Copyright 0 1997 by the Genetics Society of America

Constitutive Mutations of the Saccharomyces cereviSiae MAGActivator Genes MAL23, MAL43, MAL63, and ma164

Andrew W. Gibson,*"'* Lori A. Wojciechowicz,t" Sara E. Danzi,* Bin Zhang,* Jeong H. K i m , * 9 3

Zhen Hut and Corinne A. Michels*'t

Departments of "Biology and tBiochemistry, Queens College and the Graduate School of CUNY, Flushing, New York 11367 Manuscript received March 4, 1997

Accepted for publication May 12, 1997

ABSTRACT We report the sequence of several MALactivator genes, including inducible, constitutive, and nonin-

ducible alleles of MAL23, MAL43, MAL63, and ma164. Constitutive alleles of MAL23 and MAL43 vary considerably from inducible alleles in their C-terminal domain, with many of the alterations clustered and common to both alleles. The 27 alterations from residues 238-461 of Ma143-C protein are sufficient for constitutivity, but the minimal number of alterations needed for the constitutive phenotype could not be determined. The sequence of ma164, a nonfunctional homologue of MAL63, revealed that Ma164p is 85% identical to Ma163p. Two mutations that activate ma164 and cause constitutivity are nonsense mutations resulting in truncated proteins of 306 and 282 residues. We conclude that the C-terminal region of the MALactivator, from residues 283-470, contains a maltose-responsive negative regulatory domain, and that extensive mutation or deletion of the entire region causes loss of the negative regulatory function. Additionally, certain sequence elements in the region appear to be necessary for efficient induction of the full-length Ma163 activator protein. These studies highlight the role of ectopic recombi- nation as an important mechanism of mutagenesis of the telomere-associated family of MAL loci.

M ALTOSE fermentation in Saccharomyces requires the presence of one of five unlinked MAL loci:

M A L I , MAL2, MAL3, MAL4 and MAL6 (reviewed in NEEDLEMAN 1991). Each locus encodes three gene products essential for maltose fermentation. Genes 1 and 2 encode maltose permease and maltase, respec- tively; gene 3 encodes the MAL transcriptional activator protein (HONG and MARMuR 1986; KIM and MICHELS 1988; CHENG and MICHELS 1989). At MAL6, the three genes are referred to as MAL61, MAL62, and MAL63 (see Figure 1). Transcription of the structural genes is induced by maltose and repressed by glucose (NEEDLE- MAN et al. 1984; CHARRON et al. 1986; LEVINE et al. 1992; HU et al. 1995). The MALactivator mediates both regu- latory processes but is only one of several factors con- trolling glucose repression of maltose fermentation (Hu et al. 1995).

Constitutive mutations, usually obtained by reversion of a nonfermenting strain to Mal', have been reported at all of the MAL loci, including MAL4 (WINGE and ROBERTS 1950; KAHN and EATON 1971; CHARRON and MICHELS 1987), MAL2 (ZIMMERMAN and EATON 1974),

Corresponding author: Corinne A. Michels, Departments of Biology and Biochemistry, Graduate School, Queens College of CUNY, 65-30 Kissena Blvd., Flushing, NY 11367. E-mail: corinne-michels@qc.edu

'These authors contributed equally to this work. 'Current address: Department of Rheumatology, University of Ala-

bama at Birmingham, 1900 University Blvd., Birmingham, AL 35294. 'Current address: Department of Surgery, Room RW857, Beth Isreal

Hospital, 330 Brookline Ave., Boston, MA 02215.

Genetics 146 1287-1298 (August, 1997)

MAL1 (RODICIO 1986), and MAL6 (TEN BERGE et al. 1973b). DUBIN et al. (1986) demonstrated that one of the dominant constitutive MAL6 mutations mapped outside of the MAL61-MAL62-MAL63 genes in a gene referred to as ma164 (Figure 1). The wild-type ma164 gene is not required for maltose fermentation in a MAL6 strain, and the cloned ma164 gene does not com- plement mutations in MAL63 (DUBIN et al. 1988). Thus, ma164 appears to be a nonfunctional homologue of MAL63 but is capable of being activated by mutation to encode a constitutive MALactivator. Despite extensive efforts by several research groups using a variety of strains carrying one or more of the different MAL loci, no constitutive mutations have been identified in genes unlinked to a MAL locus.

Here we present the sequences of several constitutive alleles of MAL23, MAL43, and ma164, and of constitu- tive revertants of a noninducible ma163 nonsense muta- tion. Our results suggest that the C-terminal portion of the MAL-activator contains a maltose-responsive nega- tive regulatory element that directly or indirectly re- sponds to maltose. Moreover, it appears that ectopic recombination events are important sources of genetic variation among members of this family.

MATERIALS AND METHODS

Yeast strains: The isolation of strain R10 (MATa MAL61 MAL62 mal63::URA3 MAL64-RIO mall1 MAL12 ma113 leu2- 3,112) carrying the MAL64-R10 allele is described in DUBIN et al. (1986). Strain 340-2A (MATa AGTl MALI2 ma113 ura3- 52), or the isogenic strain pair YPH499 (MATa) and YPH500

1288 A. W. Gibson et al.

(MATa) (AGT1 MAL12 mall3A MAW1 MAL32 mal??A ura?- 52 his3-A200 ku2-Al ade2-101 lys2-801 trpl-A6?) were used to determine MAL-activator functional activity (CHARRON and MICHEIS 1988; SIKORSKY and HEITER 1989). These strains carry both structural genes required for maltose fermentation (AGTI and MAL31 encoding maltose permease, and MAL12 and MAL32 encoding maltase), but lack a MALactivator gene ( H A N et al. 1995). No other MAL loci are present in these strains other than those indicated.

Recombinant DNA techniques: Recombinant DNA meth- ods used for this study were carried out as described AUSUBEL et al. (1995). Single- and double-stranded DNA sequencing was performed by the method of SANCER et al. (1977) utilizing a series of oligonucleotide primers positioned along the length of the DNA fragment and providing overlapping se- quence information. Sitedirected in vitro mutagenesis was carried out according to the methods outlined in the Bio-Rad Muta-Gene kit in M13 according to manufacturer’s instruc- tions.

Cloning of the MAL23 constitutive alleles, ma163 mutant alleles, and MAL64-RZO: Strain 101-3A (from our collection) carries the inducible MAL2 allele (CHARRON et al. 1989). Strains MAL2-7c (generously provided by RICHARD B. NEEDLE- MAN, Wayne State Medical School) and SMG8A (generously provided byJAMEs R. MATTOON, University of Colorado, Colo- rad0 Springs) carry the constitutive MAL2-7c and MAL2-8c alleles, respectively, isolated by ZIMMERMAN and EATON (1974). MAL23 was cloned from each of these strains by plas- mid rescue ( C W O N et al. 1989). The integrating plasmid pA42, which carries the Saccharomyces LEU2 gene and the 2.6-kb BamHI/BglII fragment from the upstream untran- scribed region of MAL2, was targeted to integrate at MAL2 by digestion at the unique Hind111 site. The site of integration was confirmed by Southern analysis. The integrated vector sequences, along with the linked MAL23, were recovered from the genome by digestion with Sa&. The BglII/SalI frag- ment containing the MAL23 allele from the rescued clones was subcloned into vector YCp50 and transformed into strain 340-2A to confirm the MAL phenotype.

Plasmid pMJCGACla, shown in Figure 1, was used to clone MAL64-RIO by plasmid rescue as described in DUBIN et al. (1988). Plasmid pMJC6ACla-R, containing the same EcoRI fragment as pMJC6ACla but in the reverse orientation, was integrated upstream of the MAL6? gene in strains carrying the mal63-13, ma163-1 6, mal6?-23, and ma16324 mutant alleles (generously provided by RICHARD NEEDLEMAN) by digestion in the unique Bg&I site. Integration at the desired site was confirmed by Southern analvsis, and the ma163 alleles were recovered on a SalI genomic fragment by standard methods (CHARRON et al. 1989).

Construction of the YCpMAL63AR plasmid Plasmid YCp MAL63AR was developed to facilitate the construction of hy- brid MALactivator genes. The EcoRI site 5’ of MAL63 coding sequences was deleted by in vitro mutagenesis of a SulI frag- ment from plasmid p40Leu (CHARRON et al. 1986) containing the MAL6? gene on a 2.5-kb BglII-SalI fragment from the MAL6 locus (Figure 1). The 52-base-long oligonucleotide used for the mutagenesis was complementary to the MAL63 upstream promoter region flanking the EcoRI site but lacked the 6 bp of the EcoRI restriction site (KIM and MICHELS 1988). Loss of the EcoRI site was confirmed by sequencing and restric- tion analysis. The mutagenized SalI fragment was then cloned into the integrative plasmid YIp5. Following this, the KpnI- BamHI fragment from this YIp5 clone containing the entire yeast insert except for an -200-bp region surrounding the deleted EcoRI site was then replaced by an identical MAL63 gene fragment that had not been subjected to mutagenesis. This was done to eliminate any unintended mutations created

during the in vitro mutagenesis. The functional activity of this mutagenized MAL6? gene (MAL6?AR) was confirmed by comparison to the wild-type allele MAL63 both cloned into the CEN vector YCp50 (see Table 1).

Construction of MAL63/m164 chimeras: The SalI frag- ment containing the MALG?ARgene was cloned into the SalI site ofYCp50 to produce pMAL63AR (construct 2, Figure 4). The 1.1-kb EcoRI fragment containing the 3’ end of MAL63 was deleted and replaced with the homologous fragment from ma164 to form construct 6 (Figure 4). The 3.5-kb ClaI frag- ment containing ma164 was cloned into YCp50 to form con- struct 3 (Figure 4). The EcoRI fragment containing the 3’ end of ma164 was deleted and replaced with the homologous fragment from MALG? to form construct 5.

Construct 9 was made by PCR-based methods. Primer B9 (5’CCCCGTCGACATAAACTACCGCATTA3’), which an- neals to vector sequences next to the ClaI site of Mp5 and contains a SalI site (in bold) at the 5’ end, and primer B10 (5’CTGTTTCGCAATACCCATATCTTTTTAAAAAAATTTT TGATAS’), which consists of 24 bases that anneal to the ma164 promoter from -24 to -1 and 18 bases that anneal to bases +1 to + 18 of the MAL63 open reading frame (OW), were used to amplify the ma164 promoter from the template plas- mid YIpMAL64. Primer B11 is the complement of B10 and was paired with primer B12 (S’CCCCGTCGACZACT TTCCTGGTATAGTGAAS’), which anneals to codons 278- 283 of MALG? but creates a translation stop codon at 284 (underlined) followed by a Sall site (in bold), and used to amplify the MAL63 ORF from codon 1-283 from the tem- plate plasmid pMAL63. The two PCR products were mixed and amplified by PCR using primers B9 and B12 and the product was cloned into the SalI site of YCp50. Construct 4 was made by deleting the EcoRI fragment of construct 9 containing the 3’ end of the gene and replacing it with the EcoRI fragment containing the 3’ end of the wild-type MALG?. All PCR products and mutagenized sequences were con- firmed by sequencing.

Mutagenesis of ma163-284NS: Construct 9 (Figure 4) was mutagenized randomly by growth in the Escherichia coli muta- tor strain XL1-Red (Stratagene) that carrys mutant alleles in mum, mutS, and mutT. Construct 9 plasmid DNA was trans- formed into competent XL1-Red cells obtained from Stra- tagene, the transformed cells were diluted 100-fold, aliquoted into 25 separate samples, and allowed to grow to saturation. Mutagenized plasmid DNA was prepared from each of the 25 separate cultures and separately transformed into strain YPH500 carrying several copies of a MAL61,,,,,,,-LacZ re- porter integrated at LEU2. Transformants were transferred to plates containing SM medium lacking uracil (for plasmid maintanence) and either 3% glycerol plus 2% lactate or 0.5% sucrose that provide uninduced, derepressed conditions for MAL gene expression. Constitutive mutants were selected from among these transformants using an X-Gal plate assay. Not all of the 25 samples of mutagenized plasmid produced constitutive mutants indicating that mutants from different samples were independent. Only a single constitutive mutant from a particular sample was analyzed. Approximately 15,000-20,000 transformants were screened in total.

Construction of MAL63/43-C hybrid genes: The cloned MAL43-C gene was used for these constructions (CHARRON and MICHELS 1987). Plasmid YCpMAL63ARI was used to con- struct MAL6?/43-C hybrid alleles. Since the EcoRI site at co- dons 215/216 and an EcoRI site 3‘ to the end of the ORF remains intact, digestion with EcoRI releases the 3’ half of MALG? containing codons 215-470 allowing this fragment to be replaced by a corresponding mutated EcoRI fragment. Plasmid YCpMAL63ARI was digested with EroRI and allowed

MALActivator Constitutive Alleles 1289

to self ligate to produce plasmid YCpMAL63ARIAG. This was used as a recipient in the following constructions.

To create YCpMAL63/43C(341-361), YCpMAL63/43 C(361-385) and YCpMAL63/43-C(439-466), the EcoRI frag- ment from MAL63 containing the 3’ end of the gene was cloned into M13 and mutagenized by oligonucleotide-di- rected in vitro mutagenesis. Three mutagenic oligonuclee tides, A22 (S’TATATGTGTGGCATTAGTATTCGAAAAAAA ATTCATCCGCATATCTTTCTTATTAAGTACTAG3’), A23 (S’ACCATGTACATCATACAGGTCGATCGGAGTTAAAAGC GTGTCCTGCAACATGTCCTTAGCAATTTCGACTGGTAT 3‘), A24 (5’GTCTTCATCTTTGGAATCATCATITAAGCGC AAAGGTCTAGAAATGGGCAGATCAATTAGGGCACTTTG ACATITCGTTGAAAA3’), were synthesized to replace the MAL63codons 341-361,361-385, and 439-466, respectively, with the corresponding codons from MAL43-C. The mutagen- ized EcoRI fragments were then inserted into YCpMAL63- ARIAG and the insert orientation confirmed by restriction digestion analysis. To create the double mutation, Y C p MAL63/43-C(361-381) (439466), DNA from a clone carrying a sequence-confirmed mutant hybrid, MAL63/43-C(361-385), was used as the template in a second mutagenic reaction as described above.

For reasons that are not apparent, we were unable to con- struct the fusion containing 3’ EcoRI fragment of MAL43-C in vector YCp50. This fusion was constructed in the CEN vector pUN3O (ELLEDGE and DAVIS 1988) containing the same SalI fragment carrying MAL63ARIAC cloned into the SalI site of the multiple cloning sequence.

Construction of A4AL.43-C point mutations: YCpMAL43- C(Y32OW,Y327S) was constructed by site-directed mutagene- sis of the MAL43-C sequence using a mutagenic oligonucleo- tide, A25 (5’TCACTTGATATAGAGCCATGGTCTTACGGA TACATAGACTTTCTCTTTTCTCGGCACT3‘). Codons 320 and 327 of MAL43-C (both of which encode tyrosine) were converted to the corresponding residues of MAL63 (trypto- phan and serine, respectively), and this construct was then used as the template in a second mutagenic reaction to create YCpMAL43(Y320W,Y320S,S404N). In this reaction, oligonu- cleotide A26 (5’GCAlTGGTAGACGTCGTAAATAAGTAT GATCACAATATGJ’) was used to convert codon 404 (encod- ing serine in MAL43-C) to the asparagine residue found in MAL63. To subclone the mutagenized genes from the M13mp18 construct intoYCp50, two oligonucleotide primers, A31 (5’CGGGATCCACCCCGTGCTGCCTGCCACTT3’) and A29 (5’GCGGATCCCACACTCTATCAGTATATCTATC3’), both of which carry BamHI sites, were used to PCR-amplify a 1.484kb fragment containing the entire coding region and upstream (from bp -156) and downstream (to bp +1462) sequences. The PCR product was ligated into the BamHI site

Measurement of maltase activity and maltose fermenta- tion: Yeast media were prepared according to SHERMAN et al. (1986). Stable integrative transformants were grown in YP media plus the indicated carbon source(s). Transformants containing episomal plasmids were grown in synthetic media plus any required amino acids and the indicated carbon source but lacking the selective nutrient. Cells were grown to mid-log phase, and maltase activity was measured as the rate of pnitrophenol release from pnitrophenyl-a-wglucopyrano- side (DUBIN et al. 1986) using cell extracts prepared as de- scribed by DUBIN et al. (1985). Activity was normalized to the protein concentration of the extracts as measured with the BioRad Protein Assay Dye Reagent. Assays were carried out in duplicate using at least two independent transformants, and the variation was <15%. Fermentation was determined in Durham tubes looking for the production of gas after inoc- ulation of the cells into YF’ media + 2% (w/v) maltose.

of YCp50.

RESULTS

Sequence analysis of the MALM, M A L M 2 and MALGRlO genes: The MAL64-C2 constitutive mutant, isolated by TEN BERGE et al. (1973b) as a suppressor of the nonfermenting ma16-13 mutation, maps outside of the MAL6l”AL62”AL6? complex in a linked gene referred to as ma164 (DUBIN et al. 1986). MAL64-C2 encodes a dominant, constitutive activator of the MAL structural genes (contained within the 3.5-kb ClaI frag- ment shown in Figure 1). Another MALdlinked consti- tutive suppressor of a ma16?A null mutation, referred to as R10 (DUBIN et al. 1989), was isolated, and the homologous 3.5-kb ClaI fragment tested for its ability to constitutively activate expression of the MAL structural genes. Plasmids pMAL64 (containing the wild-type ma164 allele), pMAL64C2 (containing the constitutive MAL64-C2 allele) and pMAL64R10 were integrated in single copy at URA? in a strain that lacks a functional MALactivator.

While the wild-type ma164 gene is unable to provide MALactivator function, maltase expression in trans- formants carrying the constitutive alleles is fully consti- tutive (Table 1). In fact, maltase expression in the pMAL64R10 transformants under noninduced condi- tions is twice that under induced conditions, and twice that observed in transformants carrying the inducible MALG? allele (plasmid YCpMAL63) grown in maltose. This is likely due to glucose repression resulting from the potentially high levels of intracellular glucose pro- duced by the elevated rates of maltose transport and hydrolysis in these constitutive strains (Hu et al. 1995).

Disruption of MAL64-C2 at the Hind111 site disrupted gene function, indicating that MAL64-C2is located near this site (DUBIN et al. 1988). Sequence analysis of -2.0 kb of DNA surrounding the Hind111 site from the wild- type ma164 gene revealed a single large ORF of 1410 bp encoding Ma164p (accession number M81158). ma164 is predicted to encode a 470 residue protein that is 85% identical to the Ma163 MALactivator protein (KIM and MICHELS 1988) (Figure 2). Variant residues are scat- tered throughout the sequence of Ma164p, but most are found in clusters. The upstream sequences of the MAL63 and ma164 genes are 58% identical, if mis- matched and unmatched bases are both included in the calculation. Transcription of ma164is maltose induc- ible, and requires a functional MALactivator (DUBIN et al. 1988). A potential MALactivator binding site (LE- VINE et al. 1992) is found upstream of ma164 at position

The phenotypically significant alterations in both constitutive MAL64-C alleles were localized by con- structing hybrid ma164/MAL64-C hybrid genes using the EcoRI site found at codon 215/216 of the ma164 ORF and testing their phenotype in a strain lacking a MAL activator gene. Hybrid constructions containing the 3’ fragment derived from the constitutive alleles caused

-526 to -493.

1290

4- Centromere

A. W. Gibson et al.

Telomere + "activator permease

maltose m a b e

GiaCl r " l m 1 l-mml d " - X b X b

BHBg x0 Bg Sm M 80

R SI BgN C R C R R C H R Xb C BgRPHRHH R P S A R BgPCHp H I I I I I I I I I I

I II I II I I II I I I I I I I l l I I 1 I l l I I I I I I I I II I I I I I I I I l l

P" I pMAL63

pMJcG ACla I t

pBamRlO (*) & FIGURE 1.-The MAL6locus. A restriction endonuclease map of the chromosomal region containing the MAL6locus is shown

(NEEDLEMAN et al. 1984; DUBIN et al. 1988). The approximate location of the ORFs of each gene is shown above the map along with the direction of transcription. The DNA fragments indicated as MAL63 and MAL64 are the yeast inserts used to subclone the MAL63 and MAL64 genes, respectively, into the various vectors used for these experiments. Plasmid pMJC6ACla contains the indicated yeast insert in the vector YIp5ACla that was derived from YIp5 by deletion of the unique ClaI site (DUBIN et al. 1988). Restriction endonuclease sites are abbreviated as follows: A, AvaI; B, BamHI; Bg, BgLlI; C, CZaI; H, HzndIII; Hp, HpaI; M, MluI; N, NcoI; P, PstI; R, EcoRI; S, SalI; Sm, SmaI; Ss, SstI; Xb, XbaI; Xo, XhoI.

a constitutive phenotype while the reverse constructs produced the same noninducible phenotype as ma164 (data not shown), demonstrating that the alterations in both MAL64-C2 and MAL64-RlO map to the 3' end of the gene. Sequencing of the ORE' 3' of the EcoRl site in these constitutive alleles revealed only a single alter- ation in each mutant: MAL64-C2 (a G to A transition at bp +921) creates a translation termination at codon position 307; MAL64-RlO (a G to T transversion at bp +844) creates a termination codon at position 282. Thus, the constitutive phenotype caused by these mu- tant alleles appears to result from the truncation of -35-40% of the C-terminal end of Ma164p.

Sequence analysis of MAL.23 and MAL.43 constitutive alleles: ZIMMEFNAN and EATON (1974) reported the isolation of five MALalinked, dominant constitutive mutations obtained by reverting ma12 nonfermenting mutant strains carrylng mal2-3 or ma12-4 alleles. Two of

these strains, 7C and 8C, were crossed to the maltose nonfermenting strain YPH499; maltose fermentation and the constitutive phenotype segregated together. Southern analysis revealed no major genomic alter- ations of MAL2 in the constitutive mutants. Preliminary studies of the MAL2-7c allele suggested that the alter- ation mapped to MAL23 (CHARRON and MICHELS 1987). The MAL2? gene from wild-type and both consti- tutive mutants was recovered from the genome by plas- mid rescue, transformed into strain 340-2A lacking a MALactivator gene, and maltase expression deter- mined. The results in Table 2 show that both constitu- tive mutations are in MAL2?. Both mutations also cause resistance to glucose repression, and, in contrast to the MAL43-C (see below) and MAL64-RlO alleles, both MAL2? constitutives are induced slightly by maltose.

The sequence of MAL23 (accession number AF002704) is very similar to MAL63 (Figure 2). Minor

TABLE 1

Regulation of maltase gene expression by m u 1 6 4 and the constitutive alleles MAL6442 and MAL64RlO

Maltase activity

MAL gene Maltose Gly/Lac + Plasmid insert fermentation Gly/Lac Gly/Lac + Mal Gly/Lac + Glu Glu + Mal

Vector None 16 38 4 3 pMAL64 ma164 - 19 110 4 3 pMAL64C2 MAL64-C2 ++++ 635 725 55 54

yc~MAL63 MAL63 +++ 30 639 4 3

-

pMAL64R10 MAL64-R10 ++++ 1725 930 94 107

~~ ~

The ClaI fragment containing ma164, MAL64-C2, or MAL64-RlO or the BglII-Sal1 fragment containing MAL63 were cloned into the CEN vector YCp50 and transformed into strain 340-2A2, which lacks a MALactivator gene but contains MAL structural genes encoding maltose permease and maltase. Maltase activity was determined in uninduced (3% glycerol, 2% lactate), induced (3% glycerol, 2% lactate, 2% maltose), repressed (3% glycerol, 2% lactate, 2% glucose), and induced/repressed (3% glycerol, 2% lactate, 2% maltose, 2% glucose) conditions.

A4ALActivator Constitutive Alleles 1291

0 0 0 0 0 0 0 W W W W W W W

0 0 0 0 0 0 0 0 0 0 0 0 0 0 m m m m m o m

0 0 0 0 0 0 0 W W W W W W W m m m m m m m

0 0 0 0 0 0 0 N N N N N N N ****e**

0 0 0 0 0 0 0

* * * * * * * r r r r r r r

1292 A. W. Gibson et al.

TABLE 2

Regulation of maltase gene expression by MAL23 constitutive alleles

Maltase activity

Plasmid MAL gene insert Gly/Lac Gly/Lac + Mal Gly/Lac + Glu

Vector None 36 3 11 pMAL23 MAL23 72 1336 17

ph4AL23-K MAL23-8C 838 1867 290

~~ ~ ~~ ~~~~~

pMAL23-7C MAL23-7C 836 1694 330

The BglII-Sal1 fragment containing MAL23 or the MAL23-C mutations was cloned into the CEN vector YCp50 and transformed into strain 340-2A. Maltase activity was determined in uninduced (3% glycerol, 2% lactate), induced (3% glycerol, 2% lactate, 2% maltose), and repressed (3% glycerol, 2% lactate, 2% glucose) conditions.

sequence variability results in 20 altered residues com- pared to Ma163p, and most of these are clustered in two regions, residues 113-119 and residues 417-461 (see Figure 2). The nucleotide sequences of both MAL23-7cand MAL23-8c (accession number AF002703) are identical and vary significantly (-35%) from MAL23 [from bp 966 to 11 34 of the OW, including an in-frame deletion of 6 bp (1048-1053) plus a silent change of a T to a C at bp 1266 of the OW]. This sequence variation results in 18 altered residues and two deleted amino acids between residues 322 and 378 compared to inducible Ma123p.

The sequence of the constitutive MALactivator en- coded by MAL43-C (accession number M81157) reveals 24 amino acid differences between Ma123p and Ma143- Cp, 17 of which occur between residues 320 and 470, and 31 residue differences between Ma163p and Ma143- Cp, 24 of which lie between positions 307 and 470 (Fig- ure 2) (WINGE and ROBERTS 1950; KHAN and EATON 1974; CHARRON and MICHELS 1987). Some of the same alterations can be seen in both the Ma123 and Ma143 constitutive activators, and the alterations in both pro- teins are clustered in the same regions.

Localization of Mal43-Cp amino acid changes causing constitutiviq In an effort to determine which altered residues in Ma143-Cp are responsible for the constitu- tive phenotype, we created a series of hybrid molecules in which one or a few of the residues of Ma163p were altered to the corresponding Ma143-Cp residues, or vice versa. The structure of each hybrid is indicated in Fig- ure 3. Figure 3 also includes a diagram representing the MALactivator and indicating the position of each residue that differs between Ma163p and Ma143-Cp by a vertical line. The clustering of variant residues in the Gterminal region is obvious, and the positions of resi- dues altered in each hybrid is indicated by brackets and arrowheads above the diagram.

The MAL63/MAL43-C hybrid genes were cloned into a CEN plasmid and transformed into a strain lacking an activator gene; transformants were assayed for maltase expression (Figure 3) . Only the hybrid containing the 27 altered residues of Ma143-Cp from 238-461 caused

the constitutive phenotype (line 14), but it exhibited none of the glucose repression resistance of the MAL43- C allele. None of the other hybrid genes carrying one or in a few cases five or 10 of the alterations was constitu- tive (lines 4-7). Alternately, the MAL43-C alleles in which residues were converted to the corresponding Ma163p residues (Y320W, Y327F and S404N) retained their constitutive phenotype (lines 9 and lo), and ex- pression levels were similar to those obtained with the MAL43-C allele. Conservative changes were not in- cluded in this analysis, nor were some of the variant residues that are also found in the inducible Ma123p, and all combinations were not tried. However, the re- sults clearly indicate that no one single alteration is sufficient for constitutivity.

Taken together, the clear conclusions that can be drawn from studies described above regarding the vari- ous MAL23-C, MAL43-C, and MAL64-C constitutive al- leles are as follows. (1) The Gterminal residues of the MAL gene transcription activator protein from residues 283-470 contain a negative regulatory domain. (2) De- letion or extensive sequence alteration of this region produces a constitutive activator, and (3) the N-termi- nal residues to 282 are sufficient for sequence-specific DNA binding and transcription activation.

MAL64/MAL,63 hybrid genes: If the C-terminal resi- dues are not required for the essential functions of the MALactivator, the noninducible phenotype of strains carrying the wild-type ma164 suggests that alterations in this region inhibit induction. To explore the functional significance of the sequence variations between Ma163p and Ma164p, we constructed a series of MAL64/MAL63 hybrid genes (as described in MATERIALS AND METHODS) and tested their phenotype in a strain lacking a MAL- activator gene. The results are shown in Figure 4.

Transformants carrylng MAL63 (construct 2) un- dergo -30-fold induction in response to maltose; trans- formants carrying ma164 (construct 3) are only fourfold induced by maltose to a level that is inadequate for fermentation. As discussed above, ma164 transcription is maltose-induced and dependent on a MALactivator suggesting the possibility that the poor induction seen

MALActivator Constitutive Alleles 1293

Ma143-Cp activator

1 200 4 w 470

Maltase Activity

Uninduced Induced Repressed

1 YCp50 18 36 8

2 YCpMAL63 26 768 7

3 YCpMAL43-C 97 1 87 1 277

4 YCpMAL63/43(344-358) 29 802 a 5 YCpMAL63/43(367-379) 65 909 15

6 YCpMAL63/43(445-461) 78 714 13

7 YCpMAL63/43(367-379,445-461) 77 1395 2

8 YCpMAL63(F238Y) 47 1019 6

9 YCpMAL43-C(Y320W, Y327F) 672 674 258

10 YCpMAL43-C(Y320W, Y327F, S404N) 947 738 375

11 pUN30 21 101 ND

12 pUN30MAL63 35 726 ND

13 pUN30MAL43-C 4390 ND ND

14 pUN3OMAL63/43(238-461) 3688 1087 22

FIGURE 3.-Regulation of maltase expression by MAL63/ML43-C hybrid activator proteins. The hybrid MAL63/MAL43-C genes were constructed as described in MATERIALS AND METHODS, cloned into the CEN vectors YCp50 or pUN30, and transformed into strains 340-2A or YF'H500, respectively. Both host strains lack a MLactivator gene, but do contain MAL structural genes encoding maltose permease and maltase. Maltase was assayed in uninduced (3% glycerol, 2% lactate), induced (3% glycerol, 2% lactate, 2% maltose), and glucose-repressed (3% glycerol, 2% lactate, 2% glucose) growth conditions. The diagram at the top of the figure represents the MALactivator protein with the position of each sequence altered residue (compared to Ma163p) indicated as a vertical line. The brackets above the cartoon indicate the blocks of clustered sequence changes made in some of the hybrid constructions, and the arrowheads point to the one to three residue changes made in other constructs.

in ma164 strains could be a consequence of its depen- dence on autoinduction (DUBIN et al. 1988). This is clearly not the case. Transformants carrying MAL63 ex- pressed from the ma164 promoter (construct 4) are fully maltose-inducible and ferment maltose at the same rate as strains carrying wild-type MAL63, indicating that the level of autoinduced expression of this hybrid activator gene is adequate for full induction of the MAL struc- tural genes. Thus, the difference between the function of Ma163p and Ma164p does not appear to be related to differences in expression pattern.

The hybrid MALactivator gene consisting of the 5' end of ma164 and the 3' end of MAL63 (construct 5) encodes a functional, weakly inducible MALactivator. Transformants carrying this hybrid gene ferment malt- ose slowly (5-7 days), reflecting the finding that the

induced levels of maltase are only -35% those of wild type. Construct 6, which contains the 3' end of ma164 and the 5' end of MAL63, creates a noninducible activa- tor with a phenotype similar to that seen for the wild- type ma164. Thus, alterations in the Gterminal region of Ma164p appear to inhibit induction. This finding is consistent with our sequence analysis the spontaneous ma1613 mutation (accession number AF00303), which revealed 14 altered bp within a region spanning 294 bp [starting at bp 828 of the MAL63 ORF (codon 276)] and resulting in seven changed residues (see Figure 2) (TEN BERGE et al. 1973a). Of these 14 bp changes, 12 are shared with ma164 in this region.

Based on the homology of Ma163p and Ma164p, trun- cation of the Gterminus of Ma163p was expected create a constitutive activator. However, transformants car-

1294

Vector only

1 470

630ro I 63

1

64 170

1 470

1 215 470

1 215 470

63Pro 63 64

1 w

1 282

64aro 64

1 283

A, Mr. Gibson PI 01.

Maltase activity Uninduced

11

26

21

39

20

20

635

1725

26

rying construct 9, lacking the Mal63p Gterminus, fer- ment maltose very poorly (only after 7 or more days), and express low levels of maltase. Moreover, sequence analysis of three noninducible malh3-16, mnl63-23, and mnlh3-24 alleles (TEN RERGE et nl. 1973a; CHANG et nl. 1989) revealed translation stop signals at codons 333, 333, and 320, respectively. Thus, regardless of the high level of sequence homology behveen Ma163p and Ma164p, sequence variations in the N-terminal region of Ma164p clearly result in functional differences that enhance the ability of the truncated Ma164 protein to function in an inducer-independent manner. Efforts were made to localize the residues responsible for the constitutive phenotype of MAL64-RI0 by constructing additional MAl,63/mnl64 hybrids, but the results were inconclusive.

Isolation of MAL63(1-283) constitutive mutations: In a continued effort to identie the functionally signifi- cant sequence variations in the N-terminal region of Ma164p and Ma163p, we selected constitutive mutants in a strain carrying construct 9 (see Figure 4). The plasmid containing the truncated allele was mutagen- ized at random and transformed into a strain con- taining several integrated copies of a MAL6lpromot~r - LnrZreporter gene. Transformants were screened for p- galactosidase expression under uninduced conditions. Eight independent constitutive mutants were isolated from among - 15-20,000 transformants.

Only a single base change was found in each mutant gene. Three isolates contain the identical bp alterations and change threonine 247 to alanine. Alanine is found

Induced

45

685

98

780

260

53

725

930

222

Maltose fermentation

-

+++

-

+++

+

-

++++

++++

+I-

FIGVRE 4.-Regulation of maltase expression by M A I d 6 3 / m n 1 6 4 hybr id transcription activator pro te ins . The hybr id MAL63/mnl64 genes were constructed as described

ODS, cloned into the CEN vector YCp.50, and trans- formed into strain 340-2A. Maltase was assayed in un- induced (3% glycerol, 2% lactate) and induced (3% glycerol, 2% lactate, 2% maltose) growth condi- tions.

in MATERIAIS AND METII-

in this position in Ma164p. Three other isolates contain another identical mutation and change arginine 172 to glutamine. One mutation changes arginine 11 7 to cysteine. Cysteine is found in this position in both Ma164p, Ma123p, and Ma143-Cp. Plasmids carrying each of these mutant alleles were transformed into strain 340-2A, and the levels of maltase expressed under unin- duced and maltose induced conditions were deter- mined (Figure 5). All express maltase constitutively but at varying levels. The same sequence alterations in the context of the full-length Mal63 protein have no effect, and transformants carrying these alleles are fully induc- ible and exhibited no significant increase in the unin- duced levels of maltase expression. Thus, as also sug- gested above by construct 6 in Figure 4 and the m a l 6 1 3 mutant allele, the Gterminal regulatory domain functions in the induction process in the full-length Ma163p activator, the truncated Ma163( 1-283)~ still re- quires this function (while comparably truncated Ma164RlOp does not), and this requirement can be suppressed by certain sequence alterations in the trun- cated Ma163(1-283)p. Moreover, these alterations have no effect on the negative regulatory function of the G terminal domain.

DISCUSSION

Constitutive MAL mutations: Several laboratories have attempted to isolate mutants that constitutively express the MAL genes, both by selecting revertants of nonfermenting mutant strains (M'INGE and ROBERTS

MALActivator Constitutive Alleles 1295

Activator allele

Vector only 1 283

63

ML63(1-283)4

ML63(1-283)-7

MAL63(1-283)-20 I 470

64oro 63 1 MAL634

MAL63-7

ML63-20

Alteration

None

Thr247Ala

Argl72Gln

Argll7Cys

None

Thr247Ala

Argl72Gln

Arg 1 1 7Cys

1950; TEN BERGE et al. 1973b, 1974; KHAN and EATON

1974; ZIMMERMAN and EATON 1974; DUBIN et al. 1986; RODICIO 1986) and by isolating constitutive mutations directly in wild-type strains (NEEDLEMAN and EATON 1974; WANG and NEEDLEMAN 1996). However, only MLlinked constitutive mutations were isolated, and all of these alterations are in MALactivator genes (TEN BERCE et al. 1973b; NEEDLEMAN and EATON 1974; DUBIN et al. 1986, 1988; CHARRON and MICHELS 1987; WANG and NEEDLEMAN 1996). Thus, it seems reasonable to conclude that no MALactivator-specific negative regu- lator analogous to GAL80 is involved in the maltose inducible regulation of the MALactivator. Based on these results alone, we cannot exclude the possibility that there are such factors, but, if they exist, the genes encoding them would have to be either functionally duplicated or essential. Additionally, abundant overpro- duction of the Ma163p MALactivator does not result in constitutive expression of the MAL genes (WOJCIE- cHOWICZ 1993), indicating that any negative regulatory factors are not present in limiting amounts, as is Gal80p, the negative regulator of Gal4p UOHNSTON and HOPPER 1982). The most straightforward analysis of these find- ings is that the MALactivator is auto-regulated, and that negative regulation in the absence of inducer involves either interactions between different regions of the MLactivator protein or with other protein(s) whose regulatory function is not specific to the MAL genes.

In this article we analyzed several of the constitutive mutants reported in the early literature. Each of the five constitutive mutations studied were isolated by re- verting a nonfermenting strain (WINGE and ROBERTS 1950; TEN BERCE et al. 197313, 1974; KHAN and EATON 1974; ZIMMERMAN and EATON 1974; DUBIN et al. 1986). With the possible exception of MAL43-C, which was isolated in a genetically undefined nonfermenting

Maltase activity

Uninduced Induced FIGURE 5.-Regulation

11 39 of maltase expression by constitutive revertants of

284NS allele. Maltose-fer- 21 303 the noninducible ma163-

806 menting revertants of the

875 hybrid rna164,,,,,,,,,ma163-

1084 284NS gene (construct 9

1068 of Figure 4) were isolated as described in MATERIALS

132 ND AND METHODS, and intro- duced into strain 340-2A. Maltase was assayed in un-

24 533 induced (3% glycerol, 2% lactate) and induced (3%

31 507 glycerol, 2% lactate, 2% maltose) growth condi-

38 587 tions.

38 507

strain, the others were obtained from strains carrying a MAL-linked nonfermenting mutation. One cannot be certain that this method of obtaining the constitutive mutations does not bias the types of revertants ob- tained, but it does not seem likely in view of the inability to isolate constitutive mutants de nouo (WANC and NEE- DLEMAN 1996).

The constitutive mutations reported here fall into two classes. The first includes the MAL64-Cand MAL63/ 284NS-Cmutations, which produce truncated MALacti- vator proteins containing as few as 282 residues. The second class includes the two identical MAL23-C alleles and MAL43-C. Both encode full-length MALactivators, but contain multiple sequence alterations, most in the C-terminal residues from 238-470. Several of these al- terations are common to both the Ma143-C and Ma123- C activator proteins, and most of the alterations are clustered in two to three sites within the C-terminal region (Figure 2). Our analysis of hlAL43-C could only limit the alterations required for constitutivity to the 27 Gterminal alterations from 238-461. WANG and NEE- DLEMAN (1996) reported the sequence of two constitu- tive alleles of MAL63 that they propose arose by gene conversion from a cryptic homologous sequence found on either chromosomes 11, 111, or XVI in different strains. The allele with the fewest changes contained eight alterations identical to the eight changes found in Ma143-C from residues 419-461. Of these, the Y419C alteration was shown to be necessary but not sufficient for constitutivity. In light of these results we were quite surprised to find that the inducible Ma123 activator also shares eight of these changes, including the essential Y419C alteration. Sequence variations in Ma123p not present in Ma163p could suppress the constitutive phe- notype of these eight changes in Ma163p, and this possi- bility is under investigation. Nevertheless, while it is

1296 A. W. Gibson et al.

clear from our results and those of WANG and NEE- DLEMAN (1996) that the C-terminal region of the MAL activator functions as a negative regulatory domain, this domain is probably larger and more complex than sug- gested by the results of WANG and NEEDLEMAN (1996). The low rate of mutation to constitutivity and the appar- ent dependence on genetic exchange events (such as reciprocal recombination or gene conversion) supports this conclusion.

Although the Cterminal regulatory domain can be deleted without impairing the transcription activation activity of the N-terminal functional core of the MAL activator, it appears that certain sequence alterations within this region can inhibit induction in the full- length protein. This can be seen from the sequence of the noninducible Ma163-13 and Mal64 proteins (Figure 2) as well as from the noninducible hybrid activator Mal63(1-215)-Mal64(216-470)p (Figure 3). Charged cluster to alanine scanning mutagenesis of residues 250-470 has identified additional residues required for induction (S. DANZI, unpublished results). We suggest that these residues are involved in the induction pro- cess, possibly functioning in inducer binding or as sites of interaction with positive regulatory factors or compo- nents of the transcription machinery.

We isolated and characterized constitutive revertants of a ma163284NS nonsense mutation. This study al- lowed us to conclude that the regulation of Ma163p is not inherently different from Ma164, but that other fac- tors inhibit the otherwise constitututive activity of the truncated form. The functional significance of the R117C, R172Q and T247A alterations in the truncated Ma163/284NS protein is not clear. All lie in the region proposed to be involved in transcription activation (GIBSON 1995). The T247A alteration is also found in Ma164p. None appear to affect regulation of the full- length activator. One possible explanation of the effect of the T247A mutation is that it stabilizes a postulated high rate of turnover rate of the truncated Ma163( 1- 283) protein, to which the Ma164C2 and Ma164R10 proteins may not be subject. This suggestion is sup- ported by our finding that the LexA-Mal63( 1-283) fu- sion protein, which is abundantly expressed from the ADHl promoter, is constitutive, and by a preliminary study showing that ma163284NS is constitutive, rather than noninducible, when expressed in a doa4n strain that is deficient in ubiquitin-dependent proteolysis (PAPA and HOCHSTRASSER 1993; GIBSON 1995; Z. Hu, unpublished results). In this regard, it is interesting to note that residue 247 is located within a potential PEST sequence, approximately residues 247-281 (ROGERS et al. 1986). Whether the R117C and R172Q alterations act similarly to the T247A mutation remains to be deter- mined, these alterations do not appear to play a role in maltose induction or the functioning of the C-terminal negative regulatory domain. Ma164 and homologues: ma164, which is not re-

quired for maltose fermentation, was recognized based on its ability to be activated by mutation to encode a constitutive activator of the MAL genes (DUBIN et al. 1988). Homologues of ma164 have been found at MAL? (MICHELS et al. 1992). Reports of a gene tightly linked to MAL? and required for a-methylglucoside fermenta- tion, referred to as MGL2, suggested the possibility that ma13'4 could be this gene and, by homology, that ma164 could function similarly ( MORTIMER and CONTOPOU- LOU 1991). Transformants of strain 340-2A carrying the constitutive MAL64-R10 gene are able to ferment sev- eral a-glucosides including maltose, turanose, isomal- tose, maltotriose, melezitose and a-methylglucoside while the untransformed parent and transformants car- rying wild-type ma164 are not (data not shown). Thus, the function of Ma164p in a-glucoside fermentation, if any, remains unclear. The DNA-binding and transcrip- tion activation functions appear to be intact, as evi- denced by the constitutive alleles, but either the appro- priate inducer has not been identified or the wild-type Ma164 protein has lost its ability to respond to inducer.

The Mal-activator family of sequences: As described in several previous publications, Gene3 homologues at the other MAL loci and ma164 appear to be members of a large a family of transcription factors that regulate the various structural genes required for fermentation of different a-glucoside sugars (CHARRON et al. 1989; NEEDLEMAN 1991; MICHELS et al. 1992; HAN et al. 1995). Probably members of the MGL polygene family should be included as well, based on the functional overlaps reported between the MAL and MGL genes (HAW- THORNE 1958; NAUMOV and BARISHKOVA 1986; H A N et al. 1995). The MALZ-C and MAL43-C constitutive mu- tations described here and the MAL63C constitutive mutations reported by WANG and NEEDLEMAN (1995) appear to have resulted from gene conversion or recip- rocal exchange events involving homeologous recombi- nation between MAL-activator gene sequences and cryptic MAL-homologous sequences in the genome. Moreover, the ma163-13 spontaneous mutation isolated by TEN BERGE et al. (1973a) could have resulted from this type of exchange event between the MALG? and ma164 genes of MALG.

Homeologous recombination has been reported to occur between regions with as little as 52% homology, and appears to occur in short sequences of identity (MEZARD et al. 1992). A cryptic MALhomologous se- quence (referred to as YPRl96w, GenBank protein ID#786300) is located at the right telomere of chromo- some XVI of strain S288C, and others have been re- ported (CHARRON and MICHELS 1987; NAUMOV et al. 1992; WANG and NEEDLEMAN 1996). The similarity be- tween the protein encoded by sequence YPRl96w (in- cluded in Figure 2) and that of the Ma143-C constitutive activator in the C-terminal region is quite clear, and this sequence has been suggested as a possible donor for the recombination event producing the constitutive

MALActivator Constitutive Alleles 1297

MAL63 mutations (WANG and NEEDLEMAN 1996). In contrast, the sequence of the Ma123 constitutive acti- vators indicates that a related but different cryptic sequence was involved in the recombination event producing these mutations. Remarkably, the sequence of a putative nonfunctional Ma133p (encoded by YBR296w) is identical (22 of 22 alterations, including the two deleted residues) to the sequence of the Ma123- Cp activators within this postulated region of conver- sion (FEUERMANN et al. 1995). Thus, the lMALactivator genes are part of a much larger family of related se- quences that encode transcriptional activators regulat- ing a-glucoside sugar fermentation. Some members of the family are functional and have different inducer specificity; others may be pseudogenes that are either not expressed or are unable to respond to inducer. In either case, all should be considered as part of a se- quence pool available as a resource for genetic variation that can be called upon by means of homeologous re- combination to adapt to environmental changes. It is possible that the location of the MAL genes in a te- lomere-associated position promotes these events.

We thank RICHARD NEEDLEMAN and JAMES MATOON for generously providing strains carrying the MAL2 constitutive and mal63noninduc- ible mutations, and MARKJOHNSTON, MARJORIE BRANDRISS, and CLYDE DENIS for helpful discussions and critical reading of this manuscript. This work was supported by Public Health Service grant GM-28216 to C.A.M. from the National Institute of General Medical Sciences. Portions of this work were carried out in partial fulfillment of the requirements for the Ph.D. degree from the Graduate School of the City University of NewYork (A.W.G., L.A.W., S.D., J.H.K., and Z.H.). Additional support was awarded to L.A.W. and A.W.G. in the form of’ research fellowships from the Graduate School of the City Univer- sity of New York.

LITERATURE CITED

AUSUBEI., F. M., R. BRENT, R. E. KINGSTON, D. D. MOORE, J. G. SEID- MAN et al., 1995 Current Protocols in Molecular Biology. John Wi- ley & Sons, New York.

CHANG, Y. S., R. A. DUBIN, E. PERKINS, D. FORREST, C. A. MICHELS et al., 1988 MAL63 codes for a positive regulator of maltose fermentation in Saccharomyces cerevisiae. Curr. Genet. 1 4 201- 209.

CHARRON, M. J.. and C. A. MICHELS, 1987 The constitutive, glucose- repression-insensitive mutation of the yeast MAL4 locus is an alteration of the MAL43gene. Genetics 116 23-31.

CHARRON, M. J., R. A. DUBIN and C. A. MICHEIS, 1986 Structural and functional analysis of the MALI locus of Saccharomyces cereuis- iae. Mol. Cell. Biol. 6: 3891-3899.

CHARRON, M. J., and C. A. MICHEIS, 1988 The naturally occurring alleles of MALI in Saccharomyces species evolved by various mutagenic processes including chromosomal rearrangement. Genetics 120: 83-93.

C W O N , M . J.,E. READ,S. R. HAuTandC. A. MICHELS, 1989 Molecu- lar evolution of the telomere-associated MAL loci of Saccharomyces cereuzsiae. Mol. Cell. Biol. 6: 3891-3899.

CHENG, Q., and C. A. MICHELS, 1989 The maltose permease en- coded by the MAL61 gene of Saccharomyces cerevisiaeexhibits both sequence and structural homology to other sugar transporters. Genetics 123 477-484.

DUBIN, R. A., R. B. NEEDI,EMAN, D. GOSSETT and C. A. MICHEIS, 1985 Identification of the structural gene encoding maltase within the MAL6 locus of Saccharomyces cereuisiae. J. Bacteriol. 164: 605-610,

DUBIN, R. A,, E. L. PERKINS, R. B. NEEDLEMAN and C. A. MICHELS, 1986 Identification of a second transacting gene controlling

maltose fermentation in Saccharomyces carlsbergensis. Mol. Cell. Biol. 6: 2757-2765.

DUBIN, R. A,, M. J. CHARRON, S. R. HAUT, R. B. NEEDLEMAN and C. A. MICHELS, 1989 Constitutive expression of the maltose fermen- tative enzymes in Saccharomyces carlsbergmsis is dependent upon the mutational activation of a nonessential homolog of MAL63. Mol. Cell. Biol. 8: 1027-1035.

EI.L.EDGE, S. J., and R. DAVIS, 1988 A family of versatile centromeric vectors designed for use in the sectoring-shuffle mutagenesis assay in Saccharomyces cereuisiae. Gene 70: 303-312.

FEUERMANN, M., L. CHARBONNEL, J. DE MONTIGNY, J. C. BLOCH, S. POTIER et al., 1995 Sequence of a 9.8 kb segment of yeast chro- mosome I1 including the three genes of the MAL3 locus and three unidentified open reading frames. Yeast 11: 667-672.

GIBSON, A. W., 1995 A molecular genetic analysis of the functional domains of the MALactivator of Saccharomyces cereuisiae. Ph.D. Thesis, Graduate School of the City University of New York.

HAN, E-K., F. COTTY, C. SOTTAS, H. JIANG and C. A. MICHELS, 1995 Characterization of AGTl encoding a general a-glucoside trans- porter from Saccharomyces. Mol. Microbiol. 17: 1093-1 107.

HAWTHORNE, D. C., 1958 The genetics of a-methylglucoside fer- mentation in Saccharomyces. Heredity 12: 273-283.

HONC, S. H., and J. MARMUR, 1986 Primary structure of the maltase gene at the MAL6 locus of Sarcharomyrrs carlsberpsis. Gene 41:

Hu, Z., J. 0. NEHI.IN, H. RONNE and C. A. MICHEIS, 1995 MIGI- dependent and MZGI-independent glucose regulation of MAL gene expression in Saccharomyces cermisiae. Curr. Genet. 28: 258- 266.

JOHNSTON, S. A,, and J. E. HOPPER, 1982 Isolation of the yeast regu- latory gene GAL4 and analysis of its dosage effects on the galac- tose/melibiose regulon. Proc. Natl. Acad. Sci. USA 79: 6971- 6975.

KAHN, N. A,, and N. R. EATON, 1971 Genetic control of maltase formation in yeast. I. Strains producing high and low basal levels of enzyme. Mol. Gen. Genet. 112: 317-322.

KIM, J., and C. A. MICHEIS, 1988 The MAL63gene of Saccharomyces encodes a cysteine-zinc finger protein. Curr. Genet. 14: 319- 323.

LEVINE, J., L. TANOUYE and C. A. MICHELS, 1992 The UAS,,,. is a bidirectional promoter element required for the expression of both the MAL61 and MAL62 genes of the Saccharomyces MAL6 locus. Curr. Genet. 22: 181-189.

MEW, C., D. POMPON and A. NIC:OIAS, 1992 Recombination be- tween similar but not identical DNA sequences during yeast transformation occurs within short stretches of identity. Cell 70: 659-670.

MICHELS, C.A., E. READ, K. NAT, M. J. CHARRON, 1992 The te- lomere-associated MAL3 locus of Saccharomyces is a tandem array of repeated genes. Yeast 8: 655-665.

MORTIMER, R. K., and R. CONTOPOULOU, 1991 Yeast Genetic Stock Center Catalogue, Smenth Edition. University of California, Berke- ley.

NAUMOV, G. I., and E. V. BASHKIROVA, 1985 Identification of the a- methyglucoside genes in Sacrharomyces cereuisiae. Doklady Akade- mii Nauk SSSR 279: 1496-1499.

NAUMOV, G. I., E. S. NAUMOVA and C. A. MICHELS, 1992 Genetic variation of the repeated MAL loci in natural populations of Saccharomyces cereuisiae and Saccharomyces parudoxm. Genetics 136:

NEEDLEMAN, R. B., 1991 Control of maltase synthesis in yeast. Mol. Microbiol. 9 2079-2084.

NEEDLEMAN, R. B., and N. R. EATON, 1974 Selection ofyeast mutants constitutive for maltase synthesis. Mol. Gen. Genet. 133: 135- 140.

NEEDLEMAN, R. B., D. B. KABACK, R. A. DUBIN, E. L. PERKINS, N. G. ROSENBERG et al., 1984 MAL6 of Saccharomyces: a complex genetic locus containing three genes required for maltose fer- mentation. Proc. Natl. Acad. Sci. USA 81: 2811-2815.

PAPA, F. R., and H. HOCHSTRASSER, 1993 The yeast DOA4 gene en- codes a deubiquitinating enzyme related to a product of the human tre-2 oncogene. Nature 366: 313-319.

RODGERS, S., R. WELLS and M. RECHSTEINER, 1986 Amino acid se- quences common to rapidly degraded proteins: the PEST hy- pothesis. Science 234 364-368.

RonI<:~o, R., 1986 Insertion of non-homologous DNA sequences

75-84.

803-812.

1298 A. W. Gibson et al.

into a regulatory gene cause a constitutive maltase synthesis in yeast. Curr. Genet. 11: 235-241.

SANGER, F., S. NICKLEN and A. R. COULSON, 1977 DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 7 4

SHERMAN, F., G. R. FINK and J. B. HICKS, 1986 Laboratmy Course Manual for Methods in Yeast Genetics. Cold Spring Harbor Labora- tory Press, Cold Spring Harbor, NY.

SIKORSKY, R. S., and P. HIETER, 1989 A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cermisiae. Genetics 122: 19-27.

TEN BERGE,A. M. A,, G. ZOUTEWEI.I.E and R. NEEDLEMAN, 1974 Regu- lation of maltose fermentation in Saccharomyces carlsbergensis Ill. Constitutive mutations at the MAL6locus and suppressors chang- ing a constitutive phenotype into a maltose negative phenotype. Mol. Gen. Genet. 131: 113-121.

TEN BERGE, A. M. A,, G. ZOUTEWELLE and K. W. VAN DE POLL, 1973a Regulation of maltose fermentation in Saccharomyces carlsbergensis. I. The function of the gene MAL4 as recognized by MAL6 mu- tants. Mol. Gen. Genet. 123: 233-246.

5463-5467.

TEN BERGE, A. M. A,, G. ZOUTEWEILE and K. W. VAN DE POLL and H. P. J. BLOEMERS, 1973b Regulation of maltose fermentation in Saccharomyces carlsbergensis. 11. Properties of a constitutive MAUmutant. Mol. Gen. Genet. 125: 139-146.

WANG, J., and R. NEEDLEMAN, 1996 Removal of a Miglp binding site converts a MAL63 constitutive mutant derived by interchro- mosomal gene conversion to glucose insensitivity. Genetics 142 51-63.

WINGE, O., and C. ROBERTS, 1950 The polymeric genes for maltose fermentation in yeast, and their mutability. C. R. Trav. Lab. Carl- sberg Ser. Physiol. 25: 35-81.

W~~CHIECHOWICZ, L. A., 1993 Structural and functional comparison of the Saccharomyces cereuisiaemaltose-inducible transcription acti- vator encoded by MAL63 and its nonfunctioal homologue in- coded by MAL64. Ph.D. Thesis, Graduate School of the City University of New York.

ZIMMERMAN, F. K., and N. R. EATON, 1974 Genetics of induction and catabolite repression of maltase synthesis in Sarcharomyces cereuisiae. Mol. Gen. Genet. 134 261-271.

Communicating editor: M. JOHNSTON