Date post: | 21-Dec-2015 |
Category: |
Documents |
View: | 218 times |
Download: | 1 times |
By: Brittany DuncanMentors:
Janet Sinsheimer PhD (UCLA)Mary Sehl M.D.(UCLA)
DNA repair SNPs Associated with Breast
Cancer
What We Aim to Do
To ultimately determine: What SNP and Environmental factors
contribute to breast cancer Whether a combination of SNPs acting
independently might be significant SNP-SNP interactions associated with
breast cancer
Why is this Important?
Medical: Determining SNP associations with Breast
Cancer would: Help predict and prevent future cases
Bioinformatics: Comparing two analysis techniques will:
Help to create generalized method for analyzing future SNP interactions
SNP-Single Nucleotide Polymorphism
www.dnalandmarks.com/.../marker_systems_snp.html
•A single nucleotide change at one particular locus
•Must be present in at least 1% of the population
•Can result in genotypic and phenotypic effects
ACCGTTGTGACCTGCAGTGGAAACAGTATGA
ACCATTGTGACATGCAGTGGAAACAGTGTGA
Mechanisms of DNA Repair
NER = nucleotide-excision repair, BER = base-excision repair, MMR = mismatch repair, DSBR =double strand break repair, DRCCD = damage recognition cell cycle delay response, NHEJ = non-homologous end-joining HR = Homologous Recombination
DSBR pathway
DSBR pathway Double stranded break repair pathway
One mechanism responsible for the repair and maintenance of the integrity of DNA
BRCA1 and 2 key elements in this pathway
Vulnerability to breast cancer may be due to an individual’s capability in repairing damaged DNA
Steps to Success
Recreate data found in previous paper
Implement Cordell and Clayton: Stepwise regression method
Write up results and Create tables
Future Direction: Compare results to Lasso method
UCLA Cancer Registry
UCLA familial cancer registry Participants may have cancer or not but must
meet these criteria: Be 18 yrs or older Two family members with a same type of
cancer or related cancers Or must have a family history of cancer
susceptibility Mutation in BRCA1 or BRCA2 gene
http://www.registry.mednet.ucla.edu/
Preliminary Work
Case/control study 399 Caucasian (unrelated) women were chosen
for study 104 SNPs in 17 genes of the DSBR pathway were
chosen Logistic regression analysis conducted on each SNP
to determine associations with breast cancer Adjusted models to include covariates
Findings 12 significant SNPs
Confirming Data:The Process
First Step: Defining Variables
Genotype. Frequency DV DVG – G 199 +0 +0A – G 143 +1 +1A – A 19 +2 +1
Additive• A allele confers risk in having breast cancer and
A-A even more soDominant• A allele confers risk in having breast cancer
regardless of number of copies
Example of SNP rs16889040 on RAD21 gene, Chromosome 5
Additive Dominant
Coefficients: Estimate Std. Error z value Pr(>|z|) (Intercept) -1.42388 0.72444 -1.965 0.049358 age 0.04464 0.01305 3.419 0.000628 brca1 0.49067 0.39063 1.256 0.209079 brca2 -0.11683 0.49631 -0.235 0.813896 EDUCATION1 0.08139 0.33849 0.240 0.809976 EDUCATION2 0.28671 0.34757 0.825 0.409424 Ashkenazi_status -0.68789 0.28608 -2.405 0.016192 SNP -0.76382 0.27855 -2.742 0.006104
Logit(Y) = B0 + B1X1 ….+ Bn Xn
Example output from Logistic Regression Dominant Model rs16889040
Education
MRE11A
NBS1 RAD50
ATM
BRCA1
XRCC6 XRCC5
DNA-PK
XRCC4LIG4
ZNF350
BRIP1
RAD51
BRCA2
RAD54L
RAD52
XRCC2
XRCC3
TP53
Double-Strand Break
Repaired DNA
Non-Homologous End Joining
H2AX
H2AX
RAD21
Homologous Recombination
Cordell and Clayton Method:Stepwise Logistic Regression
Stepwise Logistic Regression:
Stepwise logistic regression Cordell and Clayton Method used 8 genes that had significant SNPs in
them Ran forward regression analysis on each gene
Performed LRT and from test found p-value
Cumulative Effects
Cumulative Effects: SNPs in model but act independently
Findings: No Accumulation of SNPS were
found significant
Interactive Effects
Multiplicative effects- interaction between SNPs
Findings: RAD21 Gene interesting but not enough information to be
considered significant SNPd: SNPf SNPd: SNPg SNPf: SNPg
Three way interaction was found to be not significant
SNPd = rs16888927
SNPf = rs16888997
SNPg = rs16889040
SNP Interactions
SNPs OR(eβ) p-value .
SNPd: SNPf 1.81212 0.090404
SNPd: SNPg 1.76986 0.096392
SNPf: SNPg 1.78383 0.090659
Using p-value threshold of 0.05
Special Thanks
To my amazing mentors at UCLA: Janet Sinsheimer PhD, Biostatistics lab Mary Sehl M.D., Dr. Sinsheimer’s lab UCLA
For making the SoCalBSI program possible: The wonderful mentors at California State Los Angeles
Dr. Momand , Dr. Warter Perez, Dr. Sharp, Dr. Johnston, Mr. Johnston, Dr. Huebach, Dr. Krilowicz
Program Coordinator Ronnie Cheng
Funding: American Society of Clinical Oncology – Mary Sehl National Science Foundation - SOCALBSI National Institute of Health - SOCALBSI Economic and Workplace Development -SOCALBSI
Question Slides
Recoding for Education
Why Use Education?
Why Only Caucasian Women?
LRT/Chi^2
NEHJ and HR
Multiple vs Independent
LRT Test
Three Way Interaction
OR
Lasso Method
Recoding for Education Logistic Regression Education: 1-8 answers in a survey
1-3 highest education high school (control) 4-5 some college 6-8 higher education Educ1 Educ21-3 0 0 μ1 = μ + 0X α1 + 0Xα24-5 1 0 μ2 = μ + 1X α1 + 0X α26-8 0 1 μ3 = μ + 0X α1 + 1X α2
Coded in 0 and 1 transformation from linear to logistic Linear: Y = B0 + B1X1 ….+ Bn Xn
Logistic: ln[ pi/(1-pin) ] = B0 + B1X1 ….+ Bn Xn Y == {0,1} Essentially the log of the probability of the odds
Back
Why Use Education as a Covariate?
Routinely include at least 1 socioeconomic covariate
Education: Not necessarily because statistically
interesting, but because other studies have repeatedly found significance
Back
Why Only White Women?
Homogeneous Population In different populations (men and other
ethnicities), different genes may be involved Not enough sampling of any other group How data was found:
Registry Website and Questionnaire in English Location of UCLA Etc…
Back
LRT
Roughly estimated as a chi-squared distribution
X2= 3.84 for 1 df
P-val = .05
http://www.union.edu/PUBLIC/BIODEPT/chi.html Back
Cell cycle with NEHJ and HR
Alignment and ligation of termini at DSB
HR
http://www2.mrc-lmb.cam.ac.uk/personal/sl/Html/Graphics/CellCycle.gifLord, Garret, Ashworth Clin Cancer Res 2006; 12(15)
GC- use sister chromatid as template
SSA-homologous sequences aligned, residues no longer present are deleted Back
Multiple vs. Acting Independently
Cumulative:
logit(P(Y)) = α + βTz +Ɣ1SNP1 + Ɣ2SNP2
Multiplicative:
logit(P(Y)) = α + βTz +Ɣ1SNP1 + Ɣ2SNP2 +Ɣ3SNP1*SNP2
Covariates
Independent
Combination of two
Back
LRT Test
Equ: LRT= 2ln(L(HA)/L(H0) )
For a 1 df, 3.84 or higher corresponds to a p-value of 0.05 or lower
Alternative model fits the data better
Less than 3.84
Null model fits the data better
Testing for which model fits the data better
Back
Three Way Interaction
logit(P(Y)) = α + βTz +SNPd + SNPf + SNPg +SNPd*SNPf*SNPg
Covariates
Back
ODDS RATIO
Coded in 0 and 1 transformation from linear to logistic Linear: Y = B0 + B1X1 ….+ Bn Xn
Logistic: ln[ pi/(1-pin) ] = B0 + B1X1 ….+ Bn Xn
Y == {0,1}
Odds Ratio is eB because of Logistic Regression’s Transformed form
Back
Lasso Penalized Regression
Exploratory method used when large amount of predictors and small amount of data
Penalizes model for having to many borderline significant predictors
F(θ) = 1/2Σi(yi - μ –Σj(xijβj))2 + λΣj| βj |
Least Squares Penalty Term
Back