JOURNAL OF CLINICAL MICROBIOLOGY, Sept. 1992, p. 2366-2372 Vol. 30, No. 9 0095-1137/92/092366-07$02.00/0 Copyright X 1992, American Society for Microbiology Biologically Distinct Subtypes of Mycobacterium avium Differ in Possession of Insertion Sequence IS901 Z. M. KUNZE,1 F. PORTAELS,2 AND J. J. McFADDENl* Molecular Microbiology Group, School of Biological Sciences, University of Surrey, Guildford, Surrey GU2 SXH, United Kingdom, 1 and Department of Microbiology, Institute of Tropical Medicine, Antwerp 2000, Belgium2 Received 21 January 1992/Accepted 6 June 1992 Mycobacterium avium causes disease, principally tuberculosis in immunocompromised individuals. It is the most frequent cause of disseminated infections in AIDS patients in the West. The pathogen is also associated with disease in animals, chiefly birds and livestock, and may be isolated from environmental samples such as soil and water. Analysis of strains of M. avium isolated from clinical, veterinary, and environmental sources for the presence of the mycobacterial insertion sequences IS900 and IS901 demonstrates the specific association of IS901 to animal pathogenic M. avium strains. In contrast, most clinical M. avium strains and all AIDS-derived strains examined so far lacked IS901. Significant differences in the plasmid contents and serotypes of strains with and without IS901 were also found. We therefore suggest that the presence of IS901 divides M. avium into two clearly distinct subtypes with differing host range, virulence, plasmid possession, and serotyping antigens. By using DNA sequence data from IS901 and M. avium DNA, a set of polymerase chain reactions were developed for the specific detection and differentiation of these subtypes. The Mycobacterium avium-M. intracellulare complex, or M. avium complex, is a group of related mycobacteria that cause widespread disease in animals (7, 8, 33). M. avium is generally considered to be an opportunistic pathogen in humans, causing tuberculosis, lymphadenitis, and dissemi- nated infections in immunocompromised patients, particu- larly AIDS patients (5, 6, 11, 15). M. avium is now recog- nized as the cause of the most common disseminated bacterial infections in Western AIDS patients. The pathogen is thought to be never or only very rarely transmitted from person to person. The source of M. avium infection in humans is unknown, but its presence in animals, birds, and environmental samples suggests a number of possible reser- voirs. The M. avium complex was initially classified into seroagglutination types: serotypes 1 to 3 were designated M. avium, and serotypes 4 to 21 were designated M. intracellu- lare. The close phenotypic similarity of the two species led to their being grouped in a single (M. avium) complex (26). DNA homology studies, however, indicated that although many M. intracellulare serotypes were genetically distinct from those of M. avium (sharing less than 56% DNA homology), serotypes 4, 5, 6, and 8 were in fact indistin- guishable from those of M. avium and are now considered to be M. avium complex serotypes (1). These higher M. avium complex serotypes are those that are most commonly asso- ciated with AIDS (15), whereas the classical M. avium serotypes (1, 2, and 3) are those most commonly associated with infections in birds and other animals (7, 8, 25, 33). The reasons for these associations are presently unknown. Two specific mammalian pathogens are also closely related to M. avium (>95% DNA homology): M. paratuberculosis, the causative agent of Johne's disease (chronic regional enteri- tis) in ruminants (3, 27), but implicated in Crohn's disease in humans (4, 21) and M. lepraemurium, the cause of murine leprosy (21, 28). M. paratuberculosis is characterized by its requirement for the iron-chelating growth factor mycobactin * Corresponding author. (2) for in vitro growth and possession of the insertion sequence IS900 (10, 35). However, some strains of M. avium, such as the "wood pigeon bacillus" (2, 18), also require mycobactin, particularly upon primary isolation. These mycobactin-dependent M. avium strains have long been the subject of controversy, since they typically display a pathogenicity intermediate between those of M. avium and M. paratuberculosis. Neither serological studies (24) nor DNA homology determinations (14, 20, 32, 37) were found to distinguish between M. paratuberculosis, M. avium, and the wood pigeon bacillus, leading some investigators to con- clude that M. paratuberculosis and the wood pigeon bacillus should be considered variants, subspecies, or biovars of M. avium (14, 24, 32). More recently, pulsed-field gel electro- phoresis (17) and numerical taxonomic analysis (34) indi- cated four clusters in this group and led to the proposal that M. paratuberculosis and mycobactin-dependent strains of M. avium be designated subspecies of M. avium, specifi- cally, M. avium subsp. paratuberculosis and M. avium subsp. silvaticum, respectively. A third cluster in the com- plex described included mostly M. avium strains isolated from animals and birds and was designated M. avium subsp. avium, whereas the fourth cluster consisted of only a single strain, M. paratuberculosis 316F. Restriction fragment length polymorphism (RFLP) analy- sis has been used to examine the M. avium complex (21, 29) and also to demonstrate that a single highly conserved strain of M. avium, designated M. avium RFLP type A, most commonly infects AIDS patients (11, 22). The mycobacterial insertion sequence IS900 was isolated from the genome of M. paratuberculosis (10) and shown to be highly specific to M. paratuberculosis. The DNA sequence of IS900 was used to develop a specific polymerase chain reaction (PCR) for the identification of M. paratuberculosis and the diagnosis of Johne's disease (35). More recently, some strains of M. avium, designated RFLP type A/I, were shown to contain a repetitive element related to IS900 (22). The DNA sequence of this element, designated IS901, was recently determined (16). For a limited number of strains studied, possession of 2366 on May 11, 2021 by guest http://jcm.asm.org/ Downloaded from on May 11, 2021 by guest http://jcm.asm.org/ Downloaded from on May 11, 2021 by guest http://jcm.asm.org/ Downloaded from on May 11, 2021 by guest http://jcm.asm.org/ Downloaded from on May 11, 2021 by guest http://jcm.asm.org/ Downloaded from
Transcript
JOURNAL OF CLINICAL MICROBIOLOGY, Sept. 1992, p. 2366-2372 Vol. 30, No. 90095-1137/92/092366-07$02.00/0Copyright X 1992, American Society for Microbiology
Biologically Distinct Subtypes of Mycobacterium avium Differin Possession of Insertion Sequence IS901
Z. M. KUNZE,1 F. PORTAELS,2 AND J. J. McFADDENl*Molecular Microbiology Group, School of Biological Sciences, University of Surrey, Guildford,
Surrey GU2 SXH, United Kingdom, 1 and Department ofMicrobiology, Institute ofTropical Medicine, Antwerp 2000, Belgium2
Received 21 January 1992/Accepted 6 June 1992
Mycobacterium avium causes disease, principally tuberculosis in immunocompromised individuals. It is themost frequent cause of disseminated infections in AIDS patients in the West. The pathogen is also associatedwith disease in animals, chiefly birds and livestock, and may be isolated from environmental samples such assoil and water. Analysis of strains ofM. avium isolated from clinical, veterinary, and environmental sources forthe presence of the mycobacterial insertion sequences IS900 and IS901 demonstrates the specific association ofIS901 to animal pathogenic M. avium strains. In contrast, most clinical M. avium strains and all AIDS-derivedstrains examined so far lacked IS901. Significant differences in the plasmid contents and serotypes of strainswith and without IS901 were also found. We therefore suggest that the presence of IS901 divides M. avium intotwo clearly distinct subtypes with differing host range, virulence, plasmid possession, and serotyping antigens.By using DNA sequence data from IS901 and M. avium DNA, a set of polymerase chain reactions weredeveloped for the specific detection and differentiation of these subtypes.
The Mycobacterium avium-M. intracellulare complex, orM. avium complex, is a group of related mycobacteria thatcause widespread disease in animals (7, 8, 33). M. avium isgenerally considered to be an opportunistic pathogen inhumans, causing tuberculosis, lymphadenitis, and dissemi-nated infections in immunocompromised patients, particu-larly AIDS patients (5, 6, 11, 15). M. avium is now recog-nized as the cause of the most common disseminatedbacterial infections in Western AIDS patients. The pathogenis thought to be never or only very rarely transmitted fromperson to person. The source of M. avium infection inhumans is unknown, but its presence in animals, birds, andenvironmental samples suggests a number of possible reser-voirs. The M. avium complex was initially classified intoseroagglutination types: serotypes 1 to 3 were designated M.avium, and serotypes 4 to 21 were designated M. intracellu-lare. The close phenotypic similarity of the two species ledto their being grouped in a single (M. avium) complex (26).DNA homology studies, however, indicated that althoughmany M. intracellulare serotypes were genetically distinctfrom those of M. avium (sharing less than 56% DNAhomology), serotypes 4, 5, 6, and 8 were in fact indistin-guishable from those ofM. avium and are now considered tobe M. avium complex serotypes (1). These higher M. aviumcomplex serotypes are those that are most commonly asso-ciated with AIDS (15), whereas the classical M. aviumserotypes (1, 2, and 3) are those most commonly associatedwith infections in birds and other animals (7, 8, 25, 33). Thereasons for these associations are presently unknown. Twospecific mammalian pathogens are also closely related to M.avium (>95% DNA homology): M. paratuberculosis, thecausative agent of Johne's disease (chronic regional enteri-tis) in ruminants (3, 27), but implicated in Crohn's disease inhumans (4, 21) and M. lepraemurium, the cause of murineleprosy (21, 28). M. paratuberculosis is characterized by itsrequirement for the iron-chelating growth factor mycobactin
* Corresponding author.
(2) for in vitro growth and possession of the insertionsequence IS900 (10, 35). However, some strains of M.avium, such as the "wood pigeon bacillus" (2, 18), alsorequire mycobactin, particularly upon primary isolation.These mycobactin-dependent M. avium strains have longbeen the subject of controversy, since they typically displaya pathogenicity intermediate between those ofM. avium andM. paratuberculosis. Neither serological studies (24) norDNA homology determinations (14, 20, 32, 37) were found todistinguish between M. paratuberculosis, M. avium, and thewood pigeon bacillus, leading some investigators to con-clude that M. paratuberculosis and the wood pigeon bacillusshould be considered variants, subspecies, or biovars of M.avium (14, 24, 32). More recently, pulsed-field gel electro-phoresis (17) and numerical taxonomic analysis (34) indi-cated four clusters in this group and led to the proposal thatM. paratuberculosis and mycobactin-dependent strains ofM. avium be designated subspecies of M. avium, specifi-cally, M. avium subsp. paratuberculosis and M. aviumsubsp. silvaticum, respectively. A third cluster in the com-plex described included mostly M. avium strains isolatedfrom animals and birds and was designated M. avium subsp.avium, whereas the fourth cluster consisted of only a singlestrain, M. paratuberculosis 316F.
Restriction fragment length polymorphism (RFLP) analy-sis has been used to examine the M. avium complex (21, 29)and also to demonstrate that a single highly conserved strainof M. avium, designated M. avium RFLP type A, mostcommonly infects AIDS patients (11, 22). The mycobacterialinsertion sequence IS900 was isolated from the genome ofM. paratuberculosis (10) and shown to be highly specific toM. paratuberculosis. The DNA sequence of IS900 was usedto develop a specific polymerase chain reaction (PCR) forthe identification ofM. paratuberculosis and the diagnosis ofJohne's disease (35). More recently, some strains of M.avium, designated RFLP type A/I, were shown to contain arepetitive element related to IS900 (22). The DNA sequenceof this element, designated IS901, was recently determined(16). For a limited number of strains studied, possession of
12547 (MFT) 1 Deera The source and/or reference referring to the strains is indicated in
parentheses. RC, R. Chiodini, University of Connecticut, Storrs, Conn.; JS,the collection of J. Stanford, Middlesex Hospital Medical School, London,United Kingdom; IB, I. Brown, Department of Medical Microbiology, St.Mary's Hospital Medical School, London, United Kingdom; FP, F. Portaels,Institute of Tropical Medicine, Antwerp, Belgium; TM, S. Neill, Departmentof Agriculture, Veterinary Research Laboratories, Stormont, Belfast, North-ern Ireland; FS, F. Saxegaard, National Veterinary Institute, Oslo, Norway;CVL, the Central Veterinary Laboratory, Weybridge, Surrey, United King-dom; JF, J. Falkingham, Department of Biology, Virginia Polytechnic Insti-tute and State University, Blacksburg; MFT, M.-F. Thorel, Centre Nationald'Etudes Veterinaires et Alimentaires, Laboratoire Central de RecherchesVeterinaires, Maisons Alfort, France (strains have already been described[34]).
b CD, Crohn's disease; TB, tuberculosis.
IS901 was found to be associated with virulence for BALB/cmice (16).
In this study, we examined in detail the distributions ofIS900 and IS901 among strains of the M. avium complexfrom clinical, veterinary, and environmental sources. Addi-tionally, we examined the association between the posses-sion of insertion sequences, plasmids, and serotypes in M.avium. We also developed a PCR-based test to differentiateM. avium strains into two specific subtypes with differenthost-range and virulence properties on the basis of thepresence or the absence of IS901.
MATERIALS AND METHODS
Mycobacterial strains. Mycobacterial strains and speciesare described in Table 1. Mycobacteria were grown on slants
of Ogawa medium (28), Lowenstein-Jensen medium, orHerrolds egg yolk medium (3). Mycobactin at 2 p,g/ml wasadded when required.
Preparation of mycobacterial DNA. Cells (approximately0.1 g) were harvested into 5 ml of TEN buffer (50 mMTris-HCl [pH 8], 100 mM EDTA, 150 mM NaCI), washed,and then digested with 10 mg of subtilisin ml-' (Carlsburg,Sigma type VIII) for 3 h at 37°C, followed by 1 mg oflysozyme ml-' (Sigma) for 3 h at 50°C. Sodium dodecylsulfate (SDS) was added to 1%, and pronase (Calbiochem)was added to 3 mg ml-1 and incubated at 37°C for 24 h, witha further addition of pronase (to a total of 6 mg ml-1) after 18h. DNA was extracted by multiple phenol-chloroform ex-traction, RNase A digestion, and ethanol precipitation asdescribed previously (22).DNA probes and manipulations. The clone pMB22 contain-
ing IS900 was derived as described previously (19). Theclone pUS410 containing IS901 was derived as describedpreviously (16). The clone pJC20 containing the mycobacte-rial plasmid pLR7 (9) was obtained from J. Crawford (Vet-erans Administration Medical Center, University of Arkan-sas, Little Rock). Restriction endonuclease digestion ofgenomic DNA, electrophoresis, Southern blotting, and prob-ing were performed by using standard protocols (30). South-ern blots were first washed at low stringency (0.15 M sodiumchloride, 0.05 M trisodium citrate, 0.1% SDS [pH 7]) andautoradiographed, and then they were washed at high strin-gency (0.015 M sodium chloride, 0.005 M trisodium citrate,0.1% SDS [pH 7]) and autoradiographed again. Since bothpMB22 and pUS410 contain flanking (M. paratuberculo-sis-M. avium) DNA in addition to insertion sequence DNA,the probes give distinctive (different) banding patterns withmost M. avium and M. paratuberculosis strains. Strainscontaining either IS900- or IS901-related insertion sequenceswere identified by the presence of an additional set ofmultiple bands that hybridized to both probes (since DNAsequences of IS900 and IS901 are 60% homologous). Strainscontaining IS900 and those containing IS901 were differen-tiated by using high stringency washes after hybridizationwith each probe.
Gen-Probe test. Two M. avium type A and two M. aviumtype A/I strains were tested with the M. avium complexGen-Probe test (Gen-Probe Inc., San Diego, Calif.). Testswere carried out according to the manufacturer's instruc-tions.PCR primers and conditions. PCR was performed as
described previously (31). Briefly, the PCR conditions forIS901 and M. avium PCR (Biometra and Hybaid heatingblocks) consisted of a 30-cycle reaction which included aninitial denaturation step at 94°C for 60 s. This was followedby cycles of annealing (65°C, 30 s), extension (72°C, 150 s),and denaturation (94°C, 30 s). The final cycle consisted of anannealing step (65°C, 120 s) followed by extension (72°C, 300s). For IS900 amplification, an annealing temperature of 680Cwas used.The primer pairs selected from IS900 (10) and IS901 (16)
sequence data and the DNA sequence flanking the IS901insertion in M. avium A/I (16a) were as follows.
(i) The primers specific for M. avium RFLP type A/I wereGCAACGGTTGTTGC1llGAAA and TGATACGGCCGGAATCGCGT. The primers were derived from positions 76and 1184 of IS901. The expected size of the PCR productwas 1,108 bp.
(ii) The primers specific for M. avium RFLP type A andM. paratuberculosis were CAGCCAGCCGAATGTCATCCand CAACTCGCGACACGTTCACC. The primers were de-
BFIG. 1. Southern blots of M. avium complex DNA digested with PvuII, probed with pMB22 (IS900) (A) and pUS410 (IS901) (B). Lanes:
1 to 4, 13, and 14, M. avium isolates from AIDS patients; 5 to 8, M. avium animal isolates; 9 to 12, M. paratuberculosis strains; 15, M.intracellulare isolates; 16, M. scrofulaceum isolates. Phage lambda HindIlI DNA size markers are shown along the sides. The DNA samplein lane 4 was not fully digested.
rived 150 bp upstream and downstream of the IS901 inser-tion in M. avium A/I. The expected size of the PCR productwas 300 bp (both M. avium type A and M. paratuberculosis;1,742 bp for M. avium type A/I).
(iii) The primers specific for M. paratuberculosis wereTGGACAATGACGGTTACGGAGGTGG and GATCGGAACGTCGGCTGGTCAGGAT. The primers were derivedfrom positions 209 and 662 of IS900. The expected size of thePCR product was 453 bp.
(iv) The primers specific for M. avium A/I and M. paratu-berculosis were CCGCGGCGAAGGCAAGACCG andCGAGGAACTCAGCGCCCAGG. The primers were de-rived from positions 511 and 1088 of IS901, exhibiting 100%homology with IS900. The expected sizes of the PCR prod-ucts were 574 bp (IS900) and 577 bp (IS901).
RESULTSAll strains examined were identified as either M. avium or
M. paratuberculosis on the basis of the RFLP patternsobtained with the probe pMB22 (19, 21, 22). Table 1 showsthe presence of IS900 and IS901 in M. avium and M.paratuberculosis strains as determined by hybridization withthe DNA probes pMB22 (containing IS900) and pUS410(containing IS901). A limited number of strains were alsoexamined by the PCRs described below, and in all cases,these reactions confirmed the results obtained by hybridiza-tion. Figure 1 shows a Southern blot of a selection of M.avium complex DNA digested with PvuII and probed withpMB22 (Fig. 1A) and pUS410 (Fig. 1B). No strains thatcontained both IS900 and IS901 were identified.M. avium from clinical sources. AIDS-derived strains were
from AIDS patients in the United States, Europe, andAustralia and were mostly isolated from patients with dis-seminated infections. None of the 81 strains isolated fromAIDS patients were found to contain IS900 or IS901 (Fig. 1,lanes 1 to 4, 13, and 14, shows typical strains). All AIDSstrains so far examined would therefore be designated M.avium RFLP type A (11, 22). Non-AIDS-derived clinicalstrains were mostly isolated from patients with (atypical)tuberculosis. Of these, 4 of 44 (9%) contained IS901 andwould be designated M. avium type A/I (22).
M. avium strains from animals. Of the 27 animal-derivedM. avium strains (all from animals with tuberculosis) exam-ined, 20 (74%) contained IS901, and we therefore designatethem M. avium A/I strains. The banding patterns obtained(Fig. 1, lanes 5 to 8) were very similar to those of moststrains, indicating identical insertion of IS901, althoughsome banding polymorphism was observed. None of thesestrains contained IS900. Four of these strains (from deer)were characterized as being mycobactin dependent upon
initial isolation; however, many were isolated initially onmedia without mycobactin and would not therefore beexpected to demonstrate mycobactin dependence. Of theseven animal strains in which IS901 was not detected (andtherefore designated M. avium RFLP type A strains), sixwere from pigs and one was from deer.M. avium strains from birds. All but one of the 45 strains
from tuberculous birds contained IS901, and they wouldtherefore be designated M. avium A/I strains. Strains were
from a variety of birds, including chickens, wildfowl, andgeese. Most of these were isolated on media without myco-bactin; however, eight strains isolated from wood pigeonswere characterized as mycobactin dependent upon initialisolation. All but one (M21) of the 9 wood pigeon-derivedstrains examined contained IS901.M. avium from environmental sources. Only one of seven
environmental strains examined contained IS901. In con-
trast, M. avium type A strains were isolated from water,aerosols, and soil.M. paratuberculosis strains. Of the 35 strains of M. paratu-
berculosis examined that were isolated from ruminants withJohne's disease, 31 (89%), including the American neotypestrain and the vaccine strain 316F that forms cluster 4described by Thorel et al. (34), contained IS900 and wouldtherefore be described by us as true M. paratuberculosisstrains. All strains gave almost identical banding patterns(Fig. 1, lanes 10 to 12), indicating nearly identical IS900insertion, except for a single-band polymorphism seen insome strains. The remaining six "M. paratuberculosis"strains contained IS901, and we would therefore now desig-nate these strains M. avium RFLP type A/I. Probing withadditional random DNA probes (data not shown) demon-
strated that these M. avium A/I strains differ from M.paratuberculosis by several independent RFLPs and areindistinguishable from the M. avium RFLP type A/I strainsisolated from other animals. Only 1 of the 15 bovine M.paratuberculosis strains, but all 3 deer strains, examinedcontained IS901, indicating that there may be some hostrange differences between M. paratuberculosis and M.avium A/I as causes of Johne's disease. The single bovinestrain containing IS901 was the vaccine strain and the formerM. paratuberculosis type strain 18. Interestingly, IS900 wasnot identified in any M. avium-described strain from ananimal with tuberculosis, indicating that although M. aviumA/I may cause Johne's disease, M. paratuberculosis doesnot cause tuberculosis in animals.
Association of IS901 with serotypes. A total of 82% of allthe M. avium A/I strains were of the classical M. aviumserotype 1, 2, or 3 (Table 2). Only 25% of the M. avium typeA strains were serotype 1, 2, or 3, the majority being mostlyserotypes 4, 6, and 8.
1 2 3 45 678 9
A
Association of IS900 and IS901 with plasmids. A total of 65(59%) of the 110 RFLP type A strains investigated werefound to contain plasmids related to pLR7. However, nopLR7-related plasmids were found in any of 55 M. avium A/Istrains that were similarly investigated. None of the M.paratuberculosis strains examined contained plasmids re-lated to pLR7.Gen-Probe test ofM. avium strains. Both M. avium type A
and M. avium type A/I strains were identified as M. aviumby using the Gen-Probe test.PCR for identification of M. avium strains. Rapid differen-
tiation of M. avium type A and M. avium type A/I may beuseful for clinical, veterinary, and epidemiological studies.The identification of possible causes of Johne's disease mayconversely require the detection of both M. paratuberculosisand M. avium type A/I. We therefore used conserved andinsertion sequence-specific regions of IS900 and IS901 andflanking M. avium DNA sequence data to develop a set ofspecific PCRs capable of differentiating these subtypes-species (Fig. 2).
(i) Specific detection of M. avium A/I by using an IS901-specific DNA sequence. A 1,108-bp PCR product was ob-tained for all strains containing IS901 (Fig. 2A, lanes 3 and4).
(ii) Detection of M. avium type A. DNA sequence dataflanking a site of the IS901 insertion in M. avium RFLP A/Iwas utilized to develop the PCR for the detection of M.avium RFLP type A strains. This PCR gave a 300-bp bandfor M. avium type A strains (Fig. 2B, lanes 3 and 4) but a1,776-bp band for strains containing IS901 at the site of PCRamplification (Fig. 2B, lanes 5 and 6). M. paratuberculosisgave a band identical to that obtained for M. avium type Astrains with this PCR (Fig. 2B, lanes 1 and 2), indicating thatthis site is unoccupied in M. paratuberculosis.
(iii) Specific detection ofM. paratuberculosis. IS900-specificDNA sequence data were used to develop a PCR that gave a
B
C DFIG. 2. PCR amplification of M. avium complex DNA employing primer pairs as described in Materials and Methods. (A) PCR specific
for M. avium A/I. (B) PCR for M. avium type A. (C) PCR specific for M. paratuberculosis. (D) PCR specific for M. avium A/I and M.paratuberculosis. (A) Lanes 1 and 2, M. paratuberculosis; lanes 3 and 4, M. avium type A/I; lanes 5 and 6, M. avium type A. (B to D) Lanes1 and 2, M. paratuberculosis; lanes 3 and 4, M. avium type A; lanes 5 and 6, M. avium type A/I. Lanes 7 of all panels contain M. intracellulareDNA, lanes 8 contain negative control PCR, and lanes 9 contain HaeIII-digested +X174 marker DNA.
453-bp band with M. paratuberculosis strains containingIS900 (Fig. 2C, lanes 1 and 2).
(iv) Detection of either M. paratuberculosis or M. avium A/I.DNA sequences common to both IS900 and IS901 were usedto develop a PCR that gave a 574-bp product with both M.avium A/I (Fig. 2D, lanes 5 and 6) and M. paratuberculosis(Fig. 2D, lanes 1 and 2).
DISCUSSION
M. avium is an important pathogen of humans and ani-mals, particularly in relation to AIDS. We demonstrate herethat the species M. avium may be divided into two distinctsubtypes on the basis of the presence or the absence of theinsertion sequence IS901. The first, M. avium type A/I,possesses IS901 and corresponds closely to the classicalspecies M. avium isolated from birds. M. avium type A/Iappears to be primarily an animal and bird pathogen that iscapable of causing both tuberculosis and (infrequently)Johne's disease in animals. It is only rarely isolated fromhuman disease (tuberculosis) and has not been identified sofar in any AIDS strains. M. avium type A is much lessfrequently associated with animal disease and may be pri-marily an environmental organism. M. avium type A is,however, the predominant M. avium pathogen in humandisease, particularly AIDS, in which it causes disseminatedinfections. These distinct pathogens are indistinguishable bypresent microbiological, biochemical, and serological tests,DNA homology studies, and the Gen-Probe M. avium com-plex test. However, the DNA probes and the PCR testsdescribed here may be used to distinguish these pathogens.
It is remarkable that we have never detected a single M.avium A/I strain in any AIDS isolate, out of 81 examined,despite the prevalence of such strains in animals and birds.Curiously, however, 9% of the clinically derived strains fromnon-AIDS patients (mostly tuberculosis patients) were M.avium A/I strains. The reasons for the markedly differentdisease associations between M. avium type A and M. aviumtype A/I are unknown but might reflect differences in viru-lence for humans, particularly AIDS patients (M. avium typeA may possess human-specific virulence factors or virulencefactors associated with the ability to cause disseminatedinfections in immunocompromised patients) or the exposureof AIDS patients to sources of infection that segregate M.avium type A and type A/I (e.g., environmental sources).These results clearly demonstrate that the source of M.avium infection in humans is unlikely to be animals.These results also clarify certain features of the epidemi-
ology of M. avium disease. Seventy-five percent of the M.avium RFLP type A strains that were serotyped were foundto be serotypes 4 to 11, particularly serotypes 4, 6, and 8,those serotypes that were previously described as M. intra-cellulare but are considered by many workers to be inter-mediate between M. avium and M. intracellulare (23, 24, 26)and are now classified as the M. avium complex. Theseserotypes are those most frequently associated with M.avium complex infections in AIDS (5, 6, 15). The associationof these M. avium serotypes with AIDS is therefore due tothe association of these particular serotyping antigens withM. avium type A. Similarly, the higher frequency of plasmidpossession described for AIDS-derived strains comparedwith M. avium from other sources (9) may also be due to therelatively high frequency of plasmids in M. avium type A. Inthis study, the frequency of plasmid possession did not differsignificantly between AIDS and non-AIDS M. avium type Astrains. We have not found any pLR7-related plasmids in
any M. avium A/I strains or M. paratuberculosis strains,suggesting that the presence of these plasmids and that ofinsertion sequences IS900 and IS901 are mutually exclusive.Previous studies have identified the serotypes 4 to 11 asbeing most frequently associated with the M. avium complexin nonliving environmental reservoirs (25, 36). Most envi-ronmental M. avium strains we examined were RFLP typeA, indicating that M. avium A is a more common environ-mental organism than M. avium A/I and supporting thesuggestion that the source of M. avium infection in AIDS isthe environment (6, 11). Interestingly, six of nine pig-derivedM. avium strains were type A strains, indicating that pigsmay, unlike other animals, have a susceptibility to thispathogen similar to that found in AIDS patients.These results also have relevance to the taxonomy of the
M. avium complex and differ in several important respectsfrom the recently described taxonomic scheme proposed byThorel et al. (34). M. paratuberculosis or M. avium subsp.paratuberculosis (34) is identified as a very slowly growing,mycobactin-dependent Mycobacterium species isolatedfrom ruminants with Johne's disease. It is clear from thiswork that this description includes two genetically distinctmycobacteria: M. paratuberculosis (containing IS900) andM. avium RFLP type A/I (containing IS901) that differ alsoin virulence properties (plus or minus the ability to causetuberculosis in animals and birds) and cultural characteris-tics (stability of mycobactin dependence). Only one bovineM. paratuberculosis strain was found to be M. avium A/I,the former type strain and vaccine strain strain 18. Severalinvestigators have noted that this strain is more closelyrelated to M. avium and, unlike most M. paratuberculosisstrains, has lost mycobactin dependence in culture (17, 21,34). M. paratuberculosis 316F, comprising cluster 4 of thetaxonomic scheme proposed by Thorel et al. (34), was in ouranalysis a typical M. paratuberculosis strain. All typicalwood pigeon-derived M. avium strains were found to containIS901, and we would therefore describe them as being M.avium RFLP type A/I strains. However, M. avium A/I doesnot correspond to M. avium subsp. silvaticum, as describedby Thorel et al. (34), but includes strains (e.g., strain 18 andM. paratuberculosis 2103) that were classified into cluster 2of Thorel et al. and therefore described by them as M. aviumsubsp. avium. Similarly, although M. avium type A includesthree strains (M21, 12547, and 2103) from cluster 2 of Thorelet al. (34), it does not entirely correspond toM. avium subsp.avium (34), since it does not contain (M. paratuberculosis)strain 18.
Finally, it is intriguing that the pathological characteristicsof disease associated with M. avium type A infection inhumans with AIDS (involvement of the gastrointestinaltract, mesenteric lymphadenitis, large numbers of organismspresent in macrophages in lesions, diffuse granuloma, excre-tion of bacilli into feces, bacteremia, disseminated disease,weight loss, and intermittent fever [12, 13]) are also thoseassociated with Johne's disease caused by M. paratubercu-losis and M. avium A/I (as shown in this study) in ruminants(3). It appears that human immunodeficiency virus-inducedimmunodeficiency allows M. avium type A, which in non-immunocompromised humans is usually associated withorgan-specific disease (e.g., tuberculosis, lymphadenitis), tocause the gastrointestinal and disseminated infections usu-ally associated with M. avium A/I and M. paratuberculosisinfections in nonimmunocompromised animals with Johne'sdisease. It would clearly be of interest to determine thegenetic modifications resulting from the integration of inser-tion sequences into these very closely related pathogens.
This investigation was supported by the Science and Technologyfor Development Programme of the European Community, contractno. TS2-0080-UK.
REFERENCES1. Baess, I. 1983. Deoxyribonucleic acid relationships between
diferent serovars of Mycobactenru, avium, Mycobacteriumintracellulare and Mycobacterium s'crofulaceum. Acta Pathol.Microbiol. Scand. 91:201-203.
2. Barclay, R., and C. Ratledge. 1983. Iron-binding compounds ofMycobactenium avium, M. intracellulare, M. scrofulaceum, andmycobactin-dependent M. paratuberculosis and M. avium. J.Bacteriol. 153:1138-1146.
3. Chiodini, R. J., H. J. Van Kruiningen, and R. S. Merkal. 1984.Ruminant paratuberculosis (Johne's disease). The current statusand future prospects. Cornell Vet. 74:218-262.
4. Chiodini, R. J., H. J. Van Kruiningen, W. R. Thayer, R. S.Merkal, and J. A. Coutu. 1984. Possible role of mycobacteria ininflammatory bowel disease. I. An unclassified Mycobacteriumspecies isolated from patients with Crohn's disease. Dig. Dis.Sci. 29:1073-1079.
5. Collins, F. 1986. Mycobactenum avium-complex infections anddevelopment of acquired immunodeficiency syndrome: causalopportunist or causal co-factor. Int. J. Lepr. 54:458-474.
6. Collins, F. M. 1989. Mycobacterial disease, immunosuppres-sion, and acquired immunodeficiency syndrome. Clin. Micro-biol. Rev. 2:360-377.
7. Collins, F. M., and R. W. Stokes. 1987. Mycobacterium aviumcomplex infections in normal and immunodeficient mice. Tuber-cle 68:127-136.
8. Collins, P., P. R. J. Mathews, A. McDiarmid, and A. Brown.1983. The pathogenicity of Mycobacterium avium and relatedmycobacteria for experimental animals. J. Med. Microbiol.16:27-35.
9. Crawford, J. T., and J. H. Bates. 1986. Analysis of plasmids inMycobacterium avium-intracellulare isolates from persons withacquired immunodeficiency syndrome. Am. Rev. Respir. Dis.134:659-661.
10. Green, E. P., M. L. V. Tizard, M. T. Moss, J. Thompson, D. J.Winterbourne, J. J. McFadden, and J. Hermon-Taylor. 1989.Sequence and characteristics of IS900, and insertion elementidentified in a human Crohn's disease isolate of Mycobacteriumparatuberculosis. Nucleic Acids Res. 17:9063-9073.
11. Hampson, S. J., F. Portaels, J. Thompson, M. T. Moss, F.Portaels, E. P. Green, J. Hermon-Taylor, and J. J. McFadden.1989. DNA probes demonstrate a single highly conserved strainof Mycobacterium avium infecting AIDS patients. Lancet i:65-68.
12. Helbert, M., D. Robinson, D. Buchanan, T. Hellyer, M. McCar-thy, I. Brown, A. J. Pinching, and D. M. Mitchell. 1990.Mycobacterial infections in patients infected with the humanimmunodeficiency virus. Thorax 45:45-48.
13. Horsburgh, C. R., Jr. 1991. Mycobacterium avium complexinfection in the acquired immunodeficiency syndrome. N. Engl.J. Med. 324:1332-1338.
14. Hurley, S. S., G. Splitter, and R. Welch. 1988. Deoxyribonucleicacid relatedness of Mycobacterium paratuberculosis to othermembers of the family Mycobacteriaceae. Int. J. Syst. Bacte-riol. 38:143-146.
15. Keihn, T. E., F. F. Edwards, P. Brannon, A. Y. Tsang, M. Maio,J. W. M. Gold, E. Whimbey, B. Wong, J. K. McClatchy, and D.Armstrong. 1986. Infections caused by Mycobacterium aviumcomplex in immunocompromised patients: diagnosis by bloodculture and fecal examination, antimicrobial susceptibility tests,and morphological and seroagglutination characteristics. J.Clin. Microbiol. 21:168-173.
16. Kunze, Z. M., S. Wall, R. Appelberg, M. T. Silva, F. Portaels,and J. J. McFadden. 1991. IS901, a new member of a wide-spread class of atypical insertion sequences, is associated withpathogenicity in Mycobacterium avium. Mol. Microbiol.5:2265-2272.
16a.Kunze, Z. M., et al. Unpublished data.
17. Levy-Frebault, V. V., M. F. Thorel, A. Varnerot, and B.Gicquel. 1989. DNA polymorphism in Mycobacterium paratu-berculosis, "wood pigeon mycobacteria," and related myco-bacteria analyzed by field inversion gel electrophoresis. J. Clin.Microbiol. 27:2823-2826.
18. Mathews, P., A. McDiarmid, P. Collins, and A. Brown. 1977.The dependence of some strains of Mycobacterium avium onmycobactin for initial and subsequent growth. J. Med. Micro-biol. 11:53-57.
19. McFadden, J. J., P. D. Butcher, R. J. Chiodini, and J. Hermon-Taylor. 1987. Crohn's disease-isolated mycobacteria are identi-cal toMycobacterium paratuberculosis, as determined by DNAprobes that distinguish between mycobacterial species. J. Clin.Microbiol. 25:796-801.
20. McFadden, J. J., P. D. Butcher, R. J. Chiodini, and J. Hermon-Taylor. 1987. Determination of genome size and DNA homologybetween an unclassified Mycobacterium species isolated frompatients with Crohn's disease and other mycobacteria. J. Gen.Microbiol. 133:211-214.
21. McFadden, J. J., P. D. Butcher, J. Thompson, R. J. Chiodini,and J. Hermon-Taylor. 1987. The use of DNA probes identifyingrestriction-fragment-length polymorphisms to examine the My-cobactenium avium complex. Mol. Microbiol. 1:283-291.
22. McFadden, J. J., Z. Kunze, and P. Seechurn. 1990. DNA probesfor detection and identification, p. 139-172. In J. J. McFadden(ed.), Molecular biology of the mycobacteria. Surrey UniversityPress, Surrey, United Kingdom.
23. McIntyre, G., and J. L. Stanford. 1986. The relationship be-tween immunodiffusion and agglutination serotypes of Myco-bactenium avium and Mycobactenium intracellulare. Eur. J.Respir. Dis. 69:135-141.
24. McIntyre, G., and J. L. Stanford. 1986. Immunodiffusion anal-ysis shows that Mycobactenium paratuberculosis and othermycobactin-dependent mycobacteria are variants of Mycobac-terinum avium. J. Appl. Bacteriol. 61:295-298.
25. Meissner, G., and W. Anz. 1977. Sources of Mycobacteriumavium complex infection resulting in human disease. Am. Rev.Respir. Dis. 166:1057-1064.
26. Meissner, G., K. H. Schroder, G. E. Amadio, W. Anz, S.Chaparas, H. W. B. Engel, P. A. Jenkins, W. Kappler, H. H.Kleeberg, E. Kubala, M. Kubin, D. Lauterbach, A. Lind, M.Magnusson, Z. D. Mikova, S. R. Pattyn, W. B. Schaeffer, J. L.Stanford, M. Tsukamura, L. G. Wayne, I. Willers, and E.Wolinski. 1974. A cooperative numerical analysis of non-scoto-and nonphoto-chromogenic slowly growing mycobacteria. J.Gen. Microbiol. 83:207-235.
27. Merkal, R. S., and A. B. Larson. 1974. Growth and metaboliccharacteristics of Mycobacterium paratuberculosis. Appl. Mi-crobiol. 28:276-279.
28. Pattyn, S. R., and F. Portaels. 1979. In vitro cultivation andcharacterisation of Mycobacterium lepraemunium. Int. J. Lepr.48:7-14.
29. Picken, R. N., A. Y. Tsang, and H. L. Yang. 1988. Speciation oforganisms within the Mycobacteinum avium-Mycobacteriumintracellulare-Mycobactenium scrofulaceum (MAIS) complexbased on restriction fragment polymorphisms. Mol. Cell. Probes2:289-304.
30. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecularcloning: a laboratory manual, 2nd ed. Cold Spring HarborLaboratory Press, Cold Spring Harbor, N.Y.
31. Sauki, R. K., S. Scharf, F. Faloona, K. B. Mullis, G. T. Horn,H. A. Erlich, and N. Armheim. 1985. Enzymic amplification ofthe b-globin genomic sequences and restriction site analysis fordiagnosis of sickle cell anemia. Science 230:1350-1354.
32. Saxegaard, F., and I. Baess. 1988. Relationship between Myco-bactenium avium-Mycobactenium paratuberculosis and "woodpigeon" mycobacteria. Acta Pathol. Microbiol. Immunol.Scand. 96:37-42.
33. Thoen, C. 0., E. M. Himes, and A. G. Karlson. 1984. Mycobac-teinum avium complex, p. 1251-1275. In G. P. Kubica and L. G.Wayne (ed.), The mycobacteria: a sourcebook. Marcel Dekker,Inc., New York.
34. Thorel, M. F., M. Krichevsky, and V. V. Levy-Frebault. 1990.
Numerical taxonomy of mycobactin-dependent mycobacteria,emended description of Mycobactenium avium, and descriptionof Mycobactenium avium subsp. avium subsp. nov., Mycobac-terium avium subsp. paratuberculosis subsp. nov., and Myco-bacterium avium subsp. silvaticum subsp. nov. Int. J. Syst.Bacteriol. 40:254-260.
35. Vary, P. H., P. R. Andersen, E. Green, J. Hermon-Taylor, andJ. J. McFadden. 1990. Use of highly specific DNA probes andthe polymerase chain reaction to detect Mycobacterium paratu-
berculosis in Johne's disease. J. Clin. Microbiol. 28:933-937.36. Wendt, S. W., K. L. George, B. C. Parker, H. Gruft, and J. 0.
Falkinham. 1980. Epidemiology of infection by non-tuberculousmycobacteria. III. Isolation of potentially pathogenic mycobac-teria from aerosols. Am. Rev. Respir. Dis. 122:259-263.
37. Yoshimura, H. H., and D. Y. Graham. 1988. Nucleic acidhybridization studies of mycobactin-dependent mycobacteria.J. Clin. Microbiol. 26:1309-1312.
studies (unpublished) showed that types 53 and 80 and someSTs cross-reacted with the typing sera, and on sequencingwe found that there is considerable sequence similaritywithin the N-terminal regions of M proteins from thesetypes. Thus, isolates scored as M nontypeable or M53 orM80 because of this ambiguity are now identified as one orthe other M type or as STs upon sequencing of theircorresponding M genes.
Finally, the definitions of both M nontypeable and se-quence types should be considered provisional, and as serafor new types become available or an identification withuncommon but already defined sera is made, the data basefor emm gene sequences will vastly increase. Such knowl-edge will contribute to the continuous epidemiological sur-veillance of group A streptococci.
REFERENCES1. Kaplan, E. L., D. R. Johnson, P. Nanthapisud, S. Sirilertpanrana,
and S. ChumdermpadetsuL 1992. A comparison of group A
streptococcal serotypes isolated from the upper respiratory tractin the USA and Thailand: implications. Bull. W.H.O. 70:433-437.
2. Reif, W. A., D. R. Martin, and K. S. Sriprakash. 1992. Identifi-cation of sequence types among the M-nontypeable group Astreptococci. J. Clin. Microbiol. 30:3190-3194.
W. A. ReifK. S. SriprakashMenzies School ofHealth ResearchP.O. Boax 41096CasuarinaAustralia
D. R. MartinNew Zealand Communicable Disease CentreP.a Box 50348PoriruaNew Zealand
Abolish Mycobacterium paratuberculosis Strain 18
Mycobacterium paratuberculosis is a slowly growing (12to 16 weeks), mycobactin-dependent organism which causesparatuberculosis (Johne's disease) in ruminants (5). Therehas been a heightened interest in this species because of thesuggestion that it may be associated with some cases ofCrohn's disease in humans (3). Discussions of the biology ofthis species invariably result in erroneous assignment ofcharacteristics to the species which are supported by pub-lished data. Careful review generally reveals that the erro-neous data were obtained from strain 18.Recent articles in the Journal of Clinical Microbiology by
Coffin et al. (6) and Kunze et al. (9) continue this trend anderroneously identify the infamous strain 18 as M. paratuber-culosis, when in fact the strain is Mycobacterium aviumserovar 2. The continued use of this organism in M. paratu-berculosis research erodes our knowledge and understand-ing of this species.During the 1920's, W. C. Hagan at Cornell University
observed that one of his laboratory strains of M. paratuber-culosis grew faster than other strains and had lost itsdependence on mycobactin. Although this laboratory strainhad been passed from graduate student to graduate studentand these same students were also working on M. avium,there were few criteria available to definitively identify thisspecies, and the possibility of cross-contamination was notconsidered at the time. The availability of a rapidly growing,mycobactin-independent strain ofM. paratuberculosis was a
major boon to research around the world.In October 1939, this laboratory-adapted strain was pro-
vided to the Regional Animal Disease Laboratory, Auburn,Ala., where it became known as U.S. Department of Agri-culture (USDA) strain 18 (10). At the request of the Ameri-can Type Culture Collection (ATCC), it was deposited bythe USDA as the "working type" and designated ATCC12227. Because of its relative ease of cultivation, rapid
growth, and lack of mycobactin dependency, strain 18 waswidely used in experimental studies, as well as in theproduction of antigens, mycobactin, and vaccines. ATCCrequested several additional deposits, the last being October24, 1966 (10).
In addition to rapid growth and mycobactin independence,strain 18 had many other differences from M. paratubercu-losis. The inability of this strain to cause disease in rumi-nants resulted in fruitless efforts to associate mycobactindependency and virulence. The differences between strain18 and M. paratuberculosis were so great that insiders beganto question if this strain was really a laboratory-adapted fieldstrain of M. paratuberculosis at all. However, the technol-ogy to determine such was not readily available at the time.
Recognizing the uncertainty regarding this strain, in 1968Merkal (10) officially withdrew strain 18 from ATCC asunrepresentative of the species and replaced it with a bonafide wild-type strain of M. paratuberculosis as the "neotypestrain," designated ATCC 19698. Despite this withdrawal,strain 18 continued to see widespread use in paratuberculo-sis research.With the advent of DNA technology, suspicions regarding
the authenticity of strain 18 were confirmed. Every study inwhich strain 18 was used unequivocally showed that strain18 was not a strain ofM. paratuberculosis but rather was M.avium (4, 7, 12). Although M. avium and M. paratuberculo-sis are very closely related and often difficult to distinguish,the absence of the species-specific insertion sequence(IS900) in strain 18, which exists in 15 to 25 copies in all M.paratuberculosis strains (8), confirmed that it could not haveevolved or been laboratory adapted from M. paratuberculo-sis. Even the articles of Coffin et al. (6) and Kunze et al. (9)serve to confirm the true identity of strain 18. As we had longsuspected, strain 18 is actually M. avium serovar 2 and likelyrepresents a 50-year-old laboratory contaminant!
J. CLIN. MICROBIOL.
LETT-ERS TO THE EDITOR 1957
These findings have a great impact on our knowledge ofthe biology of M. paratuberculosis. It is now necessary tocarefully and critically review research articles on M. para-tuberculosis to determine whether the data presented arebased on M. paratuberculosis or strain 18. Despite publisheddata to the contrary, we now know, to name just a few, thatthere are no mycobactin-independent strains of M. paratu-berculosis, it does not express a species-specific (1) (orotherwise) peptidoglycolipid similar to that from M. avium(2), and mycobactin J (11) is actually mycobactin from M.avium. Most available antigens, both commercially availableand from the USDA, and the currently employed vaccine areall made from M. avium. It will be years, if ever, before wecan sort out the true characteristics of M. paratuberculosisand those of strain 18. Fifty years of research on a laboratorycontaminant will be difficult to correct.Compounding this existing problem is the fact that despite
evidence that strain 18 is actually M. avium serovar 2, thisstrain continues to be widely used in M. paratuberculosisstudies and identified as M. paratuberculosis 18. The excel-lent articles by Coffin et al. (6) and Kunze et al. (9), althoughboth confirm the true identity of strain 18, erroneouslyidentify this strain as M. paratuberculosis 18. This practicefurther adds to the confusion and the inaccurate descriptionand characterization of the species and contributes to the50-year erosion process.For example, in the article by Coffin et al. (6), it implies
that on the basis of restriction fragment length polymor-phism (RFLP) analysis some M. paratuberculosis strains are"M. avium-like" while others are not. Strain 18 is furthererroneously authenticated as an M. paratuberculosis strainby designating it as ATCC 12227, an obsolete and nonexis-tent ATCC number. In the article by Kunze et al. (9), it isimplied that some strains ofM. paratuberculosis contain theinsertion sequence IS901 when in fact they do not-theIS901 insertion sequence was found only in strain 18. Al-though these two otherwise excellent articles were selectedto raise this issue, they are by no means the primary orworse offenders. Rather, they simply represent recent pub-lications on which to base this letter.
After 50 years of erroneous, conflicting, and confusingdata, it is time to abolish strain 18 and label it appropriatelyif it is used at all. Since this strain is still used for vaccine,antigen, and mycobactin production, its inclusion in somestudies would seem appropriate, while in others it may notbe. In either event, strain 18 must be identified as M. aviumto avoid the continued erosion of and conflicting data on M.paratuberculosis biology.
It is therefore recommended that authors and editors ofJCM and other journals disallow the designation of strain 18as M. paratuberculosis. It is further recommended that if theuse of strain 18 is necessary that it be identified as "M.avium 18 (formerly M. paratuberculosis 18)."
REFERENCES
1. Camphausen, R. T., R. L. Jones, and P. J. Brennan. 1985. Aglycolipid antigen specific to Mycobactenum paratuberculosis:structure and antigenicity. Proc. Natl. Acad. Sci. USA 82:3068-3072.
2. Camphausen, R. T., R. L. Jones, and P. J. Brennan. 1986.Structure and relevance of the oligosaccharide hapten of Myco-bacterinum avium serotype 2. J. Bacteriol. 168:660-667.
3. Chiodini, R. J. 1989. Crohn's disease and the mycobacterioses:a review and comparison of two disease entities. Clin. Micro-biol. Rev. 2:90-117.
4. Chiodini, R. J. 1990. Characterization of Mycobacterium para-
tuberculosis and organisms of the Mycobacteinum avium com-plex by restriction polymorphism of the rRNA gene region. J.Clin. Microbiol. 28:489-494.
5. Chiodini, R. J., H. J. Van Kruiningen, and R. S. Merkal. 1984.Ruminant paratuberculosis (Johne's disease): the current statusand future prospects. Cornell Vet. 74:218-262.
6. Coffin, J. W., C. Condon, C. A. Compston, K. N. Potter, L. R.Lamontagne, J. Shafiq, and D. Y. Kunimoto. 1992. Use ofrestriction fragment length polymorphisms resolved by pulsed-field gel electrophoresis for subspecies identification of myco-bacteria in the Mycobacterium avium complex and for isolationof DNA probes. J. Clin. Microbiol. 30:1829-1836.
7. Collins, D. M., D. M. Gabric, and G. W. de Lisle. 1990.Identification of two groups ofMycobacteriumparatuberculosisstrains by restriction endonuclease analysis and DNA hybrid-ization. J. Clin. Microbiol. 28:1591-1596.
8. Green, E. P., M. L. Tizard, M. T. Moss, J. Thompson, D. J.Winterbourne, J. J. McFadden, and J. Hermon-Taylor. 1989.Sequence and characteristics of IS900, an insertion elementidentified in a human Crohn's disease isolate of Mycobacteriumparatuberculosis. Nucleic Acids Res. 17:9063-9073.
9. Kunze, Z. M., F. Portaels, and J. J. McFadden. 1992. Biologi-cally distinct subtypes of Mycobacterium avium differ in pos-session of insertion sequence IS901. J. Clin. Microbiol. 30:2366-2372.
10. Merkal, R. S. 1979. Proposal of ATCC 19698 as the neotypestrain of Mycobacterium paratuberculosis Bergey et al. 1923.Int. J. Syst. Bacteriol. 29:263-264.
11. Merkal, R. S., and W. G. McCullough. 1982. A new mycobactin,mycobactin J, from Mycobacterinum paratuberculosis. Curr.Microbiol. 7:333-335.
12. Whipple, D., P. Kapke, and C. Vary. 1990. Identification ofrestriction fragment length polymorphisms in DNA from Myco-bacterium paratuberculosis. J. Clin. Microbiol. 28:2561-2564.
R. J. ChiodiniMycobacteriology Unit SWP 526Department ofMedicineBrown University and Rhode Island Hospital593 Eddy StreetProvidence, Rhode Island 02903
Authors' RepliesIn his letter to the editor, Dr. Chiodini correctly points out
that discussion of M. paratuberculosis in the literature isfrequently confusing because of the common problem ofstrain misidentification and the resultant assignment of erro-neous characteristics. Furthermore, he suggests that wehave compounded this problem by identifying strain 18 as M.paratuberculosis in our recent publication (1). While we arein agreement with the arguments for a change in the nomen-clature of strain 18 that were made by Dr. Chiodini, wewould like to make the following comments.With respect to the history, growth, and physiological
characteristics of strain 18, eloquently outlined by Dr. Chio-dini, we have no argument or further comment. We fullyrecognize M. paratuberculosis ATCC 19698 (5) as the neo-type strain and have denoted it as such in our article (1). Ourstudy included strain 18 for the very reasons outlined by Dr.Chiodini, that is the frequent previous and current use of thisstrain in vaccine, antigen, and mycobactin production. In-deed, we took considerable trouble to summarize the DNA-based analyses of M. avium complex strains in a lengthyintroduction and stated that strain 18 gave an M. aviumprofile in these studies. Moreover, as Dr. Chiodini rightlypoints out, our results confirm the true identity of strain 18and in our discussion we state, "M. paratuberculosis 18gave profiles similar to those of . .. M. avium serotype 2.. . ." This is consistent with previous documentation in the
VOL. 31, 1993
1958 LETIERS TO THE EDITOR
literature and supports the view that strain 18 is really an M.avium isolate (2-6). At no time did we suggest or proposethat this strain is a true M. paratuberculosis strain. In fact,one of the major conclusions of our work is that classicalforms of identification are insufficient to differentiate M.paratuberculosis and M. avium, especially with respect toprimary isolates. It is hoped that one of the many benefits ofan identification scheme based on DNA technology will be toprevent such anomalies from arising in the future.We entirely agree with Dr. Chiodini's listing of the prop-
erties of true M. paratuberculosis strains and do not need tocomment further except perhaps to reiterate that while all M.paratuberculosis strains are mycobactin dependent, the con-verse is certainly not true.When including strain 18 in our study and our manuscript
we described it as M. paratuberculosis 18 because this iswhat it has been consistently termed in the literature to date.This nomenclature and the ATCC number used reflect thedescription of the strain as it was received by us. Perhaps wedid not provide sufficient clarification of this point, but wecertainly did not intend to mislead and felt that our discus-sion of the results for strain 18 made this clear.
In conclusion we fully agree with and support the cumu-lative evidence and Dr. Chiodini's proposal that strain 18should henceforth be identified as M. avium 18 (formerly M.paratuberculosis 18) and applaud all attempts to clarify theoften murky waters of mycobacterial identification and no-menclature.
REFERENCES
1. Coffin, J. W., C. Condon, C. A. Compston, K. N. Potter, L. R.Lamontagne, J. Shafiq, and D. Y. Kunimoto. 1992. Use ofrestriction fragment length polymorphisms resolved by pulsed-field gel electrophoresis for subspecies identification of mycobac-teria in the Mycobacterium avium complex and for isolation ofDNA probes. J. Clin. Microbiol. 30:1829-1836.
2. Levy-Fr6bault, V. V., M.-F. Thorel, A. Varnerot, and B. Gicquel.1989. DNA polymorphism in Mycobacterium paratuberculosis,"wood pigeon mycobacteria," and related mycobacteria ana-lyzed by field inversion gel electrophoresis. J. Clin. Microbiol.27:2823-2826.
3. McFadden, J. J., P. D. Butcher, R. Chiodini, and J. Hermon-Taylor. 1987. Crohn's disease-isolated mycobacteria are identicalto Mycobacterium paratuberculosis, as determined by DNAprobes that distinguish between mycobacterial species. J. Clin.Microbiol. 25:796-801.
4. McFadden, J. J., P. D. Butcher, J. Thompson, R. Chiodini, and J.Hermon-Taylor. 1987. The use ofDNA probes identifying restric-tion fragment-length polymorphisms to examine the Mycobacte-rinum avium complex. Mol. Microbiol. 1:283-291.
5. Merkal, R. S. 1979. Proposal of ATCC 19698 as the neotypestrain ofMycobacteriumparatuberculosis Bergey et al. 1923. Int.J. Syst. Bacteriol. 29:263-264.
6. Whipple, D. L., R. B. Le Febvre, R. E. Andrews, Jr., and A. B.Thiermann. 1987. Isolation and analysis of restriction endonucle-ase digestive patterns of chromosomal DNA from Mycobacte-rum paratuberculosis and other mycobacterial species. J. Clin.Microbiol. 25:1511-1515.
John CoffinCaro CondonDennis KunimotoUniversity ofAlbertaEdmonton, Alberta T6G 2E9Canada
I fully agree with Dr. Chiodini that strain 18 is indistin-guishable from some strains of M. avium. Our own workdemonstrated that the genome of strain 18 contains IS901,and we designated it M. avium RFLP type A/I (1). Itherefore agree that strain 18 should henceforth be referredto as a strain ofM. avium. However, I do not agree with Dr.Chiodini when he states that "strain 18 is actually M. aviumserovar 2...." We have examined most of the serotypes ofM. avium by RFLP analysis (1, 2, 5) and have found that, aswith other bacteria, serotyping does not correspond togenetic identity: of the 10 serotype 2 strains we examinedonly 6 contained IS901 and were identical to strain 18 byRFLP analysis (1).
Dr. Chiodini goes on to object to our statement that somestrains of M. paratuberculosis contain IS901, claiming thatIS901 was not found in anyM. paratuberculosis strain (otherthan strain 18). However, as we described (1), we foundthree strains isolated from deer with Johne's disease thatwere identified (on the basis of initial mycobactin depen-dence) as M. paratuberculosis that contained IS901 ratherthan IS900. We stated that "we therefore designate [thesestrains] M. avium [type] A/I"-not M. paratuberculosis,reserving the designation of M. paratuberculosis for strainscontaining IS900. This would suggest that M. avium A/I isable to cause Johne's disease, at least in deer, a possibilitythat may also be significant to human disease since we haveisolated strains of M. avium A/I from patients with inflam-matory bowel disease (4).
It may be, as Chiodini suggests, that strain 18 represents alaboratory contaminant; however, it is also possible that M.avium A/I may occasionally cause Johne's disease in cattle,and strain 18 may represent one such strain. Examination ofa larger number of strains isolated from animals with Johne'sdisease with probes specific for IS900 and IS901 shouldresolve this issue.
REFERENCES
1. Kunze, Z. M., F. Portaels, and J. J. McFadden. 1992. Biologicallydistinct subtypes ofMycobacterium avium differ in possession ofinsertion sequence IS901. J. Clin. Microbiol. 30:2366-2372.
2. McFadden, J. J., P. D. Butcher, R. Chiodini, and J. Hermon.Taylor. 1987. Crohn's disease-isolated mycobacteria are identicalto Mycobacterium paratuberculosis, as determined by DNAprobes that distinguish between mycobacterial species. J. Clin.Microbiol. 25:796-801.
3. McFadden, J. J., P. D. Butcher, J. Thompson, R. Chiodini, and J.Hermon-Taylor. 1987. The use ofDNA probes identifying restric-tion fragment-length polymorphisms to examine the Mycobacte-rium avium complex. Mol. Microbiol. 1:283-291.
4. McFadden, J. J., J. Collins, B. Beaman, M. Arthur, and G.Gitnick 1992. Mycobacteria in Crohn's disease: DNA probesidentify the wood pigeon strain of Mycobacterium avium andMycobacterium paratuberculosis from human tissue. J. Clin.Microbiol. 30:3070-3073.
5. McFadden, J. J., Z. M. Kunze, P. Portaels, V. Labrousse, and N.Rastogi. 1992. Epidemiological and genetic markers, virulencefactors and intracellullar growth of Mycobacterium avium inAIDS. Res. Microbiol. 143:423-430.
J. J. McFaddenMolecular Microbiology GroupSchool ofBiological SciencesUniversity of SurreyGuildfordSurrey, GU2 5XHUnited Kingdom
![Presence of Mycobacterium avium Subspecies ... · 1. Introduction Mycobacterium avium subspecies paratuberculosis (Map) is a very slow growing member of the Mycobacteriumaviumcomplex[1,2].](https://static.documents.pub/doc/80x56/600962ca54e6680b3669b7b3/presence-of-mycobacterium-avium-subspecies-1-introduction-mycobacterium-avium.jpg)