ORIGINAL RESEARCH REPORT

Characterization of Mesenchymal Stem CellSubpopulations from Human Amniotic Membrane

with Dissimilar Osteoblastic Potential

Margarita Leyva-Leyva,1 Lourdes Barrera,2 Cesar Lopez-Camarillo,3 Lourdes Arriaga-Pizano,4

Gabriel Orozco-Hoyuela,5 Erika M. Carrillo-Casas,1 Jaime Calderon-Perez,6 Annia Lopez-Dıaz,1

Felipe Hernandez-Aguilar,1 Ricardo Gonzalez-Ramırez,1 Simon Kawa,7

Jesus Chimal-Monroy,8 and Lizeth Fuentes-Mera1

Human fetal mesenchymal stem cells can be isolated from the amniotic membrane (AM-hMSCs) by enzymaticdigestion. The biological properties of this cell population have been characterized; however, few studies havefocused on the presence of stem cell subpopulations and their differentiation potential. The aim of the present studywas to isolate homogeneous AM-hMSC subpopulations based on the coexpression of surface markers. In addition,we aimed to characterize stem cell subpopulations through the detection of typical stem cell markers and itsdifferentiation potential. In this study, fluorescence-activated cell sorting (FACS) was used to positively select for thesurface markers CD44, CD73, and CD105. Two subpopulations were isolated: CD44 + /CD73+ /CD105 + (CD105+ ),and CD44+ /CD73+ /CD105- (CD105- ). To characterize the cell subpopulations, the expression of pluripotency-associated markers was analyzed by reverse transcriptase–polymerase chain reaction and immunofluorescence. Ourresults showed positive expression of SOX2, SOX3, PAX6, OCT3/4, and NANOG in the CD105 + and CD105 - cellsubpopulations. In contrast, we did not detect expression of SSEA4 or FOXD3 in either subpopulation.Immunophenotypes, such as mesenchymal and hematopoietic markers, were studied by FACS analyses. Our datarevealed the expression of the CD49a, CD49d, CD29, integrin a9b1, CD44, CD73, and CD105 antigens in bothsubpopulations. In contrast, CD90, CD45, CD34, CD14, and HLA-DR expression was not detected. The ability ofboth subpopulations to differentiate into osteoblasts, adipocytes, and chondrocytes was evidenced using Alizarinred, Oil-Red, and Alcian blue staining, respectively. Furthermore, neuronal differentiation was demonstrated by theexpression of GFAP and NEURO-D. Interestingly, we observed a dissimilar osteoblastic differentiation potentialbetween the subpopulations. CD105 - cells showed stronger expression of secreted protein acidic and rich in cysteine(SPARC) and osteonectin, which was associated with more effective calcium deposition, than CD105 + cells. Inconclusion, we described a systematic method for the isolation of hMSCs that was highly reproducible andgenerated homogeneous cultures for osteoblast differentiation with an efficient capacity for mineralization.

Introduction

The International Society of Cellular Therapy (ISCT)had described mesenchymal stem cells (MSCs) as those

that were capable of adhering to plastic chambers, expressing

the surface markers CD73, CD105, CD90, and CD44 in theabsence of hematopoietic stem cell (HSC) markers, and dif-ferentiating into mesenchymal lineages such as osteoblasts,adipocytes, and chondroblasts under standard in vitro dif-ferentiating conditions [1–4] and into a lineage that originates

1Laboratorio de Biologıa Molecular e Histocompatibilidad, Direccion de Investigacion Hospital General ‘‘Dr. Manuel Gea Gonzalez’’,Mexico, Mexico.

2Laboratorio de Inmunologıa Integrativa, Instituto Nacional de Enfermedades Respiratorias ‘‘Ismael Cosıo Villegas’’, Mexico, Mexico.3Laboratorio de Oncogenomica y Proteomica del Cancer, Posgrado en Ciencias Genomicas, Universidad Autonoma de la Ciudad de

Mexico, Mexico, Mexico.4Unidad de Investigacion Medica en Inmunoquımica, Hospital de Especialidades, Centro Medico Nacional, Siglo XXI, IMSS, Mexico,

Mexico.5Instituto de Fisiologıa Celular, Universidad Nacional Autonoma de Mexico (UNAM), Mexico, Mexico.6Division de Ginecologıa y Obstetricia, Hospital General ‘‘Dr. Manuel Gea Gonzalez’’, Mexico, Mexico.7Comision Nacional de Bioetica, Mexico, Mexico.8Departamento de Medicina Genomica y Toxicologıa Ambiental, Instituto de Investigaciones Biomedicas, Universidad Nacional

Autonoma de Mexico (UNAM), Mexico, Mexico.

STEM CELLS AND DEVELOPMENT

Volume 00, Number 00, 2013

� Mary Ann Liebert, Inc.

DOI: 10.1089/scd.2012.0359

1

from another embryological layer [5,6]. Human mesenchymalstem cells (hMSCs) were initially isolated from bone mar-row [2] and have been identified in fetal tissues such asthe liver, bone marrow, and pancreas, in the endothelial/subendothelial layers of the umbilical vein and in the pretermblood of the fetus [7–11]. hMSCs have been isolated fromadult organs such as bone marrow, peripheral blood, cornea/retina, the brain, skeletal muscle, dental pulp, and the liverand in adipose tissues [12–16]. However, the capacity fordifferentiation of hMSCs decreases with age; therefore, thesearch for alternative sources of MSCs is imperative.

Human placenta plays a fundamental and essential role infetal development, nutrition, and immunological tolerance,and represents a stem cell reserve [17–19]. Four regions in theplacental tissue can be distinguished: amniotic epithelia,amniotic mesenchyma, chorionic mesenchyma, and chor-ionic trophoblast [17–20]. Remarkably, each region of thistissue contains stem cells that display different differentia-tion capabilities [21–23]. Although precursor cells are notscarce in these regions, the recovery and purification of thesecells require complicated methods. In addition, cell culturesthat are obtained by nonselective methods are highly het-erogeneous. Currently, research and the resulting compari-sons have been hampered by the above-mentioned problems[24–28]. Moreover, several methods have been described forthe isolation of MSCs, and these methods include thosebased on their ability to adhere to plastic surfaces, frequentmedium changes, and enzyme treatment, or more complexmethods that are based on the use of flow cytometry and cellsorting by negative or positive selection [29–34]. None-theless, Schugar demonstrated that the method of isolationand processing influences the type of stem cell populationthat is recovered. These authors described different isolationmethods from the entire umbilical cord and showed thatMSCs with different phenotypes can be recovered from thistissue [35].

To overcome these circumstances, efforts based on the useof surface antigen markers [30,31,36] had been made thatattempted to guarantee a homogenous population of MSCs.

The aim of the present study was to isolate highly ho-mogeneous subpopulations of amniotic membrane humanmesenchymal stem cells (AM-hMSCs) with efficient osteo-blastic potential using fluorescence-activated cell sorting(FACS) to positively select for surface markers.

Materials and Methods

Isolation of stem cells from the humanamniotic membrane

Caesarean-delivered term placentas (n = 30) were collectedfrom healthy donor mothers. This research was approved bythe Ethics Committee of the Dr. Manuel Gea GonzalezGeneral Hospital, and each donor gave her consent. Theamniotic membrane from each patient was mechanicallyseparated from the underlying chorion by blunt dissection.For cell isolation, the section near the umbilical cord wasselected, and a 10 · 10-cm membrane section was choppedand rinsed with phosphate-buffered saline (PBS) that wassupplemented with penicillin and streptomycin (100 U/mLpenicillin, 100mg/mL streptomycin, and 0.25 mg/mL am-photericin B; Sigma) to remove traces of blood. The frag-

ments were submitted to enzymatic digestion in 2 stages: (1)incubation with 0.125% trypsin/0.5 mM EDTA solution (ICNBiomedicals) at 37�C for 30 min; and (2) treatment with100 U/mL collagenase type II and 3 mM calcium chloride inthe Dulbecco’s Modified Eagle’s Medium (DMEM) for 2 h at37�C, which was followed by washing with PBS. Then, thecell suspension was filtered, and the cells were seeded in25-cm2 flasks in the DMEM (GIBCO) containing 10% fetalbovine serum (FBS; GIBCO) and 100 U/mL penicillin,100 mg/mL streptomycin, and 0.25 mg/mL amphotericin B.Cell cultures were incubated at 37�C in a 5% CO2 atmo-sphere, and nonadherent cells were eliminated after 5–7 daysby removing the medium every 3 days. When the culturereached 90% confluence, the cells were recovered using0.125% trypsin/EDTA and further seeded at 5 · 104 cells/cm2 to expand them.

Flow cytometry and cell sorting

After detachment using 0.125% trypsin/EDTA, AM-hMSCs were washed once with 0.2% BSA and 0.1% NaN3-PBS. This cell suspension was stained with the followingantibodies: phycoerythrin (PE)-conjugated CD73 (BioLegend),biotin-conjugated CD44 (Serotec), followed by PercP-Cy5.5-conjugated streptavidin, FITC-conjugated CD90 (Santa CruzBiotechnology), PE-conjugated CD34 (BD, Biosciences), RPE-conjugated CD45 (BD, Biosciences), RPE-conjugated CD14(Serotec), FITC-conjugated anti-a9b1 (Santa Cruz Biotechnol-ogy), FITC-conjugated CD49a (Santa Cruz Biotechnology),FITC-conjugated CD49d (Santa Cruz Biotechnology), FITC-conjugated CD29 (Santa Cruz Biotechnology), PerCP/Cy5.5-conjugated HLA-DR (BioLegend), PE-conjugated HLA-ABC(BioLegend), and APC-conjugated CD105 (BioLegend). Theproper isotype controls for each antibody were used to re-move any nonspecific binding. Cells were incubated for20 min at room temperature in the dark and then fixed andanalyzed using a BD FACSAria Flow Cytometer and FlowJoSoftware (Tree Star, Inc.). For sorting, single AM-hMSC sus-pensions (6–8 · 106) were prepared by staining with humanPE-conjugated CD73 (BioLegend), biotin-conjugated CD44(Serotec), followed by PercP-Cy5.5-conjugated streptavidinand APC-conjugated CD105 (BioLegend). Dead cells, cell de-bris, doublets, and aggregates were excluded by forward andside scattering and pulse-width gating, and isotype-matchedcontrols were applied in parallel as controls. Sorted cells wereexpanded to obtain adequate cells for subsequent assays.

RNA extraction and reverse transcription–polymerase chain reaction

Total RNA was extracted from 0.5 · 106 cells using TRIzolreagent (Invitrogen), and the RNA samples were then treatedwith deoxyribonuclease I (Amplification Grade Invitrogen).Single-stranded cDNA was synthesized using the ImPromReverse Transcription System kit (Promega) according to themanufacturer’s instructions, and the cDNA was stored at- 20�C for later polymerase chain reaction (PCR) amplifica-tion reactions. For PCR amplification, the template (250 ng)was mixed with 10 mM of each dNTP, 1.5 mM MgCl2, 10picomoles of each primer, and 0.5 U/mL Taq DNA poly-merase (Promega). The reaction volume was then broughtup to 25mL with DEPC-treated water. The reaction was

2 LEYVA-LEYVA ET AL.

performed in a Maxy-Gene thermocycler with Iso-tempcover (Stuart Scientific), and PCR programs were performedaccording to primer specifications, as described in Table 1,and using the standard amplification scheme of initial de-naturalization at 95�C for 5 min, followed by 30–35 cycles of95�C for 30 s, a specific melting temperature for 30 s, 72�C for30 s, and a final elongation at 72�C for 5 min. Amplificationproducts were examined by electrophoresis in a 2% agarosegel that was stained with ethidium bromide and docu-mented using an UV transilluminator. The TUBA1A genewas amplified as an internal control. The pixel density ofeach fragment and their ratios were determined using Lab-Works 4.0 Image Acquisition and Analysis Software (UVPBioImaging Systems, UVP). The ratios represented the rela-tive expression of each mRNA and were used for semi-quantitative analysis.

Western blotting

For immunoblotting, the cells were rinsed with cooled PBSand then lysed at room temperature for 10 min in 1 mL ofRIPA buffer (20 mM Tris–HCl, pH 7.5, 150 mM NaCl, 1 mMEGTA, 1% NP-40, 1% sodium deoxycholate, 2.5 mM sodiumpyrophosphate, 1 mM b-glycerophosphate, 1 mM Na3VO4,and 1 mg/mL leupeptin) containing the Complete ProteaseInhibitor� (0.5 mM phenylmethylsulfonyl fluoride, 10 mg/mL leupeptin, 10 mg/mL aprotinin, 5mg/mL pepstatin,10 mg/mL soybean trypsin inhibitor, and 0.5 mM dithio-threitol; ROCHE, Molecular Biochemicals). After centrifuga-tion for 20 min at 1,300 g at 4�C, the supernatant was storedat - 20�C. Equal amounts of protein (20mg) were run on 10%polyacrylamide SDS gels and transferred to a PVDF mem-brane (Millipore Corporation) in a transfer buffer (25 mMTris, 192 mM glycine, and 10% methanol). The membraneswere dried and blocked for 60 min at room temperature withTBST-1 · [137 mM NaCl, 20 mM Tris, and 0.1% Tween-20(pH 7.6)] containing 5% BSA (Sigma-Aldrich) and then in-cubated overnight at 4�C with rabbit anti-human GFAP(DAKO; 1:2,000), rabbit anti-human NEURO-D (DAKO;1:1,000), or mouse anti-human actin (which was kindly do-nated by Dr. Manuel Hernandez; 1:2,000). After incubation,the membrane was washed 3 times in TBST-1 · and incu-

bated with horseradish peroxidase-conjugated goat anti-rabbit IgG or goat anti-mouse IgG antibody at a 1:8,500dilution (Zymed), depending on the primary antibody thatwas used. The bound antibody was detected using Chemi-Lucent (Chemicon), which is based on the reaction ofluminol–horse rabbit peroxidase. The light emission wasdetected using hyperfilm-enhanced chemiluminescence (GEHealthcare).

Indirect immunofluorescence

Cells were seeded on coverslips at 2 · 103 cells/cm2 andinduced with an osteogenic medium, which contained theDMEM (GIBCO) that was supplemented with 10% FBS,10 mM b-glycerophosphate, 0.25 mM ascorbic acid, and10 - 8 M dexamethasone (Sigma-Aldrich). Indirect immu-nofluorescence was performed after induction. To maintainthe integrity of their cytoskeletons, the cells were rinsed at37�C with a cytoskeleton buffer (CB; 10 mM MES pH 6.1,138 mM KCl, 3 mM MgCl2, 2 mM EGTA, and 0.32 M Su-crose) and then fixed with 3% formaldehyde-CB for 15 minat 37�C. The cells were then washed with CB and permea-bilized with 0.1% Triton X-100 CB (Sigma-Aldrich) for5 min. Next, the coverslips were blocked with 0.5% fish skingelatin in PBS for 20 min at room temperature and incu-bated overnight at 4�C with a specific antibody: rabbit anti-human SSEA4 (Santa Cruz Biotechnology; 1:100), rabbitanti-human OCT3/4 (Santa Cruz Biotechnology; 1:100),rabbit anti-human NANOG (Santa Cruz Biotechnology;1:100), rabbit anti-human GFAP (DAKO; 1:300), or rabbitanti-human NEURO-D (DAKO; 1:400). Then, the sampleswere rinsed with PBS and incubated for 1 h at room tem-perature with FITC-conjugated F(ab’)2 goat anti-rabbit IgG(H + L; Zymed; 1:100) and phalloidin–rhodamine (Sigma-Aldrich) at 0.1 mg/mL. The slides were assembled withVECTASHIELD� Mounting Media (Vector Laboratories,Inc.) that contains DAPI, and the images were analyzedusing an Olympus FluoView FV1000 Confocal Microscopewith an attached MRC1024 LSCM system (Bio-Rad). Thecells were imaged from top to bottom in the Z-plane, andimages from the midplane of the cells were captured andstored as digital images.

Table 1. Oligonucleotides Used for Expression Analyses

Oligonucleotide Primer sequence (3¢—5¢) Tm (�C) Product size (bp)

Oct4 F GATGGCGTACTGTGGGCCC 66.6 492Oct4 R CTGGTTCGCTTTCTCTTTCGG 64.5PAX6F AACAGACACAGCCCTCACAAACA 62.8 274PAX6R CGGGAACTTGAACTGGAACTGAC 64.6FOXD3F GCAGAAGAAGCTGACCCTGA 62.4 305FOXD3R CTGTAAGCGCCGAAGCTCT 62.3SOX2F GGCAGCTACAGCATGATGCAGGAGC 69.5 130SOX2R CTGGTCATGGAGTTGTACGCAGG 66.3NANOG F CAGCTGTGTGTACTCAATGATAGATTT 61.6 201NANOG R CAACTGGCCGAAGAATAGCAATGGTGT 66.1OSNEC F GAATTCGGACAGCTCAGAGT 66.1 410OSNEC R AGACAGAGGTGGTAGAGGAG 66.1Col I F CCCAGCCACCTCAAGAGAAG 69.5 204Col I R TCCAGTCAGAGTGGCACATC 66.1Tubulin F CAGATGCCAAGTGACAAGAC 62.3 400Tubulin R ACTCCAGCTTGGACTTCTTG 61.3

CHARACTERIZATION OF HUMAN AM-MSC SUBPOPULATIONS 3

Cell differentiation assays

To induce osteogenic differentiation, cells were platedat 2 · 103 cells/cm2 in an osteogenic medium that containedthe DMEM (GIBCO) supplemented with 10% FBS, 10 mMb-glycerophosphate, 0.25 mM ascorbic acid, and 10 - 8 Mdexamethasone (Sigma-Aldrich). Cultures were maintainedfor 3 weeks, with medium changes every 2–3 days, and thephenotype was confirmed using the alkaline phosphatase(ALP) activity assay. To induce chondrogenic differentiation,micromass cultures were prepared by seeding 5-, 10-, or 20-mL droplets of a 1 · 107-cells/mL solution in the centre ofwell of a 48-well plate. After incubating the micromass cul-tures for 2 h at 37�C in a 5% CO2, humidified atmosphere, achondrogenic differentiation medium (Invitrogen Corpora-tion) was added and replaced every 2–3 days for 3 weeks.Cell pellets were fixed with 3% paraformaldehyde andstained with 1% Alcian blue 8GX (Aldrich Chemical Com-pany, Inc.) in 0.1 N HCl for 30 min. Blue staining indicatesthe synthesis of proteoglycans by chondrocytes. For adipo-genic differentiation, cells were grown to 50%–70% conflu-ence in a 4-well chamber (Thermo Fischer Scientific, Nunc) inthe DMEM supplemented with 10% FBS. Adipogenesis wasinduced with supplemented medium that contained 1 mMdexamethasone, 1 mg/mL insulin, 0.5 mM 3-isobutyl-1-methylxanthine, and 100 mM indomethacin. Control cul-tures without adipogenic supplements were also maintained.After 3 weeks, the cultures were examined for evidence ofadipogenesis by fixing in 10% paraformaldehyde andstaining with a freshly prepared Oil-red-O solution to detectlipid droplets. Photographs to document condrogenesis andadipocytic differentiation were taken using an OlympusStereomicroscope SZ61 that was equipped with an EvolutionVF Color Cooled camera.

Neuronal differentiation was induced with the DMEM(GIBCO) supplemented with 20% FBS and 0.05 mg/mL NGFover 21 days, and the cultures were maintained in thismedium for 15 days. The neuronal phenotype was analyzedby confocal fluorescence microscopy and western blotting todetect the GFAP and NEURO-D proteins.

Bone ALP activity assay

Cells (1 · 106 cells/mL) were cultured in 6-well plates andharvested at 0, 3, 5, 7, 9, and 14 days postinduction. The cellswere the washed with PBS twice and lysed with 1% (w/v)Triton X-100 in 0.9% (w/v) NaCl at 4�C. After centrifugation,the supernatant was assayed for ALP activity with theMicroVue kit (Quidel Corporation) in accordance with themanufacturer’s instructions. Subsequently, quantitative ki-netic determination of cell-associated ALP activity (U/mgprotein) was determined at 405 nm and 20�C using anEPOCH� spectrophotometer (Biotek Instruments, Inc.), andtotal the protein concentration, which was determined usingthe Lowry protein assay, was used for normalization.

Calcium deposition quantification

Cells (1 · 104 cells/mL) were cultured in 6-well plates andharvested at 0, 9, 14 and 21 days postinduction. The cellswere washed twice with PBS and decalcified with 0.6 M HClat 37�C for 24 h to extract the intracellular calcium content.The supernatant from the acid-extraction was analyzed by

staining with Alizarin Red using the Osteogenesis quantita-tion kit (Millipore Corporation) according to the manufac-turer’s instructions. The developed color was determinedat 405 nm using an EPOCH� spectrophotometer (BiotekInstruments, Inc.), and the results were normalized to theprotein concentration, which was assessed using the Lowryprotein assay.

Statistical analysis

All data were analyzed using SPSS 13.0 software (www.spss.com/corpinfo/faqs.htm), and the results representedthe mean – standard deviation. The Student’s t-test andanalysis of variance were applied, and a P value of < 0.05 wasconsidered as a significant difference.

Results

Isolation of CD44 + /CD73 + /CD105 +

and CD44 + /CD73 + /CD105 - stem cellsubpopulations from human amniotic membrane

An adherent cell population was obtained by trypsin andcollagenase II digestions of the amniotic membrane, andadherence to the culture dish was observed during the first24 h (Fig. 1A). After 7 days, 40% to 60% of the cells remainedattached and formed colony-forming units with the typicalmorphology of fibroblast-like cells (Fig. 1B). At day 10–14,the cells reached 80% confluence (Fig. 1C). Using FACSanalysis with side-scattered (SSC) and forward-scattered(FSC) light parameters on a linear scale, we observed a highcell dispersion, which suggested high heterogeneity in sizeand internal complexity (Fig. 1D). To identify cell popula-tions, we applied a logarithmic-scale analysis for SSC/FSC,and 2 subpopulations were clearly identified: smaller cells(average diameter of 9.5 – 1.1 mm) with low granularity andlarger cells (diameter of 15.0 – 1.1 mm) with high granularity(Fig. 1E).

To establish the cell surface features of the subpopulations,we analyzed the presence of MSC markers on the cells. Basedon the criteria established by the ISCT, the expression of thesurface markers CD73, CD44, and CD105 was studied forsubsequent cellular selection. We observed that 82% of thesmall-sized cell population shared CD73 and CD44 antigens,but only 0.08% expressed CD105 on their surface (CD105 -

represented 99.92%) (Fig. 1F). Regarding the larger popula-tion, it was determined that 97.57% had a CD73 + /CD44 +

phenotype, and 6.3% expressed the CD105 marker (Fig. 1G).These findings are highly promising, because in most of thetissues, the population of MSCs represents a rare populationthat ranges between 0.01% (human bone marrow) and0.0003% (human umbilical cord blood) [11,36].

Because a cell passage can significantly influence MSCmarker expression, we assessed the presence of the CD105surface marker over 4 cell passages, because its expressionwas shown to be limiting. We observed that CD105 expres-sion reached its maximum (10%) after the first and secondpassages, but after the third and fourth passages, the ex-pression fell down to 2% (Fig. 2A).

The transcription factors POU class 5 homeobox 1-/octamer-binding transcription factor 4 (POU5F1/OCT3/4)and homeoprotein Nanog (NANOG) play a critical role inpluripotency maintenance; therefore, we monitored their

4 LEYVA-LEYVA ET AL.

expression levels through the first to fourth cell passages byreverse transcriptase–polymerase chain reaction (RT-PCR)assays and western blot analysis. Our results demonstratedthat NANOG mRNA expression remained constant; how-ever, OCT3/4 expression displayed a decreasing tendencyafter the first cell passage (Fig. 2B). To establish if the de-tected mRNA expression levels of the OCT3/4 and NANOGgenes correlated with their protein levels, we performedwestern blot analysis of total protein extracts. As shown in

Fig. 2C, both proteins exhibited decreased expression by thethird cell passage. OCT3/4 continued to be expressed, but, atlower levels, and NANOG was no longer detectable after thefifth passage (Fig. 2C).

Therefore, we decided to perform cell-sorter experimentson cell cultures between the second and third passages. It isimportant to mention that before sorting, cell viability wasanalyzed by measuring the incorporation of propidiumiodide and annexin V into the cell membrane, and cultures

FIG. 1. Morphology of iso-lated cells from the humanamniotic membrane. (A) Cul-ture of amniotic membrane-derived stem cells at 24 hpostisolation. (B) Cells cul-tured with the Dulbecco’smodified Eagle medium(DMEM) after 5–7 days. (C)The cell culture reached con-fluency after 12–14 days, andfibroblast-like morphology isshown. (A–C; scale bar = 50mm). (D–G) Fluorescence-activated cell sorting analysis.(D) Dot-plots analysis on alinear scale of the adherent cellpopulation. (E) Analysis on alogarithmic scale. The arrowsindicate 2 main populations.1Small with low granularity(diameter of 9.5 – 1.1 mm);2Large with high granularity(diameter of 15.0 – 1.1 mm). (F–G) Dot-plot of the 1small cellpopulation that coexpressesthe CD73, CD44, and CD105markers. (H–I) Coexpressionof CD44, CD73, and CD105 inthe 2large cell population,which accounts for 6.3% of thecells. SSC, side-scattered; FSC,forward-scattered.

CHARACTERIZATION OF HUMAN AM-MSC SUBPOPULATIONS 5

with 91.9% cell viability were used (Fig. 2D). Cell subpopu-lations of the initial adherent cell culture were sorted intothe CD44 + /CD73 + /CD105 + and CD44 + /CD73 + /CD105 -

phenotypes, which are referred to as CD105 + and CD105 -

cell subpopulations, respectively (Fig. 2F). CD105 + andCD105 - cells were plated at the same cell density and pro-duced homogeneous cell monolayers that were a character-istic of MSCs.

Surface immunophenotype of CD105 +

and CD105 - cell subpopulations

We evaluated the expression of MSC and HSC surfacemarkers in the selected CD105 + and CD105- cell subpopula-tions by flow cytometry analysis. Our data revealed that large

numbers of cells coexpressed CD73/CD44: 80.7% in CD105 +

cultures and 84.5% in CD105 - cultures. These percentagesindicated the purity of the obtained cell subpopulations.

Flow cytometry analysis established that the CD105 + andCD105 - subpopulations were both positive for CD29 (25%and 18%, respectively), while the surface markers CD34,CD45, and CD14 showed no expression in these populations.The MSC and HSC profiles that were observed in bothsubpopulations were in agreement with an MSC [1–4].

Intriguingly, the CD90 surface marker, which is a typicalmesenchymal marker, was not present in the CD105 + andCD105 - cell subpopulations (Table 2).

The CD105 + subpopulation contained a higher percentageof cells that were positive for CD49a when compared to theCD105 - cells (57% vs. 38%). Similarly, the CD49d marker

FIG. 2. Selection and sort-ing of the CD105 + andCD105 - cell subpopulations.(A) Histogram showing theCD105-expressing cell sub-population through cellpassages (P = passage). (B)Semiquantitative reversetranscriptase–polymerase chainreaction (RT-PCR) of OCT3/4and NANOG gene expressionthat was normalized byTUBA1A through cell pas-sages. (C) Western blot anal-ysis of OCT3/4 and NANOGprotein expression that wasnormalized by ACTINthrough the cell passages. (D)Dot-plot of the initial cellpopulation showing cell via-bility (91.9%). (E) Dot-plot ofbasal cell population. Thearrow indicates the CD44 + /CD73 + -coexpressing cellsubpopulation. (F) Columnsshowing sorted subpopula-tions: 15% of CD44 + /CD73 + /CD105 + (right side)and 85% of CD44 + /CD73 + /CD105 - (left side). *P < 0.05 atindicated passages.

6 LEYVA-LEYVA ET AL.

was mainly expressed by the CD105 + subpopulation (33%vs. 16%), and the heterodimer a9b1 was expressed in theCD105 + subpopulation (5.6%). Unexpectedly, this hetero-dimer was expressed in a high percentage of the CD105–

subpopulation (16.6%). Additionally, outstanding figureswere obtained for 2 critical MHC molecules. We found that61.65% of the CD105 - cell subpopulation was completelynegative for HLA-ABC and HLA-DR, which suggested verylow immunogenicity of these cells (Table 2).

Expression of the transcription factors OCT3/4,NANOG, PAX6, and SOX in CD105 + and CD105 -

cell subpopulations

To better characterize the selected CD105 + and CD105 -

cell subpopulations, we analyzed the expression of severaltranscription factors by RT-PCR and immunofluorescenceassays. We performed semiquantitative RT-PCR to quantifythe expression levels of the POU class 5 homeobox 1-/octamer-binding transcription factor 4 (POU5F1/OCT3/4),homeoprotein Nanog (NANOG), SRY (sex-determining re-gion Y)-box 2 (SOX2), paired box 6 (PAX6), and forkheadbox D3 (FOXD3) genes. Our analysis showed that the coretranscription factors, which maintain the undifferentiatedstate of stem cells (OCT3/4, NANOG, and SOX), were ex-pressed in the population before sorting (AM-hMSCs) and inthe CD105 + and CD105 - cell subpopulations. Furthermore,PAX6 expression was evident in both cell subpopulationsand at a higher expression level than that of the AM-hMSCpopulation. In contrast, the expression of FOXD3 was onlyconserved in the starting population, and this expression waslost after cell sorting (Fig. 3A).

To determine if the detected expression of the FOXD3,PAX6, SOX2, NANOG, and POU5F1/OCT3/4 genes correlated

with the presence of the protein, we performed immunoflu-orescence analyses. Our results showed a strong, positivesignal for PAX6, OCT3/4, SOX3, SOX2, and NANOG innearly 95% of the cultures of the CD105 + and CD105 - cellsubpopulations. In contrast, the expression of FOXD3 wasabsent in both subpopulations. Additionally, we analyzed thepresence of the stem cell marker SSEA4, which is present inhighly primitive cells; however, we did not observe thismarker in any of the populations that were analyzed (Fig. 3B).

Assessment of pluripotency in the CD105 +

and CD105 - cell subpopulations

To evaluate the multilineage differentiation potential ofthe selected CD105 + and CD105 - cell subpopulations, weinvestigated the ability of those cells to differentiate intochondrogenic, adipogenic, neurogenic, and osteogenic line-ages. For chondrocyte differentiation, hMSCs and CD105 +

and CD105 - cells were maintained as micromass cultures;the formed pellets were induced in the presence of a mediumcontaining TGF-b for 3 weeks. The cells were differentiatedtoward chondrocytes, as shown by glycosaminoglycan de-position and Alcian blue staining (Fig. 4A). For adipocytedifferentiation, CD105 + , CD105 - , and AM-hMSC cultureswere induced with an adipogenic differentiation mediumcontaining dexamethasone (1 mM), indomethacin (60mM),3-isobutyl-1-metyl-xanthine (500 mM; IBMX), and insulin(5mg/mL; Sigma-Aldrich).

After 3 weeks, all of the analyzed cultures differentiatedinto adipocytes, as demonstrated by Oil-Red-O staining forthe presence of lipid droplets (Fig. 4B).

To evaluate the neurogenic potential, the AM-hMSCs andCD105 + and CD105 - subpopulations were induced with theDMEM that was supplemented with NGF for a 21-day period.During induction, the cell morphology was evaluated by lightmicroscopy, and drastic morphological changes were observedbeginning on the 4th day after induction. These cells weremore elongated, and cells in the confluence zones displayedrefractile soma and neurite-like processes. Moreover, the ex-pression of the neural markers GFAP and NEURO-D wasanalyzed by immunofluorescence, confocal microscopy, andwestern blot assays before and after treatment of the cells withthe neural induction medium. Image analysis of the differen-tiated subpopulation cell cultures showed that the astrocytemarker GFAP signal was present in 20%–50% of the culturedcells, and the neuronal marker NEURO-D signal was presentin 80%–90% of the cultured cells. Nonimmunoreactivity wasdisplayed for both markers in noninduced cultures (Fig. 4C).Consistent with the immunofluorescence studies, western blotanalysis confirmed Neuro-D and GFAP expression in the AM-hMSCs and CD105 + and CD105 - subpopulations after in-duction with NGF (Fig. 4D).

To evaluate the osteoblastic potential, we measured theALP activity after a cultivation period of 14 days with anosteogenic medium containing dexamethasone. Culturedsamples were taken over a time course of 14 days post-induction, and the bone ALP activity was assessed by ELISA.The results of our biochemical analysis showed a 2-foldincrease in the ALP activity in both subpopulations. How-ever, in the CD105 + cells, the maximum peak of ALP activitywas detected at day 9, while in the CD105 - subpopulation,the peak was reached on day 5 after induction (Fig. 4F).

Table 2. Surface Marker Expression

by Fluorescence-Activated Cell Sorting

CD105 + CD105 -

MSC markersCD44 97.0 – 4.15 98.0 – 5.33CD73 69.0 – 7.80 76.0 – 11.10CD73 + CD44 + 80.7 – 2.10 84.5 – 7.15CD90 0.17 – 0.005 1.45 – 0.075

HSC markersCD34 0.1 – 0.025 1.8 – 0.01CD45 1.9 – 0.003 1.8 – 0.003CD14 0.8 – 0.005 0.7 – 0.009

Adhesion proteinsIntegrin a9b1 5.6 – 0.22 16.6 – 4.30CD49d 33.0 – 6.41 16.25 – 5.20a

CD49a 57.3 – 4.30 38.0 – 8.10a

CD29 25.0 – 0.06 18.0 – 2.20

HLA systemsHLA-DR 13.5 – 5.20 5.28 – 0.18HLA-ABC 53.9 – 3.3 19.25 – 5.0a

HLA-DR - /HLAABC + 32.2 – 5.20 13.8 – 2.20HLA-DR - /HLA-ABC - 25.1 – 9.12 61.65 – 6.11a

Data represent the average of 3 independent experiments. Valuesare the mean percentage – standard deviation.

aP < 0.05, CD105 + versus CD105 - subpopulation.HSCs, hematopoietic stem cells; MSCs, mesenchymal stem cells.

CHARACTERIZATION OF HUMAN AM-MSC SUBPOPULATIONS 7

Dissimilar osteoblastic differentiation of CD105 +

and CD105 - cell subpopulations

As described above, the osteoblastic differentiation ofCD105 + and CD105 - cell subpopulations was first evaluatedby measuring the enzymatic activity of ALP. We observed adifference in the time that was required for these subpopu-

lations to reach the maximum peak of ALP activity. To assessif the expression of collagenous and noncollagenous keyproteins that are related to mineralization also occurs in atime-dependent manner, we studied the protein expressionof collagen type I-alpha 1 (COL1A1), secreted protein acidicand rich in cysteine (SPARC), bone gamma-carboxy-glutamate protein/osteocalcin (OSC), and osteopontin (OSP)

FIG. 3. Expression of pluripotency-associatedgenes. (A) Semiquantitative RT-PCR ofpluripotency markers of the POU class 5homeobox 1-/octamer-binding transcriptionfactor 4 (POU5F1/OCT3/4), homeoproteinNanog (NANOG), SRY (sex-determining re-gion Y)-box 2 (SOX2), paired box 6 (PAX6,and forkhead box D3 (FOXD3) genes. DNAwas used as a positive control, and ultrapurewater was used as a negative control (NC).TUBA1A expression was used for normali-zation. (B) The hAM-MSCs and CD105 + andCD105 - cell subpopulations were culturedon coverslips and stained by indirect immu-nofluorescence for OCT3/4, NANOG, SOX3,FOXD3, and SSEA4 (green channel). Spatialorganization of F-actin was revealed usingphalloidin–rhodamine in the red channel,and nuclear-DAPI was visualized in the bluechannel. At the bottom of the figure, theisotype IgG1 control reveals no specificsignal. Color images available online atwww.liebertpub.com/scd

8 LEYVA-LEYVA ET AL.

by western blot analysis. Our results showed that all of thestudied osteoblastic proteins were expressed beginning onthe seventh day after induction in both subpopulations.However, the expression of COL1A1 and OSC did not sig-nificantly differ between cell subpopulations. In contrast, theexpression of SPARC after 14 days of induction was up to3-fold higher in the CD105 - subpopulation than that of theCD105 + cell subpopulation. A similar pattern was observedfor osteonectin. Fourteen days after induction, the expressionof osteonectin was up to 6-fold greater in the CD105 - sub-population than in CD105 + cells.

To analyze whether the molecular findings that wereobserved in the late stage of osteoblastic differentiation wereaccompanied by an inefficient mineralization, and becauseosteoblast mineralization depends on the intracellular cal-cium phosphate, we evaluated the intracellular calcium

content in AM-hMSCs and CD105 + and CD105 - subpopu-lations 21 days postinduction. After osteogenic stimulation,all groups showed increased calcium deposition. However,the quantification of bone matrix mineralization was clearlyhigher for the CD105 - than CD105 + subpopulations and,surprisingly, was higher than that of AM-hMSCs (Fig. 5).

Discussion

The current study describes a methodology that is basedon the simultaneous use of 3 stem cell markers to select andsort a homogenous subpopulation of hMSCs that coexpressthe CD73 +/CD44 +/CD105 + (6%–12%) or CD73 +/CD44 +/CD105 - (80%–88%) antigens by FACS. Relevant studies,such as that by Psaltis’ group, attempted to devise a selectionmethod to improve the experimental reproducibility of this

FIG. 4. Assessment of pluripotency in amniotic membrane human-mesenchymal stem cell (AM-hMSC), CD105 + , andCD105 - cell subpopulations. (A) Chondrogenic differentiation was evaluated after 4 weeks of induction. Micromass cultureswere analyzed for proteoglycan content by Alcian blue staining, which was associated with chondrogenesis. Control cellsgrowing in the basal culture medium were negative for Alcian blue staining. (B) Adipogenic differentiation that wasevaluated by Oil-Red-O staining after 3 weeks of adipogenic induction. Control cells were grown in the basal culturemedium, and no staining with Oil Red O was evident. The cells that were treated with an adipogenic induction mediumshowed fat droplets, and an asterisk indicates a red-stained fat droplet. Scale bar = 50 mm. (C) Neurogenic differentiationevidenced by immunofluorescence analysis. Figure shows the presence of GFAP and NEURO-D (green channel), nuclei–DAPI(blue channel), and the spatial organization of F-actin (red channel). (D) Immunoblotting analyses of GFAP and NEURO-Dwith ( + ) and without ( - ) NGF induction. A mouse brain protein extract was used as a positive control, and actin expressionwas used as a loading control. (E) Osteoblastic differentiation. Alkaline phosphatase activity measured by ELISA at 0, 3, 5, 7,9, and 14 days of induction with dexamethasone. Data are shown as the mean – standard deviation (SD) for n = 3; *P < 0.05.NGF, nerve growth factor. Color images available online at www.liebertpub.com/scd

CHARACTERIZATION OF HUMAN AM-MSC SUBPOPULATIONS 9

method by immunoselection that was mediated by the sur-face marker STRO-1 [37]. Likewise, in the study conductedby Majumdar et al., only the anti-CD105 (endoglin) antibodywas used to isolate cells from human bone marrow aspi-rates. After expansion in culture, those cells displayed animmunophenotype that was distinctive to hMSCs, but hadhigh heterogeneity [38]. Although both studies achievedgood reproducibility, the heterogeneity of the culture per-sisted. These results were explained by the fact that bonemarrow, despite being a good source of MSCs, is also asource of multiple cell lineages.

Throughout the analysis of AM-hMSCs, we observed thatthe expression of CD44 and CD73 remained stable in many

passages and in nearly all analyzed cultures. A setback wasthe low and variable level of the expression of the surfacemarker CD105. To overcome this scarce expression, we uti-lized FACS analysis, which determined that the expressionlevel of this marker remained acceptable at the 2nd and 3rdpassages. This observation was consistent with those of otherauthors [39–41]. To define the best sorting period, theexpression of 2 key transcription factors (OCT3/4 andNANOG) that are related to the maintenance of the undif-ferentiated state of MSCs was analyzed. In the initial popu-lation, we found that NANOG expression was lower than thatof OCT3/4, and those levels remained unchanged until the3rd passage. Furthermore, the expression of the transcription

FIG. 5. Osteoblastic proteinexpression and intracellularcalcium content after induc-tion with dexamethasone inthe CD105 + and CD105 - cellsubpopulations. (A, B) Wes-tern blot using antibodiesthat were directed specificallyagainst collagen type I alpha1 (COL1A1), osteocalcin(OSC), secreted protein acidicand rich in cysteine (SPARC),or OSN in the CD105 + andCD105 - subpopulations, re-spectively, after 0, 7, and 14days of induction. Blots werestripped and reprobed withan anti-actin antibody tonormalize protein measure-ments. The molecular mass isshown on the right. (C) Datafrom densitometric analysisof the immunoblots representthe mean – SD of 3 indepen-dent experiments. *P < 0.05,the CD105 - versus theCD105 + subpopulation onthe same day. (D) Tableshowing mineral depositionthat was quantified by Ali-zarin red and the differentia-tion process of bothsubpopulations. Values areexpressed as the mean – SD of3 independent assays.

10 LEYVA-LEYVA ET AL.

factor OCT3/4 decreased between the 2nd and 3rd passages.After taking the expression of CD44, CD73, and CD105 andof the transcription factors NANOG and OCT3/4 into ac-count, it was decided that we would separate the subpopu-lations from the cultures between these passages.

No single surface marker is specific for MSCs, which ex-press a wide range of surface markers. Therefore, general,minimal criteria for MSCs have been proposed [4], but subtledifferences are evident between MSC populations that arederived from different sources. The immunophenotype thatincludes MSC and HSC markers was defined in the CD105 +

and CD105 - cell subpopulations by FACS, and the observedprofile was consistent with an MSC subpopulation [4,6].

The CD90 antigen (also known as Thy-1) is expressed innervous tissue, in various stromal cell lines, and by a raresubpopulation of human fetal bone marrow cells that containmultipotent hematopoietic progenitor activity [42]. Wedemonstrated that the CD90 marker was absent in theCD105 + and CD105 - subpopulations, and other groupshave reported similar data. Campioni et al. focused ondefining functional hMSC subpopulations of hematologicmalignant and normal samples based on their CD90 - antigenexpression. The CD90 - subpopulation was characterized bypeculiar functional and phenotypic characteristics, whichsupported the role of the microenvironment in selecting aparticular hMSC subpopulation when maintaining normaltissue homeostasis or inducing pathologic processes [43].Furthermore, they suggested a potential role for CD90 withthe HLA-G molecule in regulating immune-suppressivefunctions [44]. Maddox et al. described the isolation of a stemcell subpopulation of adipose tissue that highly expressedCD105 and CD73, but expressed a low level of CD90.2. In-terestingly, the CD90.2low cell subpopulation had a betterpotential to differentiate toward an osteogenic lineage invitro [41], which is a crucial feature for clinical applicationsin bone tissue engineering.

No critical differences in surface marker expression werewitnessed between subpopulations CD105 + and CD105 - ,except for their HLA profiles. The outstanding feature ofHLA system analysis was that the CD105 - subpopulationlacked HLA-ABC and HLA-DR (61.65%), which classifiesthem as nonimmunogenically active [17].

Pluripotency is mainly maintained by a network of tran-scription factors [45], and the triad composed of OCT3/4,SOX2 (which acts synergistically and leads to transcription oftarget genes), and NANOG [46–49] is fundamental in thisprocess. Our semiquantitative RT-PCR analysis, which wasbased on previously reported primers [50], revealed highlevels of OCT-3/4 and NANOG in AM-hMSCs, CD105 + ,and CD105 - cells. The presence of this triad of transcriptionfactors in these populations confirms that these cells are in anundifferentiated state [47,48].

FOXD3 was strongly expressed in AM-hMSCs beforesorting, but it was absent in the CD105 + and CD105 - sub-populations. This transcription factor is usually involved inOCT43/4 and NANOG activation in stem cells; therefore,our data suggest that the activation of OCT3/4, NANOG,and SOX2 in these subpopulations relies on an alternativepathway [49].

The presence of PAX-6 in the CD105 + and CD105 - sub-populations implies its putative ability to differentiate into aneuronal lineage. When cultures (CD105 + and CD105 - )

were induced in a neurogenic medium [5,6], the expressionof the neuronal marker NEURO-D and the astrocyte markerGFAP was observed, which suggested an efficient neuronalpotential.

We confirmed the chondrogenic and adipogenic differen-tiation ability of the CD105 + and CD105 - subpopulations,which was in agreement with the data reported by Alvianoet al. and In’t Anker et al. regarding AM-hMSCs [8]. Theosteogenic potential of the cell population was displayed byinduction with dexamethasone, and both subpopulationswere able to initiate differentiation. However, differences inthe time that was required to achieve each of the stages ofosteogenesis were delayed [51–53]. We observed that theCD105 - subpopulation reached of its peak ALP activity asearly as on the 5th day. Meanwhile, the activity peak of theCD105 + cells was delayed until the 9th day. The CD105 -

subpopulation showed strong expression of SPARC andOSP, and it exhibited effective calcium deposition. Thesedata reflect a stable phenotype that has the best mineraliza-tion state.

Finally, the simultaneous use of 3 markers (CD44, CD73,and CD105) for MSC selection allowed for the sorting andestablishment of a homogenous population of AM-hMSCsthat were nonimmunogenic, developed a high osteogenicpotential, and had efficient mineralization. This approachcould be a strategy to study the aspects of osteoblast differ-entiation and in bone tissue engineering.

Acknowledgment

We are grateful to Dr. Manuel Hernandez (Departmentof Cellular Biology, CINVESTAV-IPN, Mexico City) forsupplying anti-actin monoclonal antibody. This work hasbeen partially financed by CONACyT; CONACYT-87537/SALUD-2008.

Author Disclosure Statement

No competing financial interests exist.

References

1. Deng ZL, KA Sharff, N Tang, WX Song, J Luo, X Luo,J Chen, E Bennett, R Reid, et al. (2008). Regulation ofosteogenic differentiation during skeletal development.Front Biosci 13:2001–2021.

2. Friedenstein AJ, KV Petrakova, AI Kurolesova and GPFrolova. (1968). Heterotopic of bone marrow. Analysis ofprecursor cells for osteogenic and hematopoietic tissues.Transplantation 6:230–247.

3. Luu HH, WX Song, X Luo, D Manning, J Luo, ZL Deng, KASharff, AG Montag, RC Haydon and TC He. (2007). Distinctroles of bone morphogenetic proteins in osteogenic differ-entiation of mesenchymal stem cells. J Orthop Res 25:665–677.

4. Dominici M, K Le Blanc, I Mueller, I Slaper-Cortenbach, FMarini, D Krause, R Deans, A Keating, DJ Prockop and EHorwitz. (2006). Minimal criteria for defining multipotentmesenchymal stromal cells. The International Society forCellular Therapy position statement. Cytotherapy 8:315–317.

5. Portmann-Lanz CB, A Schoeberlein, R Portmann, S Mohr, PRollini, R Sager and DV Surbek. (2010). Turning placentainto brain: placental mesenchymal stem cells differentiate

CHARACTERIZATION OF HUMAN AM-MSC SUBPOPULATIONS 11

into neurons and oligodendrocytes. Am J Obstet Gynecol202:294.e1–294.e11.

6. Portmann-Lanz CB, A Schoeberlein, A Huber, R Sager, AMalek, W Holzgreve and DV Surbek. (2006). Placentalmesenchymal stem cells as potential autologous graft forpre- and perinatal neuroregeneration. Am J Obstet Gynecol194:664–673.

7. Campagnoli C, IA Roberts, S Kumar, PR Bennett, I Bellan-tuono and NM Fisk. (2001). Identification of mesenchymalstem/progenitor cells in human first-trimester fetal blood,liver, and bone marrow. Blood 98:2396–2402.

8. in’t Anker PS, WA Noort, SA Scherjon, C Kleijburg-van derKeur, AB Kruisselbrink, RL van Bezooijen, W Beekhuizen, RWillemze, HH Kanhai and WE Fibbe. (2003). Mesenchymalstem cells in human second-trimester bone marrow, liver,lung, and spleen exhibit a similar immunophenotype but aheterogeneous multilineage differentiation potential. Hae-matologica 88:845–852.

9. Zhang L, TP Hong, J Hu, YN Liu, YH Wu and LS Li. (2005).Nestin-positive progenitor cells isolated from human fetalpancreas have phenotypic markers identical to mesenchy-mal stem cells. World J Gastroenterol 11:2906–2911.

10. Covas DT, JL Siufi, AR Silva and MD Orellana. (2003).Isolation and culture of umbilical vein mesenchymal stemcells. Braz J Med Biol Res 36:1179–1183.

11. Lee OK, TK Kuo, WM Chen, KD Lee, SL Hsieh and THChen. (2004). Isolation of multipotent mesenchymal stemcells from umbilical cord blood. Blood 103:1669–1675.

12. Fraser JK, I Wulur, Z Alfonso and MH Hedrick. (2006).Fat tissue: an underappreciated source of stem cells forbiotechnology. Trends Biotechnol 24:150–154.

13. Griffiths MJ, D Bonnet and SM Janes. (2005). Stem cells of thealveolar epithelium. Lancet 366:249–260.

14. Beltrami AP, L Barlucchi, D Torella, M Baker, F Limana, SChimenti, H Kasahara, M Rota, E Musso, et al. (2003). Adultcardiac stem cells are multipotent and support myocardialregeneration. Cell 114:763–776.

15. Pittenger MF, AM Mackay, SC Beck, RK Jaiswal, R Douglas,JD Mosca, MA Moorman, DW Simonetti, S Craig and DRMarshak. (1999). Multilineage potential of adult humanmesenchymal stem cells. Science 284:143–147.

16. Kuhbier JW, B Weyand, C Radtke, PM Vogt, C Kasper and KReimers. (2010). Isolation, characterization, differentiation,and application of adipose-derived stem cells. Adv BiochemEng Biotechnol 123:55–105.

17. Ilancheran S, A Michalska, G Peh, EM Wallace, M Pera andU Manuelpillai. (2007). Stem cells derived from human fetalmembranes display multilineage differentiation potential.Biol Reprod 77:577–588.

18. in’t Anker PS, SA Scherjon, C Kleijburg-van der Keur, GM deGroot-Swings, FH Claas, WE Fibbe and HH Kanhai. (2004).Isolation of mesenchymal stem cells of fetal or maternalorigin from human placenta. Stem Cells 22:1338–1345.

19. Parolini O, F Alviano, GP Bagnara, G Bilic, HJ Buhring, MEvangelista, S Hennerbichler, B Liu, M Magatti, et al. (2008).Concise review: isolation and characterization of cells fromhuman term placenta: outcome of the first internationalWorkshop on Placenta Derived Stem Cells. Stem Cells26:300–311.

20. Miki T, T Lehmann, H Cai, DB Stolz and SC Strom. (2005).Stem cell characteristics of amniotic epithelial cells. StemCells 23:1549–1559.

21. Mihu CM, D Rus Ciuca˘, O Sorita˘u, S Susxman and D Mihu.(2009). Isolation and characterization of mesenchymal stem

cells from the amniotic membrane. Rom J Morphol Embryol50:73–77.

22. Yen BL, HI Huang, CC Chien, HY Jui, BS Ko, M Yao, CTShun, ML Yen, MC Lee and YC Chen. (2005). Isolation ofmultipotent cells from human term placenta. Stem Cells23:3–9.

23. Fukuchi Y, H Nakajima, D Sugiyama, I Hirose, T Kitamuraand K Tsuji. (2004). Human placenta-derived cells havemesenchymal stem/progenitor cell potential. Stem Cells22:649–658.

24. Xu S, A De Becker, B Van Camp, K Vanderkerken and I VanRiet. (2010). An Improved harvest and in vitro expansionprotocol for murine bone marrow-derived mesenchymalstem cells. J Biomed Biotechnol 2010:105940.

25. Roda B, P Reschiglian, A Zattoni, F Alviano, G Lanzoni, RCosta, A Di Carlo, C Marchionni, M Franchina, L Bonsi and GPBagnara. (2009). A tag-less method of sorting stem cells fromclinical specimens and separating mesenchymal from epithe-lial progenitor cells. Cytometry B Clin Cytom 76:285–290.

26. Jarocha D, E Lukasiewicz and M Majka. (2008). Adventageof mesenchymal stem cells (MSC) expansion directly frompurified bone marrow CD105 + and CD271 + cells. FoliaHistochem Cytobiol 46:307–314.

27. Sotiropoulou PA, SA Perez, M Salagianni, CN Baxevanisand M Papamichail. (2006). Cell culture medium composi-tion and translational adult bone marrow-derived stem cellresearch. Stem Cells 24:1409–1410.

28. Sotiropoulou PA, SA Perez, M Salagianni, CN Baxevanisand M Papamichail. (2006). Characterization of the optimalculture conditions for clinical scale production of humanmesenchymal stem cells. Stem Cells 24:462–471.

29. Nadri S, M Soleimani, RH Hosseni, M Massumi, A Atashiand R Izadpanah. (2007). An efficient method for isolation ofmurine bone marrow mesenchymal stem cells. Int J Dev Biol51:723–729.

30. Hori Y, M Fukumoto and Y Kuroda. (2008). Enrichment ofputative pancreatic progenitor cells from mice by sorting forprominin1 (CD133) and platelet-derived growth factor re-ceptor beta. Stem Cells 26:2912–2920.

31. Battula VL, S Treml, PM Bareiss, F Gieseke, H Roelofs, P deZwart, I Muller, B Schewe, T Skutella, et al. (2009). Isolationof functionally distinct mesenchymal stem cell subsets usingantibodies against CD56, CD271, and mesenchymal stemcell antigen-1. Haematologica 94:173–184.

32. Raiser DM and CF Kim. (2009). Commentary: Sca-1 and cellsof the lung: a matter of different sorts. Stem Cells 27:606–611.

33. Tarnok A, H Ulrich and J Bocsi. (2010). Phenotypes of stemcells from diverse origin. Cytometry A 77:6–10.

34. Zhang L and C Chan. (2010). Isolation and enrichment of ratmesenchymal stem cells (MSCs) and separation of single-colony derived MSCs. J Vis Exp 1852.

35. Schugar RC, SM Chirieleison, KE Wescoe, BT Schmidt, YAskew, JJ Nance, JM Evron, B Peault and BM Deasy. (2009).High harvest yield, high expansion, and phenotype stabilityof CD146 mesenchymal stromal cells from whole primitivehuman umbilical cord tissue. J Biomed Biotechnol 2009:789526.

36. Wexler SA, Donaldson C, Denning-Kendall P, Rice C,Bradley B, Hows JM. (2003). Adult bone marrow is a richsource of human mesenchymal ‘stem’ cells but umbilicalcord and mobilized adult blood are not. Br J Haematol121:368–374.

37. Psaltis PJ, S Paton, F See, A Arthur, S Martin, S Itescu, SGWorthley, S Gronthos and AC Zannettino. (2010). Enrich-

12 LEYVA-LEYVA ET AL.

ment for STRO-1 expression enhances the cardiovascularparacrine activity of human bone marrow-derived mesen-chymal cell populations. J Cell Physiol 223:530–540.

38. Majumdar MK, V Banks, DP Peluso and EA Morris. (2000).Isolation, characterization, and chondrogenic potential ofhuman bone marrow-derived multipotential stromal cells. JCell Physiol 185:98–106.

39. Aslan H, Y Zilberman, L Kandel, M Liebergall, RJ Oskouian,D Gazit and Z Gazit. (2006). Osteogenic differentiation ofnoncultured immunoisolated bone marrow-derivedCD105 + cells. Stem Cells 24:1728–1737.

40. Javazon EH, KJ Beggs and AW Flake. (2004). Mesenchymalstem cells: paradoxes of passaging. Exp Hematol 32:414–425.

41. Maddox JR, X Liao, F Li and C Niyibizi. (2009). Effects ofculturing on the stability of the putative murine adiposederived stem cells markers. Open Stem Cell J 1:54–61.

42. Haeryfar SM and DW Hoskin. (2004) Thy-1 more than amouse pan-T cell marker. J Immunol 173:3581–3588.

43. Campioni D, F Lanza, S Moretti, L Ferrari and A Cuneo.2008. Loss of Thy-1 (CD90) antigen expression on mesen-chymal stromal cells from hematologic malignancies isinduced by in vitro angiogenic stimuli and is associated withpeculiar functional and phenotypic characteristics. Cy-totherapy 10:69–82.

44. Campioni D, R Rizzo, M Stignani, L Melchiorri, L Ferrari, SMoretti, A Russo, GP Bagnara, L Bonsi, et al. 2009. A de-creased positivity for CD90 on human mesenchymal stromalcells (MSCs) is associated with a loss of immunosuppressiveactivity by MSCs. Cytometry B Clin Cytom 76:225–230.

45. Nakatake Y, N Fukui, Y Iwamatsu, S Masui, K Takahashi, RYagi, K Yagi, J Miyazaki, R Matoba, MS Ko and H Niwa.(2006). Klf4 cooperates with Oct3/4 and Sox2 to activate theLefty1 core promoter in embryonic stem cells. Mol Cell Biol26:7772–7782.

46. Chambers I, D Colby, M Robertson, J Nichols, S Lee, STweedie and A Smith. (2003). Functional expression cloningof Nanog, a pluripotency sustaining factor in embryonicstem cells. Cell 113:643–655.

47. Loh YH, Q Wu, JL Chew, VB Vega, W Zhang, X Chen, GBourque, J George, B Leong, et al. (2006). The Oct4 andNanog transcription network regulates pluripotency inmouse embryonic stem cells. Nat Genet 38:431–440.

48. Boyer LA, TI Lee, MF Cole, SE Johnstone, SS Levine, JPZucker, MG Guenther, RM Kumar, HL Murray, et al. (2005).Core transcriptional regulatory circuitry in human embry-onic stem cells. Cell 122:947–956.

49. Ying Liu and A Patricia. Labosky (2008). Regulation of EScell self renewal and pluripotency by Foxd3. Stem Cells26:2475–2484.

50. Liedtke S, J Enczmann, S Waclawczyk, P Wernet and GKogler. (2007). Oct4 and its pseudogenes confuse stem cellresearch. Cell Stem Cell 1:364–366; Erratum in 2008, 2:190.

51. Stein GS and JB Lian. (1993). Molecular mechanisms medi-ating proliferation/differentiation interrelationships duringprogressive development of the osteoblast phenotype. En-docr Rev 14:424–442.

52. Arpornmaeklong P, SE Brown, Z Wang and PH Krebsbach.(2009). Phenotypic characterization, osteoblastic differentia-tion, and bone regeneration capacity of human embryonicstem cell-derived mesenchymal stem cells. Stem Cells Dev18:955–968.

53. Jaiswal N, SE Haynesworth, AI Caplan and SP Bruder.(1997). Osteogenic differentiation of purified, culture-expanded human mesenchymal stem cells in vitro. J CellBiochem 64:295–312.

Address correspondence to:Lizeth Fuentes-Mera PhD

Laboratorio de Biologıa Molecular e HistocompatibilidadDireccion de Investigacion Hospital General

‘‘Dr. Manuel Gea Gonzalez’’Calzada de Tlalpan 4800

Secc.XVIDel. Tlalpan

Mexico CP. 14080Mexico

E-mail: lizeth46@hotmail.com

Received for publication June 26, 2012Accepted after revision December 4, 2012

Prepublished on Liebert Instant Online XXXX XX, XXXX

CHARACTERIZATION OF HUMAN AM-MSC SUBPOPULATIONS 13