+ All Categories
Home > Documents > BRAF L597 Mutations in Melanoma Are Associated …...Melanoma is a malignant tumor of melanocytes...

BRAF L597 Mutations in Melanoma Are Associated …...Melanoma is a malignant tumor of melanocytes...

Date post: 23-Aug-2020
Category:
Upload: others
View: 3 times
Download: 0 times
Share this document with a friend
8
SEPTEMBER 2012CANCER DISCOVERY | 791 ABSTRACT Kinase inhibitors are accepted treatment for metastatic melanomas that harbor specific driver mutations in BRAF or KIT, but only 40% to 50% of cases are positive. To uncover other potential targetable mutations, we conducted whole-genome sequenc- ing of a highly aggressive BRAF (V600) and KIT (W557, V559, L576, K642, and D816) wild-type melanoma. Surprisingly, we found a somatic BRAF L597R mutation in exon 15. Analysis of BRAF exon 15 in 49 tumors negative for BRAF V600 mutations as well as driver mutations in KIT, NRAS, GNAQ, and GNA11, showed that two (4%) harbored L597 mutations and another two involved BRAF D594 and K601 mutations. In vitro signaling induced by L597R/S/Q mutants was suppressed by mitogen- activated protein (MAP)/extracellular signal–regulated kinase (ERK) kinase (MEK) inhibition. A patient with BRAF L597S mutant metastatic melanoma responded significantly to treatment with the MEK inhibitor, TAK-733. Collectively, these data show clinical significance to BRAF L597 mutations in melanoma. SIGNIFICANCE: This study shows that cells harboring BRAF L597 mutants are sensitive to MEK inhibi- tor treatment, providing a rationale for routine screening and therapy of BRAF L597 -mutant melanoma. Cancer Discov; 2(9); 791–7. ©2012 AACR. RESEARCH BRIEF Authors’ Affiliations: 1 Vanderbilt-Ingram Cancer Center, Departments of 2 Cancer Biology, 3 Biomedical Informatics, 4 Pathology, Microbiology, and Immunology, and 5 Medicine/Division of Hematology-Oncology, Vander- bilt University School of Medicine; Departments of 6 Otolaryngology and 7 Pediatrics, Vanderbilt University Medical Center, Nashville, Tennessee; 8 Department of Medicine, Division of Hematology-Oncology, 9 Jonsson Comprehensive Cancer Center, UCLA, Los Angeles, California; 10 Program in Molecular Pharmacology and Chemistry, 11 Department of Medicine, Memorial Sloan-Kettering Cancer Center, New York, New York; 12 Millennium Pharmaceuticals, Inc., Cambridge, Massachusetts Note: Supplementary data for this article are available at Cancer Discovery Online (http://www.cancerdiscovery.aacrjournals.org/). K.B. Dahlman, J. Xia, and K. Hutchinson are co-first authors who contrib- uted equally to the work. J.A. Sosman, A. Ribas, Z. Zhao, and W. Pao are the co-senior authors who contributed equally to the work. Corresponding Authors: William Pao, Vanderbilt-Ingram Cancer Center, 2220 Pierce Avenue, 777 Preston Research Building, Nashville, TN 37232. Phone: 615-343-9454; Fax: 615-343-7602; E-mail: william.pao@vanderbilt. edu; Zhongming Zhao, Phone: 615-343-9158; Fax: 615-936-9545; E-mail: [email protected]; Jeffrey Sosman, Phone: 615-343-6653; Fax: 615-343-7602; E-mail: [email protected]; and Antoni Ribas, UCLA Medical Center, 11-934 Factor Building, 18033 Le Conte Avenue, Los Angeles, CA 90095. Phone: 310-206-3928; Fax: 310-825- 2493; E-mail: [email protected] doi: 10.1158/2159-8290.CD-12-0097 ©2012 American Association for Cancer Research. BRAF L597 Mutations in Melanoma Are Associated with Sensitivity to MEK Inhibitors Kimberly Brown Dahlman 1,2 , Junfeng Xia 3 , Katherine Hutchinson 2 , Charles Ng 8 , Donald Hucks 1 , Peilin Jia 3 , Mohammad Atefi 8 , Zengliu Su 1 , Suzanne Branch 8 , Pamela L. Lyle 4 , Donna J. Hicks 1 , Viviana Bozon 12 , John A. Glaspy 8,9 , Neal Rosen 10,11 , David B. Solit 10,11 , James L. Netterville 1,6 , Cindy L. Vnencak-Jones 4,7 , Jeffrey A. Sosman 1,5 , Antoni Ribas 8,9 , Zhongming Zhao 13 , and William Pao 1,5 Research. on December 9, 2020. © 2012 American Association for Cancer cancerdiscovery.aacrjournals.org Downloaded from Published OnlineFirst July 13, 2012; DOI: 10.1158/2159-8290.CD-12-0097
Transcript
Page 1: BRAF L597 Mutations in Melanoma Are Associated …...Melanoma is a malignant tumor of melanocytes that caused nearly 9,000 deaths in the United States in 2011 ( 1 ). Recently, the

SEPTEMBER 2012�CANCER DISCOVERY | 791

ABSTRACT Kinase inhibitors are accepted treatment for metastatic melanomas that harbor specifi c driver mutations in BRAF or KIT, but only 40% to 50% of cases are

positive. To uncover other potential targetable mutations, we conducted whole-genome sequenc-ing of a highly aggressive BRAF (V600) and KIT (W557, V559, L576, K642, and D816) wild-type melanoma. Surprisingly, we found a somatic BRAF L597R mutation in exon 15. Analysis of BRAF exon 15 in 49 tumors negative for BRAF V600 mutations as well as driver mutations in KIT, NRAS, GNAQ,and GNA11, showed that two (4%) harbored L597 mutations and another two involved BRAF D594 and K601 mutations. In vitro signaling induced by L597R/S/Q mutants was suppressed by mitogen-activated protein (MAP)/extracellular signal–regulated kinase (ERK) kinase (MEK) inhibition. A patient with BRAF L597S mutant metastatic melanoma responded signifi cantly to treatment with the MEK inhibitor, TAK-733. Collectively, these data show clinical signifi cance to BRAF L597 mutations in melanoma.

SIGNIFICANCE: This study shows that cells harboring BRAF L597 mutants are sensitive to MEK inhibi-tor treatment, providing a rationale for routine screening and therapy of BRAF L597 -mutant melanoma. Cancer Discov; 2(9); 791–7. ©2012 AACR .

RESEARCH BRIEF

Authors’ Affi liations: 1 Vanderbilt-Ingram Cancer Center, Departments of 2 Cancer Biology, 3 Biomedical Informatics, 4 Pathology, Microbiology, and Immunology, and 5 Medicine/Division of Hematology-Oncology, Vander-bilt University School of Medicine; Departments of 6 Otolaryngology and 7 Pediatrics, Vanderbilt University Medical Center, Nashville, Tennessee; 8 Department of Medicine, Division of Hematology-Oncology, 9 Jonsson Comprehensive Cancer Center, UCLA, Los Angeles, California; 10 Program in Molecular Pharmacology and Chemistry, 11 Department of Medicine, Memorial Sloan-Kettering Cancer Center, New York, New York; 12 Millennium Pharmaceuticals, Inc., Cambridge, Massachusetts Note: Supplementary data for this article are available at Cancer Discovery Online ( http://www.cancerdiscovery.aacrjournals.org/ ). K.B. Dahlman, J. Xia, and K. Hutchinson are co-fi rst authors who contrib-uted equally to the work.

J.A. Sosman, A. Ribas, Z. Zhao, and W. Pao are the co-senior authors who contributed equally to the work.

Corresponding Authors: William Pao, Vanderbilt-Ingram Cancer Center, 2220 Pierce Avenue, 777 Preston Research Building, Nashville, TN 37232. Phone: 615-343-9454; Fax: 615-343-7602; E-mail: [email protected] ; Zhongming Zhao, Phone: 615-343-9158; Fax: 615-936-9545; E-mail: [email protected] ; Jeffrey Sosman, Phone: 615-343-6653; Fax: 615-343-7602; E-mail: [email protected] ; and Antoni Ribas, UCLA Medical Center, 11-934 Factor Building, 18033 Le Conte Avenue, Los Angeles, CA 90095. Phone: 310-206-3928; Fax: 310-825-2493; E-mail: [email protected]

doi: 10.1158/2159-8290.CD-12-0097

©2012 American Association for Cancer Research.

BRAF L597 Mutations in Melanoma Are Associated with Sensitivity to MEK Inhibitors Kimberly Brown Dahlman 1 , 2 , Junfeng Xia 3 , Katherine Hutchinson 2 , Charles Ng 8 , Donald Hucks 1 , Peilin Jia 3 , Mohammad Atefi 8 , Zengliu Su 1 , Suzanne Branch 8 , Pamela L. Lyle 4 , Donna J. Hicks 1 , Viviana Bozon 12 , John A. Glaspy 8 , 9 , Neal Rosen 10 , 11 , David B. Solit 10 , 11 , James L. Netterville 1 , 6 , Cindy L. Vnencak-Jones 4 , 7 , Jeffrey A. Sosman 1 , 5 , Antoni Ribas 8 , 9 , Zhongming Zhao 1 – 3 , and William Pao 1 , 5

Research. on December 9, 2020. © 2012 American Association for Cancercancerdiscovery.aacrjournals.org Downloaded from

Published OnlineFirst July 13, 2012; DOI: 10.1158/2159-8290.CD-12-0097

Page 2: BRAF L597 Mutations in Melanoma Are Associated …...Melanoma is a malignant tumor of melanocytes that caused nearly 9,000 deaths in the United States in 2011 ( 1 ). Recently, the

792 | CANCER DISCOVERY�SEPTEMBER 2012 www.aacrjournals.org

Dahlman et al.RESEARCH BRIEF

INTRODUCTION

Melanoma is a malignant tumor of melanocytes that caused nearly 9,000 deaths in the United States in 2011 ( 1 ). Recently, the kinase inhibitors vemurafenib and, to a lesser extent, imatinib have become standard treatments for patients whose metastatic malignant melanomas harbor spe-cifi c driver mutations in BRAF (V600E; ref. 2 ) or KIT (exons 11 and 13; ref. 3 ), respectively; however, only approximately 40% to 50% of cases are positive for these mutations. Cur-rently, clinical algorithms recommend assessing BRAF status in melanomas at only the most common actionable mutant site, BRAF V600E (c.1799T>A).

To uncover other potentially targetable mutations, we conducted whole-genome sequencing (WGS) of a tumor/normal pair from a patient with a highly aggressive BRAF (V600) and KIT (W557, V559, L576, K642, and D816) wild-type melanoma. Among the many mutations identifi ed, we focused on the biological and clinical signifi cance of a con-fi rmed somatic mutation at the BRAF L597 codon. Our fi nd-ings have direct therapeutic implications for patients with metastatic melanoma.

RESULTS

Identifi cation of a BRAF L597R Mutation by Whole-Genome Sequencing

A 75-year-old white man presented with an ulcerated right ear melanoma that was widely excised with uninvolved sen-tinel lymph nodes. Four months later, he developed local recurrence and underwent additional surgery as well as postoperative radiation. This specimen was negative for the BRAF V600E (c.1799T>A) mutation using an allele-specifi c PCR assay, and negative for KIT exons 9, 11, 13, 17, and 18 mutations by PCR-based methods. Twelve months later, the patient developed widespread metastasis and required a pal-liative thyroidectomy. He died 13 days later with both cardiac and brain involvement.

To identify potential driver mutations in his tumor using an unbiased genome-wide approach, we conducted WGS of DNA from his metastatic thyroid lesion, along with DNA from matched blood (see Supplementary Methods for case descrip-tion and variation calling). A subset of the single-nucleotide polymorphisms (SNP), insertions, and deletions were validated (Supplementary Tables S1–S8 and Supplementary Figs. S1–S7). The validated somatic SNP with the combined highest depth of coverage and quality scores was BRAF L597R (c.1790T>G; Fig. 1 ; Supplementary Table S8 and Supplementary Fig. S7). The high depth of coverage for this SNP was in part because of concurrent amplifi cation of the BRAF locus on chromosome 7 (Supple-mentary Table S5 and Supplementary Fig. S6). Screening of an earlier biopsy confi rmed that this mutation was present before radiation therapy (data not shown), suggesting that it occurred early in the pathogenesis of the patient’s disease.

Frequency of BRAF L597 and Other Exon 15 Mutations in “BRAF Wild-type” Melanoma

Both BRAF L597 and V600 are encoded by exon 15. To determine how many exon 15 mutations might be overlooked

by assessing only the V600 position, we analyzed the muta-tional status of the entire coding exon in 49 additional tumor samples negative for mutations at V600 as well as for recur-rent mutations in NRAS (G12/13, Q61), KIT (W557, V559, L576, K642, and D816), GNAQ (Q209), and GNA11 (Q209; ref. 4 ). Two (4%) additional tumors had BRAF L597 mutations (c.1790T>A, p.L597Q; c.1789_1790CT>TC, p.L597S). A third tumor harbored a BRAF K601E mutation (c.1801A>G), whereas a fourth had a D594N mutation (c.1780G>A; Table 1 ). The BRAF c.1789_1790CT>TC mutation was confi rmed to be in cis by cloning and sequencing of the PCR product (data not shown). Thus, 8% of “pan-negative” cases harbored additional non-V600 BRAF exon 15 mutations.

Signaling Induced by BRAF L597 and K601E Mutants Is Suppressed by a MEK Inhibitor

BRAF L597 and K601 are located in the activation seg-ment of the kinase domain and are adjacent to V600. Because V600 mutants are sensitive to specifi c BRAF and mitogen-activated protein (MAP)/extracellular signal–regulated kinase (ERK) kinase (MEK) inhibitors, we studied whether signaling induced by L597 and K601 mutants in 293H cells was inhib-ited by the mutant BRAF inhibitor, vemurafenib, and the MEK inhibitor, GSK1120212. We chose to study L597R/Q/S and K601E mutations because they have been reported to occur in melanoma in the Catalogue of Somatic Mutations in Cancer (COSMIC) database ( 5 ) and we identifi ed these muta-tions in our “pan-negative” samples ( Table 1 ). We did not study endogenous melanoma cell lines because to our knowledge, none harbor and are dependent upon an L597 or K601E muta-tion for survival. We did not further investigate the sensitivity of the D594N mutation because it has been reported that D594 mutations result in an inactive kinase ( 6 ). Compared with a vector control, ectopic expression of V600E, L597R/Q/S, and K601E mutants elevated phospho-MEK and ERK levels (Supplementary Fig. S8), although the L597R/Q mutants did so to a lesser extent, consistent with studies on an analogous L597V mutant ( 7 ). Vemurafenib treatment of all of the BRAF mutant–expressing cells led to a decrease in phospho-MEK and ERK protein levels, whereas treatment with the MEK inhibitor led to a more dramatic decrease in phospho-ERK signaling ( Fig. 2 , Supplementary Figs. S8 and S9). These data suggest that patients whose tumors harbor BRAF L597 and K601 mutations could benefi t from treatment with MEK inhibitors.

Samplea Nucleotide Amino acid

1 c.1801A>G p.K601E

2 c.1790T>A p.L597Q

3 c.1789_1790CT>TC p.L597S

4 c.1780G>A p.D594NaSamples considered melanoma SNaPshot screen “pan-negative” were those that did not have mutations in BRAF (V600), NRAS (G12/13, Q61), KIT (W557, V559, L576, K642, and D816), CTNNB1 (S37/45), GNAQ (Q209), and GNA11 (Q209).

Table 1. Mutations detected in BRAF exon 15 in 49 SNaPshot screen “pan-negative” melanomas

Research. on December 9, 2020. © 2012 American Association for Cancercancerdiscovery.aacrjournals.org Downloaded from

Published OnlineFirst July 13, 2012; DOI: 10.1158/2159-8290.CD-12-0097

Page 3: BRAF L597 Mutations in Melanoma Are Associated …...Melanoma is a malignant tumor of melanocytes that caused nearly 9,000 deaths in the United States in 2011 ( 1 ). Recently, the

SEPTEMBER 2012�CANCER DISCOVERY | 793

BRAF L597 Mutant Melanoma RESEARCH BRIEF

A

BTumor

1790T>G

Blood

1790T

G G T C G TCT A G G T C G TCK A

00:1:7:2742:583143:46:14851:1185870:4:5:1344:1038000:6:27:3955:359406:42:19262:15991000:4:5:3989:74837:7:28:1285:1062815:66:18131:134991:8:66:14945:25177:2:42:12158:678462:46:13449:1868410:7:5:12727:5779700:8:7:7905:681420:2:1:14030:11939:6:67:20999:443750:1:43:1879:868940:2:25:4616:90263:7:65:9932:1359490:8:62:6399:28554:6:45:17813:1527600:8:5:3376:21254:4:66:10977:601612:46:20565:1421700:4:68:5710:882370:6:7:7507:1010484:66:13132:124169:7:24:1853:1699350:2:45:18975:1938:4:27:2521:161422:2:46:20745:16203:6:64:18274:253134:47:13600:169016:6:67:6797:13311700:4:42:8318:8137:4:42:9602:1863184:24:13852:131738:1:22:2076:167506:1:1:16097:15574000:5:68:7214:267300:2:1:7420:717324:27:18241:109894:3:43:19942:42100:7:61:20320:393555:25:18141:1701480:4:64:11029:5884:7:63:10329:16595:5:21:18786:85880:3:66:11896:20795:1:65:11688:36097:3:6:15166:1146880:7:66:5499:78047:6:6:11501:18971300:4:5:9604:392930:3:42:3408:993940:4:6:21224:485865:64:14894:141163:8:25:14403:9587600:3:26:9352:566600:5:4:8785:772934:28:17458:131329:5:6:16707:10447800:8:1:8005:726500:1:2:17611:84492:6:1:15490:1022247:47:11906:1762131:25:10752:100445:5:1:18560:197022:6:62:5640:1718920:1:47:4537:19352:5:62:1851:10008200:7:5:6177:98518:5:27:11569:67237

GBRAF

140453150 14045320014045310050 basesScale

chr 7

G

GG

G

GGG

G

GCG

GG

G G W R K V T A L G F D G I K V T L D E H L F I D ST

S L Q E F Q H S S S

DTAGGTCTGTTGACAAGTTTGACTACCCTGGGTGAGGTAGCTCTAAAGTGACATCGATCTGGTTTTAGTGGATAAAAATGACACTCCAGAAGTACTTCTTTATATAGACTCCAC

G G D N Q L V L I V K Q S T K M F F Y I Q P TH

L C S N L S I P V LI V E M I E S Y S S W F R N K S H P R S S I Y R L

TW V V T V S P W S

G

GC

GGG

GG

G

G

G

G

G

GGGGCTGGG

GGG

G

GG

GGGG

GG

T TG G

NNNNN NNNNNNNNNNNNNNNNN N

Figure 1.   Detection and validation of the BRAF L597R mutation. A, align-ment of next-generation sequence reads displaying the BRAF L597R mutation compared with the reference human genome. The region shown represents base pairs 140,453,089-140,453,201 on chromosome 7. Seventy-two reads overlap the mutant position (chr7:140,453,145), including 47 reverse (in red) and 25 forward (in blue) strands, respectively. B, sequenc-ing chromatograms show the presence of a heterozygous BRAF L597 mutation in the tumor but not in the matched blood. Arrows indicate the position of the mutant or wild-type peaks.

Research. on December 9, 2020. © 2012 American Association for Cancercancerdiscovery.aacrjournals.org Downloaded from

Published OnlineFirst July 13, 2012; DOI: 10.1158/2159-8290.CD-12-0097

Page 4: BRAF L597 Mutations in Melanoma Are Associated …...Melanoma is a malignant tumor of melanocytes that caused nearly 9,000 deaths in the United States in 2011 ( 1 ). Recently, the

794 | CANCER DISCOVERY�SEPTEMBER 2012 www.aacrjournals.org

Dahlman et al.RESEARCH BRIEF

Objective Radiographic Response to MEK Inhibitor Therapy in a Patient with a Metastatic Melanoma with a BRAF L597 Mutation

A 69-year-old patient with a metastatic melanoma who had previously received therapy with dacarbazine chemotherapy was enrolled in a phase I trial testing of the allosteric MEK inhibitor TAK-733 ( 8 ). After 2 cycles of therapy, the patient was noted to have a partial radiographic response with a decrease of 31% in the sum of maximum diameters of tar-get metastatic lesions in the liver and spleen and as of this submission remains progression free at more than 24 weeks ( Fig. 3 and Supplementary Table S9). Follow-up sequencing analysis of DNA from the patient’s tumor revealed a somatic BRAF L597S (c.1789_1790CT>TC) mutation (Supplementary Fig. S10). These data validate the notion that BRAF L597S -mutated melanomas are sensitive to MEK inhibitors in patients.

DISCUSSION

Inhibitors of mutant BRAF and the mitogen-activated pro-tein kinase (MAPK) pathway have been shown to improve the overall survival of patients with melanomas that harbor recurrent genetic alterations involving BRAF V600E (c.1799T>A; refs. 2 , 9 ). Here, WGS of a tumor–normal pair revealed that a BRAF wild-type tumor harbored an unexpected BRAF L597 mutation occurring in exon 15. Through analysis of addi-tional tumors negative for recurrent mutations in BRAF (V600E/K/M/R/D) as well as NRAS (G12/13, Q61), KIT (W557, V559, L576, K642, and D816), GNAQ (Q209), and GNA11 (Q209; ref. 4 ), we show that BRAF exon 15 muta-tions not involving the V600 codon are relatively common [4 of 49 samples (8%), including 2 L597 mutations], consistent with other studies in melanoma ( 10 ). We further show in vitro that signaling induced by ectopic expression of BRAF L597 and K601 mutants is suppressed by MEK and BRAF inhibition.

BaselineAugust 2011

A B Cycle 4January 2012

Figure 3.   Computed tomographic images from a patient with BRAF L597S -mutant metastatic melanoma responding to therapy with the MEK inhibitor TAK-733. Arrows indicate the tumor in the liver (left) and spleen (right) at baseline (A) and after 4 cycles of treatment (B).

Figure 2.   Signaling induced by BRAF L597R and L597S is sensitive to BRAF and MEK inhibitors. Immunoblotting of lysates from 293H cells trans-fected with plasmids encoding FLAG-BRAF V600E, FLAG-BRAF L597R, or FLAG-BRAF L597S show that RAF/MEK/ERK pathway signaling can be inhib-ited by increasing doses (0, 0.1, 0.5, 1, and 5 μmol/L) of the BRAF inhibitor vemurafenib (A) or the MEK inhibitor GSK1120212 (B), 2 hours post inhibitor treatment. BRAF L597R and L597S signaling compared to the vector control is shown in Supplementary Fig. S8.

V600E L597R

GSK1120212

ERK1/2

MEK1/2

pMEK1/2

FLAG

BRAF

Vemurafenib

pERK1/2

ERK1/2

MEK1/2

pMEK1/2

FLAG

BRAF

pERK1/2

V600E L597S V600E L597R V600E L597SBA

Research. on December 9, 2020. © 2012 American Association for Cancercancerdiscovery.aacrjournals.org Downloaded from

Published OnlineFirst July 13, 2012; DOI: 10.1158/2159-8290.CD-12-0097

Page 5: BRAF L597 Mutations in Melanoma Are Associated …...Melanoma is a malignant tumor of melanocytes that caused nearly 9,000 deaths in the United States in 2011 ( 1 ). Recently, the

SEPTEMBER 2012�CANCER DISCOVERY | 795

BRAF L597 Mutant Melanoma RESEARCH BRIEF

Finally, we report a case of a patient whose BRAF L597S -mutant metastatic melanoma responded radiographically to the MEK inhibitor TAK-733. Collectively, these data show that tumor cells harboring BRAF L597 and possibly K601E mutants can be dependent upon ERK signaling and therefore susceptible to treatment with MEK inhibitors. Although prior studies have shown that BRAF L597 mutations are activating ( 7 ), to our knowledge, this is the fi rst report on the sensitivity of such mutations to MEK inhibitors in vitro and in patients.

Whether MEK inhibitors will be clinically better than mutant BRAF inhibitors for BRAF L597 and K601E mutants cannot be determined by the in vitro experiments conducted in this study. Cells expressing BRAF K601E have been shown to be moderately inhibited by vemurafenib; however, the few patients whose melanomas harbored this mutation did not display responses to another BRAF inhibitor, GSK2118436 (dabrafenib; refs. 11–13 ). There is 1 patient with a K601E mutation in BRAF that did respond to GSK1120212 (trametinib; ref. 14 ). Additional in vivo and human studies will need to be conducted to address which class of agents is the most appropriate.

The choice of tumor mutations to be interrogated in the clinic requires a balance among feasibility, cost, and comprehensiveness. Single-mutation testing [i.e., BRAF V600E (c.1799T>A)] is relatively cost effective but will clearly overlook other actionable mutations, as shown here. Whole-genome sequencing is comprehensive, but currently prohibitively expensive for routine clinical use. Presently, an intermediate solution involves use of multiplex tests that can interrogate a limited number of known mutations in selected genes that may act as targets for drug therapy. For example, tumors from patients with malignant melanomas at Vanderbilt are routinely screened for recurrent mutations that occur with at least greater than or equal to 1% frequency in the disease [i.e., BRAF (V600E/K/M/R/D), NRAS (G12/13, Q61), KIT (W557, V559, L576, K642, and D816), GNAQ (Q209), and GNA11 (Q209)], using a SNaPshot-based assay ( 4 ). Such screening results in 33% of cases having a “pan-negative” status (Sup-plementary Fig. S11). Non-V600 mutations in BRAF were not originally chosen for examination, as these were observed to occur in the COSMIC database at a frequency of less than 1% ( 5 ). The observations that L597 and K601 mutations may occur at a frequency of 4% and 2%, respectively, in “pan-negative” cases and that patients harboring tumors with these mutations may be sensitive to MAPK pathway inhibi-tors suggest that such tumors should subsequently undergo BRAF exon 15 mutational analyses to exclude the possibility of rare but potentially actionable BRAF mutations.

WGS of the tumor/normal pair also revealed a number of other somatic mutations potentially relevant to melanoma biology (Supplementary Table S8). For example, we validated 3 mutations in the glutamate receptor encoded by GRIN2A (c.3395C>T, p.P1132L; c.3103G>A, p.D1035N; and c.C154T, p.R52X). GRIN2A mutations were recently reported to occur in up to 33% of melanomas ( 15 ). The role of this mutation in melanoma is currently unknown. We also identifi ed a tumor-specifi c noncanonical KRAS mutation (c.466T>C; p.F156L) that has not been previously reported in cancer but has been described as a germline mutation in patients with Noonan or cardio-facio-cutaneous syndromes ( 16 , 17 ). Interestingly, this mutant protein accumulates in the active conforma-

tion, similar to KRAS G12D , and expression of an analogous HRAS F156L mutation in NIH3T3 cells is transforming ( 17–19 ). RAS mutations have been reported to co-occur with BRAF mutations involving codons other than 600 or 601 ( 20 ). In addition, we validated other somatic mutations in genes for which importance in melanoma is unspecifi ed but that are recognized to have important functions in other tumor types, such as APC , BRCA2 , NOTCH1 , PTEN , and NF1 . Future stud-ies will need to be conducted to determine if these alterations are passenger or driver mutations and how they would affect responses to MEK inhibition.

METHODS

DNA Extraction from Patient Samples Genomic DNA was extracted from a fl ash-frozen melanoma thy-

roid metastasis (90% tumor content) using standard proteinase K digestion and phenol extraction. Genomic DNA from matched patient blood was extracted using the Gentra Puregene Blood Kit (QIAGEN). Identity testing was conducted to confi rm that tumor and blood genomic DNA originated from the same individual (Applied Biosystems). See Supplementary Methods for patient details. For examining BRAF exon 15 from the 49 patient samples, DNA from formalin-fi xed paraffi n-embedded (FFPE) tissue was extracted using the QIAGEN DNA FFPE Tissue Kit. All patient samples were ana-lyzed with informed consent on an Institutional Review Board (IRB)–approved protocol (IRB 030220 and IRB 100178).

Whole-Genome Sequencing Paired-end sequencing of tumor and matched blood genomic

DNA was conducted on an Illumina Genome Analyzer IIx platform. Average coverage was ×55.7 and ×47.8 for the tumor and matched blood samples, respectively. The 100-bp reads were aligned to the Human Genome (UCSC hg19) using ELAND (Version 2; ref. 21 ). FastQC (Version 0.9.1; ref. 22 ) was used to conduct a quality control check of the raw data. See Supplementary Methods for SNP, inser-tion/deletion, structural variant, and copy number variation detec-tion and validation details.

Direct Dideoxynucleotide-Based Sequencing Somatic SNPs and structural variants were validated by direct

sequencing of genomic DNA from the tumor and matched blood (Sup-plementary Tables S10 and S11). To determine the frequency of BRAF exon 15 mutations, we conducted direct sequencing using genomic DNA extracted from 49 FFPE samples that were pan negative for 43 driver mutations in BRAF , NRAS , KIT , CTNNB1 , GNAQ , and GNA11 (ref. 4 ; see Supplementary Table S10 for BRAF PCR primers). Sequences were analyzed using Mutation Surveyor DNA Variant Analysis Software (SoftGenetics) and manual inspection of the sequence traces.

Cloning BRAF Exon 15 Exon 15 of BRAF was PCR amplifi ed using HotStarTaq Master Mix

(QIAGEN; Supplementary Table S10). If 2 mutations were detected in exon 15, the PCR products were cloned using the TOPO TA Clon-ing Kit (Invitrogen) to determine if the mutations were in cis or trans . Sequences were analyzed using BioEdit v.7.0.5.3.

Transfections and Drug Treatment Wild-type BRAF and BRAF V600E plasmids were described previously

( 23 ). The BRAF L597R, L597Q, L597S, and K601E mutations were introduced into the wild-type BRAF plasmid using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies). Direct sequencing of entire cDNAs was conducted to confi rm introduction of

Research. on December 9, 2020. © 2012 American Association for Cancercancerdiscovery.aacrjournals.org Downloaded from

Published OnlineFirst July 13, 2012; DOI: 10.1158/2159-8290.CD-12-0097

Page 6: BRAF L597 Mutations in Melanoma Are Associated …...Melanoma is a malignant tumor of melanocytes that caused nearly 9,000 deaths in the United States in 2011 ( 1 ). Recently, the

796 | CANCER DISCOVERY�SEPTEMBER 2012 www.aacrjournals.org

Dahlman et al.RESEARCH BRIEF

the mutation and no other mutations. 293H cells (Invitrogen) were transfected using Lipofectamine 2000 (Invitrogen) and 80 ng DNA; cells that were serum starved for 6 hours were treated with vehi-cle (dimethyl sulfoxide), PLX4032/vemurafenib (Chemietek), or GSK1120212 (Chemietek) at 0, 0.1, 0.5, 1, and 5 μmol/L for 2 hours. The 293H cells were passaged in the laboratory for no more than 6 months after receipt. Cells were tested for identity using isozyme and karyotype analysis by Invitrogen.

Western Blotting Cells were lysed using standard radioimmunoprecipitation assay

buffer supplemented with protease and phosphatase inhibitors. Lysates were quantifi ed and subjected to SDS-PAGE and Western blot analysis using the following antibodies: phospho-MEK1/2 (Ser217/221), total-MEK1/2, phospho-ERK1/2 (Thr202/Tyr204), total-ERK1/2, FLAG, and BRAF. All antibodies were purchased from Cell Signaling except for FLAG (Sigma-Aldrich) and BRAF (Santa Cruz Biotechnology).

Patient Treatment Subject 58005-514 was treated with oral daily dosing with TAK-

733 (Millennium Pharmaceuticals) at 16 mg on days 1 to 21 of 28-day cycles within an ongoing phase I clinical trial ( 24 ). Objective response was assessed by CT scans conducted every 2 months according to the Response Evaluation Criteria in Solid Tumors (RECIST) guideline (version 1.1; ref. 25 ). This study is registered with ClinicalTrials.gov (NCT00948467) and full information about this clinical trial will be provided elsewhere when completed.

Disclosure of Potential Confl icts of Interest K. Dahlman has received an honorarium from Illumina. V. Bozon

is an employee of Millennium Pharmaceuticals. N. Rosen has par-ticipated on Astra Zeneca, Novartis, and GlaxoSmithKline advisory boards. J. Sosman has participated on advisory boards for Glaxo-SmithKline, Roche, and Millennium Pharmaceuticals. A. Ribas has participated on advisory boards for Amgen, Celgene, GlaxoSmith-Kline, Promethus, Roche-Genentech, and Millennium Pharmaceu-ticals. W. Pao was a consultant for MolecularMD, Bristol-Myers Squibb, Clovis, Symphogen, and AstraZeneca. No potential confl icts of interest were disclosed by the other authors.

Authors’ Contributions Conception and design: K.B. Dahlman, N. Rosen, J.A. Sosman, Z. Zhao, W. Pao Development of methodology: K.B. Dahlman, J. Xia, P. Jia, Z. Zhao, W. Pao Acquisition of data (provided animals, acquired and managed patients, provided facilities, etc.): K.B. Dahlman, K. Hutchinson, C. Ng, D. Hucks, Z. Su, D.J. Hicks, J.L. Netterville, J.A. Sosman, A. Ribas, W. Pao Analysis and interpretation of data (e.g., statistical analysis, biostatistics, computational analysis): K.B. Dahlman, J. Xia, K. Hutchinson, D. Hucks, P. Jia, Z. Su, N. Rosen, C.L. Vnencak-Jones, J.A. Sosman, A. Ribas, Z. Zhao, W. Pao Writing, review, and/or revision of the manuscript: K.B. Dahlman, J. Xia, K. Hutchinson, D. Hucks, V. Bozon, J.A. Glaspy, N. Rosen, C.L. Vnencak-Jones, J.A. Sosman, A. Ribas, Z. Zhao, W. Pao Administrative, technical, or material support (i.e., reporting or organizing data, constructing databases): D.J. Hicks, J.A. Glaspy, W. Pao Study supervision: K.B. Dahlman, V. Bozon, A. Ribas, W. Pao Performing experiments and providing some of the data: M. Atefi Research study coordinator: S. Branch Pathologist, reviewed cases: P. Lyle Medical director at Millennium managing the clinical study C20001: V. Bozon

Acknowledgments The authors thank H. Pan and S. Jelsma for technical assistance

with experiments and C. Lovly for critically reviewing the manu-script.

Grant Support Financial support was provided by a Vanderbilt-Ingram Cancer

Center Core Grant (CA68485), the TJ Martell Foundation, the Kleberg Foundation, the Seaver Institute, the Wesley Coyle Memorial Fund, the National Cancer Institute P01CA129243, the Garcia-Corsini fam-ily fund, the NIH/NCI 5K24 CA97588-06 (J.A. Sosman), the American Cancer Society (Mary Hendrickson-Johnson Melanoma Professorship to J.A. Sosman), the James C. Bradford Family Foundation, and an anonymous donor. W. Pao is supported by a Stand Up To Cancer Innovative Research Grant, a Program of the Entertainment Indus-try Foundation (SU2C-AACR-IRG0109). Treatment with TAK-733 in 1 patient was supported through a clinical trial from Millennium Pharmaceuticals.

Received March 7, 2012; revised July 2, 2012; accepted July 11, 2012; published OnlineFirst July 13, 2012.

REFERENCES 1. Siegel R , Ward E , Brawley O , Jemal A . Cancer statistics, 2011: the

impact of eliminating socioeconomic and racial disparities on prema-ture cancer deaths . CA Cancer J Clin 2011 ; 61 : 212 – 36 .

2. Chapman PB , Hauschild A , Robert C , Haanen JB , Ascierto P , Larkin J , et al. Improved survival with vemurafenib in melanoma with BRAF V600E mutation . N Engl J Med 2011 ; 364 : 2507 – 16 .

3. Guo J , Si L , Kong Y , Flaherty KT , Xu X , Zhu Y , et al. Phase II, open-label, single-arm trial of imatinib mesylate in patients with metastatic melanoma harboring c-Kit mutation or amplifi cation . J Clin Oncol 2011 ; 29 : 2904 – 9 .

4. Lovly CM , Dahlman KB , Fohn L , Su Z , Dias-Santagata D , Hicks DJ , et al. Routine mutational profi ling of melanomas enables enrollment in genotype-driven trials . PLoS One 2012;7:e35309.

5. Forbes SA , Bindal N , Bamford S , Cole C , Kok CY , Beare D , et al. COS-MIC: mining complete cancer genomes in the Catalogue of Somatic Mutations in Cancer . Nucleic Acids Res 2011 ; 39 : D945 – 50 .

6. Heidorn SJ , Milagre C , Whittaker S , Nourry A , Niculescu-Duvas I , Dhomen N , et al. Kinase-dead BRAF and oncogenic RAS cooperate to drive tumor progression through CRAF . Cell 2010 ; 140 : 209 – 21 .

7. Davies H , Bignell GR , Cox C , Stephens P , Edkins S , Clegg S , et al. Muta-tions of the BRAF gene in human cancer . Nature 2002 ; 417 : 949 – 54 .

8. Dong Q , Dougan DR , Gong X , Halkowycz P , Jin B , Kanouni T , et al. Discovery of TAK-733, a potent and selective MEK allosteric site inhibitor for the treatment of cancer . Bioorg Med Chem Lett 2011 ; 21 : 1315 – 9 .

9. Flaherty KT , Robert C , Hersey P , Nathan P , Garbe C , Milhem M , et al. Improved survival with MEK inhibition in BRAF-mutated melanoma . N Engl J Med 2012 ; 367 : 107 – 14 .

10. Beadling C , Heinrich MC , Warrick A , Forbes EM , Nelson D , Justusson E , et al. Multiplex mutation screening by mass spectrometry evalua-tion of 820 cases from a personalized cancer medicine registry . J Mol Diagn 2011 ; 13 : 504 – 13 .

11. Yang H , Higgins B , Kolinsky K , Packman K , Go Z , Iyer R , et al. RG7204 (PLX4032), a selective BRAFV600E inhibitor, displays potent antitumor activity in preclinical melanoma models . Cancer Res 2010 ; 70 : 5518 – 27 .

12. Kefford R , Arkenau H , Brown MP , Millward M , Infante JR , Long GV , et al. Phase I/II study of GSK2118436, a selective inhibitor of onco-genic mutant BRAF kinase, in patients with metastatic melanoma and other solid tumors . J Clin Oncol , 28: 15s, 2010 (suppl; abstr 8503).

13. Falchook GS , Long GV , Kurzrock R , Kim KB , Arkenau TH , Brown MP , et al. Dabrafenib in patients with melanoma, untreated brain metastases, and other solid tumours: a phase 1 dose-escalation trial . Lancet 2012 ; 379 : 1893 – 901 .

Research. on December 9, 2020. © 2012 American Association for Cancercancerdiscovery.aacrjournals.org Downloaded from

Published OnlineFirst July 13, 2012; DOI: 10.1158/2159-8290.CD-12-0097

Page 7: BRAF L597 Mutations in Melanoma Are Associated …...Melanoma is a malignant tumor of melanocytes that caused nearly 9,000 deaths in the United States in 2011 ( 1 ). Recently, the

SEPTEMBER 2012�CANCER DISCOVERY | 797

BRAF L597 Mutant Melanoma RESEARCH BRIEF

14. Kim KB , Kefford R , Pavlick A , Infante JR , Ribas A , Sosman JA , et al. A Phase II study of the MEK1/MEK2 inhibitor GSK1120212 in meta-static BRAF-mutant cutaneous melanoma patients previously treated with or without a BRAF inhibitor [abstract] . In: Proceedings of the 8th International Congress of The Society for Melanoma Research; 2011 Nov 9–13; Tampa, FL. p. 990–1075.

15. Wei X , Walia V , Lin JC , Teer JK , Prickett TD , Gartner J , et al. Exome sequencing identifi es GRIN2A as frequently mutated in melanoma . Nat Genet 2011 ; 43 : 442 – 6 .

16. Zenker M , Lehmann K , Schulz AL , Barth H , Hansmann D , Koenig R , et al. Expansion of the genotypic and phenotypic spec-trum in patients with KRAS germline mutations . J Med Genet 2007 ; 44 : 131 – 5 .

17. Sovik O , Schubbert S , Houge G , Steine SJ , Norgard G , Engelsen B , et al. De novo HRAS and KRAS mutations in two siblings with short stature and neuro-cardio-facio-cutaneous features . J Med Genet 2007 ; 44 : e84 .

18. Schubbert S , Zenker M , Rowe SL , Boll S , Klein C , Bollag G , et al. Germline KRAS mutations cause Noonan syndrome . Nat Genet 2006 ; 38 : 331 – 6 .

19. Quilliam LA , Zhong S , Rabun KM , Carpenter JW , South TL , Der CJ , et al. Biological and structural characterization of a Ras transform-

ing mutation at the phenylalanine-156 residue, which is conserved in all members of the Ras superfamily . Proc Natl Acad Sci U S A 1995 ; 92 : 1272 – 6 .

20. Thomas RK , Baker AC , Debiasi RM , Winckler W , Laframboise T , Lin WM , et al. High-throughput oncogene mutation profi ling in human cancer . Nat Genet 2007 ; 39 : 347 – 51 .

21. Bentley DR , Balasubramanian S , Swerdlow HP , Smith GP , Milton J , Brown CG , et al. Accurate whole human genome sequencing using reversible terminator chemistry . Nature 2008 ; 456 : 53 – 9 .

22. FastQC A quality control tool for high throughput sequence data. version 0.9.1. [Internet]. [cited 2012 Mar 5]. Available from: http://www.bioinformatics.bbsrc.ac.uk/projects/fastqc/ .

23. Poulikakos PI , Zhang C , Bollag G , Shokat KM , Rosen N . RAF inhibi-tors transactivate RAF dimers and ERK signalling in cells with wild-type BRAF . Nature 2010 ; 464 : 427 – 30 .

24. Sosman J . First-in-human, multicenter, dose-escalation, phase I study of the investigatioal drug TAK-733, an oral MEK inhibitor, in patients with advanced nonhematologic malignancies and melanoma . J Clin Oncol 29: 2011 (suppl; abstr TPS145).

25. Eisenhauer EA , Therasse P , Bogaerts J , Schwartz LH , Sargent D , Ford R , et al. New response evaluation criteria in solid tumours: revised RECIST guideline (version 1.1) . Eur J Cancer 2009 ; 45 : 228 – 47 .

Research. on December 9, 2020. © 2012 American Association for Cancercancerdiscovery.aacrjournals.org Downloaded from

Published OnlineFirst July 13, 2012; DOI: 10.1158/2159-8290.CD-12-0097

Page 8: BRAF L597 Mutations in Melanoma Are Associated …...Melanoma is a malignant tumor of melanocytes that caused nearly 9,000 deaths in the United States in 2011 ( 1 ). Recently, the

2012;2:791-797. Published OnlineFirst July 13, 2012.Cancer Discovery   Kimberly Brown Dahlman, Junfeng Xia, Katherine Hutchinson, et al.   to MEK Inhibitors

Mutations in Melanoma Are Associated with SensitivityL597BRAF

  Updated version

  10.1158/2159-8290.CD-12-0097doi:

Access the most recent version of this article at:

  Material

Supplementary

  http://cancerdiscovery.aacrjournals.org/content/suppl/2012/07/13/2159-8290.CD-12-0097.DC1

Access the most recent supplemental material at:

   

   

  Cited articles

  http://cancerdiscovery.aacrjournals.org/content/2/9/791.full#ref-list-1

This article cites 22 articles, 5 of which you can access for free at:

  Citing articles

  http://cancerdiscovery.aacrjournals.org/content/2/9/791.full#related-urls

This article has been cited by 28 HighWire-hosted articles. Access the articles at:

   

  E-mail alerts related to this article or journal.Sign up to receive free email-alerts

  Subscriptions

Reprints and

  [email protected]

To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at

  Permissions

  Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://cancerdiscovery.aacrjournals.org/content/2/9/791To request permission to re-use all or part of this article, use this link

Research. on December 9, 2020. © 2012 American Association for Cancercancerdiscovery.aacrjournals.org Downloaded from

Published OnlineFirst July 13, 2012; DOI: 10.1158/2159-8290.CD-12-0097


Recommended