Cathedral Basilica of Saints Peter and Paul And the Shrine of Saint Katharine Drexel
18th Street and Benjamin Franklin Parkway, Philadelphia, Pennsylvania
Most Reverend Charles J. Chaput, O.F.M. Cap., Archbishop of Philadelphia
Parish Mission Statement
As a vibrant Roman Catholic community in Center City, the Cathedral Parish Serves all those who come to the Mother Church
of the Archdiocese of Philadelphia. We profess our Catholic Faith, minister to others
and welcome all, as founded on the Word of God and the celebration of the Sacraments
of Jesus Christ, our Lord and Savior.
Adopted by the Parish Council, April 5, 2016
Reverend Gerald Dennis Gill Rector and Pastor
Reverend Monsignor Arthur E. Rodgers
Rector Emeritus
Reverend Matthew K. Biedrzycki Parochial Vicar
Reverend Monsignor Louis A. D’Addezio
Reverend Isaac Haywiser, O.S.B. Priests in Residence
Deacon Epifanio de Jesus
Sister Eleanor McCann, R.S.M.
Pastoral Associate
Sister Mary Luchia, P.V.M.I Parish Evangelization
Charlene Angelini
Director of Cathedral Parish Music
Mark Loria Principal Organist
Edward J. Specht IV
Coordinator of Religious Education
The Cathedral Shop is open Wed. 10:30 AM - 2:00 PM / Sat. 11:00 AM - 5:15 PM
Sun. 10:30 AM - 6:30 PM / 215-665-9032
Parish Office Hours: Monday to Friday 8:30 AM to 4:30 PM (lunch break 12:00 PM - 1:00 PM) 1723 Race Street, Philadelphia, PA 19103 • 215-561-1313 • www.cathedralphila.org • [email protected]
Shrine of Saint Katharine Drexel https://www.saintkatharinedrexelshrine.com/
MASS SCHEDULE
Sunday: 5:15 PM Anticipated Mass on Saturday 8:00 AM, 9:30 AM, 11:00 AM in Basilica 12:30 PM Spanish in Cathedral Chapel Sta. Misa en español, en la Capilla 6:30 PM in Basilica
Weekdays: 7:15 AM, 12:05 PM in Cathedral Chapel
Saturdays: 12:05 PM in Cathedral Chapel
Holy Days: See website
SACRAMENT OF PENANCE SCHEDULE Sunday: 9:00 AM and 5:30 PM in Basilica 12:00 PM (español) en la Capilla
Weekdays: 11:30 AM in Basilica
Saturday: 4:15 PM in Basilica
Please contact the Parish Office to arrange for the:
SACRAMENT OF BAPTISM AND MARRIAGE, SACRAMENT OF THE ANOINTING OF THE SICK,
AND HOLY COMMUNION OF THE SICK AND HOMEBOUND
Cathedral Basilica of Saints Peter & Paul @CathedralPhila
January 19, 2020
2
MMass Intentions for the week
Jan. 18, Saturday, 12:05 Thomas McDonald, Sr. 5:15 Joanne Weller & Judith Russack
Jan. 19 Second Sunday in Ordinary Time 8:00 For the People of the Parish 9:30 Marilda Mullen 11:00 Jeff Vaugh 12:30 A la Virgen Milagrosa 6:30 For the People of the Archdiocese
Jan. 20, Monday, St. Fabian 7:15 Joan Tkach 12:05 Joseph A. Wall
Jan. 21, Tuesday, St. Agnes 7:15 Kathryn McMenamin 12:05 Carol Ciarco
Jan. 22, Wednesday, Day of Prayer for the Legal Protection of Unborn Children 7:15 John B. Neff 12:05 Sr. Julia Mary Kennedy, RSM
Jan. 23, Thursday, St. Vincent
7:15 John B. Neff 12:05 Janet Reilly
Jan. 24, Friday, St. Francis de Sales 7:15 John B. Neff 12:05 Denise Anhalt
Jan. 25, Saturday, Conversion of St. Paul 12:05 Thomas M. McDonald, Sr. 5:15 Carol Ciarco
Jan. 26 Third Sunday in Ordinary Time 8:00 For the People of the Parish 9:30 Marilda Mullen 11:00 Marilda Mullen 12:30 Eustaquio Delgado 6:30 For the People of the Archdiocese
Second Sunday in Ordinary Time
Sunday, January 19, 2020
“The Word o God became flesh and dwelt among us. To those who accepted him, he gave power to become children of God.” JN 1, 14A, 12A
Dear Parishioners, Today is the Second Sunday in Ordinary Time. Ordinary Time includes the numbered Sundays between Christmas Time and Lent and between Pentecost Sunday and Advent in the Liturgical Year. While there is not a focus on a particular aspect of the Mystery of Christ, there is a complete presentation of Christ and all of his great works, as well as, the call to be his faithful followers as members of the Church. This Sunday, the Sunday following the Feast of the Baptism of the Lord, we are invited by Saint John the Baptist to recognize Jesus as the Lamb of God. Jesus is the One sent to us to save us from our sins as our Savior and Redeemer. As we begin this period of Ordinary Time, let us respond to the word of God with a renewed commitment to follow more sincerely the Lord and all he teaches us. We are in the midst of the Week of Prayer for Christian Unity, January 18 through January 25. We join with Christians all throughout the World to pray that all who belong to Christ in Baptism may come to a deeper unity with one another in the Church. Please remember this intention in your personal prayers.
This Wednesday, January 22, 2020, is the anniversary of the 1973 Roe v. Wade Supreme Court decision which legalized abortion in the United States. Since then, 60 plus million unborn children have lost their lives as a result of legalized abortion. This scar on the face of our nation continues to call Christians, everyone, into action in the defense of human life, from the first moment of conception until natural death. Respect for life is not the work of a few but the duty of all. The one thing that all of us can do is pray for the protection of human life.
Since 2011, Catholics in the United States, at the direction of the
American Bishops, have observed January 22 as a day of prayer and penance. The intention of our prayer is for the full restoration and legal guarantee of the right to life. Our penance is for the violations to the dignity of the human person committed through acts of abortion. Decide today that you will pray for this intention especially so this Wednesday and what your personal sacrifice will be. Consider coming to the 7:15 AM or the 12:05 PM Mass in the Cathedral Chapel as part of your prayer for the day. The Holy Rosary will be prayed following both Masses for the intention for the protection of human life. This coming Saturday, January 25, 2020, at 10:00 AM in the Cathedral Chapel, there will be a formation workshop for our parish lectors and extraordinary ministers of Holy Communion. This workshop is open to anyone in the parish, including any greeters and altar servers, who may be interested in learning about these liturgical ministries. No registration is needed. Next Sunday, the second collection will be directed to the programs for the Cathedral Parish Young Adult Group. If possible, please make use of the on-line possibility of making your weekly offering. Thank you so very much for all your goodness and generosity to the Cathedral Parish. God bless you! Father Dennis Gill
3
PPARISH FINANCIAL SUPPORT The Financial Support of the Cathedral Parish is the duty of our parishioners. Here at the Cathedral Parish we are greatly supported as well by our many visitors. The offertory collection for Sunday 01/12/20 was : First Collection: $6,181.00 Second Collection (Little Sisters): $3, 290.00 $1, 222.00 - For Little Sisters - collected at the door
Thank you very much for your generous financial support!
CATECHETICAL SESSION FOR ADULTS
-Adult faith formation-
The Third Commandment Thursday, January 23, 2020, 7:00 PM
Meeting in the Pastoral Center, Room 1307 The weekly catechetical session is primarily for the adults among us who are preparing to receive the Easter Sacraments. However, anyone interested in the topic for better understanding and faith formation is most welcome to attend. Anyone, especially our parishioners, seeking more information on the reception of the Sacraments or assisting as a sponsor, please call the Parish Office, 215-561-1313 or email Edward Specht at [email protected]
What’s Happening at the Parish Outside the Liturgical Schedule
Jan. 19 Legion of Mary Meeting, APC, 12:45PM
Jan. 20 Basilica will be closed. Chapel closed at 1PM
Jan. 21 Adult Faith Shar ing, APC Room, 1301, 2PM
Jan. 22 Scr ipture Reflection for lawyers, NR, 8 AM Holy Rosary, following the 7:15 AM and 12:05 PM Masses Charismatic Prayer Group, APC - Room 1307, 6 PM
Jan. 23 Catechetical Session, APC Room 1307, 7 PM Perpetual Novena to Saint Katharine Drexel, following the 7:15 AM and 12:05 PM Masses.
Jan. 25 Formation Workshop, Cathedral Chapel, 10AM
Reading I: Isaiah 49: 3, 5-6 The prophet presents himself as another Jeremiah, with references to having a call while still in the womb, and his obligation to fulfill it. He knows that he is to be “a light to the nations” with his announcements.
Reading II: I Corinthians 1: 1-3 Paul uses a standard letter introduction, and then claims to have the same apostolic authority as the original Twelve. He tells his readers that they have been set apart by God and must work to be worthy of that.
The Gospel: John 1: 29-34 The writer tells his readers that the descent of the Spirit upon Jesus was the sign for John the Baptist that He was the one designated by God. He is “the Lamb of God” with all the rich meaning of that term making Him the ultimate sacrifice for our sins.
Please remember these parishioners and friends of the Cathedral Parish in your prayers/ Ora por los enfermos: Janina Bieranowska, Michael McCann , Caroline Brennan, Samuel Pollino, Mark Perry, Terry Dynako, Dave Dynako, Anthony Ferraro, Charlotte McLaughlin, Rose McKenna, Mary Jo D’Ortone, Amanda Rozzono, Steve Cook, Corbin M. Schindler, Gloria Quici, James Pinto, and those in nursing homes or hospitals and all the sick.. Please call the Parish Office with the name of anyone who is sick, to be included in our prayer list. Por favor llame a la oficina parroquial para añadir a la lista los nombres de personas que estén enfermas.
Readings for Mass for this Week
Please see the website of the United States Conference of Catholic Bishops: usccb.org/bible/readings
Communion for the Sick
The priests of the Cathedral of SS. Peter and Paul are anxious to serve the spiritual needs of their Catholic brothers and sisters who live in Residences such as Atria, Kennedy
House, Penn Center House, Riverside Presbyterian, Watermark, Spring Garden Towers, and anyone else who may be confined to their homes. Therefore, if you are aware of anyone who would like a priest to visit and administer the Sacrament of Penance, the Sacrament of the Sick, and Holy Communion, please let us know. There is no better way that we can emulate Jesus Christ than by sharing his love with all whom he places in our paths, especially the sick and the aged who long for his healing presence. Please pass the above requested information on to us by calling the Parish Office at 215-561-1313. Be assured of the love, concern, and prayers of your priests at the Cathedral, and in your goodness, pray for us that we may always be channels of Christ’s love and peace to others. God bless you always and in all ways.
Cooking for your family? Make a little extra for those in need, freeze it and bring it to the parish.
Meal trays are available in the side entrance to the Chapel. Frozen trays may be dropped off in the Sacristy
before/after any weekend Mass. Questions? Email Carmin de Jesus at
[email protected]. aidforfriends.org
CARING FOR FRIENDS
4
RREFLEXIÓN DEL PÁRROCO Estimados feligreses,
Hoy es el segundo domingo del tiempo ordinario. El tiempo ordinario incluye los domingos numerados entre el tiempo de Navidad y la Cuaresma y entre el domingo de Pentecostés y el Adviento en el año litúrgico. Si bien no hay un enfoque en un aspecto particular del Misterio de Cristo, hay una presentación completa de Cristo y todas sus grandes obras, así como el llamado a ser sus fieles seguidores como miembros de la Iglesia. Este domingo, el domingo siguiente a la Fiesta del Bautismo del Señor, San Juan Bautista nos invita a reconocer a Jesús como el Cordero de Dios. Jesús es el enviado a nosotros para salvarnos de nuestros pecados como nuestro Salvador y Redentor. Al comenzar este período del Tiempo Ordinario, respondamos a la palabra de Dios con un compromiso renovado de seguir más sinceramente al Señor y todo lo que él nos enseña.
Estamos en medio de la Semana de Oración por la Unidad de los Cristianos, del 18 al 25 de enero. Nos unimos en oración a los cristianos todo el mundo para que todos los que pertenecen a Cristo en el Bautismo puedan llegar a una unidad más profunda entre sí en la Iglesia . Por favor recuerde esta intención en sus oraciones personales.
Este miércoles 22 de enero de 2020 es el aniversario de la decisión de la Corte Suprema Roe v. Wade de 1973 que legalizó el aborto en los Estados Unidos. Desde entonces, más de 60 millones de niños no nacidos han perdido la vida como resultado del aborto legalizado. Esta cicatriz en la cara de nuestra nación continúa llamando a los cristianos, a todos, a la acción en defensa de la vida humana, desde el primer momento de la concepción hasta la muerte natural. El respeto por la vida no es el trabajo de unos pocos, sino el deber de todos. Lo único que todos podemos hacer es rezar por la protección de la vida humana.
Desde 2011, los católicos en los Estados Unidos, bajo la dirección de los obispos estadounidenses, han observado el 22 de enero como un día de oración y penitencia. La intención de nuestra oración es la restauración completa y la garantía legal del derecho a la vida. Nuestra penitencia es por las violaciones a la dignidad de la persona humana cometidas a través de actos de aborto. Decide hoy que rezarás por esta intención, especialmente este miércoles y cuál será tu sacrificio personal. Considere asistir a la Misa de las 7:15 a.m. o a las 12:05 p.m.en la Capilla de la Catedral como parte de su oración del día. El Santo Rosario se rezará después de ambas Misas por la intención de proteger la vida humana.
El próximo sábado 25 de enero de 2020, a las 10:00 AM en la Capilla de la Catedral, habrá un taller de formación para nuestros lectores parroquiales y ministros extraordinarios de la Sagrada Comunión. Este taller está abierto a cualquier persona en la parroquia, incluidos los que saludan y los monaguillos, que puedan estar interesados en aprender sobre estos ministerios litúrgicos. No es necesario registrarse.
El próximo domingo, la segunda colecta estará dirigida a los programas para el Grupo de Jóvenes Adultos de la Parroquia de la Catedral. Si es posible, utilice la posibilidad en línea de hacer su oferta semanal. Muchas gracias por toda su bondad y generosidad con la Parroquia de la Catedral. ¡Dios te bendiga! Padre Dennis Gill
La Misión de la Catedral Basílica de Santos Pedro y Pablo
La Parroquia Catedral sirve a todos los que vienen a la Iglesia Madre de la Arquidiócesis de Filadelfia como una comunidad católica romana vibrante en el centro de la ciudad. Profesamos nuestra fe católica, servimos a los demás y damos la bienvenida a todos tal cual está escrito en la Palabra de Dios y la celebración de los Sacramentos de Nuestro Señor y Salvador Jesucristo.
Adoptado por el Consejo Pastoral Parroquial, Abril 5, 2016
El Sacramento del Bautismo en Español Enero 26, 2019— 1:30 PM
El Sacramento del Bautismo normalmente se celebra en español cada 3 meses, el último domingo del mes; Por favor hable con el Diácono Epifanio para inscribirse en la clase de preparación y para programar el Bautismo de su hijo/a. Si su hijo/a es mayor de 7 años, el proceso es diferente, por favor llame a la oficina parroquial para mayor información. El Sacramento del Bautismo normalmente se celebra en inglés el primer domingo de cada mes. Para más información por favor llame a la oficina parroquial al 215-561-1313.
EVENTOS DE INTERES
NOCHE JUVENIL HISPANA
Fechas: 1 de Febrero, 2020 7 de Marzo, 2020 Desde las 7PM
St. Joachim Church 1527 Church St. Phila, PA 19124
La Voz de Dios en las Voces de Nuestros Pueblos
Es un programa dinámico e interactivo que promueve la fe en los oyentes a través de
diálogo, música y oración. Sale al aire cada domingo por las estaciones: WEMG Mega 1310 AM el domingo a las
10:30 a.m. (Condados de Filadelfia y Camden); WISP 1570 AM a las 4:00 p.m.
(Bucks, Delaware, Montgomery, y parte del Condado de Filadelfia).
Sacramento de la Reconciliación Los domingos a las 12:00 PM en la Capilla
BOLETIN INFORMATIVO Oficina para Católicos Hispanos
CLICK HERE
5
A Special Talk Sponsored by the Legion of Mary at Cathedral Basilica of Saints Peter and Paul and
the Shrine of Saint Katharine Drexel Lectio Divina, or “divine reading,” is a traditional way of listening to the Word of God in Scripture in order to cultivate friendship with Christ through Spirit-prompted dialogue.
Lectio Divina Sunday, February 2, 2020
12:45 PM ─ 2:45 PM Presenters: Father Isaac Haywiser, O.S.B Location: Archdiocesan Pastoral Center,
Room 1307
“Lectio Divina is a traditional Benedictine practice of scriptural reading, meditation, and prayer intended to promote communion with God and to increase the knowledge of God’s Word.” (Quoted from the on-line guide to St. Benedict). Father Isaac Haywiser, O.S.B. will introduce the history of Lectio Divina, teach the steps to pray Lectio Divina, and focus on the practical application of Lectio Divina. We are very grateful to Fr. Isaac, a Benedictine monk, who practices this discipline daily and will guide us in this prayer of encounter with the Word made flesh. Please come to learn this valuable prayer as we seek to “build in our prayer a relationship, and that is not a matter of technique but of love, trust, surrender, and giving” (The Path of Life, by Fr. Cyprian Smith, O.S.B.).
Father Isaac Haywiser is a Benedictine monk and priest from the St. Vincent Archabbey in Latrobe, Pennsylvania who is in residence at the Cathedral Basilica of Saints Peter and Paul in Philadelphia. Fr. Isaac was ordained to the priesthood on May 2, 2015. Currently, Father Isaac is studying for a Masters in Marketing at Drexel University as a first step toward a PhD. He also assists at the Cathedral by celebrating Mass and hearing confessions.
“The object of the Legion of Mary is the glory of Godthrough the holiness of its members developed by prayer and active co-operation in Mary’s and the Church’s work.” Quoted from the website page of Concilium Legionis Mariae.
What Can We Do? The Role of the Laity in a Time of Crisis
January 27, 2020
As the Church undergoes this period of profound crisis, many of us feel helpless as we watch a drama unfold that we can do nothing about. But the truth is that we are not powerless. The history of the Church tells us that lay people have a role to play in the Church’s times of turmoil. Join us for an evening of reflection on the mission of the laity in times of ecclesial crisis and learn what you can do to cooperate with Christ’s action to purify and heal His Church. Presented by: Meghan Cokeley, Director, Office for the New Evangelization, Archdiocese of Philadelphia. Location: SS Peter and Paul Parish Center, West Chester, PA
More info: View the flyer No charge to attend
Gospel Reflection Group
When: Tuesday, Jan. 28th 11:00-12 PM Where: Neumann Room Discussion: Gospel of Luke 2: 22-40
The Presentation of Jesus in the Temple, caused changes of heart in the lives of Our Lady, Simeon and Anna. There may be a message for each of us as we prayerfully read and reflect on these lines of Sacred Scripture.
Please join us and bring a friend.
ALL ARE WELCOME!!
FIRST FRIDAY EXPOSITION OF THE MOST BLESSED SACRAMENT
Adoración Eucarística el primer viernes del mes
Friday, February 7, 2020 12:35 PM to 1:30 PM
Cathedral Chapel
The Most Blessed Sacrament will be exposed for adoration after the 12:05 PM Mass.
Please come to adore the Lord! The Sacrament of Penance will be available
on the First Friday of each month, beginning at 11:30AM
El Santísimo Sacramento será expuesto para adoración después de la Misa de las 12:05 pm el 1er viernes de cada mes
a partir de las 11:30 am en la Capilla de la Catedral. Confesiones en ingles a las 11am. Por favor ven a adorar al
Señor “Our hours of adoration will be special hours
of reparation for sins, and intercession for the needs of the whole world,
exposing the sin-sick and suffering humanity to the healing, sustaining and transforming rays
of Jesus, radiating from the Eucharist.”
FFFIF RSTT FFFRRRRRRRRRRRRRRFRRIIIIDIDDDDDIDDIDAAAAAYYYYYAAYYAYYYYAAAAYYY EEEEEEEEEEEEEEEEEEEEEEEXXXXXXPXPPXPPPXXXPXPPPPXPXXXPXXPPPOOOOOOOOSSSSSSSOSSSSSSOOOOOSSSSSSOOOOOSSSOOSSSSOOSSSOOOOSSOOSSSOOOSSITITIIIIITTTITITTTTIITTTTTIITTTTITIITTTITTTTTTIIITTTTTTII IIIIIOOOOOOOOOOOIIIOOIOOOOIIIOIOOOOOIIIIOOOOOOOOOOOOOOIIOOOOIIOOOIIOOOONN NNNNNNNNNNNNNNNN OOFOFOFOFFOFOFOFFFFFOFOFOFFOFFFFFOOFOFF TTTTTTTHEHHEHEHEHEEHHHHHHHHEHH MMMMMMMMMMMMMMMMMMOOOOOOSOSOSOSOSOSSOOOOOOOOOOOO TTTTTBBBBBBLBLLLBBBLBBBBLBBLLEESESESESESSSSSSESEESSEEEEESSEEEESE SSSSSESESSEEEEEEESESESEEEESSSSEEESSSEEEEESSSEESEEEEEESEDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDD DDD SASSASSASSSAAAAAAAAAAASASSSAAASSSSSSAAAAAAAASSSSSSSSSAAAAAAAASSSSSSSAAAAAAASAAAAASSSAAAAASAAAS CRCCCCRCCCCCCRRRRRRCRCRCCRCRCCCCRRRCRCRCCCRRCRRCRRCCRCRRRCRCRRRRRRRCRCCRCCRCRRRRRCCRRRRCCCRRRCRRAAAAAAMAAAAAMAMMMMMMAMAMAMAAMMAMAAAAAAMAAAAAAAAMAAAAAMMMAMAAAAAAAMAAMAMMMAAAMMAMAAAAAMAAAAAMENEENENENEENENNNENNENENNNEENEENENEENNEEEENENEEEEEEEENENEE TTTTTTTT
Adddorooraacciiióióóóóóói nnnnnn EEEuEuuuEuuEuEuEuuucccacacaacaacaaccccacaacaaacacaaaaaacccccaaaaa íríríríríííírírírrrírííírírrr stststsstsstsstiiicccciiccciccccccccccccccaaa aaaaa aaaaa elllellelllleeeelelleeeleeeeeeleeeeleeeeeeeeeell ppppppppppppppppppppppppppppppriririiiiiririiiirrrriirrrrrrrrriir mmmmmmmmmmeeemmmmmmmmmmmmmmmmm rrrrrr rrrrr r vvviiviivviviiivvvvvvvvivivvvvvvvvviereererererere nenenneneeeeeeeneennn ss ss s sssss deddeddddddedell ll l l memememememmmemmemeeemeeemmememmmeemmmm sssssssssFFFFFrFFrFrFFrFrrFFrFFFrFrF iidddididiiddididididdiiidddddayayaayayayayyyayayayayyaaaaayaaaayyayyaayy,,,,,,,,,,,, FeFFeeeeFFFeeeeeeFFeeeFFFeeeeebbrbbbbrbrrrrbbrbrbrrbrrrbrb uauuauauuauauauauauaaauauauaauuuuuaaaaaaauu ryryrrryryyyyyrrryryrrrrrrryyrryyryrryryyyyy 77777777777777777777777777,,,,,,,,,,, ,,,, 2222000202022220002220202220002202220202202020020222020202020020200202020202000002020202
122112222122211 :33333333:::33333333::3:333333333::333333555555555555 MPMPMPMPMPMMPMMPMPMPPPMMMPMPPMPMPMMPMPMMPPMPPMPPPPPMPPMMMPPMM tttttttooo ooooo ooooooooooo 1111111::111:1:::::11:11::3300333333300003033300303330033000000300333333000 PPPPPPPPPPPPPPPPPPPPPPPPPPPPPM MMMMMMMMM MM M M MM MMCCCCCaaaCCCCaaaCCCCaCaaaaaaaCCaCCCaaaaaCCCaaCCCCCaattththhthhthththhhthhtttttt eeedeedddeddededdeeeeddeedeeedeeedeedddeede rrrarararaaraaraarraaaaararraaaraarrrraraaallllllllll ll ll l ChCCCCCChChChhChChChChChhCCChChChChChhChhCChChhhCCCChhhChhCCCChChCChChhCChhCChapaaaappapapapapaaapppapapapapapappapaapapaappppapapappppppeleelelellleleleeleeeeeleelleeeelee
ThThThThhhheee e eeee MMoMoMoMoMMMoMoMoMoMoMMMoMMMoMM sststttttstssttststststs BBBBBBBBBBBBBBBBBBBBBBBBBllellelelelllelleeleeessssssssssssssssssssssssssssssssssssssssss eeedddddededddeeeddddddeeddddedddeeddedddddedddedd SSSSSSSSSSSSSSSSSSSSSSSSacacaacacacacccacaacacacccacccccacrarrararararraraaaaararraarrrrr mmmmmemmmmmmememeemmemmememmmeememeeemeemeemmemmeentntntntntntntttntntntnnttntnnttnnnnttnnntnnt wwwwwwwwwwwwwwwwwwwwwwiiiililliilililliliilillilililllillllllllllllllllll l bebebbebebbebebbbbbebbeeeeebbeeebbbeeeeeee eeeeeeeeeeeeexpxpxpxpxxpxpppxpppososososososoossoossssosededdededdededededededededededdedededddeeeedfofofoffofoffofoffoofofoffffforrrrrrrr rrrrrrrrrrrrrrrrrrrr adadadddaadadaddaadaadadddadadaddddadororororrororooorroroorooratatatatattataatatatiioioioiiioiooooioooooonnnnnnnnnnnnnnnnnnnnnn afafafafaafafafafaafafafffafaafaaaaaafaaffteteteeeeteeteetteteeteeetttteettttt rrrrrrrrrrrrrrrrrrrrrrrr r thththttthhhthhhhhththhthhhhhhttthhhhhhtheeeee eeeeeeeeeee 12112121111222221222222221222212121112121121112222::0:0:000000::000000:00000:00:0::::0:000000::0:000000:05555555555555555555555 PMPMPMPPMMMPMPMMPMPPMPMPMMMMMMPMPMPMMMPMPMPMMPMMPPMMMM MMMMMMMMMMMMMMMMasasaasasassasaasassaassaaass.s.s.s.s.s.s.
PPlPPlPlPlPPlPlPlPPlPlPlPlPPleaeaeaaaeaeaaeaaaaaeeaeaaaeaeee sesseeeesessesessesssesessessse cccccccccccccccccomomooooomommmmmmmmommmmmmmmmmmomooommmmommmmmeeeeeee eeeeeeeeee e tttttoooottotootttotottototottoottoo aaaaaaaaaaaaaaaaaaddddodddddddoddodddodododoodddododododdddodorereererererrereerre ttttttttttttttheeheheheeehhee LLLLLLLLLLLLLLLLLLLLLLLLLLorororororroorrororoorroorooroooroorrd!d!d!d!d!dd!d!!dd!d!ddddddddddd!d!ddd!dd!d!dddd!ddd!dd!ThThhTThTheeee eee SSSaaSSSSSaSaSSaSaaaaaaSaaaaSaaaaaaSaSaSaaaaaaSSSSaaSS cccrrcrrcrrccrcrcrcccrcccrccccrrccccrrrraaaamammmmaammammaamammmmammmammmmaamammaammeeeeennnneneeenneeeeneneneeeeeneeeeneneeenttt tt t ttttttt ofofoofofoffffofofofofofooofffoooffooffoofoooo PPPPPPPPPPPPPPPPPPPPPPPPPPPPPPeeeenenenenneeeenneeeeneeneneenanananannnnannaannnnncececececceeecce wwwwwwwwwwwwwililliilillili llllllll bbebebbebeeeebbbbbeeeeeebebebbeebbebbbbbbbbebbe aaaaaaaaaaaaaaaavvvvvaavaaaaaavavaaaavvaaaaaaililllillilililllllililliililliillababababababbabababaaaabbababaa lllleeleeleleleeeeelee
ononnn ttthheheheeeeeheeeeeeeehee FFFFFFFFFFFFFFFFFFFFFFFiriirirrirrriririirrririir tttssssssttsssssttttssssttttststtttstssttttssttt FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFriirirrrririiriririrrirrirririrrriirrrriiiidadadadddadaaaaaddaaaadaddadadadaaadddaaaaadaaddaaddaaaayyyyy yyyyyyyyy yyy y y yyyyyyyyyyy ofofofofofofofofofoffofofoofoff eeeeeeeeeeeeeeeeeeeeeaaaaaacaccaacccaacccaaacacaacaaa hhh hhhhhhhhhh hhhhhhhh mmmmmoommmmmmomommmmommmm ntttntnntnttntthhhhhh,h,hh bbbbbbbbbbbegegeegegeggggegeggegeeggegggiiiiinninininininiiinninninnniniinnnnnniinininnnnniniiniininnnininininiinnnnninniniinnininninnnnnnnninnnn nngngngnnnggnggnngggngngnggnng aaaaaaaaaaaatttt ttttt tt 11111111111111111111111111111111111111111 :3:333:3::3:3:3:3:33:3::333333000000000000000AMAAMAMAMMMMMMAMAMAAMAAAMAMAMAAAMM
ElElElE SSSananananantítííííííítííítítítít siisiisissisiss mommomomomo SSSSSSSSSSaaacaacacacaccccaacccaaccccca rarararrararaaaraarararrararrarammmmemmmmmeeeemmmmmememmeemmeeeentnntntttntnnn ooooooooooo sseseesesserárrá eeexppppueueueeeu stststo oooooooo oo oo oo pppappppapapapapappapaappaappapapppppppp rarrarraraararraaraarraraararrraaararr aaaaaaaaaaaadododddodddddodoodoraraarraraaarraaraar ciciciciciicciiciciccic ónónónónóóónóóónónónónónnónnónón desppuéuéués ss ssss dededeeeeeeedede lllllllla aaaaaa MiMiMiMiMMMMisasasaaasaaaaaaasssasaaaaa dddddddddddddddddddddeeeeeeeeeeeeeeeee lllllalalaaalallallaaalaallaallaalasssssss ssssss 12121122212222222222:0:0:000:0:0: 55 555 pmppmpmpm el 1e1ee1eeerrrrrr rrrrr vvivviivivivivvvviivvviviiviiivvieeeererererrerererrrrerrrererrernenennenenneneneneeennennnennennnesssssssss sssss ss dededdededededededdedededdedededededeee ccccccccccccccadaddadadadaddddaadadaaddaaaaaaa aaa mememmmmmemeees s s
aa aaaaaaaaaaaaaaaa papppaaappppapapaaapppaaaapapappppaapapppppppppp rtrtttrtrtrrtrtrttrrttrtrtrtrtiriiiiririrrirrrrrirrririrrirrr dddddddddddddddddddddde e eeeeee ee e e llalalalllalaaalalllalaalallaaalalaaaassssssss ss ss ss 1111111111111111111111111111111111111111111:3:33:3333::3::333333:::333:33333:330 00 00000000000 0 amamamamamammmmmammaamammmmmm eeeeenn lalalaaa CCCCappappppilililllillillllllalalaallaaaalalaaaaaaaaallaaaaallaala dddddddddddddddddddddddddddddddddddddeeeee eeee eeeeeeee lalalaalalalalalalalalalaallalalalaaa CCCCCCCCCCCCCCCCCCCCCCatatattatataaatataatatatatatededdededededdededededdededdedddedrarararraraarraaarrraararrraarraral.l.l.ll.l.llll.ll.l.ll. CoCooooooooonfnffnffffnnfnfnfffnfnfnnfffnfnnffffnnnfnffffesesesessseseseseesesseesssssesssioooiioioioiioiioioioioioiiioioioioonneneneneneneeeneneneeneeeneneennneeneneneesss ssssssssssssssssss s eeeennnnennneneeeeeenneeeenennenennnnnnnnee iiiiiiiiiiiiiiiiiiiinngngngngnnggggggggnggnnggnnnggnggggggnnggggggleleleelelleleleelleeelleles ssss ss s ss s aaa a aaa aaaa aaa lalallalalaallaallalllass ssssssssssss 11111111111111111 aaamaamammma .... PPPoPoPoPoPooPoPoPoPoPoPoorrrr rr rr r r r fffafafafafaaafafffaaffaaffaaaffffaafffaafaaf vvovovovovovovovovvovoovovvoovoovvvovvoorrr rrrrrrrrr rrr vvvvveeevvvevvevevvevv nnn a aaaaaaa a a adaddddadddddadadaddorororrrrorrrrrorororro arararararararararaararraaraaa aaaaaaaaaaaaaaall lllllll l l l
SeSeSeSSSeSSSeSeSeeeSeeSeSeeSeññññoñoñoññoññññoññoñooooññoooñorrrrrrrrrrrr““““““““““““““““ uOuuOuOOuOuOuOOOuOuOuOuOOOuOOOuuOuOOOuOOOOuOuOOOOuOOOOOOOOOOOuuOuurrrr r rrrrr rrrrrr hhhhohhohohhohoohhhhooohhoohhhhohohhhohhhhhoooohhh ururuuurruuururrrurrrurrrrrruurruu ssss ss ssss offoofofoffoffofffffofofofofoooooooof aaaaaaaaaaaaaaaadodododdoddododododdoddodoododddoddorarararaararrararraaatttittiitiiititittititittiiit oonoonnnoononononnnnnnnoononnoonnnnn wwwwwwwwwwwwwwwwwwwwwwwwiilililililiiiiiiliillllillllllllllllll lllll bebebebbebebeeebbebeeebebe ssssssssssssssssssssssspepeppepepepepeppepecicicicicciicicccc alalalalalalalalalal hhhhhhhhhhhhhhhooououooooouuuuooooouuuoouuuuoursrrrsssssrsssrssrrsrsrsssrrrsrsrrs
oofofofoffofoffffofoooofooofff rrrrrrrrrrrrrrrrrrepepepepepeppepppepepeppepepeppepepepepepeeepepepeppeeppppppppaaaaaarrararaaaaarraaaaaaaarraraaaraaraaaara ataatatatatattatatatatiiioioioooooiiiooiioiioioooiooioooiiooooooooonnnnnnnnnnnnnnnnn nnnnnnn n nnn fofofoffofofofoffofffofoffffoffofffoofoorrrrrrrrrrrrr ssssisisisisisissiisisiississiiiisisiiinnnsnnnsnssnsnsnnnnssnnnssnnssnssnsnsnsssnssss,,,,,,,, anaanaaaanannnanannannnaannnnnnnnannnnaaaaannnnndddddddddddddddddddddddd dddddddddd iiniiniiininininininnini tttetetetetettetttteeerrrcrcrcccrr eseesesesesessesssisisiiiiisissiiionononononoonnnonnoonnononoonononnononnn ooofofofofofofofffofofofofoffoofofofoofofooof rrrrrrrrrrrrr ththththhththhtthhhhhthththhtthtththhheeeeee ee eeeeeeeee nnnnnnneeeeennneneeneneennnnnnneeneennneneeeeededdeddeeededdddeeeddeeedeeededddeeeedddeeeedddeee ssss sssss offofofofofoofoooffofofoffoofofoffffooof tttttttttthhheheeeeheehhehhhehehhhhehehhhhhehhhhhheehhhhheeee wwwwwwwwwwwwwwwwwwhoohooohhholeleeelellelele wwwwwwwwwwwwwwwororororrooro ldlddldldddd,,,,
eeexxxxexxeexexexexxxeexxxexxxxxeexxxxeexppoppppopoppoopopopoppopopoppoppoopppopopopopoopoppp ssisiisssisisssssiingngnnnnnggggnggggggngggggngngggggggngnnngg tttttttttttttttttttttttthhhhhhhheheheehehhhhehehehheheehheehhheehhhhhheeehhhhehe ssssssssssssssssssssssssiniininininninnnininiinnnnninnnnnninnnnnnninnnnnn--------sssssisisssiisssssssss cckckckckckckkckkkckkkkckcccckckkkkcccckkkkkkck aaaaaaaaaaaaaaaaaaannnddndddndnnnnddndndndnnndddnnnnddnddndnnn ssssssssssssssuuuuufuuffuffuuuuuufuffeferirririiiriirrinngngngngnggngngnnngngngg hhhhhhhhhhhuumumumuumummummumuuumuuumummmmanaananannnnnnaaananananannnannnnnitiitttitiitititititttitiitititttttttyy y yy y yyyy yy yytotooto ttttttttttttttttthhhhhehehhehhhhehehhhee hhhhhhhhhhheeaeaeaeaeaaeeaeeaaaeeaeaeaeeeaeeaaeeaeeaeaaeallllllilililililililililiililinnngngngnnngngngngngggngnngngnggggnnngngnggnnggnngggnggggggggg,,,, , , , , sssssusususuuuuuusssssuuuuuuusuuussssuuuuuuststsststtstststtsttststttts aiaaaiaiaiiiaiaaiaaiaiaiaiinnininniiniininiininnnningngggggg aaaaaaaaaaaaaaaannnnnnndndddndnddnndnnnnndnnnd ttttttttrarararararransnnnsssssffofofoofoffofofoffofooorrmrmrmmrmrmmrmrmrrrmrrmmminininnnnininnnngg gg g gg gggg gg gggggggg rrararararaarrararraraysysysyyyysysysysyyyyyyysys
offffooofffffffffffffff JJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJeeeeeessseeeeseesssseseessseseseseseeseeesususuuuuuuusussssuuuusssssuusussusuuusssusuussusu , ,,, , ,,,,, rrrraraaaraaaarararrararaaaaararaarraararararaaaddddiddiddidddididddddiiddiiidddidd atattaatatttaataaatttttaatinininininininininiinininiiiinnnnninnnnninng g gggggggg frrrfrrrfrrrfrrromooomomommommmooooooommmmmoommmmmommm ttttttttthhehehhh EEEuuuucucuuccccccccuccccccchahahahhhhhahahhahhahahahhaaahaaaaaaaaahaaariririrrir stststttt.””””””””””
6
“Are you or someone you know divorced or separated and in need of the accompaniment of the Church? The St. Raymond Nonnatus Foundation can help. Learn more at www.nonnatus.org or email [email protected]. Free on-line support meetings available. Questions? Call or text 215-870-9913.”
Two archdiocesan observances of MLK Day are offered below
Please share with your community
Please see the attached flyer announcing a presentation on Saint Katharine Drexel and Martin Luther King—Champions of Justice—
at the Cathedral on Tuesday, January 21, 2020 at 11:30 AM.
This initiative of the Saint Katharine Drexel Shrine is the first in a se-ries of events planned this year.
More Info: View the Flyer
You are invited to attend the annual MLK Interfaith Prayer Service on Monday, January 20 at Our Mother of Consolation Church in Chestnut Hill. Archbishop Chaput will be the presider. See the attached flyer for
details.
More Info: View the Flyer
OOTHER EVENTS OF INTEREST
Tours of the Cathedral Basilica
A guided tour of the Basilica is available after the 11:00 AM Sunday Mass (except on 1st Sunday). Please gather in front of the Side Altar of the Sacred Heart, which is located to the right of the Main Sanctuary.
FEBRUARY 2, 2020 FLAME OF LOVE FEAST DAY
All are invited to come and Prays as Mary Has Asked Us
Saint Mary Magdalen Parish 2400 Providence Rd. Media, PA
For more information Call: The Flame of Love
Office 610-622-4257
Winter Retreat for Young Adults
Schedule is for Friday Night on February 7th to Saturday Afternoon February 8th at
Malvern Retreat House. The retreat will be Directed By: Fr. John Wackerman - (Pastor, Queen of the Universe, Parish Levittown) Fr. Jim Otto - (Pastor, Sacred Heart, Parish Philadelphia) Dr. Antone Raymundo, M.D. (Catholic Speaker and Mentor) Single or Married ages 18-35 are invited.
Looking for a Catholic retreat for young adults this spring? Join us for the third annual Philadelphia Charis Ministries retreat at St. Raphaela Retreat Center in Haverford, PA. Over the course of the weekend from Friday, March 6th through Sunday, March 8th, retreatants will connect with other young adults reflecting on different career or relationship paths, encounter the Holy Spirit’s presence in one’s life, learn Ignatian tools for decision making, and grow in understanding of how to respond to God’s invita-tion. Charis Ministries is a retreat ministry in the Jesuit tradition for those in their 20s and 30s. The Handmaids of the Sacred Heart of Jesus are excited to welcome back Charis Ministries to their retreat center, St Raphaela Center. Registration is open and can be accessed at straphaelacenter.org. Questions? Email [email protected]
EVANGELIZATION NEWSLETTER Office for New Evangelization
CLICK HERE
WORKSHOP ON THE ORDER OF BAPTISM OF CHILDREN
The English Translation of the second edition of the Order of Baptism of Children has been approved for use in the United States and replaces the current English edition. The first use date of the revised ritual is February 2, 2020, the Feast of the Presentation of the Lord, and the mandatory use date is April 2, 2020, Easter Sunday.
All Priests, Deacons, DRE’s, Catechists for Baptism, and Liturgical Musicians are encouraged to attend a workshop on this new ritual book which has been updated to be consistent with the current translation of the Roman Missal.
Tuesday, February 11, 2020 Archdiocesan Pastoral Center 1:30 PM to 3:30 PM. Parking will be available.
Please register at: [email protected]
YA Bible Study– Tues. June 25, 2019, 6:30PM in the Archdiocesan Pastoral Center (tall building behind Basilica). Sign up to receive most up-to-date information on our events please e-mail [email protected] or search for our Facebook page @youngadultscathedral
062 Cathedral Basilica of Saints Peter & Paul - Philadelphia (i) John Patrick PublishingCompany 1-800-333-3166 • www.jppc.net
Present This Ad To Receive 10% Off Your PurchasePresent This Ad To Receive 10% Off Your Purchase
LINNETT’S GULFForeign & Domestic Repairs
Discount Tire Center
Fax: 215-561-2658Approved Auto Repair
2201 Spring Garden Street • Philadelphia, PA 19130215-972-9000
Keith McGowan, CFP®, MBAIndependent Unbiased Financial Advice
www.americanadvisors-llc.com267-352-3392
Commercial Rates are at an All Time Low. Contact us today to get a free analysis to see if we can help Save you moneywith your monthly payments on your
commercial property. Multi-Family, Retail, Offi ce Building, Apartment and Condos.
Can close in as little as 45 days! Four season customer service is our top priority.
www.duqfunding.com1650 Market Street - Suite 3600
Philadelphia, PA 19103
Gama Printing Co.Screenprinting - Embroidery
Stickers - VinylsGraphic Design
Custom Apparel - Headwear
610-945-4263@GamaPrintingCo
Wedding Invitations Wedding Invitations & Holiday Cards& Holiday Cards
Log onto Log onto www.jppc.netwww.jppc.net conveniently from yourconveniently from your
home or office.home or office.Online Catalog • Online OrderingOnline Catalog • Online Ordering
Online Proo ngOnline Proo ngAll Major Credit Cards AcceptedAll Major Credit Cards AcceptedFREE UPS GROUND SHIPPINGFREE UPS GROUND SHIPPING!
Family Ambulance Police FireGPS + Fall Alert* + APP Tracking
24/7•365 - USA Based MonitoringNo Contract
FREE SHIPPINGCALL NOW! 800-866-2180
y
2AS LOW ASAS LOW AS
$$19199595A MonthA Month*As Shown GPS*911 Direct Connect
24 Hour Protection at 24 Hour Protection at HOMEHOME & & AWAYAWAY!!If You LIVE ALONE You Need MDMedMDMedAlert!Alert! TTM
$350Off Any New Stairlift
With This Ad
• FREE in home evaluations• Family owned & operated for
more than 20 years
1.888.900.8883www.Tri-StateStairlifts.com
What’s My Name?The #WHATSMYNAME Movement asks everyone to simply ask drivers “What’s my name?” before entering their vehicle
to make sure it is the car they are supposed to enter.
In Remembrance of Samantha Josephson#WHATSMYNAME
Mallory’s Army FoundationUnited Together In The Fight Against Bullying...
Don’t Just Teach Kindness... BE KINDNESS!www.MallorysArmy.com
(973) 440-8657 • [email protected] It’s easy to join our mailing list! Just send your email address by text message:
Text MALLORYSARMY to 22828 to get started.Message and data rates may apply.
062 Cathedral Basilica of Saints Peter & Paul - Philadelphia (b) John Patrick Publishing Company 1-800-333-3166 • www.jppc.net
567-0364Fax 567-1931
19th & Green Sts.
Free Pick-up and Delivery
FAIRMOUNT PHARMACY
Rafael Yanez, DMDWelcome New Patients!
Cosmetic Dentistry • Smile Makeover • Implants
Invisalign • Invisible Braces • DenturesEmergency Dental Care and more
Call us today! 215.923.2233www.i-dentical.com • Hablamos Español
200 walnut street • phila, pa 19106
DinanDinan- FUNERAL HOME -
est. 1890Traditional Funerals and Cremations
Members of the ParishChristopher J. Dinan, Supervisor
1923 Spring Garden St., Phila., PA 215-563-3655
Kitchen Open ‘till Midnight
Take Out Available
22nd & Cherry Streets (215) 561-5683
CHERRY STREET TAVERN
JEFCO Since 1950Windows • AWNINGS • DoorsFor Your Home or BusinessDistinctive Doors & Windows
Drapes • Shades • BlindsFREE ESTIMATES
5000 Paschall Ave., Philadelphia215-334-3220
jefcoawnings.com
Joseph GiannonePLUMBING • HEATING • AIR CONDITIONING
www.calljg.com(215) 375-7134
LEARNING TODAY...LEADING TOMORROW
www.neumanngorettihs.org/admissions
Best Irish Pub in PhiladelphiaPlease join us for our Sunday brunch
Customers enjoy 3 hr parking for only $6 at the Windsor Suites
Looking for a great place to hold your special event?We cater to Communions, Confi rmations,
Wedding Rehearsal Dinners, Funeral Luncheonsand All Your Special Event Needs
Free WiFi for all our patronsCheck us out on the web at conmurphyspub.com
1700 Benjamin Franklin Parkway, Phila., PA 19103 267-687-1128
15% OFF DINING BILL
with this ad
Karon MassadoReal Estate Salesperson
o 267.435.8015m 302.252.8824
[email protected] Market St. - Fl. 19, Phila, PA
LASTSTOP
RECOVERY(215) 593-7164
HUGE SAVINGS EVENT!
MARCH 20-22MARCH 20-22Everything for kids at 50-90% off !
FLYERS SKATE ZONE, VOORHEES
More info: www.jbfsale.com@JBFCherryhill
/ColorImageDict > /JPEG2000ColorACSImageDict > /JPEG2000ColorImageDict > /AntiAliasGrayImages false /CropGrayImages true /GrayImageMinResolution 300 /GrayImageMinResolutionPolicy /OK /DownsampleGrayImages true /GrayImageDownsampleType /Bicubic /GrayImageResolution 300 /GrayImageDepth -1 /GrayImageMinDownsampleDepth 2 /GrayImageDownsampleThreshold 1.50000 /EncodeGrayImages true /GrayImageFilter /DCTEncode /AutoFilterGrayImages true /GrayImageAutoFilterStrategy /JPEG /GrayACSImageDict > /GrayImageDict > /JPEG2000GrayACSImageDict > /JPEG2000GrayImageDict > /AntiAliasMonoImages false /CropMonoImages true /MonoImageMinResolution 1200 /MonoImageMinResolutionPolicy /OK /DownsampleMonoImages true /MonoImageDownsampleType /Bicubic /MonoImageResolution 1200 /MonoImageDepth -1 /MonoImageDownsampleThreshold 1.50000 /EncodeMonoImages true /MonoImageFilter /CCITTFaxEncode /MonoImageDict > /AllowPSXObjects false /CheckCompliance [ /None ] /PDFX1aCheck false /PDFX3Check false /PDFXCompliantPDFOnly false /PDFXNoTrimBoxError true /PDFXTrimBoxToMediaBoxOffset [ 0.00000 0.00000 0.00000 0.00000 ] /PDFXSetBleedBoxToMediaBox true /PDFXBleedBoxToTrimBoxOffset [ 0.00000 0.00000 0.00000 0.00000 ] /PDFXOutputIntentProfile () /PDFXOutputConditionIdentifier () /PDFXOutputCondition () /PDFXRegistryName () /PDFXTrapped /False
/CreateJDFFile false /Description > /Namespace [ (Adobe) (Common) (1.0) ] /OtherNamespaces [ > /FormElements false /GenerateStructure false /IncludeBookmarks false /IncludeHyperlinks false /IncludeInteractive false /IncludeLayers false /IncludeProfiles false /MultimediaHandling /UseObjectSettings /Namespace [ (Adobe) (CreativeSuite) (2.0) ] /PDFXOutputIntentProfileSelector /DocumentCMYK /PreserveEditing true /UntaggedCMYKHandling /LeaveUntagged /UntaggedRGBHandling /UseDocumentProfile /UseDocumentBleed false >> ]>> setdistillerparams> setpagedevice