ISOLATION AND CHARACTERIZATION OF FUNGAL ENDOPHYTES FROM CERTAIN MEDICINAL PLANTS AND RET

SPECIES IN WESTERN GHATS AND THEIR THERAPEUTIC POTENTIALS

FINAL TECHNICAL REPORT

BACK TO LAB PROGRAMME (Sanction No: 702/2012/KSCSTE dated 30/10/2012)

WOMEN SCIENTISTS DIVISION

KERALA STATE COUNCIL FOR SCIENCE TECHNOLOGY AND ENVIRONMENT

GOVT. OF KERALA

Project Period : 30/10/2012 to 08/04/2016

Principal Investigator: Dr. Thulasi. G. Pillai

DEPARTMENT OF FOREST PATHOLOGY

KERALA FOREST RESEARCH INSTITUTE, PEECHI

THRISSUR - 680653, KERALA

APRIL 2016

- 2 -

AUTHORIZATION

The work entitled “Isolation and characterization of fungal endophytes from

certain medicinal plants and RET species in Western Ghats and their therapeutic

potentials” by Dr. Thulasi G Pillai, was carried out under the “Back to lab

programme” of Women Scientists Division, Kerala State Council for Science

Technology and Environment, Govt. of Kerala. The work was carried out at

Department of Forest Pathology, Kerala Forest Research Institute, Peechi,

Thrissur, Kerala - 680 653. The project was initiated wide sanction No:

702/2012/KSCSTE dated 30/10/2012, with scheduled completion by 29/10/2015.

The field and laboratory works were completed by October 2015, however an

additional period of 6 month was given (without additional financial

commitments) for compilation of results and preparation of final report as

required by the Principal Investigator. The project was completed on 08/04/2016

with a financial expenditure of Rs. 16.2921 lakhs.

- 3 -

ACKNOWLEDGMENTS

I am deeply indebted to Kerala State Council for Science, Technology and

Environment for the financial aid through “Back to Lab program for Women” which

helped me to get an independent project with great exposure leading to career

development. I am highly obliged to Kerala Forest Research Institute for providing me

necessary facilities and logistical support for carrying out the field work as well as

laboratory experiments during the course of the project. I am grateful to Dr. K.R. Lekha,

Head, Women Scientists Division for the encouragement and support throughout the

tenure of the project. I am grateful to Dr. R. Jayaraj, Scientist mentor, KFRI for giving

consent to become the mentor of the Project.

Words are not enough to express my heartfelt gratitude to all The Directors and

Registrars of KFRI during the tenure of the project for the support to make this endeavor

a success. I am greatly indebted to Dr. K.V. Sankaran, The then Director, for the immense

help in writing and implementing the project at KFRI. I express my heartfelt gratitude to

Dr. V.V. Sudeendrakumar, Head and Program Coordinator of Forest Health Division, for

the excellent moral support, encouragement and providing all the facilities and making

all necessary arrangements for the successful completion of the Project. I am grateful to

Dr.E.A. Jayson, Research Co-ordinator, KFRI, for the timely help and valuable advice. I

am cordially obliged to Dr.E.M. Muralidharan, Head and Program Coordinator,

Department of Biotechnology, KFRI, for the immense moral support. The morale boosting

words helped to overcome many dispiriting moments.

I am extremely privileged to be associated with Dr. T. Muthukumar, Assistant

Professor, Department of Botany, Bharathiyar University, who taught me what Mycology

is. The excellent guidance, encouragement and the delightful patience are inimitable. I am

deeply obliged to Dr. D. Karunagaran, Professor and Head, Department of Biotechnology,

IIT Madras for permitting me to carry out my anti-cancer work in his lab and providing

me an excellent working atmosphere. I am grateful to Dr. N. Sasidaran, Scientist (Rtd.),

KFRI, for helping in identification and collection of plants.

I am also grateful to Dr. P.S. Easa, Director, KFRI and Shri. K. Satheesakumar,

Registrar for the great help in administrative and financial formalities for the smooth

functioning of the project. I express my sincere gratitude to Dr. T.K. Damodaran, Head

and Program Co-ordinator, Wood science and Technology, KFRI, for the excellent

support and encouragement.

I am also grateful to Dr.T.V. Sajeev, Head and Program Coordinator, Department

of Pathology, for the immense support and help in carrying out my project work. I am

also grateful to Dr. G.E.M. Swamy, Scientist, Co-mentor of the Project. I am grateful to all

the scientific and non-scientific staff of KFRI and Research fellows for their kind

cooperation.

Thulasi G Pillai

- 4 -

CONTENTS

1. ABSTRACT 5

2. INTRODUCTION AND REVIEW OF LITERATURE 6

3. OBJECTIVES 20

4. MATERIALS AND METHODS 21

5. RESULTS AND DISCUSSION 27

6. SUMMARY 45

7. OUTCOMES OF THE PROJECT 47

8. SCOPE OF FUTURE WORK 48

9. BIBLIOGRAPHY 49

- 5 -

ABSTRACT

True endophytes have been evolving with the host for millions of years. The

endophytes play important role in the survival and protection of the plant against

harsh environment and adverse conditions. The present study was carried out to

identify true endophytic fungi from three important medicinal plants - Aerva

lanata, Emelia sonchifolia and Cynometra travancorica, isolate and establish the

therapeutic potential of the secondary metabolites produced by them. Two true

endophytes were isolated from C. travancorica – Colletotrichum gloeospoiriodes from

leaves and Diaporthe eres from stem. Fusarium equiseti was isolated from leaves,

stem and root of A. lanata. Emelia sonchifolia did not any associations with fungi.

Secondary metabolites were isolated from C. gloeosporiodes and F. equiseti. No

metabolites were obtained from D. eres. One of the compounds isolated from C.

gloeospoiriodes, Compound A, was found to have cytotoxic activity and anticancer

activity in colon cancer cell lines SW620. The properties of compounds B isolated

from C. gloeosporiodes, and the compounds C and D isolated from A. lanata needs

further investigation. The findings suggest that the terpenoids from C.

gloeosporiodes possess significant anticancer activity and warrants further scientific

investigations. .

- 6 -

1. INTRODUCTION

Endophytes are organisms that spend the whole life or part of their life cycle in

the symplast or apoplast region of healthy plant tissues without causing any

disease or pathological symptoms. These organisms include bacteria, fungi, algae

and actinomycetes. Some fungal endophytes are able to produce some bioactive

compounds which are sometimes produced by the host plants also, e.g., Fusarium

fujikorai producing gibberellins [1]. Over 8,600 bioactive metabolites of fungal

origin have been described [2]. Endophytes of medicinal plants and trees and

their potential use are a most promising resource, which awaits exploration.

Reports from the earlier studies reveal that active metabolites produced by

endophytic fungus isolated from the medicinal plants and trees have medicinal

importance. Their therapeutic application can be exploited for human diseases in

future. The Western Ghats is very rich in its medicinal plant wealth. The forests

and hills of this region is a treasure house of about 700 medicinal plants of which

some are used in traditional and folk medicine. Many are exploited commercially

for their enzymes. The limited knowledge on the varied use of the medicinal

plants, their availability and extent of distribution limits efficient use of these

resources. Endophytes of medicinal plants and their potential use are a most

promising resource, which awaits exploration.

Practical applications of endophytes are as biocontrol agents and sources of novel

metabolites for medicine. These also include plant protection and industrial uses

and as research model systems for investigations of host parasite interactions and

evolution in natural systems [3]. The present study was aimed at isolation and

characterization of endophytic fungi from 2 important medicinal plants- Aerva

lanata and Emelia sonchifolia and a rare, endangered and threatened species,

Cynometra travancorica and to explore their therapeutic potentials.

2. REVIEW OF LITERATURE

Filamentous fungi are well known producers of secondary metabolites [4]. A

literature survey covering more than 23,000 bioactive microbial products i.e.,

- 7 -

antifungal, antibacterial, antiviral, cytotoxic and immunosuppressive agents

shows that fungi are the main source of these products. Reports also suggest that

endophytes elicit plants to produce enhanced amount of secondary metabolites

[5]. Endophytes have major influences on plant distribution, ecology, physiology

and biochemistry [6]. On the other hand, the factors influencing the distribution

of endophytes within and between hosts and regions are atmospheric humidity,

plant density and associations, tissue type, air pollutants, stand management

practices, anthropogenic modifications etc [7-9].

Endophytes are microorganisms that reside asymptomatically in the tissues of

higher plants and are a promising source of novel organic natural metabolites

exhibiting a variety of biological activities. The term “endophytes” includes a suite

of microorganisms that grow intra-and/or intercelullarly in the tissues of higher

plants without causing over symptoms on the plants in which they live, and have

proven to be rich sources of bioactive natural products [10, 11]. Mutualism

interaction between endophytes and host plants may result in fitness benefits for

both partners [12]. The endophytes may provide protection and survival

conditions to their host plant by producing a plethora of substances which, once

isolated and characterized, may also have potential for use in industry,

agriculture, and medicine [13-14]. Approximately 3,00,000 plant species growing

in unexplored area on the earth are host to one or more endophytes [15], and the

presence of biodiverse endophytes in huge number plays an important role on

ecosystems with greatest biodiversity, for instance, the tropical and temperate

rainforests [14], which are extensively found in Brazil and possess almost 20% of

its biotechnological source [16]. Considering that only a small amount of

endophytes have been studied, recently, several research groups have been

motivated to evaluate and elucidate the potential of these microorganisms applied

in biotechnology focusing on the production of bioactive compounds. The

production of bioactive substances by endophytes is directly related to the

independent evolution of these microorganisms, which may have incorporated

genetic information from higher plants, allowing them to better adapt to plant

host and carry out some functions such as protection from pathogens, insects, and

- 8 -

grazing animals [15]. Endophytes are chemical synthesizer inside plants [17], in

other words, they play a role as a selection system for microbes to produce

bioactive substances with low toxicity toward higher organisms [15]. Natural

bioactive compounds produced by endophytes have potential uses in safety and

human health, even though there is significant demand for synthetic products in

drug industry due to economic reasons [13]. Problems related to human health

such as the development of drug resistance towards human pathogenic bacteria,

fungal infections, and life threatening virus claim for new therapeutic agents for

effective treatment of diseases in human, plants, and animals that are currently

unmet [14, 15, 17]. Recent review by Newman and Cragg [18] presented a list of

all approved agents from 1981 to 2006, reveals that a significant number of natural

drugs are produced by microbes and/or endophytes.

Endophytes provide a broad variety of bioactive secondary metabolites with

unique structure, including alkaloids, benzopyranones, chinones, flavonoids,

phenolic acids, quinones, steroids, terpenoids, tetralones, xanthones, and others

[11]. Such bioactive metabolites find wide-range of application as agrochemicals,

antibiotics, immunosuppressants, antiparasitics, antioxidants, and anticancer

agents [19]. Methods to obtain bioactive compounds include the extraction from a

natural source, the microbial production via fermentation, or microbial

transformation. Extraction from natural sources presents some disadvantages

such as dependency on seasonal, climatic and political features and possible

ecological problems involved with the extraction, thus calling for innovative

approaches to obtain such compounds [20].

Biotechnological techniques by using different microorganisms appears to be a

promising alternative for establishing an inexhaustible, cost-effective and

renewable resource for the production of high-value bioactive products and

aroma compounds. The biotransformation method has a huge number of

applications [21], for instance, it has been extensively employed for the production

of volatile compounds [21]. These volatile compounds possess not only sensory

properties, but other desirable properties such as antimicrobial (vanillin, essential

- 9 -

oil constituents), antifungal and antiviral (some alkaloides), antioxidant (eugenol,

vanillin), somatic fat reducing (nootkatone), blood pressure regulating (2-[E]-

hexenal), anti-inflammatory properties (1,8-cineole), and others [22].

The anticancer properties of several secondary metabolites from endophytes have

been investigated recently. Cancer is a group of diseases characterized by

unregulated growth and spread of abnormal cells, which can result in death if not

controlled [23]. It has been considered one of the major causes of death

worldwide: 7.4 million (about 13% of all deaths) in 2004 [24]. The anticancer drugs

show nonspecific toxicity to proliferating normal cells, possess enormous side

effects, and are not effective against many forms of cancer [19]. Thus, the cure of

cancer has been enhanced mainly due to diagnosis improvements which allow

earlier and more precise treatments. There are some evidences that bioactive

compounds produced by endophytes could be alternative approaches for

discovery of novel drugs, since many natural products from plants,

microorganisms, and marine sources were identified as anticancer agents [25].

The diterpenoid “Taxol” (also known in the literature as paclitaxel) have

generated more attention and interest than any other new drug since its discovery,

possibly due to its unique mode of action compared to other anticancer agents [19,

26]. This compound interferes with the multiplication of cancer cells, reducing or

interrupting their growth and spreading. FDA (Food and Drug Administration)

has approved Taxol for the treatment of advanced breast cancer, lung cancer, and

refractory ovarian cancer [27]. Taxol (C47H51NO14) was firstly isolated from the

bark of trees belonging to Taxus family (Taxus brevifolia), its most common source

[28]. Nevertheless, these trees are rare, slow growing, and produce small amount

of Taxol, which explain its high price in the market when obtained from this

natural source [29]. Besides, in the context of environmental degradation, the use

of plant source as unique option have limited the supply of this drug due to the

destructive collection of yew trees [30]. Several reports about Taxol and its

anticancer properties were published since its discovery [31–33], as well as other

sources for production of Taxol have been investigated in the last decade. The

- 10 -

isolation of Taxol-producing endophyte Taxomyces andreanae has provided an

alternative approach to obtain a cheaper and more available product via

microorganism fermentation [34]. After that, Taxol has also been found in a

number of different genera of fungal endophytes either associated or not to yews,

such as Taxodium distichum [35]; Wollemia nobilis [36]; Phyllosticta spinarum [37];

Bartalinia robillardoides [19]; Pestalotiopsis terminaliae [38]; Botryodiplodia theobromae

[39].

“Camptothecin” (C20H16N2O4), a potent antineoplastic agent which was firstly

isolated from the wood of Camptotheca acuminate Decaisne (Nyssaceae) in China

[40]. Camptothecin and 10-hydroxycamptothecin are two important precursors for

the synthesis of the clinically useful anticancer drugs, topotecan, and irinotecan

[41]. Although it have potential use in medical treatments, the unmodified

Camptothecin suffers from drawbacks that compromises its applications due to

very low solubility in aqueous media and high toxicity [42, 43]. On the other hand,

some Camptothecin derivatives retain the medicinal properties and can show

other benefits without causing further drawbacks in some cases [44, 45].

Therefore, it is desirable to develop strategies for isolation, mixture separation,

and production of Camptothecin and its analogues from novel endophytic fungal

sources. The anticancer properties of the microbial products Camptothecin and

two analogues (9-methoxycamptothecin and 10-hydroxycamptothecin) were

already reported. The products were obtained from the endophytic fungi Fusarium

solani isolated from Camptotheca acuminate [46]. Several reports have described

other Camptothecin (or analogues) producing endophytes [47-49]. Since then,

endophytes have been included in many studies purposing new approaches for

drug discovery.

“Ergoflavin” (C30H26O14), belongs to the compound class called ergochromes and

was described as a novel anticancer agent isolated from an endophytic fungi

growing on the leaves of an Indian medicinal plant Mimusops elengi (Sapotaceae)

[50]. “Secalonic acid D” (C32H30O14), a mycotoxin also belonging to ergochrome

class, is known to have potent anticancer activities. It was isolated from the

- 11 -

mangrove endophytic fungus and observed high cytotoxicity on HL60 and K562

cells by inducing leukemia cell apoptosis [46].“Phenylpropanoids” have attracted

much interest for medicinal use as an anticancer, antioxidant, antimicrobial, anti-

inflammatory, and immunosuppressive properties [51]. Despite the

phenylpropanoids belong to the largest group of secondary metabolites produced

by plants, reports showed the production of such compounds by endophytes. The

endophytic Penicillium brasilianum, found in root bark of Melia azedarach, promoted

the biosynthesis of phenylpropanoid amides [52].

Two monolignol glucosides, coniferin and syringin, are produced not only by the

host plant, but were also recognized by the endophytic Xylariaceae species as

chemical signals during the establishment of fungus-plant interactions [53].

Koshino and coworkers characterized two phenylpropanoids and lignan from

stromata of Epichloe typhina on Phleum pretense [54]. “Lignans” are other kinds of

anticancer agents originated as secondary metabolites through the shikimic acid

pathway and display different biological activities that make them interesting in

several lines of research [55]. Although their molecular backbone consists only of

two phenylpropane units (C6-C3), lignans show enormous structural and

biological diversity, especially in cancer chemotherapy [42].

“Podophyllotoxin” (C22H22O8) and analogs are clinically relevant mainly due to

their cytotoxicity and antiviral activities and are valued as the precursor to useful

anticancer drugs like etoposide, teniposide, and etopophos phosphate [56-57]. The

aryl tetralin lignans, such as podophyllotoxin, are naturally synthesized by

Podophyllum sp., alternative sources have been searched to avoid the use of

endangered plant. Another study showed a novel fungal endophyte, Trametes

hirsute, that produces podophyllotoxin and other related aryl tetralin lignans with

potent anticancer properties [58]. Novel microbial sources of Podophyllotoxin

were reported from the endophytic fungi, Aspergillus fumigatus isolated from

Juniperus communis L. Horstmann [59], Phialocephala fortinii isolated from

Podophyllum peltatum [60], and Fusarium oxysporum from Juniperus recurva [61].

- 12 -

Three novel “Cytochalasins”, bearing antitumor activity was isolated from the

endophyte Rhinocladiella sp. [61]. Extensive experiments identified these new

compounds as 22-oxa-12-cytochalasins. “Torreyanic acid” (C38H44O12) is an

unusual dimeric quinone isolated from the endophytic fungus Pestalotiopsis

microspora from T. taxifolia (Florida torreya) and was proven to have selective

cytotoxicity 5 to 10 times more potent in cell lines that are sensitive to protein

kinase C agonists and causes cell death by apoptosis [62].

“Gliocladicillins A” and “B” were reported as effective antitumor agents in vitro

and in vivo, since they induced tumor cell apoptosis and showed significant

inhibition on proliferation of melanoma B16 cells implanted into immunodeficient

mice [63]. Crude Extracts of Alternaria alternata, an endophytic fungus isolated

from Coffea Arabica L., displayed moderate cytotoxic activity towards HeLa cells in

vitro, when compared to the dimethyl sulfoxide-(DMSO-) treated cells [64]. The

investigation of endophytic actinomycetes associated with pharmaceutical plants

in rainforest reported 41 microorganisms from the genus Streptomyces displayed

significant antitumor activity against HL-60 cells, A549 cells, BEL-7404 cells, and

P388D1 cells [1]. The screening of endophytic fungi isolated from pharmaceutical

plants in China showed that 13.4% endophytes were cytotoxic on HL-60 cells and

6.4% on KB cells [65].

Other compounds with anticancer properties isolated from endophytic microbes

reported are cytoskyrins [66], phomoxanthones A and B [67], photinides A-F [68],

rubrofusarin B [69], and epiepoxydon [70].

Antimicrobial metabolites bearing antibiotic activity can be defined as low-

molecular-weight organic natural substances made by microorganisms that are

active at low concentrations against other microorganisms [15]. Endophytes are

believed to carry out a resistance mechanism to overcome pathogenic invasion by

producing secondary metabolites [5]. So far, studies reported a large number of

antimicrobial compounds isolated from endophytes, belonging to several

structural classes like alkaloids, peptides, steroids, terpenoids, phenols, quinines,

and flavonoids [71].

- 13 -

The discovery of novel antimicrobial metabolites from endophytes is an important

alternative to overcome the increasing levels of drug resistance by plant and

human pathogens, the insufficient number of effective antibiotics against diverse

bacterial species, and few new antimicrobial agents in development, probably due

to relatively unfavorable returns on investment [72, 73]. The antimicrobial

compounds can be used not only as drugs by humankind but also as food

preservatives in the control of food spoilage and food-borne diseases, a serious

concern in the world food chain [74]. Many bioactive compounds, including

antifungal agents, have been isolated from the genus Xylaria residing in different

plant hosts, such as “sordaricin” with antifungal activity against Candida albicans

[75]; “mellisol” and “1,8-dihydroxynaphthol 1-O-a-glucopyranoside” with activity

against herpes simplex virus-type 1 [76]; “multiplolides A and B” with activity

against Candida albicans [77]. The bioactive compound isolated from the culture

extracts of the endophytic fungus Xylaria sp. YX-28 isolated from Ginkgo biloba L.

was identified as “7-amino-4-methylcoumarin” [74]. The compound presented

broad-spectrum inhibitory activity against several food-borne and food spoilage

microorganisms including S. aureus, E. coli, S. typhia, S. typhimurium, S. enteritidis,

A. hydrophila, Yersinia sp., V. anguillarum, Shigella sp., V. parahaemolyticus, C.

albicans, P. expansum, and A. niger, especially to A. hydrophila, and was suggested

to be used as natural preservative in food [74]. Another strain F0010 of the

endophytic fungus Xylaria sp. from Abies holophylla was characterized as a

producer of “griseofulvin”., a spirobenzofuran antifungal antibiotic agent used for

the treatment of human and veterinary animals mycotic diseases [78]. They

evaluated and reported high antifungal activity in vivo and in vitro of the

endophyte-produced griseofulvin against plant pathogenic fungi, controlling

effectively the development of various food crops.

Aliphatic compounds, frequently detected in cultures of endophytes, often show

biological activities. Four antifungal “aliphatic compounds” were characterized

from stromata of E. typhina on P. pratense [79]. Ester metabolites isolated from an

endophyte of the eastern larch presented antimicrobial activity. One compound

was toxic to spruce budworm (Choristoneura fumiferana Clem.) larvae, and the

- 14 -

other may serve as potent antibacterial agent against Vibrio salmonicida,

Pseudomonas aeruginosa, and Staphylococcus aureus [80]. Chaetomugilin A and D

with antifungal activities, were isolated from an endophytic fungus C. globosum

collected from Ginkgo biloba [81]. Cytosporone B and C were isolated from a

mangrove endophytic fungus, Phomopsis sp. They inhibited two fungi C. albicans

and F. oxysporum with the MIC value ranging from 32 to 64 mg/ml [82].

Chlorinated metabolites such as mycorrhizin A, cryptosporiopsin isolated from

endophytic Pezicula strains were reported as strongly fungicidal and herbicidal

agents, and to a lesser extent, as algicidal and antibacterial agents [83]. Similarly,

other new chlorinated benzophenone derivatives, “Pestalachlorides A”

(C21H21Cl2NO5) and “B” (C20H18Cl2O5), from the plant endophytic fungus

Pestalotiopsis adusta, proven to display significant antifungal activity against three

plant pathogenic fungi, Fusarium culmorum, Gibberellin zeae, and Verticillium albo-

atrum [84].

The production of “Hypericin” (C30H16O8), a naphthodianthrone derivative, and

“Emodin” (C15H10O5) is believed to be the main precursor of hypericin, by the

endophytic fungus isolated from an Indian medicinal plant, was reported. Both

compounds demonstrated antimicrobial activity against several bacteria and

fungi, including Staphylococcus aureus, Klebsiella pneumonia ssp. ozaenae,

Pseudomonas aeruginosa, Salmonella enterica ssp. Enteric, and Escherichia coli, and

fungal organisms Aspergillus niger and Candida albicans [85].

An endophytic Streptomyces sp. from a fern-leaved grevillea (Grevillea pteridifolia)

in Australia was described as a promising producer of novel antibiotics,

“kakadumycin A” and “echinomycin”. Kakadumycin A is structurally related to

echinomycin, a quinoxaline antibiotic, and presents better bioactivity than

echinomycin especially against Gram-positive bacteria and impressive activity

against the malarial parasite Plasmodium falciparum [86]. More than 50% of

endophytic fungi strains residing in Quercus variabilis possessed growth inhibition

against at least one pathogenic fungi or bacteria. Cladosporium sp., displaying the

most active antifungal activity, was investigated and found to produce a

- 15 -

secondary metabolite known as “brefeldin A” (C16H24O4), a lactone with antibiotic

activity. Results showed brefeldin A to be more potent than the positive control in

antifungal activity [87]. “Coronamycin”, a peptide antibiotic produced by an

endophytic fungi Streptomyces sp. isolated from Monstera sp., is active against

pythiaceous fungi, the human fungal pathogen Cryptococcus neoformans, and the

malarial parasite, Plasmodium falciparum [88].

Production of lipopeptide “pumilacidin”, an antifungal compound, by B. pumilus

isolated from cassava cultivated by Brazilian Amazon Indian tribes was described

for the first time [89]. The compounds “2-hexyl-3-methyl-butanodioic acid” and

“cytochalasin D” were isolated from the endophytic fungus Xylaria sp. isolated

from Brazilian Cerrado, and presented antifungal activity [90]. Two new bioactive

metabolites, “ethyl 2,4-dihydroxy-5,6-dimethylbenzoate” and “phomopsilactone”

were isolated from an endophytic fungus Phomopsis cassiae from Cassia spectabilis

and displayed strong antifungal activity against two phytopathogenic fungi,

Cladosporium cladosporioides, and C. sphaerospermum [91].

The polyketide “citrinin”, produced by endophytic fungus Penicillium janthinellum

from fruits of Melia azedarach, presented 100% antibacterial activity against

Leishmania sp. [92]. Among the 12 secondary metabolites produced by the

endophytic fungi Aspergillus fumigatus CY018 which was isolated from the leaf of

Cynodon dactylon, “asperfumoid”, “fumigaclavine C”,“fumitremorgin C”, “

physcion”, and “helvolic acid” were found to inhibit Candida albicans [93].

Endophyte Verticillium sp. isolated from roots of wild Rehmannia glutinosa

produced two compounds “2,6-Dihydroxy-2-methyl-7-(prop-1E-enyl)-1-

benzofuran-3(2H)-one”, reported for the first time, and “ergosterol peroxide”

with clear inhibition of the growth of three pathogens including Verticillium sp.

[94]. An endophytic fungus Pestalotiopsis theae of an unidentified tree in Jianfeng

Mountain, China, was capable of producing “Pestalotheol C” with anti-HIV

properties [95]. Other secondary metabolites with antimicrobial properties

isolated from endophytic microbes were reported are “3-O-methylalaternin” and

- 16 -

“altersolanol A” [96], “phomoenamide” [97], “phomodione” [98], “ambuic acid”

[98], “isopestacin” [99], and “munumbicin A, B, C” and “D” [100].

Natural antioxidants are commonly found in medicinal plants, vegetables, and

fruits. However, it has been reported that the metabolites from endophytes can be

a potential source of novel natural antioxidants. Liu and coworkers evaluated the

antioxidant activity of an endophytic Xylaria sp. isolated from the medicinal plant

Ginkgo biloba [101]. The results collected indicated that the methanol extract

exhibited strong antioxidant capacity due to the presence of “phenolics” and

“flavonoids” compounds among 41 identified compounds. Huang and coworkers

investigated the antioxidant capacities of endophytic fungal cultures of medicinal

Chinese plants and its correlation to their total phenolic contents. They suggested

that the phenolic content is the major antioxidant constituent produced in the

endophytes [102].

“Pestacin” (C15H14O4) and “isopestacin”, 1,3-dihydro isobenzofurans, were

obtained from the endophytic fungus Pestalotiopsis microspora isolated from a plant

in the Papua New Guinea, Terminalia morobensis [103-104]. Besides antioxidant

activity, pestacin and isopestacin also presented antimycotic and antifungal

activities, respectively. Pestacin is believed to have antioxidant activity 11 times

greater than Trolox, a vitamin E derivative, primarily via cleavage of an unusually

reactive C-H bond and to a lesser extent, O-H abstraction [105].

Isopestacin possess antioxidant activity by scavenging both superoxide and

hydroxy free radicals in solution, added to the fact that isopestacin is structurally

similar to the flavonoids [106]. Polysaccharides from plants and microorganisms

have been extensively studied and considered as potent natural antioxidants [107–

110]. Liu and coworkers reported for the first time, the capacity of endophytic

microorganisms to produce polysaccharides with antioxidant. The bacterium

endophyte Paenibacillus polymyxa isolated from the root tissue of Stemona japonica

Miquel, a traditional Chinese medicine, produced “exopolysaccharides (EPS)” that

demonstrated strong scavenging activities on superoxide and hydroxyl radicals

[111]. “Graphislactone A”, a phenolic metabolite isolated from the endophytic

- 17 -

fungus Cephalosporium sp. IFB-E001 residing in Trachelospermum jasminoides,

demonstrated to have free radical-scavenging and antioxidant activities in vitro

stronger than the standards, butylated hydroxytoluene (BHT) and ascorbic acid,

coassayed in the study [112].

Endophytic microorganisms are able to produce necessary enzymes for the

colonization of plant tissues, and to use, at least in vitro, most plant nutrients and

components. Endophytes have received attention as biocatalysts in the chemical

transformation of natural products and drugs, due to their ability to modify

chemical structures with a high degree of stereospecificity and to produce known

or novel enzymes that facilitates the production of compounds of interest.

Therefore, biotransformation is a useful method for production of novel

compounds; enhancement in the productivity of a desired compound; overcoming

the problems associated with chemical analysis; leading to basic information to

elucidate the biosynthetic pathway [113]. For this reason, biotransformation using

microbial cultures and/or their enzymatic systems alone has received increasing

attention as a method for the conversion of lipids, monoterpenes, diterpenes,

steroids, triterpenes, alkaloids, lignans, and some synthetic chemicals, carrying

out stereospecific and stereoselective reactions for the production of novel

bioactive molecules with some potential for pharmaceutical and food industries

[4, 114]. Although these microorganisms have high potential, studies using

endophytes in the field of biotransformation are still limited. The

biotransformation of a tetrahydrofuran lignan, ()-grandisin, by the endophytic

fungus Phomopsis sp. from Viguiera arenaria was demonstrated by Verza and

coworkers [115]. The process led to the formation of a new compound named as

“3,4-dimethyl-2-(-hydroxy-dimethoxyphenyl)-5-methoxy-tetrahydrofuran”, which

showed trypanocidal activity similar to its natural corresponding precursor

against the causative agent of Chagas disease, the parasite Trypanosoma cruzi.

Zikmundová and coworkers reported an endophytic fungus isolated from the

roots and shoots of Aphelandra tetragona, capable to transform benzoxazinones, 2-

benzoxazolinone (BOA) and 2-hydroxy-1,4-benzoxazin-3-one (HBOA), into

- 18 -

different series of compounds [116]. The use of endophytic fungi in the

stereoselective kinetic biotransformation of “thioridazine (THD)”, a phenothiazine

neuroleptic drug, was investigated. Results showed that these microorganisms are

able to biomimic mammalian metabolism via biotransformation reactions [112].

Another study employed endophytic fungus on the biotransformation of

“propranolol (Prop)” to obtain 4-OH-Prop active metabolite in enantiomerically

pure form [4]. Another interesting topic in biotransformation process is the use of

endophytes in the biotransformation of terpenes for production of novel

compounds through enzymatic reactions carried out by these microbes.

“Terpenes” are large class of bioactive secondary metabolites used in the

fragrance and flavor industries, and have been extensively used in

biotransformation process by microorganisms with focus on the discovery of

novel flavor compounds and on the optimization of the process condition [3].

Microbial transformations of terpenes were published recently using limonene [5],

and α-farnesene [6], by diverse microorganisms. However, some research groups

have also investigated studies with the biotransformation of terpenes by

endophytes. Other endophytic microbes were studied for the capability to

biotransform natural products like taxoids [117], alkaloids [118], and pigment

curcumim [119].

Endophytes have proven to be rich sources of novel natural compounds with a

wide-spectrum of biological activities and a high level of structural diversity.

However, the application of microorganisms by the food and pharmaceutical

industries to obtain compounds of interest is still modest, considering the great

availability of useful microorganisms and the large scope of reactions that can be

accomplished by them. Novel antibiotics, antimycotics, immunosuppressant, and

anticancer compounds are only a few examples of what has been found after the

isolation and culturing of individual endophytes followed by purification and

characterization of some of their natural products. Isolation of rohitukine, a

chromane alkaloid possessing anti-cancer activity was reported from Fusarium

proliferatum [120].

- 19 -

NEED FOR THE STUDY

Endophytes of medicinal plants and their potential use are a most promising

resource, which awaits exploration. The limited knowledge on the varied use of the

medicinal plants, their availability and extent of distribution in forest area limits

efficient use of these resources. Fungal endophytes have been found in every plant

species examined to date and appear to be important, but largely unquantified,

components of fungal biodiversity. Endophytes are especially little known in

tropical forest trees, where their abundance and diversity are thought to be greatest.

The biggest challenge for researchers and policy makers, therefore, is how the forest

would meet the global requirement at a time when there is steady decrease of

resources. Endophytic fungi capable of producing active metabolites can solve the

problem of overexploitation medicinal plants and RET plants leading to their

extinction. The study was aimed to explore the occurrence of endophytes in

medicinal plants and RET species. Only a few reports are available on isolation and

diversity of endophytic mycoflora from Indian medicinal plants and trees. Much

progress can be made in utilizing the fungal endophytes in agriculture, medicine

and food industry and hence it is worthwhile to conduct studies in this area to bring

out fruitful results.

- 20 -

3. OBJECTIVES

Immense literature available had shown the importance of secondary metabolites

from endophytic fungi. The present study was carried out to identify true

endophytic fungi from different medicinal plants, isolate and to establish the

therapeutic potential of the secondary metabolites produced by them. The

following objectives were framed for the study;

1. Isolation and identification of endophytic fungi from three important medicinal plants - Aerva lanata, Emelia sonchifolia and RET species Cynometra travancorica.

2. Isolation and characterization of secondary metabolites from selected endophytic fungi.

3. Screening of the isolated molecules for their therapeutic potentials.

- 21 -

4. MATERIALS AND METHODS

4.1 Plants and study area

Aerva lanata is a perennial herb of the Amaranthaceae family. It has significant

therapeutic properties such as an antioxidant, anti-hyperglycaemic, anthelmintic,

anti-hyperlipidemic and anti-microbial. It is extensively used in Ayurveda. The

chemical constituents of A.lanata include alkaloids, flavonoids, phenol, tannin,

proteins, amino acids and carbohydrates respectively.

Emelia sonchifolia is a herbaceous plant of the family Asteracae. It is a traditional

medicine used in India in Ayurveda and folklore medicine against inflammation,

rheumatism, cough, cuts and wounds. In China, the leaves are used as a cure in

fever and dysentery. It is also used as an analgesic agent and antibiotic. The aerial

part of the plant contains alkaloids and flavanoids.

Cynometra travancorica is a legume of the family Fabaceae. The plant is endemic to

Western Ghats and its distribution is now threatened by habitat loss. The bark of

the tree is used as a uterine tonic and as a substituent of Asoka.

4.2 Sample collection

Sampling of plant materials for isolating fungal endophytes was done during three

different seasons, pre-monsoon (April-May), monsoon (June-July) and post-

monsoon (October-November). Whole plants of Aerva lanata and Emelia sonchifolia

were collected from southern, northern and central parts of Kerala. A minimum of

twelve plants were collected from each locality. Leaves, stems and roots were used

for inoculation. Leaves and stems of three different trees of Cynometra travancorica

collected from different forest areas viz., Shiruvani, Shenduruny, Thamarassery and

Vellanimala, were used for isolation of fungal endophytes (Table – 1). Sixty leaves

from each site were used for the isolation. Six explants per plate were inoculated in

ten petri plates.

- 22 -

No Plant Name Months collected

Sample site Materials collection

1. Aerva lanata April, June and October

Peyad, Pathanapuram, Thodupuzha, Thrissur,

Thaliparampa and Kanhangad

Whole plant

2. Emelia Sonchifolia

April, June and October

Peyad, Pathanapuram, Thodupuzha, Thrissur,

Thaliparampa and Kanhangad

Whole plant

3. Cynometra travancorica

May, July and November

Siruvani, Shendurney, Thamarassery and

Vellanimala

Leaves and stem

Table - 1: Particulars of sample collection.

4.3 Isolation of endophytes

The leaves, stems and roots were surface sterilized in 75% ethanol for 60 seconds.

Leaf bits (0. 5 cm dia and 0.5 cm long) of stem and root tissues were cut and rinsed

in sterile distilled water 3 times and allowed to surface dry in sterile conditions.

Five different media were initially used for fungal isolation to identify the best

medium for isolation in terms of growth and diversity. These were:

1. Potato dextrose agar (PDA)

2. Sabouraud’s dextrose agar

3. PDA with Rose Bengal

4. Water agar and

5. Oat meal Agar.

Of these, oat meal agar (OMA) was found to give optimum fungal growth (rapid

growth and more number of colonies) and was selected for further study. Sixty

bits of leaf, stem and root of each plant were used for plating at each sampling

time. The plant tissues were evenly placed in petri dishes containing OMA

amended with streptopenicillin, to suppress bacterial growth. Inoculated plates

were incubated for 30 days at room temperature. Tissues were observed for fungal

growth at alternate day intervals. Pure cultures obtained after subculture were

stored at -4°C on OMA slants for preservation. A total of 113 pure cultures were

obtained (Table - 2).

- 23 -

Plant Part used for isolation No of pure cultures obtained

Aerva lanata Leaves 12

Stem 11

Root 15

Emelia sonchifolia Leaves 18

Stem 13

Root 14

Cynometra travancorica Leaves 12

Stem 18

Total 113

Table – 2: No of cultures obtained from different parts of the plants used for the study.

4.4 Analysis of data

a. Frequency of occurrence of endophytes (%): The fungal population

was quantified as frequency of occurrence as given below

[No of leaf discs colonised by a given fungus/total number of explants

observed] x 100 [121].

b. Colonization rate:

[Total number of explants in a sample yielding 1 isolate or more/ total

number of leaf segments in that sample] x 100 [122]

c. Isolation rate: Isolation rate was determined by Frohlich et al. [123].

[Total number of isolates yielded by a given sample/total number of

explants in that sample].

4.5 Morphological identification of true fungal endophytes

Attempts were made to identify fungi based on morphological features. It proved

to be difficult since most of the cultures remained sterile without producing any

fruiting bodies which is necessary for identification. This is a common

characteristic of fungal endophytes. Attempts were made to induce sporulation by

altering carbon source, exposing petri plates to ultraviolet radiation, starving the

fungi, incorporating sterile host tissues in the medium and exposing the plates to

- 24 -

alternate cold and hot conditions. However, most strains (cultures) failed to

sporulate.

4.6 Molecular identification of ‘true’ fungal endophytes

Genomic DNA was isolated from pure endophytic culture of C. travancorica and A.

lanata using Sigma Aldrich DNA extraction Kit. D1/D2 region of LSU (Large

subunit 28S rDNA) gene was amplified by PCR from the above isolated genomic

DNA. DNA sequencing was carried out with PCR amplicon. The D1/D2 region of

LSU (Large subunit 28S rDNA) gene sequence was used to carry out BLAST with

the nr database of NCBI gene bank database.

Two fungi namely, Colletotrichum gloeosporiodes and Diaporthe eres were found

constantly associated with the leaves and stem of C. travancorica, respectively.

Likewise, Fusarium equiseti was associated with the leaves, stem and root of A.

lanata. So, these were considered as ‘true’ endophytes and not casual isolations

and were used for further studies. Emelia sonchifolia did not show such

associations with any fungi.

4.7 Isolation of secondary metabolites from endophytes

C. gloeosporiodes, F. equiseti and D. eres were cultured in bulk quantities in potato

dextrose broth at room temperature (200 C) (say the range in room temp) in 500 ml

conical flasks. The cultures were incubated for 40 days. The broth after removal of

fungal mycelium was filtered, concentrated by heating on a boiling water bath.

The concentrated broth was treated with five different solvents such as petroleum

ether, dichloromethane, ethyl acetate, methanol and water, batch wise in a

separating funnel. The extracts were separated using Thin Layer chromatography

(TLC) followed by column chromatography using suitable solvents [124]. The

eluent obtained after open column chromatography was colored when ethyl

acetate was used as solvent. Coloration can be an indication of the presence of

terpenoids or flavanoids. Single spots were observed in TLC when visualised

under UV. Two compounds each was obtained from C. gloeosporiodes (A and B)

and F. equiseti (C and D). Compound A and C were soluble in dimethyl

sulphoxide/Petroleum ether and B, D in water. No compounds were obtained

- 25 -

from D. eres. The isolated compounds were characterised by IR, NMR and LC-

MS. IR was done at STIC facility, CUSAT (Cochin University of Science and

Technology), NMR and LC-MS analysis were done at SAIF, IIT, Madras, Chennai,

India.

4.8 Cell culture

SW620 cells were obtained from NCCL, Pune, cultured in complete Dulbecco's

modified eagle medium (cDMEM) composed of DMEM supplemented with

streptomycin (100 mg/ml), penicillin (100U/ml) and 10% FBS. Cells were

maintained in a humidified incubator at 370 C with 5% CO2.

4.9 Resazurin reduction assay

Cells were seeded in a 96 well plate at a density of 5000 per well and grown

overnight. Cells were treated with increasing concentration of compounds – A, B,

C and D ranging from (0, 2, 4, 6, 8 mg) in complete DMEM. Analysis of

cytotoxicity after 48 h treatment was determined by resazurin reduction assay

with slight modifications [125]. At a concentration of 0.1 mg/ml, resazurin dye

was added on to the media, incubated for 3 h, for the reduction of blue dye

resazurin to pink resorufin which is read at 570-590 nm. The data were analysed

as percent control. IC50 was obtained by determining the concentration of

compounds resulting in 50% inhibition of viability after 48h by using (Graph Pad

Software.Inc). Compound A was found to possess significant activity compared to

other three drugs. The compounds B, C and D are under further study. The rest of

the study was carried out using compound A.

4.10 Cell cycle analysis

Propidium iodide staining and flow cytometry were used to assess the cell cycle

distribution profile. The treated cells were washed with PBS-EDTA and then

harvested using 0.25% Trypsin EDTA and then suspended in cDMEM. Cells were

then washed with PBS and centrifuged at 500 x g at 40C for 5 min, and re-

suspended in 300 µl propidium iodide (2µg/ml) in the dark, incubated at 370C for

- 26 -

1 h. Data from 10,000 cells were collected for each sample. Data acquisition and

analysis were performed on a flow cytometer (Beckman Coulter cell lab Quanta).

4.11 Protein isolation and Western blotting

Cells were washed with phosphate-buffered saline (PBS) 48h post treatment, and

total protein was extracted after scraping and collecting cells in radio immuno

precipitation assay (RIPA) lysis buffer [20mM Tris (pH 7.5), 150mM sodium

chloride, 1mM ethylene diamine tetra acetic acid, 1mM β-glycerophosphate, 1%

Triton X 100, 2.5mM Sodium pyrophosphate, 1mM sodium orthovanadate, 0.5%

sodium deoxycholate, 1mM phenyl methane sulfonyl fluoride, 20mM sodium

fluoride, 1% protease inhibitor, incubated for 1h, and centrifuged. Total cell

protein in the supernatant was estimated using Bradford assay, and 30μg of

protein was subjected to SDS PAGE separation followed by transfer onto

polyvinylidenedifluoride membrane. The membrane was incubated with primary

antibodies against PARP (116 kDa nuclear poly (ADP-ribose) polymerase (1:1000

dilution), or Vinculin (1:10,000 dilution) overnight, followed by incubation with

an HRP-conjugated secondary antibody. Protein bands were detected using an

enhanced chemiluminescence detection kit and visualized by using the Versa Doc

image analysis system (Bio-Rad).

- 27 -

5. RESULTS AND DISCUSSION

A total of 113 fungal cultures were obtained from the tissues of the three plants.

Most strains were sterile in nature and could not be identified. The frequency of

occurrence, colonisation rate and isolation rate were more in A. lanata and E.

sonchifolia compared to C. travancorica. However, molecular techniques were

employed to those fungi which were constantly isolated from plant tissues.

Sequenced data of D1/D2 region of LSU (Large Subunit 28S rDNA) after

subjecting to BLAST with the nr database of NCBI gene bank database revealed

that endophyte from leaves of Cynometra travancorica was Colletotrichum

gloeosporioides with 100% similarity with accession number KM823608, from the

stem was D. eres with 99% similarity with accession number KM823609 and

Fusarium equiseti from leaves, stem and root with accession number KM823608. Of

these, the identity of D. eres requires further confirmation (Figure - 1, 2, 3, 4 and

Table-3). No true endophytes were obtained from E. sonchifolia. Infrequent

isolates which was not isolated from all the localities were not selected for further

studies (Table - 5, 6, 7, 8, 9 and 10).

The compound A from the true endophyte C. gloeosporioides was subjected to

structural and biological studies. The compound B from C. gloeosporioides and the

compounds C and D from Fusarium equiseti are under investigation for structural

details and biological properties.

Consensus Sequence Data of Colletotricum gloeosporioides ATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATT TGAAATCTGGCCCTAGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGTGCGGTGCCTTCCAAGTTCCCTAGA ACGGGACGCCAGAGAGGGTGAGAGCCCCGTACAGTTGGACACCAAGCCTTTGTAAAGCTCCTTCGACGAGTCGA GTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCG CACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAACAGCACGTGAAATTGTTAAAAGGG AAGCGCTTGTGACCAGACTTGCGTCCGGTGAATCACCCAGCTCTCGCGGCTGGGGCACTTCGCCGGCTCAGGCC

- 28 -

AGCATCAGCTCGCTGTCGGGGACAAAAGCTTCAGGAACGTAGCTCTCTTCGGGGAGTGTTATAGCCTGTTGCAT AATACCCTTCGGCGGGCTGAGGTACGCGCTCCGCAAGGATGCTGGCATAATGGTCATCAGCGA Consensus Sequence Data of D. eres AGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTC AAATTTGAAATCTGGCTTCGGCCCGAGTTGTAATTTGCAGAGGATGCTTCTGGCGCGGTGCCTTCCGAGTTCCC TGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTATGGTCGGACACCAAGCCTGTGTGAAGCTCCTTCAACGAG TCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGAT AGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGGGGGTTAAATAGTACGTGAAATTGTTGAA AGGGAAGCACTTATGACCAGACTTGGGCCGGGCGGCTCATCAGGGGTTCTCCCCTGTGCACTCCGCCCGGCACA GGCCAGCATCGGTTCTCGTGGGGGGATAAGACCGTCAGGAACGTAGCACCCTCCGGGGTGTGTTATAGCCTGGC GGACGATACCCCCGTGGGGACCGAGGTCCGCGCTCCGCAAGGATGCTGGCGTAATGGTCATCAGTGACCCGTCTT Consensus Sequence Data of F. equiseti AGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCG AGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTCGGGCCCGAGTTGTAATTT GTAGAGGATGCTTTTGATGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGA GGGTGAGAGCCCCGTCTGGTTGGATGCCAAATCTCTGTAAAGCTCCTTCGACGAGTC GAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATAC CGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGA AAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACT TGGGCTTGGTTAATCATCTGGGGTTCTCCCCAGTGCACTTTTCCAGTCCAGGCCAGAT CAGTTTTCGCCGGGGGATAAAGGCTTCGGGAATGTGGCTCTCTCCGGGGAGTGTTAT AGCCCGTTGCGTAATACCCTGGCGGGGACTGAGGTTCGCGCATCTGCAAGGATGCTG GCGTAATGGTCATCAACGACCCGTCT

- 29 -

b. c.

Figure – 1 : Representative cultures of fungal endophytes isolated from (A) leaves, (B)

stem and (C) root of Aerva lanata.

Figure – 2 : Representative cultures of fungal endophytes isolated from (A) leaves and (B) stem of Cynometra travancorica.

Figure – 3 : Representative cultures of fungal endophytes isolated from (A) leaves, (B)

stem and (C) root of Emelia sonchifolia.

B

A B C

A B

A B C

- 30 -

Table – 3 : Frequency, Colonisation and Isolation rate of endophytes from C.

travancorica, A. lanata and E. sonchifolia

Figure – 4 : (A) True fungal endophyte isolated from Cynometra travancorica -

Colletotrichum gloeosporiodes, (B) Pure culture of Diaporthe eres, (C) True fungal endophyte

isolated from Aerva lanata – Fusarium equiseti

Plant Frequency of occurrence of endophytes

(value - %)

Colonisation rate

(value - %)

Isolation Rate

(value - %)

A. lanata

Leaf – 98.8

Stem – 87.6

Root - 98.3

Leaf - 80

Stem -73.3

Root -66.6

Leaf – 86

Stem- 93.3

Root – 86.6

E. sonchifolia

Leaf - 95.5

Stem - 92.8

Root - 68.45

Leaf - 93

Stem -73.3

Root -60

Leaf – 90

Stem- 80

Root - 73

C. travancorica

Leaf –70.6

Stem –62.25

Leaf -86.6

Stem -60.0

Leaf –80

Stem-46.6

A B C

- 31 -

Table - 4 : Fungal endophytes from the leaves of C. travancorica

Table – 5: Fungal endophytes from the stem of C. travancorica

Fungi/Location Vellanimala Shendurney Thamarassery Siruvani

May July Nov May July Nov May July Nov May July Nov

Colletotrichum gloeosporiodes

+ + + + + + + + + + + +

Phomopsis sp - - + + - - + + - - + + Sterile white Mycelium (with black Pigmentation)*

+ + + + + + + + + + + +

Sterile white Mycelium (without Pigmentation)**

+ + + + + + + + + + + +

*Contains a group of 5 morphotypes none of which were isolated constantly from any locality during any season.; +, present; -, absent

** Contains a group of 12 morphotypes none of which were isolated constantly from any locality during any season.; +, present; -, absent

Fungi/Location Vellanimala Shendurney Thamarassery Siruvani

May July Nov May July Nov May July Nov May July Nov

Diaporthe eres + + + + + + + + + + + +

Fusarium sp. - - - - - - + + - - - +

Sterile white mycelium*

+ + + + + + + + + + + +

*Contains a group of 17 morphotypes none of which were isolated constantly from any locality during any season.; +, present; -, absent

- 32 -

Table – 6: Fungal endophytes from the leaves of A. lanata

Fungi/Location Kanhangad Thaliparamba Thodupuzha Thrissur Pathanapuram Peyad

A J O A J O A J O A J O A J O A J O

Fusarium equiseti + + + + + + + + + + + + + + + + + +

Phomopsis species

+ + + - + - - + + - - - - - - - - -

Sterile grey mycelium*

+ - + - + - + - - + + + + + + + - -

Sterile brown mycelium**

- - - - - - - - - - - - - - + - - -

*Contains a group of 3 morphotypes none of which were isolated constantly from any locality during any season.; +, present; -, absent

** Contains a group of 1 morphotype which was not isolated constantly from any locality during any season.; +, present; -, absent. A- April, J-June, O-October

Table – 7: Fungal endophytes from the stem of A.lanata

Table – 8: Fungal endophytes from the roots of A. lanata

Fungi/Location Kanhangad Thaliparamba Thodupuzha Thrissur Pathanapuram Peyad

A J O A J O A J O A J O A J O A J O

Fusarium equiseti + + + + + + + + + + + + + + + + + +

Fusarium sp. - - + - - - + + - - - + + + + + + +

Sterile grey mycelium*

+ - + - + - + - - + + + + + + + - -

*Contains a group of 3 morphotypes none of which were isolated constantly from any locality during any season.; +, present; -, absent. A- April, J-June, O-October

Fungi/Location Kanhangad Thaliparamba Thodupuzha Thrissur Pathanapuram Peyad

A J O A J O A J O A J O A J O A J O

Fusarium equiseti

+ + + + + + + + + + + + + + + + + +

Sterile grey mycelium*

+ + + + - - + + + - - - + + - - - -

Sterile white mycelium**

+ + + + + + + + - + + + + + + + + +

*Contains a group of 6 morphotypes none of which were isolated constantly from any locality during any season.; +, present; -, absent

** Contains a group of 10 morphotypes none of which were isolated constantly from any locality during any season.; +, present; -, absent. A- April, J-June, O-October

- 33 -

Fungi/Location Kanhangad Thaliparamba Thodupuzha Thrissur Pathanapuram Peyad

A J O A J O A J O A J O A J O A J O

Sterile whit

mmycelium*

+ + + + + + + + + + + + - + + + + -

Sterile cottony white mycelium**

+ + - - - + + + + + + + - + - - - -

Sterile brown mycelium***

+ - - + + - - - + + + + - - - - - -

*Contains a group of 4 morphotypes none of which were isolated constantly from

any locality during any season.; +, present; -, absent

** Contains a group of 8 morphotypes none of which were isolated constantly from

any locality during any season.; +, present; -, absent

***Contains a group of 3 morphotypes none of which were isolated constantly from any locality during any season.; +,

present; -, absent. A- April, J-June, O-October

Table – 9: Fungal endophytes from the leaves of E. sonchifolia

Table – 10: Fungal endophytes from the roots of E. sonchifolia

Scanning Electron Microscope (SEM) study

SEM study of the fungal cultures revealed the presence of chlamydospores. Only

vegetative spores were found to be present. The cultures were sterile (Figure – 5 -

7).

Fungi/Location Kanhangad Thaliparamba Thodupuzha Thrissur Pathanapuram Peyad

A J O A J O A J O A J O A J O A J O

Sterile white mycelium*

+ + + + + + + + + + - + + + + + + +

Sterile grey mycelium**

- - - - + + + + + - - - + + + - - +

*Contains a group of 10 morphotypes none of which were isolated constantly from any locality during any season.; +, present; -, absent

** Contains a group of 3 morphotypes none of which were isolated constantly from any locality during any season.; +, present; -, absent. A- April, J-June, O-October

- 34 -

Figure - 5 : (A) Scanning electron microscope image of mycelium of C. gloeosporiodes (B) Scanning electron microscope image of hyphae of C. gloeosporiodes.

Figure – 6 : (A) Scanning electron microscopic image of mycelium of Diaporthe eres (B) Scanning electron microscopic image of hyphae of Diaporthe eres, with Chlamydospores.

Figure – 7 : (A) Scanning electron microscopic image of mycelium of Fusarium equiseti (B) Scanning electron microscopic image of hyphae of Fusarium equiseti with Chlamydospores.

A B

A A B

A B

- 35 -

The D1/D2 region of isolated fungal DNA after amplification by PCR using

universal primers obtained bands between 500-600 bp (Figure - 8 and 9). The PCR

amplicon was subjected to sequencing.

a. b.

Figure – 8: Agarose gel showing PCR amplification of DNA from (a) C. gloeosporiodes and

(b) Fusarium equiseti. M is DNA size marker of 100 bp, Lane one is amplified DNA from

the fungi.

a. b.

Figure – 9 : Agarose gel showing the PCR-amplified rDNA with Eco R1 Hind III double digest marker 125 bp from (a) C. gloeosporiodes and (b) Fusarium equisitei

- 36 -

Koch’s Postulates

The true endophytes C.gloeosporioides and Fusarium equiseti inoculated in

Potato Dextrose Broth secreted secondary metabolites (Figure-10). At the same

time, D.eres did not secrete any metabolites. Koch’s postulates were confirmed for

the fungal endophytes. The inoculated cultures were successfully re-isolated from

the plants in which it was inoculated (Figure -11).

Figure – 10 : Potato Dextrose Broth inoculated with Colletotrichum gloeosporiodes for

metabolite isolation

Figure – 11 : Confirmation of Koch’s postulates to affirm the pathogenicity of the strain.

- 37 -

Thin layer chromatography

Single spot was detected under UV after Thin layer chromatography confirming

the purity of compound (Figure-12).

a. Separation of metabolites using Separating funnel b. TLC of the metabolites

c. Column chromatography of the metabolites d. Thin layer chromatogram of the isolated metabolites under UV

Figure – 12 : Separation of secondary metabolites using, TLC and Column chromatography.

- 38 -

IR Spectrum

From the IR spectrum the peaks of compound A, isolated from Colletotrichum

gloeosporiodes, 2042 cm-1, 2947 cm-1 and 3404 cm-1 indicate the presence of

terpenoids 3404-OH/COOH (Figure -13).

The IR spectrum of compound A exhibited diagnostic absorption bands of

hydroxyl (3443 cm−1), γ-lactone (1776 cm−1), ester carbonyl (1722 cm−1) and

conjugated ketone (1655 cm−1) functionalities.

Figure – 13: IR spectrum of Drug A

NMR spectrum

The chemical shift at 4.23 ppm indicates that the compound is aliphatic in nature

The 1H and 13C NMR spectroscopic data indicated the presence of a methyl

singlet (δH 1.08; δC 16.5, C-15), a methyl doublet (δH 1.19, J = 7.0 Hz; δC 8.5, C-19),

one exocyclic double bond (δH 5.02, 4.98, each s, H2-20; δC 112.5, C-20; δC 149.7, C-

11), one trisubstituted double bond (δH 6.89, d, J = 9.6 Hz, H-6; δC 134.5, C-5; 136.8,

C-6), four oxygenated methine protons and carbons, (δH 5.11, d, J = 7.6 Hz; δC 75.6,

C-2; δH 5.31, d, J = 9.6 Hz; δC 78.3, C-7; δH 5.60, d, J = 2.8 Hz; δC 72.8, C-9; δH 4.64, t,

J = 2.8 Hz; δC 74.1, C-14), an oxygenated quaternary carbon (δC 83.5, C-8), four

methylene carbons (δC 32.3, 24.1, 31.4, 28.9) and two methine carbons (δC 43.9 and

44.7), together with a conjugated ester carbonyl (δC 166.8, C-16) and γ-lactone

carbonyl carbon (δC 174.4, C-19) (Figure - 14 & 15).

- 39 -

Figure – 14 : HNMR spectrum of drug A

Figure - 15 : 13CNMR of drug A

LC-MS

From the LC-MS spectrum the mass of the compound A is determined to be

201.05 kDa (Figure – 16).

.

- 40 -

Figure – 16 : LC-MS of drug A

Cytotoxicity

Cell viability was significantly reduced in a dose-dependent manner after drug

treatment (Figure -17). The IC50 value of compound A at 48 h was found to be

4mg/ml from the resazurin assay indicating its cytotoxicity to colorectal cancer

cells. The terpenoids from the endophytic fungi was found to possess significant

cytotoxic activity at a concentration of 4mg/ml.

Cell cycle analysis

In cell cycle analysis, sub G0 population was high indicating the programmed cell

death indicating the ability of the drug to induce apoptosis. The population

distribution for control group in sub-G0, G0-G1, S and G2M phase was 2.6%,

67.90%, 14.76% and 15.24% compared to treated group with the readings 23%,

29%, 24% and 24%. The sub G0 population was 12 fold high for treated group. G0-

G1 showed reduction in treated group compared to control group (Figure – 18 a &

b).

- 41 -

Figure – 17 : Resazurin assay showing IC50 of drug A in SW620 cells

Figure - 18(a). Cell cycle distribution in SW 620 cell line without treatment of Ct.

0

10

20

30

40

50

60

70

80

2 4 6 8 10

IC 5

0

Concentration of drug A in mg//ml

- 42 -

Figure - 18(b). Effect of drug A on cycle cycle distribution in SW 620 cell line.

Western blot analysis

PARP protein was detected in Western analysis. In human, PARP is a 116 kDa

nuclear poly (ADP-ribose) polymerase protein having role in maintaining cell

viability and DNA repair in response to stress and considered as a marker for cells

undergoing apoptosis. During stress, the cleavage of the total PARP protein

occurs between Asp214 and Gly215, resulting in amino-terminal DNA binding

domain (24 kDa) of PARP as well as the carboxy-terminal catalytic domain (89

kDa). With stress after treatment with compound A, the total PARP level was

- 43 -

found to be reduced an indication of its cleavage which results in cellular

disassembly and in apoptosis. Our findings suggest that the terpenoid isolated

from the endophytic fungus Colletotrichum gloeosportioides was found to possess

anticancer activity in colon cancer cell line, SW 620.

Endophytic fungi are a precious resource of rare and valuable compounds which

possess a broad range of therapeutic properties. After the discovery of taxol from

the endophytic fungus, Taxomyces andreanae, research on endophytes gained

importance. Tropical endophytes are a target for study in recent years but few

studies have addressed the therapeutic potentials of these fungi [121]. Present

study was undertaken to assess the therapeutic potentials of endophytic fungi

isolated from medicinal plants and a rare and endangered species occurring in the

forests of the Western Ghats, a hot spot of biodiversity. Most fungi isolated were

sterile and therefore only those strains which were constantly associated with the

tissues of the selected plants were used for further studies. Two endophytes viz.,

Colletotrichum gloeosporiodes and Diaporthe eres were isolated from the leaves and

stem of C. travancorica, respectively. Diaporthe eres, another true endophyte

isolated from the stem of C. travancorica was found incapable of producing

compounds after 40 days incubation. Studies using Colletotrichum gloeosporiodes

proved that it produces terpenoids possessing cytotoxity and anticancer activity in

colon cancer cell lines, SW620.

Studies elsewhere have shown that Colletotrichum gloeosporiodes is capable of

producing taxol, the anticancer drug [126]. Taxol is an expensive anticancer drug

extracted from the plant Pacific yew, Taxus brevifolia. Endophytic fungi capable of

producing compounds with anticancer property can be used as a substitute for

plants with these properties. This would prevent over exploitation of the plants

which may lead to extinction of such plants. The compounds produced from the

other fungus, F. equiseti isolated from A. lanata are currently being investigated.

Host-endophyte relation is a type of mutualism which helps the plants for disease

resistance, drought tolerance and growth enhancement. These mutualistic

- 44 -

endophytes are considered to have evolved from parasitic or pathogenic fungi.

The interface of fungal endophyte-plant host is characterized by a finely tuned

equilibrium between fungal virulence and plant resistance. The utilization of the

fungal endophyte for therapeutic potentials demands intelligent screening.

In short, our rationale for studying endophytic microbes as potential sources of

new medicines is to tap this unexplored area of biochemical diversity. Also, the

endophytes can protect the plant by virtue of the antimicrobial compounds that

they produce. It is possible that the drugs derived out of a plant endophyte will

have reduced toxicity compared to drugs developed from chemicals. Thus, the

plants themselves serve as a storehouse of microbes having bioactive molecules

with reduced toxicity towards higher organisms. We must use modern

technologies to understand this important resource and make it available for the

benefit for the mankind.

- 45 -

6. SUMMARY

A study was carried out to isolate, identify and evaluate the therapeutic potentials

of endophytic fungi from 2 medicinal plants, viz., Aerva lanata and Emelia

Sonchifolia and a rare, endangered and threatened (RET species) viz., Cynometra

travancorica in Kerala. Samples of medicinal plants for the study were collected

from southern, central and northern parts of Kerala and samples of RET species

from four different forest areas of south Western Ghats. Sampling was done

during three different seasons, pre-monsoon, monsoon and post-monsoon. In all,

one hundred and thirteen endophytic cultures were obtained from the study. Of

these, three ‘true’ endophytic fungal species viz., Colletotrichum gloeosporoides

(isolated from C. travancorica), Diaporthe eres (C. travancorica), and Fusarium equiseti

(A. lanata) were screened for secondary metabolites. Secondary metabolites from

the fungi were isolated and characterised by IR, NMR and Mass spectrum. Two

compounds each were isolated from C. gloeosporiodes (A and B) and F. equiseti (C

and D). No compounds were obtained from D.eres. All compounds were

identified as terpenoids and were subjected to cytotoxicity, cell cycle analysis and

anticancer studies employing colon cancer cell line SW620. The compound A

isolated from Colletotrichum gloeosporoides was found to possess anticancer activity

in colon cancer cell lines. The properties of compounds B isolated from C.

gloeosporiodes, and the compounds C and D isolated from A. lanata are currently

being investigated.

It is only natural that the constantly growing market demand and increasing

marketisation would encourage destructive harvesting practices. As per a study,

70% of the medicinal plant collections involve destructive harvesting practices,

leading to useful plant species becoming endangered or threatened (report of the

task force on conservation and sustainable use of medicinal plants, Planning

Commission, 2000). The biggest challenge for researchers and policy makers,

therefore, is how would the forest meet the global requirement at a time when

there is steady decrease of resources? Medicinal plants can be preserved and

used for common human ailments. These plants have secondary plant

- 46 -

metabolites of different composition are grouped as alkaloids, glycosides,

terpenoids, steroids, saponin, essential oils etc. Fungal endophytes capable of

producing these metabolites can solve the problem of over exploitation of the

plants leading to extinction. The plant endophytic fungi are novel mine of natural

bioactive compounds with great potentials in agriculture, medicine and food

industry. Taking advantage of modern technologies we can better understand

and manipulate this important microorganism resource and make it more benefit

for the mankind. Thus metabolites from the fungal endophytes of several

precious herbs and plants can be developed into medicines in laboratories and

can benefit the public. Fungal endophytes have been found in every plant species

examined to date and appear to be important, but largely unquantified,

components of fungal biodiversity. Endophytes are especially little known in

tropical forest trees, where their abundance and diversity are thought to be

greatest. The study proposed is aimed to explore the occurrence of endophytes in

medicinal plants and RET species. Only a few reports are available on isolation

and diversity of endophytic mycoflora from Indian medicinal plants and trees.

Much progress can be made in utilizing the fungal endophytes in agriculture,

medicine and food industry and hence it is worthwhile to conduct studies in this

area which can bring out fruitful results. The present study had identified few

promising molecules from the true endophytes from Cyanometra travancorica and

Aerva lanata.

- 47 -

7. OUTCOMES OF THE PROJECT

Salient achievements

Identified the true endophytes of Cyanometra travancorica and Aerva lanata

Identified two compounds each from the endophytic fungi C. gloeosporioides

and Fusarium equiseti – Compound A, B, C and D respectively.

Compound A, a terpenoid from C. gloeosporioides with cytotoxic activity, G0

arrest in cell cycle analysis and anticancer activity in colon cancer cell lines was

isolated.

Research publications

Thulasi G. Pillai and R.Jayaraj. Colletotrichum gloeosporioides, a true endophyte of the endangered tree, Cynometra travancorica in the Western Ghats. Journal of Plant Pathology and Microbiology.2015. 6.267-269.

Thulasi G. Pillai and R.Jayaraj. Identification of Endophytic Fungi/Opportunistic Pathogen from the Perennial Herb of Amaranthaceae Family. J. Plant Physiology and Pathology. 2015. 3.1-2.

Papers presented in Conferences Post irradiation protection and enhancement of DNA repair of beta glucan

isolated from Ganoderma lucidum. Thulasi G. Pillai et al., National conference on “Current Perspectives on Environmental Mutagenesis and Human Health” held at Bhabha Atomic Research Centre, Mumbai, from Jan 28-30, 2013.

27th International Carbohydrate Symposium organized by International carbohydrate organization at IISc, Bangalore from Jan 12-17, 2014. Thulasi G. Pillai and C. K. K. Nair. Fungal polysaccharide protects radiation induced DNA damage in human lymphocytes.

International conference on Proteomics organised by IIT, Bombay from 06.12.2016 to 11.12.2016. Thulasi G Pillai. Genomic analysis of C. gloeosporiodes from an endophytic fungi, Lifestyle transition in host.

- 48 -

8. SCOPE OF FUTURE WORK

Understanding the diversity of fungal endophytes of major medicinal plants in the

Western Ghats which have therapeutic value is an area which is less explored. The

limited knowledge on the varied use of the medicinal plants, their availability and

extent of distribution in forest area limits efficient use of these resources.

Endophytes of medicinal plants and their potential use are a most promising

resource, which awaits great exploration. The present study can fill this gap to

certain extent and lay foundation for future studies.

Only a few reports are available on isolation and diversity of endophytic

mycoflora from Indian medicinal plants and trees. The fungal kingdom is species-

rich, and fungi perform a multitude of functions in the ecosystems, yet the extent

of fungal diversity is poorly known. Reports suggest that active metabolites

produced by endophytic fungi have medicinal importance. eg. The anticancer

drug, taxol is produced by the endophytic fungus Taxomyces andreanae, and the

potent antileukemia agent vincristine from leaves of Catharanthus roseus. The

forest is an integral part of a traditional life-style. Western Ghats is one of the 33

recognised sensitive zones of the world. In several ways it is most unique. The

Western Ghats and Sri Lanka biodiversity hotspot, with its unique assemblages of

plant and animal communities and endemic species, is globally important for

conserving representative areas of the Earth’s biodiversity, making it worthy of

international attention.

- 49 -

9. BIBLIOGRAPHY

1. S.K.Gond., A.Mishra, V.K.Sharma, S.K Verma., J.Kumar, R.N.Kharwar, A.Kumar, Diversity and Antimicrobial activity of endophytic fungi isolated from Nycanthes arbour-tritis, a well –known medicinal plant of India. Mycoscience, vol.53, pp85-166, 2011.

2. J.Berdy. Bioactive microbial metabolites. J of Antibiot, vol.58,pp.1-26,2005. 3. M.M.Dreyfuss, and I.H.Chapela. 1994. Potential of fungi in the discovery of novel,

low molecular weight pharmaceuticals. In the discovery of natural products with therapeutic potential. Edited by U.F. Gullo. Butterworth-Heinemann, London.Pp.49-80.

4. D.Hoffmeister, N.P.Keller. Natural Products of filamentous fungi: enzymes, genes and their regulation.Nat.Prod.Rep.vol.24, pp.393-416,2007.

5. R.Tiwari, A.Kalra, M.P.Darokar, M.Chandra, N.Aggarwal, S.K.Singh, S.P.S.Khanuja. Endophytic bacteria from Ocimum sanctum and their yield enhancing capabilities. Curr. Microbiol. Vol.60, pp.167-171,2010.

6. K.R.Sridhar and N.S.Raviraj. Endophytes – a crucial issue. Current Science, vol.69, pp.570-571, 1995.

7. O.Petrini. Notes on some species of Chloroscypha endophytic in Cupressaceae of Europe and North America. Sydowia, vol.35, pp.206-222, 1989.

8. T.N.Sieber. Endophytic fungi in twigs of healthy and diseased Norway spruce and White fir. Mycological Research, vol. 92, pp.322-326,1989.

9. P.J.Fisher, O.Petrini, L.E.Petrini and E.Descals. 1993. A preliminary study of fungi inhabiting xylem and whole stems of Olea europea. Sydowia, vol.44,pp117-121, 1993.

10. J. Li, G.-Z. Zhao, H.-H. Chen et al., “Antitumour and antimicrobial activities of endophytic streptomycetes from pharmaceutical plants in rainforest,” Letters in Applied Microbiology, vol. 47, no. 6, pp. 574–580, 2008.

11. R. X. Tan and W. X. Zou, “Endophytes: a rich source of functional metabolites,” Natural Product Reports, vol. 18, no. 4, pp. 448–459, 2001.

12. K.-H. Kogel, P. Franken, and R. Hückelhoven, “Endophyte or parasite—what decides?” Current Opinion in Plant Biology, vol. 9, no. 4, pp. 358–363, 2006.

13. G. Strobel, B. Daisy, U. Castillo, and J. Harper, “Natural products from endophytic microorganisms,” Journal of Natural Products, vol. 67, no. 2, pp. 257–268, 2004.

14. G. Strobel and B. Daisy, “Bioprospecting for microbial endophytes and their natural products,” Microbiology and Molecular Biology Reviews, vol. 67, no. 4, pp. 491–502, 2003.

15. Strobel, “Endophytes as sources of bioactive products,” Microbes and Infection, vol. 5, no. 6, pp. 535–544, 2003.

16. Q. L. Souza, A. D. L. Souza, S. Astolfi Filho, M. L. Belém Pinheiro, M. I. M. Sarquis, and J. O. Pereira, “Atividade antimicrobiana de fungos endofíticos isolados de plantas tóxicas da Amazônia: Palicourea longiflora (aubl.) rich e Strychnos cogens bentham,” ACTA Amazônica, vol. 34, pp. 185–195, 2004.

17. N. L. Owen and N. Hundley, “Endophytes—the chemical synthesizers inside plants,” Science Progress, vol. 87, no. 2, pp. 79–99, 2004.

18. R.Zhang, J.An. Wang et al., “Exploring novel bioactive compounds from marine microbes,” Current Opinion in Microbiology, vol. 8, no. 3, pp. 276–281, 2005.

19. D. J. Newman and G. M. Cragg, “Natural products as sources of new drugs over the last 25 years,” Journal of Natural Products, vol. 70, no. 3, pp. 461–477, 2007.

20. A.A. L. Gunatilaka, “Natural products from plant-associated microorganisms: distribution, structural diversity, bioactivity, and implications of their occurrence,” Journal of Natural Products, vol. 69, no. 3, pp. 509–526, 2006.

- 50 -

21. J. L. Bicas, A. P. Dionísio, and G. M. Pastore, “Bio-oxidation of terpenes: an approach for the flavor industry,” Chemical Reviews, vol. 109, no. 9, pp. 4518–4531, 2009.

22. K. B. Borges, W. D. S. Borges, R. Durán-Patrón, M. T. Pupo, P. S. Bonato, and I. G. Collado, “Stereoselective biotransformations using fungi as biocatalysts,” Tetrahedron Asymmetry, vol. 20, no. 4, pp. 385–397, 2009.

23. L. Bicas, F. F. C. Barros, R. Wagner, H. T. Godoy, and G. M. Pastore, “Optimization of R-(+)-α-terpineol production by the biotransformation of R-(+)-limonene,” Journal of Industrial Microbiology and Biotechnology, vol. 35, no. 9, pp. 1061–1070, 2008.

24. U. Krings, B. Hardebusch, D. Albert, R. G. Berger, M. Maróstica Jr., and G. M. Pastore, “Odor-active alcohols from the fungal transformation of α-farnesene,” Journal of Agricultural and Food Chemistry, vol. 54, no. 24, pp. 9079–9084, 2006.

25. R. G. Berger, “Biotechnology of flavours-the next generation,” Biotechnology Letters, vol. 31, no. 11, pp. 1651–1659, 2009.

26. Scopus American Cancer Society, “Cancer Facts & Figures 2009,” American Cancer Society, Atlanta, Ga, USA, 2009. WHO Mortality Database, Fact sheet No. 297. February 2009.

27. V. Gangadevi and J. Muthumary, “Taxol, an anticancer drug produced by an endophytic fungus Bartalinia robillardoides Tassi, isolated from a medicinal plant, Aegle marmelos Correa ex Roxb,” World Journal of Microbiology and Biotechnology, vol. 24, no. 5, pp. 717–724, 2008.

28. G. Pasut and F. M. Veronese, “PEG conjugates in clinical development or use as anticancer agents: an overview,” Advanced Drug Delivery Reviews, vol. 61, no. 13, pp. 1177–1188, 2009.

29. S. Firáková, M. Šturdíková, and M. Múčková, “Bioactive secondary metabolites produced by microorganisms associated with plants,” Biologia, vol. 62, no. 3, pp. 251–257, 2007.

30. M. A. Cremasco, B. J. Hritzko, and N.-H. Linda Wang, “Experimental purification of paclitaxel from a complex mixture of taxanes using a simulated moving bed,” Brazilian Journal of Chemical Engineering, vol. 26, no. 1, pp. 207–218, 2009.

31. M. C. Wani, H. L. Taylor, M. E. Wall, P. Coggon, and A. T. McPhail, “Plant antitumor agents. VI. The isolation and structure of taxol, a novel antileukemic and antitumor agent from Taxus brevifolia,” Journal of the American Chemical Society, vol. 93, no. 9, pp. 2325–2327, 1971.

32. A.Guo, Y. Wang, X. Sun, and K. Tang, “Bioactive natural products from endophytes: a review,” Applied Biochemistry and Microbiology, vol. 44, no. 2, pp. 136–142, 2008.

33. H. Lu, B. Li, Y. Kang et al., “Paclitaxel nanoparticle inhibits growth of ovarian cancer xenografts and enhances lymphatic targeting,” Cancer Chemotherapy and Pharmacology, vol. 59, no. 2, pp. 175–181, 2006.

34. S. Kakolyris, A. Agelidou, N. Androulakis et al., “Cisplatin plus etoposide chemotherapy followed by thoracic irradiation and paclitaxel plus cisplatin consolidation therapy for patients with limited stage small cell lung carcinoma,” Lung Cancer, vol. 53, no. 1, pp. 59–65, 2006.

35. S. Peltier, J.-M. Oger, F. Lagarce, W. Couet, and J.-P. Benoît, “Enhanced oral paclitaxel bioavailability after administration of paclitaxel-loaded lipid nanocapsules,” Pharmaceutical Research, vol. 23, no. 6, pp. 1243–1250, 2006.

36. A.Stierle, G. Strobel, and D. Stierle, “Taxol and taxane production by Taxomyces andreanae, an endophytic fungus of Pacific yew,” Science, vol. 260, no. 5105, pp. 214–216, 1993.

- 51 -

37. J.-Y. Li, G. Strobel, R. Sidhu, W. M. Hess, and E. J. Ford, “Endophytic taxol-producing fungi from bald cypress, Taxodium distichum,” Microbiology, vol. 142, no. 8, pp. 2223–2226, 1996.

38. G. A. Strobel, W. M. Hess, J.-Y. Li et al., “Pestalotiopsis guepinii, a taxol-producing endophyte of the wollemi pine, Wollemia nobilis,” Australian Journal of Botany, vol. 45, no. 6, pp. 1073–1082, 1997.

39. R. S. Kumaran, J. Muthumary, and B. K. Hur, “Production of taxol from Phyllosticta spinarum, an endophytic fungus of Cupressus sp,” Engineering in Life Sciences, vol. 8, no. 4, pp. 438–446, 2008.

40. V. Gangadevi and J. Muthumary, “Taxol production by Pestalotiopsis terminaliae, an endophytic fungus of Terminalia arjuna (arjun tree),” Biotechnology and Applied Biochemistry, vol. 52, no. 1, pp. 9–15, 2009.

41. M. Pandi, R. Manikandan, and J. Muthumary, “Anticancer activity of fungal taxol derived from Botryodiplodia theobromae Pat., an endophytic fungus, against 7, 12 dimethyl benz(a)anthracene (DMBA)-induced mammary gland carcinogenesis in Sprague dawley rats,” Biomedicine and Pharmacotherapy, vol. 64, pp. 48–53, 2010.

42. M. E. Wall, M. C. Wani, C. E. Cook, K. H. Palmer, A. T. McPhail, and G. A. Sim, “Plant antitumor agents. I. The isolation and structure of camptothecin, a novel alkaloidal leukemia and tumor inhibitor from Camptotheca acuminata,” Journal of the American Chemical Society, vol. 88, no. 16, pp. 3888–3890, 1966.

43. S. R. Uma, B. T. Ramesha, G. Ravikanth, P. G. Rajesh, R. Vasudeva, and K. N. Ganeshaiah, “Chemical profiling of N. nimmoniana for camptothecin, an important anticancer alkaloid: towards the development of a sustainable production system,” in Bioactive Molecules and Medicinal Plants, K. G. Ramawat and J. Merillion, Eds., pp. 198–210, Springer, Berlin, Germany, 2008.

44. Q.-Y. Li, Y.-G. Zu, R.-Z. Shi, and L.-P. Yao, “Review camptothecin: current perspectives,” Current Medicinal Chemistry, vol. 13, no. 17, pp. 2021–2039, 2006.

45. A.F. S. Kehrer, O. Soepenberg, W. J. Loos, J. Verweij, and A. Sparreboom, “Modulation of camptothecin analogs in the treatment of cancer: a review,” Anti-Cancer Drugs, vol. 12, no. 2, pp. 89–105, 2001.

46. S. Kusari, S. Zühlke, and M. Spiteller, “An endophytic fungus from Camptotheca acuminata that produces camptothecin and analogues,” Journal of Natural Products, vol. 72, no. 1, pp. 2–7, 2009.

47. S.-S. Jew, H.-J. Kim, M. Goo Kim et al., “Synthesis and in vitro cytotoxicity of hexacyclic Camptothecin analogues,” Bioorganic and Medicinal Chemistry Letters, vol. 9, no. 22, pp. 3203–3206, 1999.

48. S.Shweta, S. Zuehlke, B. T. Ramesha et al., “Endophytic fungal strains of Fusarium solani, from Apodytes dimidiata E. Mey. ex Arn (Icacinaceae) produce camptothecin, 10-hydroxycamptothecin and 9-methoxycamptothecin,” Phytochemistry, vol. 71, no. 1, pp. 117–122, 2010.

49. K. Liu, X. Ding, B. Deng, and W. Chen, “10-Hydroxycamptothecin produced by a new endophytic Xylaria sp., M20, from Camptotheca acuminata,” Biotechnology Letters, vol. 32, no. 5, pp. 689–693, 2010.

50. S. Rehman, A. S. Shawl, A. Kour et al., “An endophytic Neurospora sp. from Nothapodytes foetida producing camptothecin,” Applied Biochemistry and Microbiology, vol. 44, no. 2, pp. 203–209, 2008.

51. T. Amna, S. C. Puri, V. Verma et al., “Bioreactor studies on the endophytic fungus entrophospora infrequens for the production of an anticancer alkaloid camptothecin,” Canadian Journal of Microbiology, vol. 52, no. 3, pp. 189–196, 2006.

- 52 -

52. S. G. Puri, V. Verma, T. Amna, G. N. Qazi, and M. Spiteller, “An endophytic fungus from Nothapodytes foetida that produces camptothecin,” Journal of Natural Products, vol. 68, no. 12, pp. 1717–1719, 2005.

53. S. K. Deshmukh, P. D. Mishra, A. Kulkarni-Almeida et al., “Anti-inflammatory and anticancer activity of ergoflavin isolated from an endophytic fungus,” Chemistry and Biodiversity, vol. 6, no. 5, pp. 784–789, 2009.

54. J.-Y. Zhang, L.-Y. Tao, Y.-J. Liang et al., “Secalonic acid D induced leukemia cell apoptosis and cell cycle arrest of G1 with involvement of GSK-3β/β-catenin/c-Myc pathway,” Cell Cycle, vol. 8, no. 15, pp. 2444–2450, 2009.

55. L. G. Korkina, “Phenylpropanoids as naturally occurring antioxidants: from plant defense to human health,” Cellular and Molecular Biology, vol. 53, no. 1, pp. 15–25, 2007.

56. T. P. Fill, B. F. da Silva, and E. Rodrigues-Fo, “Biosynthesis of phenylpropanoid amides by an endophytic penicillium brasilianum found in root bark of Melia azedarach,” Journal of Microbiology and Biotechnology, vol. 20, no. 3, pp. 622–629, 2010.

57. H. Chapela, O. Petrini, and L. Hagmann, “Monolignol glucosides as specific recognition messengers in fungus-plant symbioses,” Physiological and Molecular Plant Pathology, vol. 39, no. 4, pp. 289–298, 1991.

58. H. Koshino, S.-I. Terada, T. Yoshihara et al., “Three phenolic acid derivatives from stromata of Epichloe typhina on Phleum pratense,” Phytochemistry, vol. 27, no. 5, pp. 1333–1338, 1988.

59. M. Gordaliza, P. A. García, J. M. Miguel Del Corral, M. A. Castro, and M. A. Gómez-Zurita, “Podophyllotoxin: distribution, sources, applications and new cytotoxic derivatives,” Toxicon, vol. 44, no. 4, pp. 441–459, 2004.

60. S. Kusari, M. Lamshöft, and M. Spiteller, “Aspergillus fumigatus Fresenius, an endophytic fungus from Juniperus communis L. Horstmann as a novel source of the anticancer pro-drug deoxypodophyllotoxin,” Journal of Applied Microbiology, vol. 107, no. 3, pp. 1019–1030, 2009.

61. A.Kour, A. S. Shawl, S. Rehman et al., “Isolation and identification of an endophytic strain of Fusarium oxysporum producing podophyllotoxin from Juniperus recurva,” World Journal of Microbiology and Biotechnology, vol. 24, no. 7, pp. 1115–1121, 2008.

62. S. C. Puri, A. Nazir, R. Chawla et al., “The endophytic fungus Trametes hirsuta as a novel alternative source of podophyllotoxin and related aryl tetralin lignans,” Journal of Biotechnology, vol. 122, no. 4, pp. 494–510, 2006.

63. A.L. Eyberger, R. Dondapati, and J. R. Porter, “Endophyte fungal isolates from Podophyllum peltatum produce podophyllotoxin,” Journal of Natural Products, vol. 69, no. 8, pp. 1121–1124, 2006.

64. M. M. Wagenaar, J. Corwin, G. Strobel, and J. Clardy, “Three new cytochalasins produced by an endophytic fungus in the genus Rhinocladiella,” Journal of Natural Products, vol. 63, no. 12, pp. 1692–1695, 2000.

65. I.C. Lee, G. A. Strobel, E. Lobkovsky, and J. Clardy, “Torreyanic acid: a selectively cytotoxic quinone dimer from the endophytic fungus Pestalotiopsis microspora,” Journal of Organic Chemistry, vol. 61, no. 10, pp. 3232–3233, 1996.

66. Y.Chen, H. Guo, Z. Du, X.-Z. Liu, Y. Che, and X. Ye, “Ecology-based screen identifies new metabolites from a Cordyceps-colonizing fungus as cancer cell proliferation inhibitors and apoptosis inducers,” Cell Proliferation, vol. 42, no. 6, pp. 838–847, 2009.

67. M. D. R. V. Fernandes, T. A. C. Silva, L. H. Pfenning et al., “Biological activities of the fermentation extract of the endophytic fungus Alternaria alternata isolated from

- 53 -

Coffea arabica L,” Brazilian Journal of Pharmaceutical Sciences, vol. 45, no. 4, pp. 677–685, 2009.

68. Y. Huang, J. Wang, G. Li, Z. Zheng, and W. Su, “Antitumor and antifungal activities in endophytic fungi isolated from pharmaceutical plants Taxus mairei, Cephalataxus fortunei and Torreya grandis,” FEMS Immunology and Medical Microbiology, vol. 31, no. 2, pp. 163–167, 2001.

69. S. F. Brady, M. P. Singh, J. E. Janso, and J. Clardy, “Cytoskyrins A and B, new BIA active bisanthraquinones isolated from an endophytic fungus,” Organic Letters, vol. 2, no. 25, pp. 4047–4049, 2000.

70. M. Isaka, A. Jaturapat, K. Rukseree, K. Danwisetkanjana, M. Tanticharoen, and Y. Thebtaranonth, “Phomoxanthones A and B, novel xanthone dimers from the endophytic fungus Phomopsis species,” Journal of Natural Products, vol. 64, no. 8, pp. 1015–1018, 2001.

71. G. Ding, Z. Zheng, S. Liu, H. Zhang, L. Guo, and Y. Che, “Photinides A-F, cytotoxic benzofuranone-derived γ-lactones from the plant endophytic fungus Pestalotiopsis photiniae,” Journal of Natural Products, vol. 72, no. 5, pp. 942–945, 2009.

72. Y. C. Song, H. Li, Y. H. Ye, C. Y. Shan, Y. M. Yang, and R. X. Tan, “Endophytic naphthopyrone metabolites are co-inhibitors of xanthine oxidase, SW1116 cell and some microbial growths,” FEMS Microbiology Letters, vol. 241, no. 1, pp. 67–72, 2004.

73. A.Klemke, S. Kehraus, A. D. Wright, and G. M. König, “New secondary metabolites from the marine endophytic fungus Apiospora montagnei,” Journal of Natural Products, vol. 67, no. 6, pp. 1058–1063, 2004.

74. H. Yu, L. Zhang, L. Li et al., “Recent developments and future prospects of antimicrobial metabolites produced by endophytes,” Microbiological Research, vol. 165, no. 6, pp. 437–449, 2010.

75. J.H. Song, “What's new on the antimicrobial horizon?” International Journal of Antimicrobial Agents, vol. 32, no. 4, pp. S207–S213, 2008.

76. X. Liu, M. Dong, X. Chen, M. Jiang, X. Lv, and J. Zhou, “Antimicrobial activity of an endophytic Xylaria sp.YX-28 and identification of its antimicrobial compound 7-amino-4-methylcoumarin,” Applied Microbiology and Biotechnology, vol. 78, no. 2, pp. 241–247, 2008.

77. W. Pongcharoen, V. Rukachaisirikul, S. Phongpaichit et al., “Metabolites from the endophytic fungus Xylaria sp. PSU-D14,” Phytochemistry, vol. 69, no. 9, pp. 1900–1902, 2008.

78. P. Pittayakhajonwut, R. Suvannakad, S. Thienhirun, S. Prabpai, P. Kongsaeree, and M. Tanticharoen, “An anti-herpes simplex virus-type 1 agent from Xylaria mellisii (BCC 1005),” Tetrahedron Letters, vol. 46, no. 8, pp. 1341–1344, 2005.

79. S. Boonphong, P. Kittakoop, M. Isaka, D. Pittayakhajonwut, M. Tanticharoen, and Y. Thebtaranonth, “Multiplolides A and B, new antifungal 10-membered lactones from Xylaria multiplex,” Journal of Natural Products, vol. 64, no. 7, pp. 965–967, 2001.

80. J.-H. Park, G. J. Choi, H. B. Lee et al., “Griseofulvin from Xylaria sp. strain F0010, an endophytic fungus of Abies holophylla and its antifungal activity against plant pathogenic fungi,” Journal of Microbiology and Biotechnology, vol. 15, no. 1, pp. 112–117, 2005.

81. H. Koshino, T. Yoshihara, S. Sakamura, T. Shimanuki, T. Sato, and A. Tajimi, “Novel C-11 epoxy fatty acid from stromata of Epichloe typhina on Phleum pratense,” Agricultural Biology and Chemistry, vol. 53, pp. 2527–2528, 1989.

82. I.A. Findlay, G. Li, and J. A. Johnson, “Bioactive compounds from an endophytic fungus from eastern larch (Larix laricina) needles,” Canadian Journal of Chemistry, vol. 75, no. 6, pp. 716–719, 1997.

- 54 -

83. C. Qin, Y.-M. Zhang, J.-M. Gao et al., “Bioactive metabolites produced by Chaetomium globosum, an endophytic fungus isolated from Ginkgo biloba,” Bioorganic and Medicinal Chemistry Letters, vol. 19, no. 6, pp. 1572–1574, 2009.

84. Z. Huang, X. Cai, C. Shao et al., “Chemistry and weak antimicrobial activities of phomopsins produced by mangrove endophytic fungus Phomopsis sp. ZSU-H76,” Phytochemistry, vol. 69, no. 7, pp. 1604–1608, 2008.

85. B. Schulz, J. Sucker, H. J. Aust et al., “Biologically active secondary metabolites of endophytic Pezicula species,” Mycological Research, vol. 99, no. 8, pp. 1007–1015, 1995.

86. A.Li, L. Jiang, L. Guo, H. Zhang, and Y. Che, “Pestalachlorides A-C, antifungal metabolites from the plant endophytic fungus Pestalotiopsis adusta,” Bioorganic and Medicinal Chemistry, vol. 16, no. 17, pp. 7894–7899, 2008.

87. S. Kusari, M. Lamshöft, S. Zühlke, and M. Spiteller, “An endophytic fungus from Hypericum perforatum that produces hypericin,” Journal of Natural Products, vol. 71, no. 2, pp. 159–162, 2008.

88. U. Castillo, J. K. Harper, G. A. Strobel et al., “Kakadumycins, novel antibiotics from Streptomyces sp. NRRL 30566, an endophyte of Grevillea pteridifolia,” FEMS Microbiology Letters, vol. 224, no. 2, pp. 183–190, 2003.

89. A.W. Wang, R. H. Jiao, A. B. Cheng, S. H. Tan, and Y. C. Song, “Antimicrobial potentials of endophytic fungi residing in Quercus variabilis and brefeldin A obtained from Cladosporium sp,” World Journal of Microbiology and Biotechnology, vol. 23, no. 1, pp. 79–83, 2007.

90. D. Ezra, U. F. Castillo, G. A. Strobel et al., “Coronamycins, peptide antibiotics produced by a verticillate Streptomyces sp. (MSU-2110) endophytic on Monstera sp,” Microbiology, vol. 150, no. 4, pp. 785–793, 2004.

91. A.M. P. de Melo, M. F. Fiore, L. A. B. de Moraes et al., “Antifungal compound produced by the cassava endophyte Bacillus pumilus MAIIIM4A,” Scientia Agricola, vol. 66, no. 5, pp. 583–592, 2009.

92. I.C. Cafêu, G. H. Silva, H. L. Teles et al., “Antifungal compounds of Xylaria sp., an endophytic fungus isolated from Palicourea marcgravii (Rubiaceae),” Quimica Nova, vol. 28, no. 6, pp. 991–995, 2005.

93. A.H. Silva, H. L. Teles, H. C. Trevisan et al., “New bioactive metabolites produced by Phomopsis cassiae, an endophytic fungus in Cassia spectabilis,” Journal of the Brazilian Chemical Society, vol. 16, no. 6 B, pp. 1463–1466, 2005.

94. A.M. R. Marinho, E. Rodrigues-Filho, M. D. L. R. Moitinho, and L. S. Santos, “Biologically active polyketides produced by Penicillium janthinellum isolated as an endophytic fungus from fruits of Melia azedarach,” Journal of the Brazilian Chemical Society, vol. 16, no. 2, pp. 280–283, 2005.

95. A.Y. Liu, Y. C. Song, Z. Zhang et al., “Aspergillus fumigatus CY018, an endophytic fungus in Cynodon dactylon as a versatile producer of new and bioactive metabolites,” Journal of Biotechnology, vol. 114, no. 3, pp. 279–287, 2004.

96. F. You, T. Han, J.-Z. Wu, B.-K. Huang, and L.-P. Qin, “Antifungal secondary metabolites from endophytic Verticillium sp,” Biochemical Systematics and Ecology, vol. 37, no. 3, pp. 162–165, 2009.

97. E. Li, R. Tian, S. Liu, X. Chen, L. Guo, and Y. Che, “Pestalotheols A-D, bioactive metabolites from the plant endophytic fungus Pestalotiopsis theae,” Journal of Natural Products, vol. 71, no. 4, pp. 664–668, 2008.

98. A.H. Aly, R. Edrada-Ebel, V. Wray et al., “Bioactive metabolites from the endophytic fungus Ampelomyces sp. isolated from the medicinal plant Urospermum picroides,” Phytochemistry, vol. 69, no. 8, pp. 1716–1725, 2008.

- 55 -

99. V. Rukachaisirikul, U. Sommart, S. Phongpaichit, J. Sakayaroj, and K. Kirtikara, “Metabolites from the endophytic fungus Phomopsis sp. PSU-D15,” Phytochemistry, vol. 69, no. 3, pp. 783–787, 2008.

100. A.M. Hoffman, S. G. Mayer, G. A. Strobel et al., “Purification, identification and activity of phomodione, a furandione from an endophytic Phoma species,” Phytochemistry, vol. 69, no. 4, pp. 1049–1056, 2008.

101. J.Y. Li, J. K. Harper, D. M. Grant et al., “Ambuic acid, a highly functionalized cyclohexenone with antifungal activity from Pestalotiopsis spp. and Monochaetia sp,” Phytochemistry, vol. 56, no. 5, pp. 463–468, 2001.

102. U. F. Castillo, G. A. Strobel, E. J. Ford et al., “Munumbicins, wide-spectrum antibiotics produced by Streptomyces NRRL 30562, endophytic on Kennedia nigriscans,” Microbiology, vol. 148, no. 9, pp. 2675–2685, 2002.

103. W.-Y. Huang, Y.-Z. Cai, J. Xing, H. Corke, and M. Sun, “A potential antioxidant resource: endophytic fungi from medicinal plants,” Economic Botany, vol. 61, no. 1, pp. 14–30, 2007.

104. H. E. Seifried, D. E. Anderson, E. I. Fisher, and J. A. Milner, “A review of the interaction among dietary antioxidants and reactive oxygen species,” Journal of Nutritional Biochemistry, vol. 18, no. 9, pp. 567–579, 2007.

105. G. Strobel, E. Ford, J. Worapong, et al., “Isopestacin, an isobenzofuranone from Pestalotiopsis microspora, possessing antifungal and antioxidant activities,” Phytochemistry, vol. 60, no. 2, pp. 179–183, 2002.

106. A.Kardošová and E. Machová, “Antioxidant activity of medicinal plant polysaccharides,” Fitoterapia, vol. 77, no. 5, pp. 367–373, 2006.

107. D. Luo and B. Fang, “Structural identification of ginseng polysaccharides and testing of their antioxidant activities,” Carbohydrate Polymers, vol. 72, no. 3, pp. 376–381, 2008.

108. C. Sun, J.-W. Wang, L. Fang, X.-D. Gao, and R.-X. Tan, “Free radical scavenging and antioxidant activities of EPS2, an exopolysaccharide produced by a marine filamentous fungus Keissleriella sp. YS 4108,” Life Sciences, vol. 75, no. 9, pp. 1063–1073, 2004.

109. R. Yu, W. Yang, L. Song, C. Yan, Z. Zhang, and Y. Zhao, “Structural characterization and antioxidant activity of a polysaccharide from the fruiting bodies of cultured Cordyceps militaris,” Carbohydrate Polymers, vol. 70, no. 4, pp. 430–436, 2007.

110. J. Liu, J. Luo, H. Ye, Y. Sun, Z. Lu, and X. Zeng, “Production, characterization and antioxidant activities in vitro of exopolysaccharides from endophytic bacterium Paenibacillus polymyxa EJS-3,” Carbohydrate Polymers, vol. 78, no. 2, pp. 275–281, 2009.

111. Y. C. Song, W. Y. Huang, C. Sun, F. W. Wang, and R. X. Tan, “Characterization of graphislactone A as the antioxidant and free radical-scavenging substance from the culture of Cephalosporium sp. IFB-E001, an endophytic fungus in Trachelospermum jasminoides,” Biological and Pharmaceutical Bulletin, vol. 28, no. 3, pp. 506–509, 2005.

112. K. B. Borges, W. D. S. Borges, M. T. Pupo, and P. S. Bonato, “Endophytic fungi as models for the stereoselective biotransformation of thioridazine,” Applied Microbiology and Biotechnology, vol. 77, no. 3, pp. 669–674, 2007.

113. M.Doble, A. K. Kruthiventi, and V. G. Gaikar, Eds., Biotransformations and Bioprocesses, Marcel Dekker, New York, NY, USA, 2004. B. Suresh, T. Ritu, and G. A. Ravishankar, “Biotransformations as applicable to food industries,” in Food Biotechnology, pp. 1655–1690, Taylor and Francis, New York, NY, USA, 2nd edition, 2006.

- 56 -

114. K. B. Borges, W. D. S. Borges, M. T. Pupo, and P. S. Bonato, “Stereoselective analysis of thioridazine-2-sulfoxide and thioridazine-5-sulfoxide: an investigation of rac-thioridazine biotransformation by some endophytic fungi,” Journal of Pharmaceutical and Biomedical Analysis, vol. 46, no. 5, pp. 945–952, 2008.

115. J. Aleu and I. G. Collado, “Biotransformations by Botrytis species,” Journal of Molecular Catalysis, vol. 13, no. 4–6, pp. 77–93, 2001.

116. N.A. Longo and M. A. Sanromán, “Production of food aroma compounds: microbial and enzymatic methodologies,” Food Technology and Biotechnology, vol. 44, no. 3, pp. 335–353, 2006.

117. A.C. Figueiredo, M. J. Almendra, J. G. Barroso, and J. J. C. Scheffer, “Biotransformation of monoterpenes and sesquiterpenes by cell suspension cultures of Achillea millefolium L. ssp. Millefolium,” Biotechnology Letters, vol. 18, no. 8, pp. 863–868, 1996.

118. N.Verza, N. S. Arakawa, N. P. Lopes et al., “Biotransformation of a tetrahydrofuran lignan by the endophytic fungus Phomopsis sp,” Journal of the Brazilian Chemical Society, vol. 20, no. 1, pp. 195–200, 2009.

119. M. Zikmundová, K. Drandarov, L. Bigler, M. Hesse, and C. Werner, “Biotransformation of 2-benzoxazolinone and 2-hydroxy-1,4-benzoxazin-3-one by endophytic fungi isolated from Aphelandra tetragona,” Applied and Environmental Microbiology, vol. 68, no. 10, pp. 4863–4870, 2002.

120. P.Mohana Kumar, S.Zuehlke, V.Priti, B.T.Ramesha, S. Shweta, et al. Fusarium proliferatum, an endophytic fungus from Dysoxylum binectariferum Hook. f, produces rohitukine, a chromane alkaloid possessing anti-cancer activity. Antonie van Leeuwenhoek vol.101, pp323-329, 2012.

121. W.Photita, S.Lumyong, P.Lumyong, and K.D.Hyde. Endophytic fungi of wild banana (Musa acuminate) at Doi Suthep Pui National Park, Thailand. Mycological Research, vol.105,pp1508-1513, 2001.

122. O.Petrini. Notes on some species of Chloroscypha endophytic in Cupressaceae of Europe and North America. Sydowia, vol.35, pp206-222,1982.

123. J.Frohlick, K.D.Hyde, and O.Petrini. Endophytic fungi associated with palms. Mycological Research, vol.104, pp1202-1212, 2000.

124. H.Wagner. L.Horhammer L. Pharmacognosy and Phytochemistry. Springer-Verlag Berlin and Heidelberg GmbH & Co. K.1970.

125. J.O'Brien, I.Wilson, T.Orton, F.Pognan. Investigation of the Alamar Blue (resazurin) fluorescent dye for the assessment of mammalian cell cytotoxicity. European journal of biochemistry / FEBS. vol.267,pp 5421–6, 2000.

126. V.Gangadevi and J.Muthumary J. Isolation of Colletotrichum gloeosporioides, a novel endophytic taxol-producing fungus from the leaves of a medicinal plant, Justicia gendarussa. Mycologia Balcanica. Vol.5,pp1–4, 2008.