 6 month was taken by the Principal Investigator (without additional financial
commitments) for compilation of results and preparation of the final report. The final report
was submitted by June 2017 and the total financial expenditure of project was Rs. 17, 76,360.
3 | P a g e
ACKNOWLEDGMENTS I am deeply indebted to Kerala State Council for Science, Technology and
Environment (KSCSTE) for the financial support through “Back to Lab program for
Women” which gave me an invaluable opportunity to come back to the main-
stream research. I am very much grateful to Dr. K.R. Lekha, Head, Women
Scientists Division for the encouragement and support throughout the tenure of
the project.
I am highly obliged to Dr. S. Muraleedharan Nair, Scientist mentor,
Department of Chemical Oceanography, School of Marine Sciences, Cochin
University of Science & Technology (CUSAT) for giving consent to become the
mentor of the Project and for advising and supporting me throughout the course of
the project work. I am grateful to the Registrar, CUSAT and the Director, School of
Marine Sciences for providing me necessary facilities and logistical support for
carrying out the field work as well as laboratory experiments during the course of
the project.
I am greatly indebted to Dr. N. Chandramohanakumar, my Ph.D. guide and
Co-mentor of the Project for the immense help in writing and implementation of the
project. I express my heartfelt gratitude to Dr. C. H. Sujatha, Professor,
Department of Chemical Oceanography for the excellent support and
encouragement.
I am indebted to Dr. A.V. Saramma, Department of Marine Biology,
Microbiology and Biochemistry, CUSAT for permitting me to utilise the laboratory
facilities and providing me an excellent working atmosphere. I am grateful to Ms.
Gaby John, M.Phil. Student for all the timely helps in identification and culturing
of microalgae. I also acknowledge the helps rendered by Ms. Vijayalakshmi,
Research Scholar, Department of Marine Biology, Microbiology and Biochemistry,
CUSAT for the identification of microalgae.
I am cordially obliged to The Principal, Maharaja’s College Ernakulam for the
permission to utilise the facilities in the Botany Department for the culture of
microalgae. I am grateful to Dr. Shyam Kumar S., Assistant Professor, Maharaja’s
College, Ernakulam for helping me in identification and culturing of microalgae.
I owe my heartfelt thanks to my colleagues in the Department of Chemical
Oceanography Dr. Byju K., Dr. Prasobh Peter K.J., Dr. Salas P., Ms. Saritha S. for
the help rendered in every possible way. I am grateful to Dr. Shaiju P., Technical
Assistant and all the other non-teaching staff of Department of Chemical
Oceanography for their kind cooperation.
Words are insufficient to convey my gratefulness for the prayers and
encouragement of my family during the entire course of this research programme.
Manju Mary Joseph
4 | P a g e
CONTENTS
No. Title Page No.
1. ABSTRACT 5
2. INTRODUCTION AND REVIEW OF LITERATURE 6
3. OBJECTIVES OF THE STUDY 13
4. MATERIALS AND METHODS 15
5. RESULTS AND DISCUSSION 23
6. SUMMARY 44
7. OUTCOMES OF THE PROJECT 47
8. SCOPE OF FUTURE WORK 49
9. BIBLIOGRAPHY 50
5 | P a g e
ABSTRACT
Environmental and energy security concerns are forcing the world as a whole to shift
from petroleum based fuels to alternative energy in the form of biofuels, especially bio-
diesel. Biodiesel is mono alkyl ester of fatty acids, made by the trans-esterification of oils
or fats, from plants or animals. Microalgae, the third generation biodiesel feedstock, have
recently received a lot of attention on the merit that they do not compete with agricultural
land and fresh water supplies. Moreover, the lipid content of algae, specifically its fatty
acids, has the potential to compensate for a future decline in crude oil production.
Selection of locally dominant high lipid microalgae is an important prerequisite to
domesticate and develop cost effective biodiesel production. The main objective of this
study was to investigate the potential of locally abundant strains as feedstock for biodiesel
production using growth kinetic parameters and fatty acid profiles. For standardisation and
optimisation of the methodology, five diatom strains were cultured and screened for
Growth Kinetic Parameters (biomass productivity, lipid content and volumetric lipid
productivity) and fatty acid profile. Among the five diatom strains under study, Navicula
sp. and Thalassiosira sp. were found to be the most promising diatom strains for biodiesel
production, whereas Nitzschia sp. was found inferior as a biodiesel feedstock. The study
confirmed that the biomass productivity and the lipid productivity are the best suitable
indicators to screen the biodiesel production potential of microalgae. The study also
reiterates that the FAME profiles are significant and quick method to assess biodiesel
properties for selecting suitable algal strains. AHP (Analytic Hierarchy Process) analysis
was found to be very effective multi-crietria decision tool to identify the promising
microalgal strains for biodiesel production. Five genus of microalgal samples were
isolated from local water bodies and screened for biodiesel potential on the basis of FAME
profiles and growth kinetic parameters. The study found that the potent algal strain for
biodiesel feedstock can be prioritised as T. weissflongii > Ocsillatoria sp. > L. undulatum
> D. communis > N. oceanica.. Comparatively higher biomass as well as lipid
productivity noticed in all the isolated algae suggested that significant increase in biomass
and lipid productivity could be achieved through open culture than controlled lab culture.
The study also recommended that locally isolated microalgae hold great potential as
feedstock for large scale biodiesel production provided the lipid as well as biomass
production are augmented through biochemical and genetic engineering approaches.
6 | P a g e
1. INTRODUCTION
The increasing industrialization and modernization of the world has led to a steep rise
for the demand of petroleum products. Economic development in developing countries has
led to huge increase in the energy demand. In India, the energy demand is increasing at a rate
of 6.5% per annum. The crude oil demand of the country is met by import of about 80%. In
fact, India is ranked as the fourth largest consumer of energy, especially of crude petroleum
and products (US EIA, 2016). Thus the energy security has become a key issue for the nation
as a whole. Petroleum-based fuels are limited and the finite reserves are highly concentrated
in certain regions of the world. Therefore, those countries not having petroleum reserves are
necessary to look forward for alternative fuels, which can be produced from feedstock
available within the country.
In addition, burning petroleum fuels have raised numerous environmental concerns,
including Green House Gas (GHG) effects which significantly contribute towards global
warming (Gavrilescu and Chisti, 2005). Since vehicular emissions are responsible for 60% of
the GHG (Tedoy, 2008), 190 million registered motor vehicles by 2015 in India should also
have substantial detrimental impact on the environment. The transport sector is the second
largest contributor to GHG emission in India, which currently is the fourth largest emitter in
the world (MoEF, 2010). Over past few years, climate change has become one of the main
concerns in driving energy policy. More than 150 countries, including India, have committed
themselves under the United Nations Framework Convention on Climate Change (UNFCC)
to formulate and implement mitigation and adaptation measures to climate change. Evidently,
India’s energy security and environmental sustainability would remain vulnerable until
alternative fuels based on indigenously produced renewable feedstock are developed to
substitute or supplement petro-based fuels (Government of India, 2008).
A number of alternative energy options coupled with various initiatives towards
energy efficiency improvement and energy conservation are being promoted in India to deal
with an impending crisis. India’s Comprehensive National Policy on Biofuels formulated by
the Ministry of New and Renewable Energy (MNRE) is driven by the fact that biofuels can
increasingly satisfy the country’s growing energy needs in an environmentally benign and
cost effective manner; reducing dependence on import of fossil fuels and thereby providing a
higher degree of energy security.
7 | P a g e
1.1 Biodiesel
Environmental and energy security concerns are forcing the world as a whole to shift
from fossil fuels to alternatives in the form of bio-ethanol, bio-diesel, etc. One of the
promising alternatives is biodiesel, which is considered as green energy that has attracted vast
interest from researchers, governments, and local and international traders. Biodiesel is mono
alkyl ester of fatty acids, made by the trans-esterification of oils or fats, from plants or
animals. The major advantages of biodiesel when compared to petroleum derived fuels are
that it is carbon neutral-no net accumulation of CO2 in the atmosphere, is non-toxic, contains
no sulfur and is highly biodegradable (Demirbas, 2009).
The first generation biodiesel feedstocks are edible vegetable oils such as soybean,
rapeseed, sunflower and palm oil. However, the use of edible oils as energy source has raised
a lot of objections from social point of view because it is a threat to food security as they
compete for scarce land area with food crops, especially in many developing countries
(Johansson and Azar, 2007). Thus, second generation biodiesel derived from non-edible oils
such as Jatropha curcas L. appear as an attractive alternative feedstock for the biodiesel
industry. Even though Jatropha trees grow easily on non-arable or wasteland, it demands
regular irrigation, heavy fertilization and good management practices to ensure high oil yield
(Lam et al., 2009). Food and energy security are among the most important concerns of every
government in the world especially in developing countries like India. Therefore food and
fuel production have to be sustainable, and does not compete each other for land and fresh
water supplies, and in turn does not raise crucial sustainability issues. Due to these problems,
the search for a more sustainable biodiesel feedstock continues and now focuses on
microalgae.
Microalgae are third generation biodiesel feedstock, have recently received a lot of
attention because of the unique features of some algal species, i.e., superior to land plants due
to its microscopic nature, faster growth rate, higher biomass and oil productivities, capacity to
live in diverse ecological habitats, simple life cycle and zero competition with land and food
(Li et al., 2008). The lipid content of algae, specifically its fatty acids, has the potential to
compensate for a future decline in crude oil production (Chisti, 2007; Hu et al., 2008).
Microalgae synthesise and accumulate substantial amounts of neutral lipids, which are in turn
potentially convertible to more usable liquid fuels-most attractive route among them is the
transesterification of the triacyl glycerols (TAG) to algal biodiesel. Despite these advantages,
8 | P a g e
the cost for microalgal biomass production is currently much higher than from other energy
crops (Chisti, 2007).
At present, bio-fuel production is minimal, accounting only for one percent of global
fuel production. Biodiesel is produced currently from plant and animal oils on a commercial
scale, but not from microalgae. In the United States, biodiesel is produced mainly from
soybeans. Other sources of commercial biodiesel include canola oil, animal fat, palm oil, corn
oil, waste cooking oil (Felizardo et al., 2006; Kulkarni and Dalai, 2006), and Jatropha oil
(Barnwal and Sharma, 2005). In Malaysia, palm oil has been the major raw material for
biodiesel production; however, the supply of palm oil is not sufficient to meet the demand.
Policy support, technological breakthroughs, and cost-effective feedstock production, are
some measures that will help augment biodiesel production. Hence it is imperative to develop
an energy and cost-efficient production model that could play a vital role in achieving
competitive biodiesel production.
2. REVIEW OF LITERATURE
Microalgae for biodiesel is internationally accepted as the environmental friendly
feedstock for green energy option and has been researched the most (Chisti, 1980-81; Nagle
and Lemke, 1990; Sawayama et al., 1995; Knothe et al., 1997; Sheehan et al., 1998; Fukuda
et al., 2001; Barnwal and Sharma, 2005; Demirbas, 2005; Van Gerpen, 2005; Felizardo et al.,
2006; Kulkarni and Dalai, 2006; Meher et al., 2006; Chisti, 2008a; Chisti, 2008b; Mulbry et
al., 2008; Chiu et al., 2009; Liu et al., 2008; Li et al., 2008; Meng et al., 2009; Rodolfi et al.,
2009). Current biodiesel production from microalgae is in the research phase, but is being
developed to commercial scale in many countries.
Microalgae are recognized as one of the oldest living photosynthetic microorganisms
on Earth (Song et al., 2008). Compared to terrestrial plants, microalgae have superior
photosynthetic efficiency due to their simple structure. They grow at an exceptional fast rate;
100 times faster than terrestrial plants and they can double their biomass in less than one day
(Tredici, 2010). Roughly, microalgae can convert 6% of the total incident radiation in to new
biomass where as sugar cane, one among the most productive terrestrial crops, has a
photosynthetic efficiency of 3.5 to 4%. According to a recent study reported in the literature,
a realistic value of microalgae biomass production lies between 15 and 25 tonne/ha/year.
About 50% of this microalgal biomass is dominated by lipids and in which much of this as
triacyl glycerides (TAGs), the starting material for biodiesel fuels (Chisti, 2007). With an
9 | P a g e
assumption of 30% lipid content in microalgae cells (without optimizing the growth
condition), this is equivalent to a lipid production of 4.5–7.5 tonne/ha/year (Tsukahara and
Sawayama, 2005). This amount is higher compared to the production of oil from soybean
(0.4 tonne/ha/year), rapeseed (0.68 tonne/ha/year), oil palm (3.62 tonne/ha/year) and jatropha
(4.14 tonne/ha/year) (Chisti, 2007; Lam and Lee, 2011). In other words, culturing microalgae
for biodiesel production requires the least land area and holds an important key feature for
effective land utilization. The four most abundant classes of micro algae are diatoms
(Bacillariophyceae), green algae (Chlorophyceae), blue-green algae (Cyanophyceae), and
golden algae (Chrysophyceae).
The oil content of microalgae was found to range from 16 to 68% dry weight (Chisti,
2007). In some extreme cases, it can reach 70%–90% of dry weight, for instance, freshwater
green alga Botryococcus braunii can produce oil up to 86% of its dry cell weight (Brown et
al., 1969). Lipid productivity can be dramatically increased by external application of stress
factors and is considered a survival strategy for microalgae under adverse conditions (Li et
al., 2008; Hsieh and Wu, 2009). For instance, some microalgae can accumulate storage lipids
(triglycerides) up to 70% dry weight under nitrogen-starvation (Roessler, 1990). But it has
the major disadvantage of slow growth rates and a low tolerance for contamination.
Nannochloropsis sp., Chlorella, Tetraselmis sp., Pavlova sp., Isochrysis sp., and
Scenedesmus sp. are considered as possible candidates for biodiesel production due to their
lipid productivity/lipid content (Chisti, 2007; Li et al., 2008; Rodolfi et al., 2009; Huerlimann
et al., 2010). When grown under heterotrophic condition on glucose, Chlorella
protothecoides produces a crude lipid content of 55.2% dry weight (Xu et al., 2006). The
biodiesel produced by this alga has been shown to be of high quality, with high heating value
and viscosity. Both Chorella sp. and Navicula sp. grown under sea water conditions were
identified as promising biodiesel feedstocks based on FAME profile and growth parameters
(Matsumoto et al., 2009). Among the five isolated fresh water microalgae, S. obliquus YSR01
was identified as possible candidate species for producing oils for biodiesel, based on its high
lipid and oleic acid contents (Abou-Shanab et al., 2011). Dunaliella tertiolecta was
considered as suitable feedstock for biofuel production due to the dominance of Methyl
linolenate and methyl palmitate in its FAME profile (Tang et al., 2011). Six microalgal
isolates of southern Pakistan were screened for biodiesel production and found that
Scenedesmus acuminatus contains the highest oil content among all six microalgal strains,
whereas Oscillatoria sp. showed highest biomass productivity (Musharraf et al., 2012). Five
10 | P a g e
freshwater microalgae strains of the family Scenedesmaceae were examined for biodiesel
potential before and after nitrogen limitation and found that Scenedesmus incrassatulus
before N-limitation and Desmodesmus pleiomorphus as well as Desmodesmus spinosus after
N-limitation met almost all the estimated fuel properties of biodiesel standard (Valdez-
Ojeda et al., 2015).
Though some of the countries have already advocated algal feedstock and have started
research on large projects on algal biodiesel, still it has not yet been initiated properly in
India. The focus has not been shifted to the third generation biofuel; as ethanol is currently
produced from molasses and biodiesel from jatropha, the arable land feed stocks. Press
reports reveal that at present, 23 road vehicles are running on bio-diesel and petro-diesel
mixture on a trial basis at the Railways' bio-diesel manufacturing plant at Perambur, near
Chennai. Two meter-gauge train, two Diesel Electrical Multiple Unit (DMEU) trains and one
broad-gauge train have been powered with the mixture. High speed diesel (HSD) blended
with bio-diesel has been available at select outlets around the country. The first biodiesel
locomotive powered by B5 (5% biodiesel mixed with 95% diesel) operated in Tiruchi. The
Palakkad Division of Southern Railway has introduced a biodiesel blending and dispensing
facility at its Railway Consumer Depots at Palakkad in partnership with Indian Oil
Corporation Ltd., where High Speed Diesel would be mixed with biodiesel up to five per cent
before being used in diesel locomotives.
Mohan et al., (2010) have demonstrated mass cultivation of fresh water micro algae
and reported an effective harvesting method. 10 different microalgae collected from various
locations of Tamilnadu were evaluated for lipid contents using Nile red and Bodipy staining
and found that Chlorella vulgaris showed more lipid content than other microalgae by
Bodipy staining (Elumalai et al., 2011). Pankaj Kumar et al., (2011) collected six naturally
occurring algal biomass (one blue-green alga Tolypothryx and five green algae Pithophora,
Spirogyra, Hydrodictyon, Rhizoclonium and Cladophora) from different localities of north
India. Higher percentage of methyl palmitate, methyl stearate, methyloleate and methyl
linoleate were obtained from them and the physico-chemical properties of algal oil met all the
properties given by American society for testing and materials (ASTM) D6751, ISO 15607
and EN14214- Europe. Six species of microalgae belonging to the Chlorophyta, isolated from
freshwater bodies in Assam were screened for fatty acid profile and suggested that it is
important to characterize the fatty acid profile when proposing the utility or potential of
microalgal lipids as a biodiesel feedstock. These six freshwater microalgae were dominated
11 | P a g e
by Palmitic, oleic, linoleic and linolenic acids and enhanced percentages of total saturated
and monounsaturated fatty acids with a concomitant decrease in polyunsaturated fatty acid
content upon the prolonged cultivation of both microalgae were observed (Kaur et al., 2012).
Mandal and Mallik (2012) examined Biodiesel production with Scenedesmus obliquus in a
recirculatory aquaculture system with fish pond discharge and poultry litter to couple with
waste treatment and found that projected lipid productivity was 14,400 litre ha−1
year−1
was
projected with 11 cultivation cycles per year. The fuel properties of the biodiesel produced
adhered to Indian and international standards. Jena et al., (2012) screened three brackish
water microalgal strains (Chlorococcum sp., Chlorella sp. and Scenedesmus sp.) of Odisha
coast for the suitability for biodiesel production. Among all, Scenedesmus sp. seems to be the
best one for high lipid productivity with high biomass yield. The study suggested that
Scenedesmus sp. is appropriate for bio-diesel production for its high lipid content and
recommended this strain for higher scale studies. Eleven heterocystous cyanobacterial strains
from rice field and fresh water ponds of Tamilnadu were screened for biodiesel production
potential based on growth kinetic parameters and fatty acid profile and found that the isolate
Anabaena sphaerica MBDU 105 is the most promising biodiesel feed Stock (Anahas and
Muralitharan, 2015).
Bhavnagar based research institute Central Salt and Marine Chemicals Research
Institute (CSMCRI) received the US patent to manufacture the jatropha-based bio-diesel on a
larger scale and they also successfully tested biodiesel obtained from the microalgal biomass
generated in solar salt pans. As per the officials, though no problems were reported with
regard to the quality of the fuel, its commercial viability is still to be nailed down. Apart from
these scientific organisations, private agencies like Abellon Clean Energy, Ahmadabad are
also focussing on clean energy generation through bioenergy that lower greenhouse gas
emissions and productively harness the abundant energy of the sun. They successfully
developed dual operating pilot scale bio-reactor system for comparative simulation studies on
algal cultivation.
Current oil crises and fast depleting fossil oil reserves along with the increasing
environmental concern have made it more imperative for different agencies and countries to
invest more time and efforts into research on such suitable renewable feedstock.
12 | P a g e
NEED FOR THE STUDY
India’s Comprehensive National Policy on Biofuels formulated by the Ministry of
New and Renewable Energy (MNRE) is driven by the fact that biofuels can increasingly
satisfy the country’s growing energy needs in an environmentally benign and cost effective
manner; reducing dependence on import of fossil fuels and thereby providing a higher degree
of energy security. The ambitious ‘Ethanol Blending Programme’ (EBP) by Ministry of
Petroleum & Natural Gas (MoPNG) introduced in 2003 failed to succeed primarily because
of the reason that the bio-ethanol production in India is mainly from molasses, a by-product
of the sugar industry. Lower availability of sugar molasses and subsequent higher molasses
prices make the bioethanol production highly unsustainable. More than 6.3 billion litres of
ethanol would be required to meet the national biofuel policy’s target of blending at least
20% biofuels with diesel and petrol by 2017. Since sugarcane is highly water intensive
agriculture land based crop, it is highly unsustainable to extend area beyond a limit (Shinoj et
al., 2011).
Concurrently, the National Mission on Biodiesel, following the recommendations of
the Planning Commission of India, identified Jatropha curcas as the most suitable non-edible
tree-borne oilseed for biodiesel production. Initially a demonstration phase was started during
2003-2007 for feasibility and technology development using jatropha feedstock for biodiesel.
Proclaimed as “Wonder Plant” with the ability to grow and yield on arid lands with no
additional requirements such as fertilization and regular irrigation, Jatropha was planted in
several thousand hectares of arid land. But it was realised that Jatropha needed heavy
fertilization, regular irrigation and good management to ensure high oil yield (Lam et al.,
2009). Thus India’s production of biodiesel from jatropha seeds was commercially negligible
and economically unviable and impeded the progress of the national biodiesel mission.
Besides, there are about twenty large capacity plants in India that produce biodiesel
from alternative feed stocks such as edible oil, waste oil, animal fat and inedible oils.
Attempts were also made to make use of plant based feed stocks such as seeds of pongamia
(Ponagamia Pinnata), neem (Azadirachta indica), kusum (Achleichera oleosa) and mahuma
(Madhuca longifolia). But these modest attempts fail to achieve any level of commercial
scalability and production. While India does not currently maintain a specific mandate for
biodiesel production, more dedicated efforts are indispensable to focus on non-edible; non-
land based alternative feedstocks which does not compete with agricultural land and fresh
water supplies.
13 | P a g e
Although there is a great potential for biodiesel generation from microalgae, the cost
for microalgal biomass production is currently much higher than from other energy crops
(Chisti, 2007). Thus, selection of an energy and cost-efficient production model could play a
very important role in achieving competitive biodiesel production. This includes the selection
of high lipid-producing algae, suitable farming locations, efficient cultivation and harvesting
methods and oil extraction procedures (Duong et al., 2012). The selection of strains is a prime
important area of algal biodiesel research. Successful commercial algal growth will require
the development of strains and conditions for culture that allow rapid production of biomass
with high lipid content, suitable fatty acid profile and minimal growth of competing strains.
The lipid content of the algae has the largest influence on the ultimate cost of the produced
biofuel (Davis et al., 2011) and the fuel characteristics such as ignition quality, cold-flow
properties, and oxidative stability are determined by the structure of the fatty acids. Although
many microalgae species have been identified and isolated for lipid production, there is
currently no consensus as to which species provide the highest productivity. Different species
are expected to function best at different aquatic, geographical and climatic conditions
(Duong et al., 2012).
The fatty acid composition can widely vary both quantitatively and qualitatively with
the microalgae’s physiological status and the environmental conditions (Hu et al., 2008;
Rodolfi et al., 2009). Moreover, these information are very limited at present and most of the
analyses have used total lipid content rather than the examination of individual of fatty acid
composition (Hu et al., 2008). These knowledge gaps clearly indicate the need for more
research on lipid content, fatty acid profile and growth rate of microalgae for cheap and
sustainable biodiesel production.
3. OBJECTIVES OF THE STUDY
Selection of locally dominant high lipid microalgae is an important prerequisite to
domesticate and develop cost effective biodiesel production. Lipid content and fatty acid
composition of algal biomass and their dominance varies significantly in different
environmental condition (Barman et al., 2012). Kerala State is blessed with an expansive
body of brackish waters, the different sectors of which are variously referred to as
backwaters, lakes, lagoons and estuaries including mangrove and swamps. Cochin
backwaters, a part of Vembanad Lake (a Ramsar Site) is selected for the study (09° 00’ -10 °
40’ N and 76° 00’ -77° 30’ E). It is the largest among 30 estuaries of Kerala, stretches to
about 24000 ha in area and contributes to about 50 percent of the total area of estuaries in the
14 | P a g e
state. Cochin backwaters is a tropical micro-tidal estuary with high biological production and
well known for its rich biodiversity (Qasim, 2003). The main objective of the work is to
isolate a few locally available algal species that could be economically cultured to have the
potential to serve as a future biofuel.
The proposed objectives are
1. To collect microalgae species from different salinity gradients of Cochin estuary and
to identify them.
2. To assess the physico-chemical characteristics of the natural environment by
collecting and analysing the water samples.
3. To culture the identified microalgae by replicating the natural environmental
conditions and stress conditions.
4. To extract the algal oil from the collected algae and analyse the total lipids and fatty
acid profile.
5. To recover and quantify glycerol, the by-product of transesterification.
6. To optimize the conditions for sustained microalgal biomass, and also to optimize
suitable stress conditions for lipid production by microalgal biomass.
15 | P a g e
4. MATERIALS AND METHODS
4.1 Culture Cultivation
Five diatom strains (Chaetoceros calcitrans, Thalassiosira sp., Skeletonema sp.,
Navicula sp., Nitzschia sp.) were obtained from Central Marine Fisheries Research Institute,
Kochi, India. The diatoms were grown in f/2 Medium, an enriched seawater medium
designed for growing marine algae especially diatoms (Guillard and Ryther, 1962). The algae
were cultured in triplicates in 1.5 L working volumes in 2 L Erlenmeyer flasks. The initial
inoculum concentrations were about 2x104 to 3x10
4 cells/ml. The diatom cultures were
illuminated through a 40 watt/m2 fluorescent light for 24 hours continuously. Initial pH and
salinity of the culture mediums were 8.0 and 30 ppt respectively. The cultures were
maintained at the room temperature. Diatoms were harvested at stationary phase by
centrifugation of 3000 rpm for 30 minutes. After that, samples were freeze dried and stored at
-20ºC until analysis.
16 | P a g e
Figure 1Culture of microalgae
4.2 Microalgae collection from local environment, isolation and culture cultivation
Microalgae were collected from both estuary and fresh water habitats. Water samples
for microalgae isolation were collected aseptically from sites that appeared to contain algal
growth in Cochin Back waters (Fig. 3). Samples were collected by filtering the water through
a 20µ net. The residue was washed into a bottle containing 10 ml of filtered water of the
particular station. The bottles were transferred to the laboratory for further culture. The
mediums were prepared using the collected water from the sampling site. Microalgae were
grown in 250 mL Erlenmeyer flasks containing different mediums specific for different
genus: (f/2 medium for diatoms (Guillard and Ryther,1962), Walne’s medium for marine
microalgae (Walne, 1970) and BG11 medium for fresh water microalgae (Allen and Stainer,
1968)). Microalgae were isolated by using serial dilution and streak plating methods
(Andersen, 2005). Compound microscope (BX60; Olympus Corp., Lake Success, NY) was
used for preliminary observation, while Nikon TE-2000E microscope (Melville, NY) was
used for detailed examination and imaging. For mass culture, the isolated algae were cultured
in triplicates in 4 L working volumes in 5 L Erlenmeyer flasks using specific mediums for
17 | P a g e
different genus as already mentioned above. In case of all the isolated microalgae, open
culture (depending solely on natural conditions) was executed instead of continuous artificial
illumination. The cultures were maintained at the ambient temperature. Salinity of the culture
mediums was 2ppt for fresh water microalgae and 28-30 ppt for marine algae. Microalgae
were harvested at stationary phase by centrifugation of 3000 rpm for 30 minutes. After that,
samples were freeze dried and stored at -20ºC until analysis.
Figure 2 Streaking of isolated microalgae
4.3 DNA Extraction and Molecular Identification of Algal Samples
Genomic DNA was isolated from the algal samples using Sigma Aldrich DNA
Extraction KIT. DNA was quantified using spectrophotometer at 260 and 280 nm. Only
DNAs with absorbance ratios (A260:A280 nm) greater than 1.8 were used for the present study.
Tuf A gene fragment was amplified by PCR from algal genomic DNA using tuf A-PCR
universal primers: Forward Primer: tuf A F: GGNGCNGCNCAAATGGAYGG and
Reverse Primer: tuf A R: CCTTCNCGAATMGCRAANCGC. PCR products were
separated by electrophoresis. Commercially available 100bp ladder was used as standard
molecular weight of DNA. Amplified PCR product was purified using column
purification and further used for sequencing reaction. The concentration of the purified
DNA was determined and was subjected to automated DNA sequencing on ABI3730xl
Genetic Analyzer (Applied Biosystems, USA). The concentration of the purified DNA
was determined and was subjected to automated DNA sequencing on ABI3730xl
Genetic Analyzer (Applied Biosystems, USA). Similarity to the sequences was analysed
18 | P a g e
by BLAST algorithm in the NCBI (National Centre for Biotechnology Information)
GenBank (www.ncbi.nlm.nih.gov), DNA database for identifying the plant sample.
Figure 3 Cochin Backwaters with the sampling locations
4.4 Assessment of Growth kinetic parameters and Biochemical composition
Growth kinetic parameters (biomass productivity, total lipid content and volumetric
lipid productivity) were obtained in triplicates for the tested diatom strains during the
cultivation period. Biomass productivity (Pdwt) was measured as the dry biomass produced (in
milligrams per liter per day) during the stationary growth phase by harvesting the cells by
centrifugation for 10 minutes at 3000 rpm at 4°C. The cell pellets were washed with distilled
water, lyophilized at -40°C for 48 h and their dry weights were determined gravimetrically
(Griffiths and Harrison, 2009). Total lipid content (Lc) was extracted using
chloroform/methanol (Folch et al., 1957), reported as percentage of the total biomass (% dry
weight). Volumetric lipid productivity (Lp) was calculated following the equation Lp = Pdwt ×
Lc and expressed as milligrams per liter per day (Liu et al., 2011). Annual biomass and lipid
production yield for the isolated microalgae were calculated as tonne/hectare per year.
Colorimetric methods were employed for the determination of biochemical compounds
19 | P a g e
includes proteins and carbohydrates. Proteins (PRT) analyses were carried out following the
procedure of Lowry et al., (1951), with albumin as the standard. Total carbohydrates (CHO)
were analysed according to Dubois et al., (1956), using glucose as the standard.
4.5 Lipid Extraction and Trans-esterification
Lipid extraction was done by the method of Folch et al., (1957). A known quantity
(~1g) of freeze dried biomass was extracted using 20 ml/g chloroform: methanol (2:1). The
extraction was repeated until the biomass was decolorized completely. The extract was
filtered through Whatman No. 1 filter paper and washed with 0.9% NaCl solution (4 ml for
20 ml). After vortexing 2 minutes, allowed to separate the two layers and the lower lipid layer
was transferred carefully. The pooled extracts were passed through anhydrous sodium sulfate
and stored in a pre-weighed glass vial. Solvents were removed by rotary evaporation (Buchi
Rotovapor, Buchi, India). Lipids were quantified gravimetrically and the lipid content was
expressed as percentage on dry weight basis.
Trans-esterification of lipids into Fatty Acid Methyl Esters (FAME) was carried out
according to Christie (1982) with minor modifications. The dried lipid (50 mg) extract was
added to 15 mL of 2% H2SO4 in methanol and refluxed for about 4 hours. After the
completion of the reaction, the contents were transferred to a separating funnel and 25 ml
0.9% NaCl was added to it. The aqueous layer was extracted with hexane (25 ml each) and
pooled the hexane layer. The extract was dried over anhydrous Na2SO4 and concentrated by
rotary evaporation.
4.6 Gas chromatography analysis of FAMEs
The analysis of FAMEs was performed using gas chromatograph (Agilent,
GC/6890N) equipped with flame ionization detector (FID). FAMEs were separated with a
HP-88 capillary column (30 m length, 0.25 mm internal diameter, 0.2 µm film thickness).
After injection at 250 ºC (split ratio 1:10), the oven temperature was held at 50ºC for 2
minutes and then programmed to increase to 250 ºC at a rate of 4 ºC /min. Then it was held at
250ºC for 10 minutes. The flame ionization detector was maintained at 260 ºC during the
analysis. Helium was used as carrier gas at a flow rate of 1 ml/min. FAMEs were identified
by comparing the retention times with a standard mix (Supelco 37 Component FAME Mix,
18919-1AMP).
20 | P a g e
4.7 Evaluation of biodiesel fuel properties from FAME profiles
Twelve biodiesel fuel properties were estimated from FAME profiles to search the
most suitable microalgal strain for biodiesel production. The Kinematic Viscosity (KV) was
estimated using equation (1) (Ramirez-Verduzco et al., 2012).
ln(vi)= 12.503 2.496×ln(Mi) 0.178×N (1)
where ln (vi) is the KV of individual FAMEs, Mi is molecular weight and N the number of the
double bonds in each FAME. The summation of all derived KV provides the final KV of the
biodiesel.
The densities (ρ) of all biodiesel samples were estimated from their FAME profiles,
following Equation (2) (Ramirez-Verduzco et al., 2012).
ρ = 0.8463
+0.0118×N) (2)
where ρ is the density, Mi is the molecular weight and N is the number of the double bonds of
the i th FAME.
The Cetane Number (CN) was estimated using the following equation (3) (Ramirez-
Verduzco et al., 2012)
CNi = 7.8 0.302 × Mi 20×N (3)
where CNi is the CN, Mi is the molecular weight, and N is the number of the double bond of
the ith FAME.
Saponification Value (SV) was calculated using the Equation (4) (Francisco et al.,
2010)
SV=
(4)
where N is the percentage of each FA component and Mi is the corresponding FAME
molecular weight.
Higher Heating Value (HHV)/gross calorific value of each FAME was estimated by
the following Equation (5)( Ramirez-Verduzco et al., 2012)
HHVi=
(5)
where Mi is the molecular weight and N is the number of double bonds in each FAME.
21 | P a g e
The Long-Chain Saturated Factor (LCSF) was estimated by weighting up the values
of longer chain fatty acids (C16, C18, C20, C22, C24 wt.%) using the following Equation (6)
by Francisco et al., 2010.
LCSF=(0.1×C16) (0.5 C18) (1 C20) (1.5 C22) (2 C24) (6)
Cloud Point (CP) and Pour Point (PP) were estimated on the basis of C16:0 content
(wt. %) in FAME profiles using Equations 7 and 8 as detailed in Sarin et al., 2009.
CP= (0.526 C16) 4.992 (7)
PP= (0.571 C16) 12.240 (8)
Cold Filter Plugging Point (CFPF) was calculated using Equation (9) related to LCSF
(Francisco et al., 2010).
CFPF= (3.1417 long chain saturation factor 16.477 (9)
Degree of Unsaturation (DU) calculated using Equation (10) (Francisco et al., 2010)
DU= (10)
Oxidation Stability was estimated using Equation (11) (Wang et al., 2012)
OS= 0.0384 DU 7.770 (11)
Iodine Value (IV) was calculated using Equation (12) (Francisco et al., 2010)
IV=
(12)
Where D is the number of double bonds, N is the percentage of each FAME component and
M is the FAME molecular weight.
4.8 CHNS analysis
The composition of carbon, hydrogen, nitrogen and sulphur of diatoms biodiesel was
carried out using CHNS analyzer (Elementar Vario EL III, Hanau, Germany) and the oxygen
content was calculated by difference.
4.9 Statistical analysis
The statistical analysis was performed using IBM SPSS Statistics version 22. Cluster
analysis was carried out to find out the resemblance between different diatom strains, based
on the growth parameters and fatty acid profiles (saturation/unsaturation). PCA analysis was
22 | P a g e
employed to integrate the growth parameters and fatty acid profiles to assess the important
criteria for designating a suitable biodiesel feedstock.
4.10 Multi-Criteria Decision Analysis (MCDA)
In the study, PriEsT –Priority Estimation Tool (Siraj et al., 2015) was used to resolve
the vital problem of microalgae strain selection for production of biodiesel. It is a decision
support tool based on Analytic Hierarchy Process (AHP), a Multi-Criteria Decision Analysis
(MCDA). All individual criteria are paired against others and the results compiled in a matrix
form. A numerical scale is used to compare the criteria and the AHP method moves
systematically through all pair wise comparisons of criteria and alternatives (Linkov and
Steevens, 2008). The AHP is the one of the most comprehensive methods for algal strain
selection because it considers the importance of each criterion and inconsistencies in the
rankings are verified (Nwokoagbara et al., 2015).
23 | P a g e
5. RESULTS AND DISCUSSION
5.1 Marine Diatoms
Amongst the microalgae, marine diatoms demand special mention as the most
important eukaryotic microalgae and a major component of the biological carbon pump
(Field et al., 1998; Bowler, 2009; Ramachandra et al., 2009). It is believed that the burial of
diatoms over geologic time has contributed significantly to the petroleum deposits
(Ramachandra et al., 2009). Moreover, diatoms are capable of producing up to 200 times
higher amounts of oil per hectare than oil seeds (Ramachandra et al., 2009). Therefore
standardisation and optimisation of the methodology, five diatom strains were cultured and
screened for Growth Kinetic Parameters (Biomass productivity, lipid content and volumetric
lipid productivity) and fatty acid profile.
5.1.1 Growth Kinetic Parameters
Biomass productivity and lipid content are the most studied parameters in search of
the prospective biodiesel strain. Biomass productivity in the study ranged from 0.67±0.03 to
16.21±0.22 mgl-1
day-1.
Navicula sp. and Thalassiosira sp. were the highest biomass
producing strains and Nitzschia sp. showed least biomass productivity (Table 1). Comparing
with the reported literature revealed that the biomass productivities for Chaetoceros sp.
(2.47±0.07 - 13.22±0.66), Thalassiosira sp. (4.35±0.22-24.29±0.97 mgl-1
day-1
) and
Skeletonema sp. (7.17±0.27-9.02±0.54 mgl-1
day-1
) are of almost similar magnitudes
(d’lppolito et al., 2015), although unusually high biomass productivity (as high as 315 mg l-1
day-1
) was reported for Navicula sp. (Bogen et al., 2013).
Lipid content in the analysed diatom strains varied from 5.55±0.44 to 29.89±0.22 %.
Thalassiosira sp. showed higher and Skeletonema sp. showed lower lipid contents. But the
least biomass producer in the study, Nitzschia sp. showed second highest lipid content. The
reported values of lipid contents for Chaetoceros sp. (7.63±0.23-14.86±0.31 %),
Thalassiosira sp. (7.95±0.26-38.84± 0.78 %), Skeletonema sp. (9.14± 0.43-9.38±0.23 %),
Navicula sp. (27.08 ±0.66 %) and Nitzchia sp.(26-47 %) are comparable to the present study
(Griffiths and Harrison, 2009; Song et al., 2013; d’lppolito et al., 2015).
Even though higher intracellular lipid content was one of the key criteria for
evaluating the potential of algae for biodiesel production, taking lipid content alone into
account could be inadequate. Lipid productivity should be considered one of the most
obvious and easily quantifiable features related to biodiesel production (Griffiths and
24 | P a g e
Harrison, 2009; Griffiths et al., 2012). Volumetric lipid productivity of the algal strains
under study varied from 0.19±0.02 to 3.62±0.06 mgl-1
day-1.
Navicula sp. and Thalassiosira
sp. were the dominant lipid producers in the study. Irrespective of the higher lipid content,
Nitzschia sp. showed lower lipid productivity. Earlier studies also reported similar lipid
productivities for Chaetoceros sp. (0.19±0.01 to 1.97±0.04), Thalassiosira sp. (0.43±0.01 to
7.27±0.28) and Skeletonema sp. (0.66±0. 03to 0.85±0.02) (d’lppolito et al., 2015). On a par
with higher biomass productivity, reported lipid productivity for Navicuala sp. was also very
high (77.81 mgl-1
day-1
) (Bogen et al., 2013). No proper comparisons could be traced for
Nitzschia sp. to confirm the disparities in lipid content and lipid productivity. The study
supports the argument that lipid content alone cannot be a reliable indicator of lipid
productivity. It further reiterates the findings by Rodolfi et al., (2009) that volumetric lipid
productivity is a suitable variable evaluating the potential of algal species for biodiesel
production, both in terms of volume and time.
5.1.2 Fatty acid Methyl Ester (FAME) profile
The FAME profiles of five selected diatoms (Table 2) contained the carbon chain
lengths ranging from C6 to C24. Short chain fatty acids (C6 to C18) including saturated and
unsaturated ones constituted about 93-96% of the total fatty acids in all the investigated
strains. The saturated FAs ranged from 65.59% (Navicula sp.) to 95.46% (Nitzschia sp.).
C16:0 was the dominant FA in all the strains except Chaetoceros calcitrans, where C14:0
was the major one. The mono unsaturated fatty acids (MUFAs) ranged from 2.41%
(Nitzschia sp.) to 27.92 % (Navicula sp.) of TFAs. C16:1 was the major MUFA in all the
analysed diatom strains. MUFAs like C16:1 and C18:1 are essential as they are capable of
giving the finest compromise between oxidative stability and cold flow (Knothe, 2009;
Hoekman et al., 2012). C16:1 was fairly present in the diatom strains (6.37- 22.24 %), except
Nitzschia sp. C18:1n9 was found lower (0-5.5%). Poly unsaturated fatty acids (PUFAs)
ranged from 1.71% (Thalassiosira sp.) to 6.48 % (Navicula sp.) in the study. C18:2n6 was
the dominant PUFA in the diatom strains, except Nitzschia sp. and varied between 0.55 and
2.20%. Strains with high PUFAs would result in biodiesel with lower oxidation stability but
better cold flow properties (Anjorin, 2011; Nascimento et al., 2013).
25 | P a g e
FAs like C14:0, C16:0, C18:0, C18:1n9 and C18:3 are considered suitable for high
quality biodiesel (Hoekman et al., 2012). Ideal FA profile for a good quality biodiesel should
have higher levels of SFAs and MUFAs to strike a balance between cold flow and other
properties. Such feedstock would result in biodiesel with enhanced energy yields, higher
oxidative stability and higher cetane number. However, high levels of SFAs would inherently
lead to biodiesel with poor cold flow properties. All the analysed strains contained significant
amounts of C16 and C18 FAs, in the range 29.93% (Chaetoeros calcitrans) to 72.09%
(Nitzschia sp.). Both C16:1 and C18:1n9 were absent in Nitzschia sp., which is also
characterised by higher percentages of SFAs (95.46%). Therefore from the FAME
perspective, Nitzschia sp. should not be considered a suitable biodiesel feedstock, providing
an altering culture condition or harvesting period to maintain a reasonable balance between
saturated and unsaturated fatty acid content. Navicula sp. is the most promising biodiesel
feedstock in terms of SFAs (65.59%) and MUFAs (27.92%). Both C16:1 and C18:1n9 were
present in appreciable levels (C16:1+C18:1=27.29 %). Irrespective of the above, Navicula
sp. contained higher percentage (3.31 %) of highly unsaturated fatty acids (≥4 double bonds),
26 | P a g e
which according to EN14214 should not exceed 1%. From the FAME profiles, potent algal
strains for biodiesel feedstock should be prioritised in the order: Navicula sp. > Thalassiosira
sp. > Chaetoceros calcitrans > Skeletonema sp. > Nitzschia sp.
5.1.3 Estimation of biodiesel’s fuel properties from fatty acid profiles
Fatty acid structural features such as chain length, degree of unsaturation and
branching of the chain have direct impact on the physical and chemical properties of
biodiesel (Knothe, 2005). Hence the fuel properties like KV, ρ, CN, SV, HHV,LCSF,CP,PP,
CFPF,OS, IV etc. could also be derived from the fatty acid profiles without experimental
tests to avoid the cost of test and time (Ramirez-Verduzco et al., 2012; Islam et al., 2013).
The Kinematic Viscosity (KV), one of the most important properties of biodiesel, is a
measure of resistance to flow of biodiesel (Knothe, 2005). Higher KV is generally
disadvantageous as higher viscosity leads to overall poorer combustion, higher emissions,
and increased oil dilution. Hence KV limits are set to 2.5-6.0 mm2 s
-1, 1.9-6.0 mm
2 s
-1 and
3.5-5.0 mm2 s
-1 as per IS 15607, ASTM 6751-02 and EN 14214, respectively. The FAME
derived KV (Table 3) of all the studied diatom species (4.08 to 4.72 mm2 s
-1) are well within
the prescribed viscosity range, therefore meeting the standard requirement. Navicula sp.
showed comparatively lower KV, whereas Skeletonema sp. exhibited higher KV. Since KV is
established to increase with increasing saturation (Hoekman et al., 2012), the reported
variations could clearly be attributed to the presence of higher MUFAs and PUFAs in
Navicula sp. as well as higher SFAs in Skeletonema sp.
Fuel density (ρ) is a key characteristic that influences engine performance (Hoekman
et al., 2012). According to EN 14214 (European) and ISO 3675/P32 (Indian), the standard
range for density of biodiesel is 0.86-0.90 g cm-3
. Although the biodiesel density is also
affected by average unsaturation (Hoekman et al., 2012), FAME derived density for diatom
species showed negligible variations (0.87-0.88 g cm-3
) and falls within the standard range.
Cetane number (CN) characterises the ignition quality of fuels in diesel engines; the higher
the cetane number, the better the ignition quality of the fuel (Knothe, 2009). Although diesel
engines operate well with a CN from 45 to 55, ASTM D6751 sets the minimum at 47, while
27 | P a g e
standards EN 14214 and IS 15607 fix the minimum CN value at 51 (Hoekman et al., 2012).
Among the five diatom species in this study, the FAME derived CN varied from 53.50 to
65.50. Skeletonema sp. showed higher CN, while Navicula sp. recorded lower CN as CN
found to increase with increasing saturation. Saponification value (SV) gives a direct
indication on the proportion of lower or higher fatty acids. SV of the diatom strains in the
study ranged from 206.46 to 215.40 mg KOH g-1
. Chaetoceros calcitrans showed
comparatively higher values, although no significant variations were found between the
diatoms.
The higher heating value (HHV) is an important property defining the energy content
and thereby efficiency of biodiesel. HHV increases with increasing chain length and
decreases with the presence of double bonds in the esters. Although there is no specification
on the higher heating value in any of the biodiesel standards, it generally found about 10%
less than that of petrodiesel (46 MJ kg-1
). In the present study the FAME derived HHV
ranged from 39.01 to 39.53 MJ kg-1
. Long Chain Saturated Factor (LCSF) of FAME profile
of a feedstock is a critical parameter for OS, CN, IV and CFPF of the biodiesel obtained.
LCSF of biodiesel and their cold flow properties are inversely related. In the present study,
the LCSF of FAMEs of diatom strains ranged from 4.97 to 17.41. Among the five diatom
strains, Chaetoceros calcitrans showed lower LCSF, whereas Skeletonema sp. showed higher
values.
Among the cold flow properties of biodiesel, Cloud point (CP) causes major
operability problems due to formation of crystals and solidification of saturates (Knothe,
2005). In the present study, the FAMEs derived CP ranged between 7.57 and 28.65°C. On the
contrary to CP, pour point (PP) is the lowest temperature at which the fuel can flow and
below which the fuel tends to freeze or ceases to flow. The FAME derived PP in the study
varied from 1.40 to 24.28°C. For all the analysed diatoms, PP is lower than CP. It was
established that biodiesel fuels derived from fats or oils with significant amounts of saturated
fatty acids will display higher CPs and PPs (Hoekman et al., 2012). Chaetoceros calcitrans
showed lowest CP and PP due to its lower C16:0 content and vice versa for Nitzschia sp.
Cold filter plugging point (CFPP), another critical parameter for the diesel engine
performance, ranged from -0.72 to 38.22°C. Again, Chaetoceros calcitrans showed lower
and Skeletomnema sp. showed higher values. These cold flow properties are specific to local
weather conditions and hold great significance in temperate and Arctic regions (Knothe,
2011).
28 | P a g e
Degree of unsaturation for the biodiesel ranged from 6.94 to 40.89 for the diatom
strains in the present study. It showed direct correlations with important biodiesel
characteristics such as OS, IV etc. Similar to many of the FAME derived properties,
Nitsczhia sp. showed lower and Navicula sp. showed higher DU values. IV in the present
study varied between 9.00 to 42.94 gI2100g-1
fat. It should be noted that the higher IV was
obtained for FAMEs with the higher DU (Navicula sp.) and lower IV corresponds to lower
DU (Nitsczhia sp.). High unsaturation degrade the fatty acid chain by oxidation reaction that
results into polymerisation of glycerides and formation of deposits that clog up engine parts
(Francisco et al., 2010). OS primarily affects the stability of biodiesel during the extended
storage and is influenced by factors such as presence of air, heat, traces of metal, peroxides,
light, and fatty acid structure (Hoekman et al., 2012). Since storage stability is one of the
main quality criteria, minimum oxidation stability for biodiesel according to EN 14112 is 6
hours. OS in the study ranged from 6.20 to 7.50 hours. Navicula sp. showed lower OS
because of its high DU, whereas Nitzschia sp. showed higher OS due to lower DU.
Succinct comparisons of the FAME derived properties revealed that the values of
KV, ρ, CN, OS,IV of the five diatom strains completely satisfied the specifications set by the
biodiesel standards ASTM D6751, EN 14214 and ISO 3675/P32. Navicula sp. and
Thalassiosira sp. can be considered as the best diatom strains among the five analysed,
whereas Nitzschia sp. can be ranked as the worst. Despite having high CN, which is ideal for
diesel fuels in terms of combustion, Skeletonema sp. exhibited high CFPF, indicating poor
cold flow properties.
5.1.4 Elemental Analysis of diatom FAMEs
CHNSO analysis (Table 4) revealed that the Carbon content among the analyzed algal
FAMEs ranged from 74.24±0.77 to 78.50±0.44 %. Hydrogen content varied from
10.99±0.91to 12.79±1%. Chaetoceros calcirans, Thalassiosira sp. and Navicula sp. showed
higher percentages of Carbon and Hydrogen. The analysis confirmed the absence of sulphur
in all the five diatom biodiesels. Nitrogen content lied in the range of 0.001±0.001to
0.002±0.002 %. The absence of sulphur and lower nitrogen content in all the biodiesel
samples analysed will results in less exhaust emissions (NOx and SO2) while using it in a
diesel engine. Oxygen content varied from 8.70±0.70 to 14.76± 1.67 %. The presence of
oxygen content in biodiesel allows the fuel to burn more completely, reducing tailpipe
particulate matter, hydrocarbon and carbon monoxide emissions.
29 | P a g e
5.1.5 Statistical Analysis
Cluster analysis of the diatom strains was carried out using growth parameters and
fatty acid profiles to find the familiarity between the five diatom strains under study. The
results (Fig. 4a) revealed resemblance between Chaetoceros Calcitrans and Skeletonema sp.
as well as between Thalassiosira sp. and Navicula sp. in terms of the assessed properties.
Nitzschia sp. could be clearly distinguished from the other four. PCA analysis was employed
to integrate the growth parameters and fatty acid profiles to assess the important criteria for
designating a suitable biodiesel feedstock. Two extracted components expressed 86.2% of the
total variability observed in the data. Principal component 1 (65.5% variance) established
highly significant positive loadings on biomass productivity, lipid productivity and MUFAs
as well as highly significant negative loading on SFAs. Principal component 2, with 20.7%
variance, showed highly significant positive loading on lipid content with notable loading on
lipid productivity (Fig. 4b). The principal component analysis thus provided further
confirmation that lipid content alone cannot be a reliable criterion for evaluating suitable
biodiesel feedstock.
5.1.6 Analytic Hierarchy Process (AHP)
Multi-criteria decision analysis for microalgal strain selection is performed using PriEsT
(Priority Estimation Tool), which is based on AHP, one of the most comprehensive methods
for algal strain selection (Nwokoagbara et al., 2015). Six criteria used for AHP analysis in
the present study are biomass productivity, lipid productivity, lipid content, SFAs, MUFAs
and PUFAs for five alternatives (Chaetoceros calcitrans, Thalassiosira sp., Skeletonema
sp.,Navicula sp., Nitzschia sp.). All individual criteria were compared against the others and
criteria weights (Priority Vectors or Weights) were determined for six criteria. The matrices
are normalized and the Consistency Ratio (CR) was calculated to ensure consistency.
30 | P a g e
Figure 4. (a) Dendrogram showing the linkage between the diatom strains under study. (b)
Principal Component Analysis results showing component plot in rotated spaces.
CR for pair-wise comparison was less than <0.099 for all six criteria, which confirms
the relatively consistency and hence no corrective action was taken. From the pair-wise
comparison matrix the weights of the criteria are biomass productivity (0.419), lipid
productivity (0.232), lipid content (0.155), SFAs (0.070), MUFAs (0.068) and PUFAs
(0.056). This result reveals that among the six criteria considered, the biomass and lipid
productivities have the highest weights. This implies that the best diatom strain for biodiesel
production should have very high biomass as well as lipid productivity. The final ranking
from the AHP analysis using PriEsT is given the figure 5. Navicula sp. has the highest
ranking (0.345) followed by Thalassiosira sp. (0.304). Skeletonema sp. (0.145) and
Chaetoceros calcitrans (0.119) occupy the next places, whereas Nitzschia sp. (0.086) was
the worst among the five alternatives used in the study.
31 | P a g e
Figure 5. Graphical representation of the Analytic Hierarchy Process using a Priority
Estimation Tool.
5.2 Isolated microalgae from the local environment
Microalgal samples were collected from Cochin backwaters and adjacent fresh water
habitat. Temperature, Salinity, pH, DO, and Nutrients (nitrite, nitrate, ammonium, phosphate,
silicate) were measured and the values obtained are given in the figure 6. The collected
samples were grown in the laboratory and five microalgal strains were successfully isolated
by using microlgal isolation techniques (Andersen, 2005). Four of them are identified by
employing molecular techniques. Blast analysis of the tuf A region of nucleotide sequence
data with NCBI gene bank database revealed that microalgae isolated are Thalassiosira
weissflogii (T. weissflogii) with98% similari ty with Accession No:KJ958485.1 ,
Lithodesmium undulatum (L. undulatum) with 88% similarity with Accession
No:KC509525.1, Nannochloropsis oceanica (N. Oceanic ) with 99% similari ty
with Accession No: KJ1410683.1 and Desmodesmus communis (D.
Communis ) with 99% similari ty with Accession No: HG514404.1. One
microalgae isolated was identified as Oscillatoria sp. using the morphological features
(Fritsch et al.,1951; Bold and Wynne,1985; Hickman, 2000; John et al.,2002).
32 | P a g e
Figure 6. Water quality parameters recorded in 10 stations of Cochin Backwaters
Consensus Sequence Data of T. Weissflongii
TCTGCCGCAGATGGTCCGATGCCTCAAACACGTGAACATATTTTATT
AGCAAAACAAGTAGGTGTTCCACATATTGTTGTGTTTTTAAATAAACAAG
ATCAAGTAGATGATGATGAATTATTAGAATTAGTAGAATTAGAAGTTCGT
GAATTATTATCAACTTATGACTTCCCAGGTGATGATATTCCAATTTGTCCT
GGTTCAGCTTTACAAGCTATTGAAGCAATTTCATCTAATCCAGATCTTAAA
CGTGGGGATAACCCTTGGGTTGATAAAATCTTTGCTTTAATGGATTCTGTT
GATGATTATATTCCAACTCCAGAACGTGATGTTGAAAAAACATTTTTAATG
GCAATTGAAGATGTTTTCTCAATTACTGGTCGAGGTACAGTAGCAACAGG
AAGAATTGAAAGAGGAGTAGTAAAAGTTGGTGATAACGTAGAAATTGTTG
GTGTTGGTGAAACACAAACTACAACTATTACTGGTATTGAAATGTTCCAA
AAAACTTTAGAAGAAGGGTTTGCTGGAGATAATGTAGGTATCTTATTACG
TGGTGTTACTCGAGAAAATATTGAACGTGGTATGGTATTAGCTAAACCAG
GTACTATTACTCCACATACAAATTTTGAATCAGAAGTATACGTTTTAACAA
AAGAAGAAGGTGGACGTCATACACCATTCTTTACAGGTTACCGACCACAA
33 | P a g e
TTCTATGTAAGAACAACTGATGTTACAGGTTCAATTATCCAATTTACAGCA
GATGATGGTTCAGTCGTAGAAATGGTAATGCCAGGCGATCGTATTAAAAT
GACAGCTGAATTAATCTACCCAGTTGCAATTGAAGAA
GGTAT
Consensus Sequence Data of L. undulatum
TGAACATATTTTATTATCAAAACAAGTTGGTGTTCCAAATATTGTAGTTTTTTTAA
ATAAAGAAGATCAAGTTGATGATGCTGAATTATTAGAATTAGTAGAATTAGAAG
TTCGTGAATTACTTTCTGCTTATGATTTCCCAGGTGATGATATTCCAATTTGTCCT
GGTTCAGCATTACAAGCAATTGAAGCTATTTCAGCAAATCCAGAAATCCGTCGTG
GAGATGATCCATGGGTTGACAAGATTTATGCATTAATGGATGCAGTTGATGAATA
TATTCCAACACCAGAACGCGACACAGAAAAAACATTCTTAATGGCTATTGAAGA
CGTTTTCTCAATTACAGGTCGTGGTACTGTTGCCACTGGTCGTATTGAACGTGGA
GTTGTAAAAGTTGGTGATAGTGTAGAAATTGTTGGTATTAGTGAAACACAAACA
ACAACAATTACTGGAATTGAAATGTTCCAAAAAACATTAGATGAAGGATTTGCT
GGTGATAATGTTGGAATTTTATTACGTGGTGTTACACGTGAAGATATCGAACGTG
GAATGGTATTAGCTAAACCTGGTACAATTACACCACATACAAATTTTGAATCTGA
AGTTTATGTTTTAACAAAAGATGAAGGTGGACGTCATACGCCATTCTTTACCGGT
TATCGACCACAATTTTATGTACGAACAACGGATGTTACTGGTGCAATCACTCAAT
TTACAGCCGATGATGGATCAATTGTTGAAATGTAATGCCAGTGATCGTATTAAAT
GACAGCAGATTAATTTATCCTGTAGCATTGA
Consensus Sequence Data of N. oceanica
GTACCTCATGTTTGTTGTATTCTTAATAAAGCTGATCAAGTATATGATGATGAACT
TCTGGAATTACTAGAACTTGAAGTTCGTGAGTTATTATCAAATTATGATTTCCCTG
GTGAGGAAATACCTTTTGTTTTCAGGTTCAGCATTATTAGCTTTGGAAGCGGTAA
CAAATGCAACTGTAACAAAACGTGGTGAAAATCAATGGGTAGACAAAATTTTTG
ACCTAATGGATGCTGTAGATAGCTATATTCCAACACCAGTACGTGATGTTGACAA
AACATTTTTAATGGCTGTTGAGGATGTATTCTCAATTACAGGCCGTGGTACAGTC
GCAACAGGAAGAATTGAGCGTGGTACAGTTAAAGTTGGGGAAACAATTGAAATC
ATTGGTATCGTTGAAACAAAAACGACAACTGTTACTGGTTTAGAGATGTTCCAAA
AGACACTTGACGAAGGATTTGCTGGAGATAATATTGGTATTTTATTACGTGGTGT
ACAAAAAGGTGATATTCAAAGGGGAATGGTTCTAGCTAAACCTGGCACTATTAA
ACCACACAAACGTTTTGAAGCTGAGGTTTACATTCTAAAAAAAGAAGAAGGTGG
34 | P a g e
GCGTCATACACCATTCTTACCAGGTTATCGACCTCAGTTTTATGTAAGAACAACA
GATGTAACAGGTAATATTACAGGATTTACTGCCGATGATGGAGCTGCCGCAGAA
ATGGTAATTCCGGGTGACGGTATTAAAATGACAGCAGAATTAATTTCGCCTATTG
Consensus Sequence Data of D. communis
AGCATATTCTATTAGCAAACAAGTAGGAGTTCCAAACATGGTAGTGTTTTTAAAC
AAAGAAGATCAAGTTGATGACCCAGAATTATTAGAATTAGTTGAATTAGAAATT
CGTGAAACATTAGATAAATATGAATTCCCAGGAGATGAAATTCCAATTGTAAGT
GGATCAGCTTTACTTGCATTAGAAGCTCTTGTTGAAAATTCATCAATTAAACGTG
GTGATAACAAATGGGTTGATAAAATCTATGATTTAATGGATCGAGTTGATGAATA
CATCCCTACACCTGATCGTGAAACAGATAAACCTTTTTTATTAGCTGTTGAAGAC
GTTTTATCAATTACAGGACGTGGAACTGTAGCTACAGGACGTGTTGAAAGAGGA
ACATTAAAAGTTGGTGAAAACGTTGAATTAGTTGGACTAAAAGATACAAAAGCA
ACAGTTGTTACAGGTCTTGAAATGTTCAAAAAAACATTAGATGAAACAATGGCT
GGTGATAACGTAGGTGTACTTTTACGTGGTATTCAAAAAAAAGATGTTGAGCGTG
GAATGGTTTTAGCAAAACCTGGTTCTATTACTCCACATACAAAATTTGAAGCACA
AGTTTATGTATTAACAAAAGAAGAAGGTGGACGTCATTCACCTTTTTTAGTAGGA
TACCAACCACAATTCTTTATTCGTACAACAGATGTTACTGGAAAAATTGTAAGTT
TTACACACATTCAAATGAAAAATCCTTCTTCTGTTGCTGAGAACATTCAAATAAA
A
T. weissflongii is a species of centric diaoms, unicellular microalgae. It is found in
marine, brackish and fresh water environments, but it grows best at higher salinities (Vrieling
et al., 1999). It is a non toxic alga, but it is sometimes associated with other microalgae that
cause algal blooms or red tides. It is very tolerant to poor water quality. It flourishes in
environments with high carbon dioxide levels (Ishida et al., 2000), high chlorine, high
cadmium (Lee et al., 1995), and pH (Sala, 1997). Lithodesmium undulatum is a marine
centric diatom (Ehrenberg, 1839). Desmodesmus communis is a genus of green algae,
specifically of the Scenedesmaceae (Hegewald, 2000). N. oceanica is one of the six species
of the genus Nannochloropsis, which has drawn attention as a potential feedstock for the
production of biofuels. The species have mostly been known from the marine environment
but also occur in fresh and brackish water (Fawley and Fawley, 2007). Oscillatoria sp. is a
genus of filametous cyanobacterium which is named after the oscillation in it movement and
it inhabits a wide range of environments from fresh water to marine. The results suggested
that the locally isolated microalgae were robust enough to withstand variable local climatic
35 | P a g e
conditions under lab as well as open culture. These five microalgae were screened for growth
kinetic parameters and fatty acid profiles to compare their potential as biodiesel feedstock.
Figure 7. Microscope images of D. communis and L. undulatum
5.2.1 Growth kinetic parameters and Biochemical Composition
Biomass productivity of the isolated microalgal strains ranged from 10.15±0.05 to
24.89±0.32 mg L-1
day-1.
N. Oceanica and L. undulatum were the fastest growing algal strains
and Oscillatoria sp. exhibited lower biomass productivity (Table 4). Fresh water
microalgae
D. communis also showed good biomass productivity, whereas T. weissflongii and
Oscillatoria sp. showed almost similar biomass productivity range.
All the above microalgal strains, in general, recorded lipid content >15% and varied
from 16.10 ± 0.50 to 32.84 ± 0.06 %. Diatoms, T. weissflongii and L. undutum showed higher
lipid content and Oscillatoria sp. showed lower lipid content (Table 4). Volumetric Lipid
Productivity of the isolated microalgal strains ranged from 16.58 ± 0.66 to 167.30 ± 4.82 mg
L-1
day-1
. N. oceanica and L. undulatum showed higher and Oscillatoria sp. showed lower
volumetric lipid productivity among the microalgal strains (Table 4).
Based on growth kinetic parameters, N.oceanica and L. undulatum were found to be
ideal feedstock for biodiesel production among the isolated microalgal strains. T.weissflongii
can also be considered as a good feedstock for biodiesel production on the merit of highest
recorded lipid content as well as fairly good growth parameters.
Annual biomass productivity of all the isolated microalgae ranged from 5.87
(Oscillatoria sp.) to 22.22 (N.oceanica) tonne/ha/year and the corresponding lipid
productivity varied from 0. 93(Oscillatoria sp.) to 4.73(N. oceanica) tonne/ha/year. L.
undulatum also showed higher annual biomass productivity (17.92 tonne/ha/year) as well as
lipid productivity (4.1 tonne/ha/year). Annual biomass productivity and lipid productivity of
36 | P a g e
D. communis were 10.35 and 2.0 tonne/ha/year and for T. weissflongii, these were and 8.13
and 2.7 tonne/ha/year, respectively. According to reported literature, a realistic value of
microalgae biomass production lies between 15 and 25 tonne/ha/year and that of
corresponding lipid production varies between 4.5 and 7.5 tonne/ha/ year (Chisti, 2007). This
amount is higher compared to the production of oil from soybean (0.4 tonne/ha/year),
rapeseed (0.68 tonne/ha/year), oil palm (3.62 tonne/ha/year) and jatropha (4.14 tonne/ha/year)
(Chisti, 2007; Lam et al., 2009). Moreover, culturing microalgae for biodiesel production
requires the least land area and holds an important key feature for effective land utilization,
without compromising on agricultural land as the former generation feedstock. The locally
isolated microalgae hold a great promise as feedstock for large scale biodiesel production
provided the lipid as well as biomass production are augmented through biochemical and
genetic engineering approaches.
Comparatively high biomass as well as lipid productivity noticed in all the isolated
algae suggested that significant increase in biomass and lipid productivity could be achieved
through open culture (Table 4) than controlled lab culture (Table 1). Therefore, open culture
could play an important role in energy and cost efficient biodiesel production.
Other biochemical compounds (proteins and carbohydrates) of all the isolated
microalgae showed the dominance of protein content over carbohydrates. D. communis
(41.23%) and T. weissflongii (32.63%) recorded higher protein content and N. oceanica
(16.71%) recorded lower protein content. T.weissflongii (21.57%) and L. undutum (21.31%)
showed higher carbohydrate content and N. oceanica (12.15%) showed lower values. L.
undultum and Oscillatoria sp. showed protein content of 28.36% and 21.88 % respectively.
Carbohydrate content of D. communis and Oscillatoria sp. were 13.12% and 11.36%. D.
communis and T. weissflongii showed comparatively high nutritive values when compared to
rest of algae under study, based on their high protein content.
37 | P a g e
5.2.2 FAME profiles
As evident from the marine diatom analysis, ideal microalgae feedstock for biodiesel
production requires not only high biomass productivity and lipid content/productivity, but
also suitable fatty acid composition. Structural features of fatty acids including carbon chain
length and degree of unsaturation influence biodiesel properties such as such as cetane
number, iodine value, density, kinematic viscosity, higher heating value and oxidation
stability. The FAME profile of isolated microalgal strains (Fig. 8) consists of carbon chains
ranging from C8 to C24 with different degrees of unsaturation. C16:0 was the major FA in all
the isolated strains except Oscillatoria sp. where C16:1 was the dominant one (Table 5). The
FAME profiles of different class of microalgal strains under study varied significantly with
respect to SFAs, MUFAs and PUFAs. SFAs ranged from 36.23 (D.communis) to 73.23% (L.
undulatum) in isolated microalgal strains. Marine diatoms, L. undulatum, T. Weissflongii and
Oscillatoria sp. recorded higher SFAs and fresh water algae D. communis and marine green
algae N. oceanica recorded lower SFAs. Palmitic acid (C16:0) was the dominant SFA in all
the strains except Oscillatoria sp. where C14:0 was the major SFA. MUFAs varied from
20.22 to 34.33% of TFA and C16:1 was the major MUFA in all strains except D. communis
where 18:1n9c was the dominant one. PUFAs ranged from 0 to 43.56% of TFA. In the
isolated marine diatoms, the PUFAs ranged from 0 to 1.98 %. Oscillatoria sp. also showed
very low PUFAs. PUFA content of fresh water algae D. communis and marine green algae N.
oceanica was very high (43.56% and 21.62%, respectively). C18:3n3 was the dominant
PUFA in D. communis (28.05%) and C20:5n3 was the major PUFA in N. oceanica (15.22%).
The fatty acid profiles for most promising feedstock for biodiesel production should
be enriched with five most common C16-C18 fatty acids including C16:0, C18:0, C18:1,
C18:2, C18:3 (Knothe, 2009). C16 and C18 fatty acids (including saturated and unsaturated
ones) constituted about 52.35(Oscillatoria sp.) to 89.30 % (L. undulatum) of the total fatty
acids in all the five isolated microalgae. L. undulatum and D. communis showed high content
of C16 and C18 FAs (89.3% and 86.12% respectively). All the isolated strains under study
exhibited a reasonable balance between saturated and unsaturated C16 and C18 fatty acid
content. C16 and C18 saturated FAs ranged from 19.49 (Oscillatoria sp.) to 62.84% (L.
undulatum) and unsaturated C16 and C18 ranged from 26.46 (L. undulatum) to 55.23% (D.
communis).
38 | P a g e
39 | P a g e
Figure 8. FAME profiles of the isolated microalgae
Unlike the marine diatoms, the unsaturated C16 and C18 fatty acids were more than
their saturated counterparts in D. communis, N. oceanica and Oscillatoria sp. But the PUFA
content was very high in D. communis (43.56%) and N. oceanic (21.62%). According to EN
14214 the PUFAs with ≥4 double bonds should not exceed 1%. In N. oceanica PUFA was
19.18% and in D. communis, it was 6.65%. Therefore, these two algal strains are not suitable
for biodiesel production. But the high content of C20:5n3 (Eeicosapentanoic acid), in N.
oceanica implies great benefits to human health (Bucy et al., 2012, Ronacarti et al., 2004)
than biodiesel potential. On the other hand, Oscillatoria sp. and T. Weissglongii contained
very low levels of PUFAs and give a fair balance between SFAs and MUFAs. Even though
40 | P a g e
L. undulatum contains SFAs and fair amounts of MUFAs as required, PUFAs are
conspicuously absent, degrading the biodiesel potential. Based on FAME profiles potent algal
strain for biodiesel feed stock for the isolated microalgae can be prioritised as T. Weissflongii
> Ocsillatoria sp.> L. undulatum > D. communis > N. oceanica.
5.2.4 Estimation of biodiesel’s fuel properties from fatty acid profiles
As discussed in the previous section, it is well established that the fatty acid
composition (carbon chain length and degree of unsaturation) has a major effect on fuel
41 | P a g e
properties. The most important characteristics affected by the level of unsaturation are
oxidative stability, ignition quality (i.e. Cetane Number), and cold flow properties. For
example, fully saturated methyl esters have high oxidative stability and high Cetane number,
but suffer from poor cold flow properties. Conversely, methyl esters with a higher degree of
unsaturation have better cold flow properties but decreased oxidative stability and decreased
Cetane Number. Ideal FA profile for a good quality biodiesel should have higher levels of
SFAs and MUFAs to strike a balance between cold flow and other properties.
kV, one of the most important properties of biodiesel, is a measure of resistance to
flow (Knothe, 2005). FAME derived kV of all the isolated microalgal strains varied from
4.28 (Ocsillatoria sp.) to 5.48 mm2 s
-1 (L. undulatum) (Table 6). All the strains except L.
undulatum meet both the American and the European biodiesel Standards. L. undultum did
not fall in EN 14214 for which the limits are between 3.5 and 5.0 mm2 s
-1. The kinematic
viscosity of the fatty compounds is significantly influenced by the factors such as chain
length, position, number and nature of double bonds. Ocsillatoria sp. showed lower kV
values because the short chain fatty acids (C13:0 and C14:0) accounted for 43.1% of the
total fatty acids and the high kV of L. undulatum is due to the higher concentration of SFAs
and lack of PUFAs ( ≥2 double bonds).
FAME derived density for the isolated microalgal strains falls well within the
standard range (0.86-0.88 g cm-3
). Values of biodiesel density will depend on the methyl
esters composition and their purity and density will increase with decreasing chain length
(number of carbon atoms) and increasing number of double bonds (degree of unsaturation).
D. communis and N. oceanica showed higher density due to their higher degree of
unsaturation. On account of the large concentration of long chain fatty acids, T. weissflongii
showed lower density. Cetane number (CN) is one of the main indicators of the quality of the
diesel fuel, and high values of CN guarantee a good control of the combustion, therefore
increasing the engine efficiency (Knothe, 2009). Long chain saturated fatty acids results in
higher cetane number (Knothe et al., 1998; Dermibas, 2005; Bajpai and Tyagi, 2006).
Although diesel engines operate well with a CN from 45 to 55, ASTM D6751 sets the
minimum at 47, while standards EN 14214 and IS 15607 fix the minimum CN value at 51
(Hoekman et al., 2012). In case of fuels with very high cetane number, ignition will be
carried out before proper mixing with air, results in incomplete combustion and increase in
amount of exhaust smoke. Also, if the cetane number is too high, the fuel will ignite close to
the injector causing it to overheat and unburned fuel particles can plug the injector nozzles.
42 | P a g e
Therefore cetane number should not exceed 65 (Bataga et al., 2003). FAME derived CN
values of the isolated microalgal strains varied from 55.53 to 72.58. N. oceanica showed
lower CN value and L. undulatum recorded much higher CN value. Greater unsaturation in
N. oceanica and grater saturation and absence of PUFAs in L. undulatum could have
contributed to this variation.
Saponification value gives a direct indication on the proportion of lower or higher
fatty acids and SV decreases with increase of its molecular weight (Demirbas, 1998). SV of
the algal strains varied from 196.45 to 221.95 mg KOH g-1. Lower proportion of very short
chain fatty acids i.e. C8 to C14 in D. communis (3.52%) accounted for lower SV and higher
proportion of these FAs in Oscillatoria sp. (46.13%) accounted for higher value. HHV is an
important property defining the energy content and thereby the efficiency of biodiesel and it
increases with increasing chain length and decrease in the number of double bonds. HHV in
the present study varied from 39.15 (Oscillatoria sp.) to 39. 60 MJ kg-1
(T. weissflongii). The
Long Chain Saturated Factor (LCSF) of a feedstock is a critical parameter for OS, CN, IV
and CFPF of the biodiesel obtained. In the present study LCSF of algal strains varied from
2.51 to 10.35%. Oscillatoria sp. showed lower and T. weissflongii showed higher LCSF
value.
The cold flow properties such as CP and PP determine the low temperature
operatability of the fuel. FAME derived CP varied from 4.85 to 27.05°C. Oscillatoria sp.
showed lower CP value due to low concentration of C16:0 and L. undulatum showed higher
value due to the high concentration of C16:0. The CP of N. oceanica and D. communis are
desirable due to their medium level of C16:0 FAs. T. weissflongi also showed higher CP
value of 15.6°C. PP in the study ranged from -1.56 (Oscillatoria sp.) to 22.54°C (L.
undulatum). Like CP, PP is also estimated from the percentage of C16:0 and lower value for
Oscillatoria sp. and higher value for L. undulatum was contributed by the respective lower
and higher percentage of C16:0. CFPP, another critical parameter for diesel engine
performance, ranged from -8.58 (Oscillatoria sp.) to 16.04°C (T. weissflongii). The CFPP
43 | P a g e
value increases proportionally to the concentration of saturated fatty esters in a given
biodiesel, is more pronounced for larger FAMEs and due to the higher LCSF value, T.
weissflongi and L. undulatum showed higher CFPP values. Oscillatoria sp., N. oceanica and
D. communis showed good CFPP values due to their comparatively lower percentages of
SFAs, especially long chain saturated FAs. These cold flow properties are specific to local
weather conditions and hold great significance in temperate and arctic regions (Knothe,
2011). Based on cold flow properties Oscillatoria sp., N. oceanica and D. communis showed
excellent CP, PP and CFPP, whereas L. undulatum showed poor CP and PP. T. weissflongii
exhibited fairly good cold flow properties.
FAME derived DU for microalgal strains ranged from 26.77 to 107.14. It showed
direct correlations with important biodiesel characteristics such as OS and IV. L. undulatum
showed lower DU and D. communis showed higher DU values. Another important parameter
for estimating the contribution of unsaturated FAs, IV varied from 25.08 to 133.72 g I2100g-1
fat in the isolated microalgal strains. Lack of PUFAs in L. undulatum resulted lower IV
value; while D. communis contained very high concentration of MUFAs and PUFAs,
showing higher IV value. Oxidation stability is one of the major issues affecting the use of
biodiesel during the extended storage because of its presence of polyunsaturated methyl
esters (Knothe, 2006). Since storage stability is one of the main quality criteria, minimum
oxidation stability for biodiesel according to EN 14112 is 6 hours. FAME derived OS in the
isolated algal strains varied from 3.66 (D. communis) to 6.74 hours (L. undulatum). Fresh
water green algae D. communis and marine water green algae N. oceanica recorded OS below
the standard limit of 6 hours due to their high DU. L. undulatum showed higher OS because
of its large concentration of SFAs.
Analysis of FAME derived fuel properties of five isolated microalgal strains revealed
that all the fuel properties of Oscillatoria sp. and T.weissflongii completely satisfied the
specifications set by the biodiesel standards ASTM D6751, EN 14214 and ISO 3675/P32.
Lack of PUFAs (≥2) in L. undulatum resulted higher values of kV, CN, CP and PP for
biodiesel than that prescribed by biodiesel standards. Even though D. communis and N.
oceanica showed excellent cold flow properties, they showed high DU and IV and very low
OS, degrading the quality of biodiesel.
44 | P a g e
6. SUMMARY
Biodiesel production from microalgae have recently received a lot of attention
because of the escalating price of petroleum, depleting natural resources and more
significantly, the emerging concern about global warming that is associated with burning
fossil fuels. The present study investigated the biodiesel production potential of locally
dominant microalgal strains using growth kinetic parameters (Biomass productivity, lipid
content and lipid productivity) and FAME profile. Lipid content and fatty acid composition
of algal biomass and their dominance varies significantly in different environmental
condition. Kerala State is blessed with an expansive body of brackish waters, the different
sectors of which are variously referred to as backwaters, lakes, lagoons and estuaries
including mangrove and swamps. Cochin backwaters, a part of Vembanad Lake (Ramsar
Site) is selected for the study (09° 00’ -10 ° 40’ N and 76° 00’ -77° 30’ E ). It is the largest
among 30 estuaries of Kerala, stretches to about 24000 ha in area and contributes to about 50
percent of the total area of estuaries in the state. Cochin Backwaters is a tropical micro-tidal
estuary with high biological production and well known for its rich biodiversity.
Five diatom strains (Chaetoceros calcitrans, Thalassiosira sp., Skeletonema sp.,
Navicula sp., Nitzschia sp.) obtained from Central Marine Fisheries Research Institute, Kochi
were screened for FAME profiles and growth kinetic parameters to standardise and optimise
the methodology. Five genus of microalgal samples were isolated from local water bodies
and screened for their biodiesel production potential. Microalgae were collected from both
estuary and fresh water habitats. Water samples for microalgae isolation were collected
aseptically from sites that appeared to contain algal growth in Cochin Back waters.
Identification was done by employing molecular techniques and morphological features.
Screening of diatoms to identify potent strains for biodiesel production revealed that
Navicula sp. and Thalassiosira sp. were the higher biomass producing strains, whereas
Nitzschia sp. showed lower biomass productivity. Lipid content was higher for Thalassiosira
sp. and lower for Skeletonema sp. It was found that Navicula sp. was the most suitable
biodiesel feedstock in terms of saturated (65.59%) and monounsaturated (27.92%) fatty acids.
Cluster analysis of the strains based on growth parameters and FAME profiles revealed close
resemblance between Chaetoceros calcitrans and Skeletonema sp. and also between
Thalassiosira sp. and Navicula sp. But Nitzschia sp. secerned from the other strains. Principal
Component Analysis (PCA) provided a confirmation that lipid content alone cannot be a
reliable criterion for evaluating suitable feedstock. Multi-Criteria Decision Analysis (MCDA)
45 | P a g e
based on Analytic Hierarchy Process (AHP) was successively utilized for strain selection,
which identified Navicula sp. as the ideal biodiesel feedstock, followed by Thalassiosira sp.
The study also found that Nitzschia sp. is inferior as a viable biodiesel feedstock. The study
confirmed that biomass productivity and lipid productivity are the best suitable indicators to
screen the biodiesel production potential of microalgae. The study also reiterates that FAME
profiles are a significant and quick method to assess biodiesel properties for selecting suitable
algal strains. AHP analysis was found to be very effective multi-criteria decision tool to
identify the promising microalgal strains for biodiesel production.
Growth kinetic parameters and FAME profiles of five locally isolated microalgae (T.
weissflongii, L. undulatum, N. oceanica, Oscillatoria sp. and D. communis) revealed that N.
Oceanica and L. undulatum were the fastest growing algal strains where as Oscillatoria sp.
exhibited lower biomass productivity. Fresh water microalgae D. communis also showed
good biomass productivity. T. weissflongii and Oscillatoria sp. showed almost similar
biomass productivity range. All the isolated microalgal strains, in general, recorded lipid
content >15% and varied from 16.10 ± 0.50 to 32.84 ± 0.06 %. Diatoms, T. weissflongii and
L. undutum showed higher lipid content and Oscillatoria sp. showed lower lipid content. N.
oceanica and L. undulatum showed higher and Oscillatoria sp. showed lower volumetric
lipid productivity among the microalgal strains. Annual biomass productivity of all the
isolated microalgae ranged from 5.87 (Oscillatoria sp.) to 22.22 (N.oceanica) tonne/ha/year
and the corresponding lipid productivity varied from 0. 93 (Oscillatoria sp.) to 4.73 (N.
oceanica) tonne/ha/year. Based on growth kinetic parameters, N. oceanica and L. undulatum
were found to be ideal feedstock for biodiesel production among the isolated microalgal
strains. T. weissflongii can also be considered as a good feedstock for biodiesel production
on the merit of the higher lipid content as well as fairly good growth parameters.
Comparatively high biomass as well as lipid productivity noticed in all the isolated
algae suggested that significant increase in biomass and lipid productivity could be achieved
through open culture than controlled lab culture. Therefore, open culture could play an
important role in energy and cost efficient biodiesel production. Moreover, culturing
microalgae for biodiesel production requires least land area and holds an important key
feature for effective land utilization, without compromising on agricultural land as the former
generation feedstock. The locally isolated microalgae hold a great potential as feedstock for
large scale biodiesel production provided the lipid as well as biomass production are
augmented through biochemical and genetic engineering approaches.
46 | P a g e
Analysis of FAME derived fuel properties of the five isolated microalgal strains
revealed that all the fuel properties of Oscillatoria sp. and T. weissflongii completely satisfied
the specifications set by the biodiesel standards ASTM D6751, EN 14214 and ISO 3675/P32.
Lack of PUFAs (≥2) in L. undulatum resulted in higher values of kV, CN, CP and PP for
biodiesel than that prescribed by biodiesel standards. Even though D. communis and N.
oceanica showed excellent cold flow properties, they showed high DU and IV and very low
OS, degrading the quality of biodiesel. The study confirmed the importance of combined
parameters such as FAME profile and Growth kinetic parameters to discover potent strains
for biodiesel production. One parameter alone could not give a clear picture about the
biodiesel production potential of algal strain. The study underlines that it is important to
characterize the fatty acid profile when proposing the utility or potential of microalgal lipids
as a biodiesel feedstock. The study also revealed significance of locally abundant algae
because all isolated algae have fairly good biomass productivity and were grown without
much contamination.
47 | P a g e
7. OUTCOMES OF THE PROJECT
• Five diatom strains were screened for methodology standardization and optimization for
assessment of biodiesel production potential.
• Based on Growth kinetic parameters, FAME profiles and Analytic Hierarchy Process
(AHP) identified Navicula sp. as the ideal biodiesel feedstock, followed by Thalassiosira
sp. The study also found that Nitzschia sp. is inferior as a viable biodiesel feedstock.
• Of the five locally isolated microalgae (T. weissflongii, L. undulatum, N. oceanica,
Oscillatoria sp. and D. communis) N. Oceanica and L.undulatum were the highest
biomass and lipid producers and Oscillatoria sp. exhibited lower biomass and lipid
productivity.
• Annual biomass productivity of all the isolated microalgae ranged from 5.87 (Oscillatoria
sp.) to 22.22 (N.oceanica) tonne/ha/year and the corresponding lipid productivity varied
from 0. 93 (Oscillatoria sp.) to 4.73(N.oceanica) tonne/ha/year.
• Comparatively higher biomass as well as lipid productivity noticed in all the isolated algae
suggested that significant increase in biomass and lipid productivity could be achieved
through open culture than controlled lab culture.
• T. weissflongii identified as the most promising microalgal strain for biodiesel potential
based on fairly good growth kinetic parameters, good FAME profile and biodiesel fuel
properties.
• Oscillatoria sp. was found to be ideal feedstock based on desirable FAME profile and
biodiesel fuel properties. But the biomass and lipid productivity was low for cost efficient
biodiesel production.
• Even though D. communis and N. oceanica showed excellent cold flow properties, they
showed high DU and IV and very low OS, degrading the quality of biodiesel.
• L. undulatum resulted higher values of kV, CN, CP and PP for biodiesel than that
prescribed by biodiesel standards due to lack of PUFA and higher concentration of SFAs.
• The study suggested the utility of combined parameters such as biomass productivity, lipid
content, lipid productivity and FAME profile to screen the best potent microalgal strain
biodiesel production.
• The study also recommended locally isolated microalgae that hold great promise as
feedstock for large scale biodiesel production, provided the lipid as well as biomass
production are augmented through biochemical and genetic engineering approaches.
48 | P a g e
Research Publications
International Journals
1. Manju Mary Joseph, Renjith, K. R., Gaby John, Muraleedharan Nair, S.,
Chandramohanakumar, N., 2017. Biodiesel prospective of five diatom strains
using growth parameters and fatty acid profiles. Biofuels, 8(1): 81-89.
2. Manju Mary Joseph, Renjith, K. R., Gaby John, Muraleedharan Nair, S.,
Chandramohanakumar, N. Marine centric diatom, Lithodesmium undulatum as
biodiesel feed stock Communicated to Biomass and Bioenergy (Under Review)..
3. Manju Mary Joseph, Renjith, K. R., Gaby John, Muraleedharan Nair, S.,
Chandramohanakumar, N. Comparison of biodiesel production potential three
genus of microalgae. Communicated to Marine and Freshwater Research (Under
Review).
National Journals: Nil
International Seminar
1. Manju Mary Joseph, Byju, K., Prasobh Peter, K.J., Muraleedharan Nair, S.,
Chandramohanakumar, N., 2014. Environmentally Benign Alternatives for the
Sustainable Management of Water Hyacinth, "The Blue Devil" from Vembanad
Lake. International seminar Tropical Ecology Congress-2014 “Ecosystems
Tropical Ecosystems in a Changing World” conducted at Jawaharlal Nehru
University (JNU), New Delhi.
National Seminar: Nil
49 | P a g e
8. SCOPE OF FUTURE WORK
Glycerol, the by-product of the transesterification reaction in the production of
biodiesel, needs to be quantified and studied for economical utilisation. The crude glycerol
obtained is impure and of little economic value. Given the current glut of crude glycerol in
the market, mainly due to the global biodiesel industry booming, various studies on
alternative uses have been developed such as combustion, composting, animal feed,
thermochemical conversions and biological conversion methods. Very few studies have used
glycerol as a carbon source for microalgae growth (Mixotrophic culture), there is no
information about which are the most appropriate concentrations for the cultivation of
microalgae, and which are the effects of this compound in the production of biomolecules.
Even though two of the locally isolated microalgae (D. communis and N. Oceanica)
were found inferior as biodiesel feedstock in terms of fatty acid profile, the nutritive aspects
as well as health benefits of these species should not be overlooked. In the study, PUFAs like
Omega-3 fatty acids were found abundant in these species, for eg. C20:5n3
(Eeicosapentanoic acid) in N. oceanic and C18:3n3 (α-Linilenic acid) in D. communis.
The diatom species such as Navicula sp., Thalassiosira sp. and T. weissflongii,, which
were found to be excellent biodiesel feedstock in terms of ideal fatty acid profiles should be
subjected to further trials to enhance the growth kinetic parameters for cost effective
biodiesel production. Even though annual yield on the basis of biomass and lipid productivity
were assessed for these diatom strains, conditions to augment the yield should be optimised
through proper biochemical and genetic engineering technologies.
50 | P a g e
9. BIBLIOGRAPHY
Abou-Shanab, R.A.I., Jae-Hoon, H., Yunchul, C., Booki, M., Jeon, B.H., 2011a.
Characterization of microalgal species isolated from fresh water bodies as a potential
source for biodiesel production. Applied Energy, 88: 3300-3306.
Allen, M. M., Stanier, R.Y., 1968. Growth and division of some unicellular blue-green algae.
Journal of General Microbiology, 51:199–202.
Anahas, A.M.P., Muralitharan, G., 2015.Isolation and screening of heterocystous
cyanobacterial strains for biodiesel production by evaluating the fuel properties from
fatty acid methyl ester (FAME) profiles. Bioresource Technology, 184 : 9–17.
Andersen, R.A. 2005. Algal culturing techniques. Ist Ed: Academic Press.
Anjorin, R., 2011. Selection of microalgae strains for biodiesel production. M.Sc. Thesis.
Cranfield University, Cranfield, United Kingdom.
Bajpai, D., Tyagi, V.K., 2006. Biodiesel: source, production, composition, properties and its
benefits. Journal of Oleo Science, 55: 487–502.
Barman, N., Satpati, G.G., Sen Roy, S., Khatoon, N. , Sen, R., Kanjilal, S., Prasad, R.B.N.,
Pal, R., 2012. Mapping Algae of Sundarban Origin as Lipid Feedstock for Potential
Biodiesel Application. Journal of Algal Biomass Utilization, 3: 42-49.
Barnwal, B.K., Sharma, M.P., 2005. Prospects of biodiesel production from vegetables oils in
India. Renewable and Sustainable Energy Reviews, 9:363–378.
Bogen, C., Klassen, V., Wichmann, J., Russa, M.L., Doebbe, A., Grundmann, M., Uronen, P.,
Kruse, O., Mussgnug, J., H., 2013. Identification of Monoraphidium contortum as a
promising species for liquid biofuel production. Bioresource Technololoy, 133: 622–
626.
Bold, H.C., Wynne, M.J, 1985. Introduction to the algae structure and reproduction. 2nd
edition. Englewood Cliffs, NJ: Prentice-Hall Inc.
Bowler, C., Karl, D.M., Colwell, R.R., 2009. Microbial oceanography in a sea of opportunity.
Nature, 459:180–184.
Brown, A.C., Knights, B.A., Conway, E., 1969. Hydrocarbon content and its relationship to
physiological state in the green alga Botryococcus braunii. Phytochemistry, 8: 5.
Bucy, H.B., Baumgardner, M.E., Marchese, A.J., 2012. Chemical and physical properties of
algal methyl ester biodiesel containing varying levels of methyl eicosapentaenoate and
methyl docosahexaenoate. Algal Research, 1:57–69.
Chisti, Y., 1980–81. An unusual hydrocarbon. Journal of Ramsay Society, 27–28: 24–26.
Chisti, Y., 2007. Biodiesel from microalgae. Biotechnology Advances, 25: 294–306.
51 | P a g e
Chisti, Y., 2008b. Response to Reijnders: Do biofuels from microalgae beat biofuels from
terrestrial plants? Trends in Biotechnology, 26: 351-352.
Chisti,Y., 2008a. Biodiesel from microalgae beats bioethanol. Trends in Biotechnology,
26:126–131.
Chiu, S. Y., Kao, C.Y., Tsai, M.T., Ong, S.C., Chen, C.H., Lin, C.S., 2009. Lipid
accumulation and CO2 utilization of Nannochloropsis oculata in response to CO2
aeration. Bioresource Technology, 100: 833-838.
Christie, W.W. 1982. The preparation of derivatives of lipids. In Lipid Analysis. (2nd edn.),
Pergamon Press Ltd, 52–53 pp.
d’Ippolito, G., Sardo. A., Paris, D., Vella, F.M.,.Adelfi, M.G., Botte, P., Gallo, C., Fontana,
A., 2015. Potential of lipid metabolism in marine diatoms for biofuel production.
Biotechnology for Biofuels, 8:1-10.
Davis, R., Aden, A., Pienkos, P.T., 2011. Techno-economic analysis of autotrophic
microalgae for fuel production. Applied Energy, 88:3524–3531.
Demirbas, A., 1998. Fuel properties and calculation of higher heating values of vegetable
oils. Fuel, 77:1117–1120.
Dubois, M.K., Gilles, J.K., Hamilton, P.A., Rebers, Smith, F., 1956. Colorimetric method for
determination of sugars and related substances. Analytical Chemistry, 28:350-356.
Duong, V.T., Li, Y., Nowak, E., Schenk, P.M., 2012. Microalgae Isolation and Selection for
Prospective Biodiesel Production. Energies, 5:1835-1849.
Ehrenberg, C. G., 1839. Uber jetzt wirklich noch zahlreich lebende Thier-Arten der
Kreidefomation der Erde. Bericht iiber die zur Bekanntmachung geeigneten
Verhandlungen der Koniglich Preussischen Akademie der Wissenschaften zu Berlin,
1839:152-1 59.
Elumalai, S., Prakasam, V., 2011. Lipid Granules Staining (Nile Red and Bodypy) of
Different Biofuel Producing Fresh Water Microalgae Growing under Various Stress
Conditions. Journal of Experimental Sciences, 2: 65-67.
Fawley, K.P., Fawley, M.W., 2007.mObservations on the diversity and ecology of freshwater
Nannochloropsis (Eustigamtophyceae), with descriptions of new taxa. Protist
158(3):325-336
Felizardo, P., Correia, M.J.N., Raposo, I., Mendes, J.F., Berkemeier, R., Bordado, J.M.,
2006. Production of biodiesel from waste frying oil. Waste Managagement, 26:487–
494.
52 | P a g e
Field, C.B., Behrenfeld, M.J., Randerson, J.T., Falkowski, P., 1998. Primary production of
the biosphere: integrating terrestrial and oceanic components. Science, 281: 237–240.
Folch, J., Lees, M., Sloane-Stanley, G.H., 1957. A Simple Method for the Isolation and
Purification of Total Lipides from Animal Tissues. Journal of Biological Chemistry,
226: 497–509.
Francisco, E.C., Neves, D.B., Jacob Lopes, E., Franco, T.T., 2010. Microalgae as feedstock
for biodiesel production: carbon dioxide sequestration, lipid production and biofuel
quality. Journal of Chemical Technology and Biotechnology, 85: 395–403.
Fritsch, H.W., Graham, O.P., Iyengar, D.A., Johansen, H.H., Johnson, B.H., Kethcum, G.F.,
Papenfuss, G.W., Prescott, E.G., Pringshsheim, H.H., Strain. L.H., Tiffany, L.H.,
1951.Manual of phycology: an introduction to the algae and their biology. Waltham,
Mass., USA: Chronica Botanica Co.
Fukuda, H., Kondo, A., Noda, H., 2001. Biodiesel fuel production by transesterification of
oils. Journal of Bioscience Bioengineering, 92: 405–416.
Gavrilescu, M., Chisti, Y., 2005. Biotechnology — a sustainable alternative for chemical
industry. Biotechnology Advances, 23: 471–499.
Government of India, 2008. National Policy on Biofuels.
Griffiths, M.J., Harrison, S.T.L., 2009. Lipid productivity as a key characteristic for
choosing algal species for biodiesel production. Journal of Applied Phycology, 21:
493–507.
Griffiths, M.J., van Hille, R.P., Harrison, S.T.L., 2012. Lipid productivity, settling
potential and fatty acid profile of 11 microalgal species grown under nitrogen replete
and limited conditions. Journal of Applied Phycology, 24:989–1001.
Guillard, R.R., Ryther, J.H., 1962. Studies ofmarine planktonic diatoms. I. Cyclotella nana
Hustedt, and Detonula confervacea (Cleve) Gran. Canadian Journal of
Microbiology, 8: 229–239.
Hegewald, E., Hanagata, N., 2000. Phylogenetic studies on Scenedesmaceae (Chlorophyta).
Archiv für Hydrobiologie, 136: 29–49.
Hickman, M.,2000. A brief Introduction to algae botany 333, laboratory manual. Edm.
Canada: University of Alberta.
Hoekman, S.K., Broch, A., Robbins, C., Ceniceros, E., Natarajan, M., 2012. Review of
biodiesel composition, properties, and specifications. Renewable Sustainable Energy
Reviews, 16: 143–169.
53 | P a g e
Hsieh, C.H., Wu, W.T., 2009. Cultivation of microalgae for oil production with a cultivation
strategy of urea limitation. Bioresource Technology, 100:3921-3926.
Hu, Q., Sommerfeld, M., Jarvis, E., Ghirardi, M., Posewitz, M., Seibert, M., Darzins, A.,
2008. Microalgal triacylglycerols as feedstocks for biofuel production: perspectives and
advances. The Plant Journal, 54: 621-639.
Huerlimann, R., de Nys, R., Heimann, K., 2010. Growth, lipid content, productivity, and
fatty acid composition of tropical microalgae for scale-up production. Biotechnology
and Bioengineering., 107: 245-257.
Ishida, Y, Hiragushi, N., Kitaguchi, H., Mitsutani, A., Nagai, S., Yoshimura, M., 2000. A
highly CO2- tolerant diatom, Thalassiosira weissflogii H1, enriched from coastal sea,
and its fatty acid composition. Fisheries Science, 66:655-659.
Islam, M.A., Ayoko, G.A., Brown, R, Stuart, D, Magnusson, M, Heimann, K, (2013)
Influence of fatty acid structure on fuel properties of algae derived biodiesel. Procedia
Engineering, 56: 591–596.
Jena, J., Nayak, M., Panda, H.S., Pradhan, N., Sarika, C., Panda, P.K.U., Rao, V.S.K.,
Prasad, B.N., Sukla, L.B., 2012. Microalgae of Odisha Coast as a Potential Source for
Biodiesel Production. World Environment, 2: 11-16.
Johansson, D.J., Azar, C., 2007. A scenario-based analysis of land competition between food
and bioenergy production in the United States. Climatic Change, 82: 267–291.
John, D.M., Whitton,B.A., Brook, A.J.,2002.: The freshwater algal flora of the British isles:
an identification guide to freshwater and terrestrial algae. London, England: Cambridge
University Press.
Kaur, S., Sarkar, M., Srivastava, R.B., Gogoi,H.K., Kalita, M.C., 2012. Fatty acid profiling
and olecular characterization of some freshwater microalgae from India with potential
for biodiesel production. New Biotechnology, 29:332-344
Knothe, G. 2011. A technical evaluation of biodiesel from vegetable oils vs. algae. Will
algae-derived biodiesel perform? Green Chemistry, 13: 3048–3065.
Knothe, G., 2005. Dependence of biodiesel fuel properties on the structure of fatty acid alkyl
esters. Fuel Process Technology, 86:1059-1070.
Knothe, G., 2006. Analyzing biodiesel: standards and other methods. Journal of American
Oil Chemical Society, 83: 823–833.
Knothe, G., 2009. Improving biodiesel fuel properties by modifying fatty ester composition.
Energy and Environmental Science, 2: 759–766.
54 | P a g e
Knothe, G., Bagby, M.O., Ryan III, T.W., 1998. Precombustion of fatty acids and esters of
biodiesel. A possible explanation for differing cetane numbers. Journal of American
Oil Chemical Society,75:1007–1013.
Knothe, G., Dunn, R.O., Bagby, M.O., 1997. Biodiesel: the use of vegetable oils and their
derivatives as alternative diesel fuels. ACS Symposium Series, 666:172–208.
Kulkarni, M.G., Dalai, A.K., 2006.Waste cooking oil-an economical source for biodiesel: A
review. Industrial and Engineering Chemistry Research, 45: 2901- 2913.
Lam, M.K., Lee, K.T., 2011. Renewable and sustainable bioenergies production from palm
oil mill effluent (POME): win–win strategies toward better environmental protection.
Biotechnology Advances, 29:124–41.
Lam, M.K., Lee, K.T., Rahmanmohamed, A., 2009.Life cycle assessment for the production
of biodiesel: a case study in Malaysia for palm oil versus jatropha oil. Biofuels
Bioproducts Biorefining, 3:601–12.
Lee, I., Johnson, L.A., Hammond, E.G., 1995. Use of branched-chain esters to reduce the
crystallization temperature of biodiesel. Journal of American Oil Chemical Society,
72: 1155-1160.
Lee, I., Johnson, L.A.. Hammond, E.G., 1995.Journal of American Oil Chemical Society,
72: 1155.
Li Y, Horsman, M., Wu, N., Lan, C.Q., Dubois Calero, N., 2008. Biofuels from microalgae,
Biotechnology Progress, 24: 815–820.
Li, Y., Horseman, M., Wang, B., Wu, N., Lan, C.Q., 2008. Effects of nitrogen sources on cell
growth and lipid accumu-lation of green alga Neochloris oleoabundans. Applied.
Microbiology and Biotechnology, 81:629–636.
Linkov, I., Steevens, J. 2008. Appendix A: multi-criteria analysis. Advances in experimental
medicine and biology; Cyanobacterial harmful algal blooms, state of the science and
research needs. Symposium [chapter 35]. 619:815–830.
Liu, J., Huang, J., Sun, Z., Zhong, Y., Jiang, Y., Chen, F., 2011. Differential lipid and fatty
acid profiles of photoautotrophic and heterotrophic Chlorella zofingiensis: assessment
of algal oils for biodiesel production. Bioresource Technology, 102: 106–110.
Liu, Z.Y., Wang, G.C., Zhou, B.C., 2008. Effect of iron on growth and lipid accumulation in
Chlorella vulgaris. Bioresource Technology, 99: 4717-4722.
Lowry, O.H., Rosebrough, N.J., Fart, A.L., Randall, R.J., 1951. Protein measurement with
Folin phenol reagent. Journal of Biological Chemistry, 193: 265-275.
55 | P a g e
Mandal, S., Mallick, N., 2012. Biodiesel production by the green microalga Scenedesmus
obliquus in a recirculatory aquaculture system. Applied and Environmental
Microbiology, 78: 5929-5933.
Matsumoto, M.,Sugiyama, H., Maeda, Y.,Sato, R.,Tanaka, T.,Matsunaga, T. 2009. Marine
Diatom, Navicula sp. Strain JPCC DA0580 and Marine Green Algae, Chlorella sp.
Strain NKG400014 as potential sources for biodiesel production. Applied
Biochemistry and Biotechnology, 161:483-490
Meher, L.C., Vidya Sagar, D., Naik, S.N., 2006. Technical aspects of biodiesel production by
transesterification- a review. Renewable and Sustainable Energy Reviews, 10:248–
268.
Meng, X., Yang, J. M., Xu, X., Zhang, L., Nie, Q.J., Xian, M., 2009. Biodiesel production
from oleaginous microorganisms. Renewable Energy, 34: 1-5.
MoEF (Ministry of Environment and Forests, Government of India), 2010. India: Greenhouse
Gas Emissions 2007.
Mohan, P., Hanumantha Rao, R., Ranjith Kumar, Sivasubramanian, V., 2010. Mass
Cultivation of Chroococcus turgidus and Oscillatoria sp. and Effective Harvesting of
Biomass by Low-cost methods. Nature Proceedings,
http://dx.doi.org/10.1038/npre.2010.4331.1.
Mulbry, W., Kondrad, S. , Buyer, J., 2008. Treatment of dairy and swine manure effluents
using freshwater algae: fatty acid content and composition of algal biomass at different
manure loading rates. Journal of Applied Phycology, 20: 1079-1085.
Musharraf, S.G., Ahmed, M. A., Zehra, N., Kabir, N., Choudhary, M.I., Rahman, A., 2012.
Biodiesel production from microalgal isolates of southern Pakistan and quantification
of FAMEs by GC-MS/MS analysis. Chemistry Central Journal, 6:149.
Nagle, N., Lemke, P., 1990. Production of methyl-ester fuel from microalgae. Applied
Biochemistry and Biotechnology, 24–25:355–361.
Nascimento, I.A., Marques, S.S.I., Cabanelas, I.T.D., Pereira, S.A., Druzian, J.I., de Souza,
C.O., Vich, D.V., de Carvalho, G.C., Nascimento, M.A., 2013. Screening microalgae
strains for biodiesel production: lipid productivity and estimation of fuel quality based
on fatty-acids profiles as selective criteria. BioEnergy Research, 6:1–13.
Nwokoagbara, E., Olaleye, A.K., Wang, M., 2015. Biodiesel from microalgae: The use of
multi-criteria decision analysis for strain selection. Fuel. 159:241-249.
56 | P a g e
Pankaj Kumar, M.R., Suseela, Kiran Toppo, 2011. Physico-Chemical Characterization of
Algal oil: a Potential Biofuel. Asian Journal of Experimental Biological Science, 2:
493-497.
Qasim, S.Z., 2003. Indian Estuaries. Allied Publication Pvt. Ltd., Heriedia Marg, Ballard
estate, Mumbai, 259 pp.
Ramachandra, T.V., Mahapatra, D.M., Gordon, R., Karthick, B., 2009. Milking diatoms for
sustainable energy: biochemical engineering versus gasoline-secreting diatom solar
panels. Industrial and Engineering Chemistry Research, 48: 8769–8788.
Ramírez-Verduzco, L.F., Rodríguez-Rodríguez, J.E., Jaramillo-Jacob Ad, R., 2012.
Predicting cetane number, kinematic viscosity, density and higher heating value of
biodiesel from its fatty acid methyl ester composition. Fuel, 91:102–111.
Rodolfi, L., Chini Zittelli, G., Bassi, N., Padovani, G., Biondi, N., Bonini, G., Tredici, M.R.,
2009. Microalgae for oil: strain selection, induction of lipid synthesis and outdoor mass
cultivation in a low-cost photobioreactor. Biotechnology and Bioengineering, 102: 100–
112.
Roessler, P.G., 1990. Environmental control of glycerolipid metabolism in microalgae:
commercial implications and future research directions. Journal of Phycology, 26: 393-
399.
Roncarati, A., Meluzzi, A., Acciarri, S., Tallarico, N., Melotti, P., 2004. Fatty acid
composition of different microalgae strains (Nannochloropsis sp., Nannochloropsis
oculata (Droop) Hibberd, Nannochloris atomus Butcher and Isochrysis sp.) According
to the culture phase and the carbon dioxide concentration. Journal of the World
Aquaculture Society, 401–411.
Sala, S.E., 1997.Diatom flora of Paso de las Piedras impounding , Buenos Aires Province :
Order Centrales. Gayana Botanica, 54:1-14.
Sarin, A., Arora, R., Singh, N.P., Sarin, R., Malhotra, R.K. , Kundu, K., 2009. Effect of
blends of Palm–Jatropha–Pongamia biodiesels on cloud point and pour point. Energy,
34: 2016–2021.
Sawayama, S., Inoue, S., Dote, Y.D., Yokoyama, S.Y., 1995. CO2 fixation and oil production
through microalga. Energy Conversion Management, 36:729-731.
Sheehan, J., Dunahay, T., Benemann, J., Roessler, P., 1998. A Look Back at the U.S.
Department of Energy’s Aquatic Species Program: Biodiesel from Algae. National
Renewable Energy Laboratory, Golden, Colorado, USA.
57 | P a g e
Shinoj, P., Raju, S.S., Joshi, P.K., 2011. India’s biofuels production programme: Need for
prioritizing alternative options. Indian Journal of Agricultural Sciences, 81(5): 391-
397.
Siraj, S., Mikhailov, L., Keane, J.A., 2015. "PriEsT: an interactive decision support tool to
estimate priorities from pairwise comparison judgments". International Transactions in
Oprerational Research, 22: 217–235.
Song, M.M., Pei, H.Y., Hu, W.R., Ma, G.X., 2013. Evaluation of the potential of 10
microalgal strains for biodiesel production. Bioresource Technology, 141: 245–251.
Song, D, Fu, J., Shi, D., 2008. Exploitation of oil-bearing microalgae for biodiesel. Chinese
Journal of Biotechnology, 24:341–8.
Tang, H.,Abunasser, N., Garcia, M., Chen, M.,Ng, K.S., Salley, S.O., 2011.Potential of
microalgae oil from Dunaliella tertiolecta as a feedstock for biodiesel. Applied
Energy, 88: 3324–3330.
Tedoy, R., 2008. National Urban Policy and its implication. Transport Research, New Delhi,
ND, 3, 13-17.
Tredici, M.R., 2010. Photobiology of microalgae mass cultures: understanding the tools for
the next green revolution. Biofuels, 1:143–62.
Tsukahara, K, Sawayama, S., 2005. Liquid fuel production using microalgae. Journal of
Japan Petroleum Institute, 48:251–9.
US EIA (US Energy Information Administration),2016. EIA country Analysis Brief: India,
US Department of Energy, Washington DC.
Valdez-Ojeda, R., González-Muñoz, M., Us-Vázquez, R., Narváez-Zapata, J., Chavarria-
Hernandez, J.C., López-Adrián, S., Barahona-Pérez, F., Toledano-Thompson, T.,
Garduño-Solórzano e, G., Escobedo-Gracia Medrano, R.M., 2015. Characterization of
five fresh water microalgae with potential for biodiesel production. Algal Research,
7:33–44.
Van Gerpen, J., 2005. Biodiesel processing and production. Fuel Processing Technology,
86:1097–107
Vrieling, E.G., Beelen, T. P. M., Van Santen, R. A., Gieskes, W. W. C., 1999. Diatom
silicon biomineralization as an inspirational source of new approaches to silica
production. Journal of Biotechnology, 70:39-51.
Walne, P.R., 1970. Studies on the food value of nineteen genera of algae to juvenile bivalves
of the genera Ostrea, Crassostrea, Mercenaria, and Mytilis. Fish Investigation, 26:162.
58 | P a g e
Wang, L.B., Yu, H.Y., He, X.H., Liu, R.Y., 2012. Influence of fatty acid composition of
woody biodiesel plants on the fuel properties. Journal of Fuel Chemistry and
Technology, 40:397–404.
Xu, H., Miao, X., Wu, Q., 2006. High Quality Biodiesel Production from a Microalga
Chlorella protothecoides by Heterotrophic Growth in Fermenters. Journal of
Biotechnology, 126: 499-507.
****************
