RESEARCH ARTICLE

Early Detection of Avian Oncogenic Viruses from Bloodof Apparently Healthy Chickens

Namita Mitra • Ramneek Verma • Amarjit Singh

Received: 9 April 2012 / Revised: 10 July 2012 / Accepted: 18 August 2012 / Published online: 4 September 2012

� The National Academy of Sciences, India 2012

Abstract Viral neoplasms in commercial poultry are

mainly caused by members of two families with Marek’s

disease virus (MDV) belonging to Herpesviridae and

reticuloendotheliosis virus (REV), avian leukosis virus

subgroups A to E and avian leukosis virus subgroup

J (ALV-J) belonging to Retroviridae. This study was con-

ducted to know the status of neoplasms caused by avian

oncogenic viruses in commercial chickens. 25 blood sam-

ples were collected from a broiler breeder flock that

appeared healthy but chickens from the flock on necropsy

showed visceral tumours. PCR was employed on blood

DNAs of these chickens for detection of avian oncogenic

viruses which eventually detected the presence of multiple

oncogenic virus infection in most birds. MDV specific

primers that could differentiate between pathogenic and

non-pathogenic serotype-1 virus detected MDV in four

blood DNAs. REV could be detected from all the 25 blood

DNAs and endogenous ALV was detected in 21 blood

DNAs signifying the slow transforming nature of the ret-

roviruses that may take months to perpetuate visible

tumours. It was concluded that concurrent presence of

multiple oncogenic viruses in the same bird is more

common than the presence of single virus. Thus, for early

disease control programs, this moderately simple PCR

diagnostic technique can be utilized to identify the birds

undergoing latent infection with avian oncogenic viruses.

Keywords MDV � ALV � REV � PCR

Introduction

Infectious diseases result in direct and indirect losses at

various steps of poultry farming and amongst them neo-

plastic disease caused by viruses is a major economic

problem faced by the poultry industry worldwide. The

oncogenic viruses causing neoplastic infections in chickens

are herpesviruses comprising of Marek’s disease virus

(MDV), retroviruses comprising of reticuloendotheliosis

virus (REV) and avian leukosis virus (ALV) [1].

Marek’s disease is the most common lymphoproliferative

disease of chickens that transforms T-lymphocytes [2],

leading to the formation of tumors along with immunosup-

pression. Natural MDV isolates of variable virulence have

been isolated and avirulent viruses like herpesvirus of turkey

have been adapted as effective vaccines [1]. REV has

empathy for transforming pre-B and pre-T lymphocytes,

leading to bursal and T cell lymphomas in susceptible

chickens and turkeys [3]. Based on the properties of viral

envelope glycoproteins, ALV is classified into six sub-

groups: A, B, C, D, E and J [4, 5] of which ALV-E is an

endogenous virus being expressed in the genome of every

chicken as DNA provirus and is known to be non-patho-

genic or rarely pathogenic [6]. Rest all ALVs are exogenous

that transform B-lymphocytes resulting in B cell lymphoma

(except ALV-J) which originates in the bursa of Fabricius

and metastasizes to other visceral organs [6]. ALV-J has

N. Mitra (&) � R. Verma

School of Animal Biotechnology, Guru Angad Dev Veterinary

and Animal Sciences University,

Ludhiana 141004, Punjab, India

e-mail: mitranamita@gmail.com

R. Verma

e-mail: ramneekv@rediffmail.com

A. Singh

Animal Disease Research Centre, College of Veterinary Science,

Guru Angad Dev Veterinary and Animal Sciences University,

Ludhiana 141004, Punjab, India

e-mail: amarjitsingh@gmx.net

123

Proc. Natl. Acad. Sci., India, Sect. B Biol. Sci. (January–March 2013) 83(1):53–58

DOI 10.1007/s40011-012-0084-3

been found to be associated primarily with myeloid leukosis,

transforming myeloid cells predominantly in bones of meat

type broilers [1]. In addition to their oncogenic property,

these retroviruses are also immunosuppressive and may

contaminate poultry vaccines [7–10].

The laboratory assays for diagnosis are based on virus

isolation, demonstration of specific antibodies and histopa-

thological examination of tumor tissues. The diagnosis based

on virus isolation is laborious and time-consuming because of

difficulty in adopting these viruses to the cell culture system,

and can be intricated by the presence of serum antibodies that

neutralize the virus. Histopathologically, infiltrative patterns

caused by avian oncogenic viruses are very diverse and not

pathognomonic. Moreover, serodiagnosis is not pertinent in

cases of vertically transmitted retroviral infections because in

such cases, it may lead to development of a tolerant state in

which antibodies are not detectable [11]. Lately polymerase

chain reaction (PCR) is being used for the rapid and differential

diagnosis of oncogenic viruses [12, 13]. In India, limited work

has been done pertaining to molecular detection of oncogenic

viruses. Moreover, both herpesviruses and retroviruses could

infect the same bird under field conditions [14] but this fact has

not been explored in Indian poultry flocks. The present study

was envisaged to investigate the presence of avian oncogenic

viruses in blood samples and to establish the occurrence of

multiple avian oncogenic virus infections in chickens.

Material and Methods

Sampling

Blood samples (N = 25) were randomly collected in

EDTA from the wing vein of broiler breeder flocks of

Department of Animal Breeding and Genetics, GAD-

VASU, Ludhiana, that appeared apparently healthy but

dead birds from these flocks on necropsy frequently

showed the presence of tumors. Retroviruses can form

DNA with the help of unique reverse transcriptase enzyme

and can integrate itself into the cellular DNA to form a

provirus. This property of retroviruses to form provirus was

exploited to perform PCR on extracted DNA with the help

of specific primers. DNA isolation from blood samples was

accomplished by conventional phenol/chloroform extrac-

tion method as per Sambrook et al. [15]. Concentration and

purity of DNA was assessed by UV spectrophotometry

using Nanodrop system (Nanodrop 2000C, Thermo Sci-

entific, USA).

Primers for the Detection of Avian Oncogenic Viruses

The primers for MDV (M1/M2) were selected to amplify

MDV-1 BamH1-H 132 bp tandem repeat [16] producing an

amplicon of 434 bp. Oligonucleotide primers for REV

(R1/R2) were selected to amplify proviral LTR [16] with a

product size of 291 bp. ALV subgroups A–E primers (H5/

AD1) were designed to amplify 326 bp sequence flanking

the 30 region of the Pol gene as per Smith et al. [17]. ALV-A

(H5/EnvA) primer set was selected as per Fenton et al. [18],

in which H5 anneals just upstream from the 30 region of the

pol gene and Env A anneals specifically to ALV-A envelope

sequence amplifying a product of size 694 bp. The direct

and reverse primers for ALV subgroup B and D, ALV-C and

ALV-E were used as per Silva et al. [9] to yield a product of

1.1, 1.4 and 1.074 kbp respectively; and for ALV-J env gene

(H5/H7) as per Smith et al. [17] amplifying a 545 bp

sequence. The forward primer for these virus subgroups

binds to the reverse transcriptase gene (except H5 that

anneals just upstream from the 30 region of the pol gene) and

reverse primer binds to unique region in the gp85. The

rationale was based on retrovirus ability of rapid integration

into the host DNA to form provirus. Primers for b-actin,

were used as internal control which amplified a fragment of

401 bp to ensure the presence of chicken genomic DNA

when negative PCR results were observed for oncogenic

virus sequences [18]. For negative control, nuclease–free

water was taken in place of DNA template. The respective

primer sequences are given in Table 1.

PCR Amplification Conditions

Using the above mentioned set of primers, products were

amplified with following amplification conditions:

MDV-1, REV, ALV subgroup B and D, ALV-C and

ALV-E: DNA was amplified in a 25 ll PCR containing

2.5 ll of 109 PCR buffer (–MgCl2), 1.5 mM MgCl2,

200 lM dNTPs, 25 pmol of each primer and 1 U of Taq

polymerase (1.25 U for ALVs). PCR parameters followed

were: one cycle of initial denaturation at 95 �C for 3 min,

31 cycles of denaturation at 95 �C for 1 min, annealing at

55 �C for 1 min (50 �C for REV) and extension at 72 �C

for 1 min (1.5 min for ALVs), followed by a final elon-

gation at 72 �C for 5 min.

ALV subgroup A–E, ALV subgroup A and b-actin:

Amplification was carried out in a final volume of 25 ll

containing 2.5 ll of 109 PCR buffer (–MgCl2), 1.0 mM

MgCl2, 200 lM dNTPs, 25 pmol of each primer and 1 U

of Taq polymerase. PCR parameters followed were: one

cycle of initial denaturation at 94 �C for 4 min; 35 cycles

each of denaturation at 94 �C for 30 s, annealing at 58 �C

(55 �C for ALV subgroup A and b-actin) for 30 s, and

extension at 72 �C for 30 s with 5 s increment in each

cycle; followed by final elongation at 72 �C for 10 min.

ALV subgroup J: 25 ll reaction mixture contained 2.5 ll

of 109 PCR buffer (–MgCl2), 2.0 mM MgCl2, 400 lM

dNTPs, 25 pmol of each primer and 1 U of Taq polymerase.

54 N. Mitra et al.

123

PCR parameters: Initial denaturation for 3 min, 13 cycles

each of initial denaturation at 93 �C for 1 min, annealing at

60 �C for 1 min decreasing by 1 �C in each cycle, and

extension at 72 �C for 1.5 min followed by 30 cycles each of

denaturation at 93 �C for 1 min, annealing at 48 �C for

1 min, and extension at 72 �C for 1.5 min, followed by final

elongation at 72 �C for 10 min.

Electrophoresis was carried out on 1.5 % agarose gel

prepared in 0.59 TBE buffer and containing 0.5 lg/ml

ethidium bromide. Gene Ruler DNATM ladder 100 bp plus

(MBI, Fermentas) was run along with the test samples.

Agarose gels were visualized under Geldoc (AlphaImager

3400 HP), photographed and analysed with the same

software.

Results and Discussion

This study deals primarily with the three most economi-

cally important virus-induced neoplastic diseases of poul-

try, namely MD, the ALVs and REV. Prior to the use of

vaccines, MD constituted a serious economic threat to the

poultry industry causing up to 60 % layer mortality and

10 % broiler condemnations. Because vaccines are not

100 % effective, sporadic losses still occur, but they are no

longer as a serious problem [2]. Economic losses from

ALV-induced diseases are mainly attributed to either tumor

mortality amounting to around 1–2 % of birds, with

occasional losses of up to 20 % or more, or, subclinical

infection, leading to a depressed egg production and quality

[19].

A total of 25 chicken blood samples randomly collected

from broiler breeder flock were analyzed by PCR with eight

primer sets to detect the incidence of various oncogenic

viruses. MDV specific primers employed in this study could

differentiate between pathogenic and non-pathogenic sero-

type-1 MDV in lieu of their ability to amplify BamH1-H

132 bp tandem repeat from the genomic sequences of

pathogenic MDV-1 only [20]. Out of 25 samples, MDV

DNA could be amplified from four samples with a product of

*434 bp size (Fig. 1). These chicken flocks had the history

of vaccination at day one with HVT (herpesvirus of turkey)

strain. Despite their vaccination status, these birds were still

revealing the presence of MDV and this could be attributed

to another incidence of vaccine failure. MDV detection from

the apparently healthy birds indicated towards the presence

of a latent infection. Surprisingly, REV could be detected

from all the 25 blood samples (Fig. 2) suggesting the slow

transforming nature of the retroviruses that may take over

months to produce visible tumors [5]. Aly et al. [21] using

the same primer pair could detect REV in tissue and blood

samples of chickens that did not even seroconvert.

Out of six different primer pairs used for detection of

various ALV subgroups, H5/AD1 primer pair amplified

both endogenous and exogenous ALVs i.e. all subgroups

from A to E; another primer pair amplified viruses of two

subgroups i.e. B and D since their envelopes are similar

and share the same cellular receptor [17]; rest four primers

Table 1 Primer sequences used

for PCR amplification of

following genes

Virus Primer Sequence

MDV-1 M1-F 50 TACTTCCTATATAGATTGAGACGT 30

M2-R 50 GAGATCCTCGTAAGGTGTAATATA 30

REV R1-F 50 CATACTGGAGCCAATGGTT 30

R2-R 50 AATGTTGTACCGAAGTACT 30

ALV subgroups A–E H5-F 50 GGATGAGGTGACTAAGAAAG 30

AD1-R 50 GGGAGGTGGCTGACTGTGT 30

ALV-A H5-F 50 GGATGAGGTGACTAAGAAAG 30

EnvA-R 50 AGAGAAAGAGGGGYGTCTAAGGAGA 30

ALV-B and D BD-F 50 CGAGAGTGGCTCGCGAGATGG 30

BD-R 50 AGCCGGACTATCGTATGGGGTAA 30

ALV-C C-F 50 CGAGAGTGGCTCGCGAGATGG 30

C-R 50 CCCATATACCTCCTTTTCCTCTG 30

ALV-E E-F 50 CGAGAGTGGCTCGCGAGATGG 30

E-R 50 GGCCCCACCCGTAGACACCACTT 30

ALV-J H5-F 50 GGATGAGGTGACTAAGAAAG 30

H7-R 50 CGAACCAAAGGTAACACACG 30

b-actin Baf-F 50 CACAACCCACACGCAGCCCTG 30

Bar-R 50 TCTGGTGGTACCACAATGTACCCT 30

Early Detection of Avian Oncogenic Viruses 55

123

amplified the viruses of remaining subgroups i.e. A, C, E

and J, respectively. The primer pair specific for ALV

subgroup A–E (H5/AD1) gives 292–326 bp products [22].

Using this primer pair ALV could be detected from all 25

blood samples with an amplified product of *326 bp

(Fig. 3) and the results were confirmed with the standard

DNA for ALV subgroup A–E primer.

The 25 blood samples positive for ALV subgroup A–E

were further subjected to PCR with subgroup specific

primers. With subgroup E specific primer pair, a product of

*1,074 bp size was observed in 21 blood samples (Fig. 4).

This amplified product size coordinated with endogenous

ALV isolates SDO5O1 (GeneBank: EF467236.1) and ALV

strain ev-1 (GeneBank: AY013303.1) but was a little

smaller than the product size documented by Silva et al. [9]

i.e. 1,250 bp. This may be attributed to sequence heterol-

ogy between the isolates of different geographical regions.

Four blood samples that were positive by ALV subgroup

A–E primers did not yield any product with either of the

subgroup specific primers on repeated testing. Pham et al.

[23] also observed that three samples positive by ALV

subgroup A–E primers did not yield any product in PCR

using subgroup specific primers. It potentially indicates

towards some variation or mutation in the nucleotide

sequence complementary to the primers used in the present

study and necessitates towards the development of some

newer subgroup specific primers.

~434bp 400bp

M 1 2 3 4 N

Fig. 1 PCR amplified product of MDV from blood samples. Lane M100 bp plus molecular weight marker. Lane N negative control. Lane1–4 test samples

M 1 2 3 4 5

~291 bp

500bp

Fig. 2 PCR amplified product of REV from blood samples. Lane M100 bp plus molecular weight marker. Lane 1–5 Test samples

300 bp ~326 bp

1 2 3 4 5 6 7 M

Fig. 3 PCR amplified product of ALV subgroup A–E from blood

samples. Lane M 100 bp plus molecular weight marker. Lane 1–7 test

samples

1000 bp ~1074 bp

M 1 2 3 4 5 N M

Fig. 4 PCR amplified product of ALV subgroup E from blood

samples. Lane M and N 100 bp plus molecular weight marker and

negative control respectively. Lane 1–5 Test samples

56 N. Mitra et al.

123

From blood, REV?ALV combination could be detected

in 84 % (21/25) and MDV?REV?ALV combination in

16 % (4/25) samples. In the present study, the ALV present

in all the cases was subgroup E virus which is the ubiq-

uitous endogenous leukosis virus possessing very little or

no pathogenicity. However, embryonic infection with

endogenous ALV can lead to more persistent viremia and

neoplasms following infection with exogenous ALVs [24].

Likewise, subgroup E recombinants of endogenous and

exogenous viruses have been reported to be capable of

inducing neoplasm [25].

Till date, no commercial vaccine is available for the

protection of chickens from infection with ALV and REV.

Therefore, eradication of these viruses from the primary

breeding flocks itself seems to be the most effective means

for controlling infection in chickens. Commonly used

method to detect potential shedders in the primary flock is

ELISA for detecting virus from vaginal and cloacal swabs

but the problem associated with the application of ELISA

to swabs is the need to distinguish positive reactions due to

the presence of gs (group specific) antigen derived from

endogenous ALV from the reactions due to the presence of

exogenous ALV infection [26]. With increasing reports of

vaccination failures and emergence of more virulent

pathotypes, MD also poses a severe threat to the poultry

industry [27]. The relatively simple PCR technique as

described in this study could be helpful in the early

detection of oncogenic viruses in the chicken flocks and

can be used to differentiate between endogenous and var-

ious exogenous ALV subgroup infections in order to

eliminate the infected birds at the initial stage when the

bird has not even perpetuated disease.

Conclusion

It was observed that concurrent presence of two or more

oncogenic viruses in the same bird are more common than

the presence of single virus. The presence of REV and

ALV in apparently healthy birds revealed the slow trans-

forming nature of retroviruses which could perpetuate the

disease in near future. Current control programs for ALV

infection in chicken breeder flocks are based on selective

breeding and elimination of dams that test positive for virus

since there are no vaccines available for the control of ALV

commercially. Thus the relatively easier PCR technique

can be utilized to identify the birds not only with ALV

infection but also with REV and MDV infection conse-

quently paving the way for early control of avian onco-

genic virus infections.

Acknowledgments Guidance and support from Dr M.R. Reddy

(Senior Scientist, Avian Health laboratory, Project Directorate on

Poultry, Hyderabad) is greatly appreciated by the authors. He also

provided standard DNA for ALV subgroup A–E primer pair for which

the authors are thankful.

References

1. Davidson I, Silva RF (2008) Creation of diversity in animal virus

world by inter species and intra-species recombinations: lessons

learned from poultry viruses. Virus Genes 36:1–9

2. Schat KA, Nair V (2008) Marek’s disease. In: Saif YM, Fadly

AM, Glisson JR, McDougald LR, Nolan LK, Swayne DE (eds)

Diseases of poultry, 12th edn. Blackwell Publishing Company,

Ames, pp 452–514

3. Fadly AM, Zavala G, Witter RL (2008) Reticuloendotheliosis. In:

Saif YM, Fadly AM, Glisson JR, McDougald LR, Nolan LK,

Swayne DE (eds) Diseases of Poultry, 12th edn. Blackwell

Publishing Company, Ames, pp 568–588

4. Coffin JM (1992) Structure and classification of retroviruses. In:

Levy JA (ed) The Retroviridae. Plenum Press, New York,

pp 19–49

5. Fadly AM, Nair V (2008) Leukosis/Sarcoma group. In: Saif YM,

Fadly AM, Glisson JR, McDougald LR, Nolan LK, Swayne DE

(eds) Diseases of poultry, 12th edn. Blackwell Publishing Com-

pany, Ames, pp 514–568

6. Ewert DL, deBoer GF (1988) Avian lymphoid leukosis: Mech-

anism of lymphomagenesis. In: Perk K (ed) Immunodeficiency

disorders. Academic Press Inc. Boston, pp 37–53

7. Fadly AM, Witter RL (1997) Comparative evaluation of in vitro

and in vivo assays for the detection of reticuloendotheliosis virus

as a contaminant in a live vaccine of poultry. Avian Dis

41:695–701

8. Fadly A, Silva R, Hunt H, Pandiri A, Davis C (2006) Isolation

and characterization of an adventitious avian leukosis virus iso-

lated from commercial Marek’s disease vaccines. Avian Dis

50:380–385

9. Silva RF, Fadly AM, Taylor SP (2007) Development of a poly-

merase chain reaction to differentiate avian leukosis virus (ALV)

subgroups: detection of an ALV contaminant in commercial

Marek’s disease vaccines. Avian Dis 51:663–667

10. Biswas SK, Jana C, Chand K, Rehman W, Mondal B (2011)

Detection of fowl poxvirus integrated with reticuloendotheliosis

virus sequences from an outbreak in backyard chickens in India.

Vet Italy 47:147–153

11. Davidson I (2007) Avian oncogenic viruses: the correlation

between clinical signs and molecular virus identification,

knowledge acquired from the examination of over 1000 flocks.

Isr J Vet Med 62:42–47

12. Davidson I, Perl S, Malkinson M (1998) A 4-year survey of avian

oncogenic viruses in tumor-bearing flocks in Israel- a comparison

of PCR, serology and histology. Avian Pathol 27:90

13. Gopal S, Manoharan P, Kathaperumal K, Chidambaram B, Divya

KC (2012) Differential detection of avian oncogenic viruses in

poultry layer farms and turkeys by use of multiplex PCR. J Clin

Microbiol 50:2668–2673

14. Davidson I, Borenshtain R (2001) In vivo events of retroviral

long terminal repeat integration into Marek’s disease virus in

commercial poultry: detection of chimerical molecules as a

marker. Avian Dis 45:102–121

15. Sambrook J, Fritch EF, Maniatis T (1989) Molecular cloning: a

laboratory manual, 2nd edn. Cold Spring Harbor Laboratory,

Cold Spring Harbor

16. Davidson I, Borenshtain R (1999) Multiple infections of chickens

and turkeys with avian oncogenic viruses: prevalence and

molecular analysis. Acta Virol 43:136–142

Early Detection of Avian Oncogenic Viruses 57

123

17. Smith LM, Brown SR, Howes K, McLeod S, Arshad SS, Barron

G, Venugopal G, McKay JC, Payne LN (1998) Development and

application of polymerase chain reaction (PCR) tests for the

detection of subgroup J avian leukosis virus. Virus Res 54:87–98

18. Fenton SP, Reddy MR, Bagust TJ (2005) Single and concurrent

avian leukosis virus infections with avian leukosis virus-J and

avian leukosis virus-A in Australian meat-type chickens. Avian

Pathol 34:48–54

19. Gavora JS (1987) Influences of avian leukosis virus infection on

production and mortality and the role of genetic selection in the

control of lymphoid leukosis. In: de Boer GF (ed) Avian leukosis.

Martinus Nijhoff, Boston, pp 241–260

20. Becker Y, Asher Y, Tabor E, Davidson I, Malkinson M, Weisman

Y (1992) Polymerase chain reaction for differentiation between

pathogenic and non-pathogenic serotype 1 Marek’s disease

viruses (MDV) and vaccine viruses of MDV-serotype 2 and 3.

J Virol Methods 40:307–322

21. Aly MM, Smith EJ, Fadly AM (1993) Detection of reticuloen-

dotheliosis virus infection using polymerase chain reaction.

Avian Pathol 22:543–554

22. Abdel-Latif MM, Khalafalla AI (2005) Detection by PCR of

multiple subgroups of avian leukosis virus (ALV) in broilers in

Sudan. J Anim Vet Adv 4:407–413

23. Pham TD, Spencer JL, Johnson ES (1999) Detection of avian

leukosis virus in albumen of chicken eggs using reverse tran-

scription polymerase chain reaction. J Virol Methods 78:1–11

24. Crittenden LB, McMahon S, Halpern MS, Fadly AM (1987)

Embryonic infection with the endogenous avian leukosis virus

Rous-associated virus-0 alters responses to exogenous avian

leukosis virus infection. J Virol 61:722–725

25. Crittenden LB, Hayward WS, Hanafusa H, Fadly AM (1980)

Induction of neoplasms by subgroup E recombinants of exoge-

nous and endogenous avian retroviruses (Rous-associated virus

type 60). J Virol 33:915–919

26. Ignjatovic J (1986) Replication-competent endogenous avian

leukosis virus in commercial lines of meat chickens. Avian Dis

30:264–270

27. Payne LN, Venugopal K (2000) Neoplastic diseases: Marek’s

disease, avian leukosis and Reticuloendotheliosis. Rev Sci Tech

Off Int Epiz 19:544–564

58 N. Mitra et al.

123