RESEARCH ARTICLE
Early Detection of Avian Oncogenic Viruses from Bloodof Apparently Healthy Chickens
Namita Mitra • Ramneek Verma • Amarjit Singh
Received: 9 April 2012 / Revised: 10 July 2012 / Accepted: 18 August 2012 / Published online: 4 September 2012
� The National Academy of Sciences, India 2012
Abstract Viral neoplasms in commercial poultry are
mainly caused by members of two families with Marek’s
disease virus (MDV) belonging to Herpesviridae and
reticuloendotheliosis virus (REV), avian leukosis virus
subgroups A to E and avian leukosis virus subgroup
J (ALV-J) belonging to Retroviridae. This study was con-
ducted to know the status of neoplasms caused by avian
oncogenic viruses in commercial chickens. 25 blood sam-
ples were collected from a broiler breeder flock that
appeared healthy but chickens from the flock on necropsy
showed visceral tumours. PCR was employed on blood
DNAs of these chickens for detection of avian oncogenic
viruses which eventually detected the presence of multiple
oncogenic virus infection in most birds. MDV specific
primers that could differentiate between pathogenic and
non-pathogenic serotype-1 virus detected MDV in four
blood DNAs. REV could be detected from all the 25 blood
DNAs and endogenous ALV was detected in 21 blood
DNAs signifying the slow transforming nature of the ret-
roviruses that may take months to perpetuate visible
tumours. It was concluded that concurrent presence of
multiple oncogenic viruses in the same bird is more
common than the presence of single virus. Thus, for early
disease control programs, this moderately simple PCR
diagnostic technique can be utilized to identify the birds
undergoing latent infection with avian oncogenic viruses.
Keywords MDV � ALV � REV � PCR
Introduction
Infectious diseases result in direct and indirect losses at
various steps of poultry farming and amongst them neo-
plastic disease caused by viruses is a major economic
problem faced by the poultry industry worldwide. The
oncogenic viruses causing neoplastic infections in chickens
are herpesviruses comprising of Marek’s disease virus
(MDV), retroviruses comprising of reticuloendotheliosis
virus (REV) and avian leukosis virus (ALV) [1].
Marek’s disease is the most common lymphoproliferative
disease of chickens that transforms T-lymphocytes [2],
leading to the formation of tumors along with immunosup-
pression. Natural MDV isolates of variable virulence have
been isolated and avirulent viruses like herpesvirus of turkey
have been adapted as effective vaccines [1]. REV has
empathy for transforming pre-B and pre-T lymphocytes,
leading to bursal and T cell lymphomas in susceptible
chickens and turkeys [3]. Based on the properties of viral
envelope glycoproteins, ALV is classified into six sub-
groups: A, B, C, D, E and J [4, 5] of which ALV-E is an
endogenous virus being expressed in the genome of every
chicken as DNA provirus and is known to be non-patho-
genic or rarely pathogenic [6]. Rest all ALVs are exogenous
that transform B-lymphocytes resulting in B cell lymphoma
(except ALV-J) which originates in the bursa of Fabricius
and metastasizes to other visceral organs [6]. ALV-J has
N. Mitra (&) � R. Verma
School of Animal Biotechnology, Guru Angad Dev Veterinary
and Animal Sciences University,
Ludhiana 141004, Punjab, India
e-mail: [email protected]
R. Verma
e-mail: [email protected]
A. Singh
Animal Disease Research Centre, College of Veterinary Science,
Guru Angad Dev Veterinary and Animal Sciences University,
Ludhiana 141004, Punjab, India
e-mail: [email protected]
123
Proc. Natl. Acad. Sci., India, Sect. B Biol. Sci. (January–March 2013) 83(1):53–58
DOI 10.1007/s40011-012-0084-3
been found to be associated primarily with myeloid leukosis,
transforming myeloid cells predominantly in bones of meat
type broilers [1]. In addition to their oncogenic property,
these retroviruses are also immunosuppressive and may
contaminate poultry vaccines [7–10].
The laboratory assays for diagnosis are based on virus
isolation, demonstration of specific antibodies and histopa-
thological examination of tumor tissues. The diagnosis based
on virus isolation is laborious and time-consuming because of
difficulty in adopting these viruses to the cell culture system,
and can be intricated by the presence of serum antibodies that
neutralize the virus. Histopathologically, infiltrative patterns
caused by avian oncogenic viruses are very diverse and not
pathognomonic. Moreover, serodiagnosis is not pertinent in
cases of vertically transmitted retroviral infections because in
such cases, it may lead to development of a tolerant state in
which antibodies are not detectable [11]. Lately polymerase
chain reaction (PCR) is being used for the rapid and differential
diagnosis of oncogenic viruses [12, 13]. In India, limited work
has been done pertaining to molecular detection of oncogenic
viruses. Moreover, both herpesviruses and retroviruses could
infect the same bird under field conditions [14] but this fact has
not been explored in Indian poultry flocks. The present study
was envisaged to investigate the presence of avian oncogenic
viruses in blood samples and to establish the occurrence of
multiple avian oncogenic virus infections in chickens.
Material and Methods
Sampling
Blood samples (N = 25) were randomly collected in
EDTA from the wing vein of broiler breeder flocks of
Department of Animal Breeding and Genetics, GAD-
VASU, Ludhiana, that appeared apparently healthy but
dead birds from these flocks on necropsy frequently
showed the presence of tumors. Retroviruses can form
DNA with the help of unique reverse transcriptase enzyme
and can integrate itself into the cellular DNA to form a
provirus. This property of retroviruses to form provirus was
exploited to perform PCR on extracted DNA with the help
of specific primers. DNA isolation from blood samples was
accomplished by conventional phenol/chloroform extrac-
tion method as per Sambrook et al. [15]. Concentration and
purity of DNA was assessed by UV spectrophotometry
using Nanodrop system (Nanodrop 2000C, Thermo Sci-
entific, USA).
Primers for the Detection of Avian Oncogenic Viruses
The primers for MDV (M1/M2) were selected to amplify
MDV-1 BamH1-H 132 bp tandem repeat [16] producing an
amplicon of 434 bp. Oligonucleotide primers for REV
(R1/R2) were selected to amplify proviral LTR [16] with a
product size of 291 bp. ALV subgroups A–E primers (H5/
AD1) were designed to amplify 326 bp sequence flanking
the 30 region of the Pol gene as per Smith et al. [17]. ALV-A
(H5/EnvA) primer set was selected as per Fenton et al. [18],
in which H5 anneals just upstream from the 30 region of the
pol gene and Env A anneals specifically to ALV-A envelope
sequence amplifying a product of size 694 bp. The direct
and reverse primers for ALV subgroup B and D, ALV-C and
ALV-E were used as per Silva et al. [9] to yield a product of
1.1, 1.4 and 1.074 kbp respectively; and for ALV-J env gene
(H5/H7) as per Smith et al. [17] amplifying a 545 bp
sequence. The forward primer for these virus subgroups
binds to the reverse transcriptase gene (except H5 that
anneals just upstream from the 30 region of the pol gene) and
reverse primer binds to unique region in the gp85. The
rationale was based on retrovirus ability of rapid integration
into the host DNA to form provirus. Primers for b-actin,
were used as internal control which amplified a fragment of
401 bp to ensure the presence of chicken genomic DNA
when negative PCR results were observed for oncogenic
virus sequences [18]. For negative control, nuclease–free
water was taken in place of DNA template. The respective
primer sequences are given in Table 1.
PCR Amplification Conditions
Using the above mentioned set of primers, products were
amplified with following amplification conditions:
MDV-1, REV, ALV subgroup B and D, ALV-C and
ALV-E: DNA was amplified in a 25 ll PCR containing
2.5 ll of 109 PCR buffer (–MgCl2), 1.5 mM MgCl2,
200 lM dNTPs, 25 pmol of each primer and 1 U of Taq
polymerase (1.25 U for ALVs). PCR parameters followed
were: one cycle of initial denaturation at 95 �C for 3 min,
31 cycles of denaturation at 95 �C for 1 min, annealing at
55 �C for 1 min (50 �C for REV) and extension at 72 �C
for 1 min (1.5 min for ALVs), followed by a final elon-
gation at 72 �C for 5 min.
ALV subgroup A–E, ALV subgroup A and b-actin:
Amplification was carried out in a final volume of 25 ll
containing 2.5 ll of 109 PCR buffer (–MgCl2), 1.0 mM
MgCl2, 200 lM dNTPs, 25 pmol of each primer and 1 U
of Taq polymerase. PCR parameters followed were: one
cycle of initial denaturation at 94 �C for 4 min; 35 cycles
each of denaturation at 94 �C for 30 s, annealing at 58 �C
(55 �C for ALV subgroup A and b-actin) for 30 s, and
extension at 72 �C for 30 s with 5 s increment in each
cycle; followed by final elongation at 72 �C for 10 min.
ALV subgroup J: 25 ll reaction mixture contained 2.5 ll
of 109 PCR buffer (–MgCl2), 2.0 mM MgCl2, 400 lM
dNTPs, 25 pmol of each primer and 1 U of Taq polymerase.
54 N. Mitra et al.
123
PCR parameters: Initial denaturation for 3 min, 13 cycles
each of initial denaturation at 93 �C for 1 min, annealing at
60 �C for 1 min decreasing by 1 �C in each cycle, and
extension at 72 �C for 1.5 min followed by 30 cycles each of
denaturation at 93 �C for 1 min, annealing at 48 �C for
1 min, and extension at 72 �C for 1.5 min, followed by final
elongation at 72 �C for 10 min.
Electrophoresis was carried out on 1.5 % agarose gel
prepared in 0.59 TBE buffer and containing 0.5 lg/ml
ethidium bromide. Gene Ruler DNATM ladder 100 bp plus
(MBI, Fermentas) was run along with the test samples.
Agarose gels were visualized under Geldoc (AlphaImager
3400 HP), photographed and analysed with the same
software.
Results and Discussion
This study deals primarily with the three most economi-
cally important virus-induced neoplastic diseases of poul-
try, namely MD, the ALVs and REV. Prior to the use of
vaccines, MD constituted a serious economic threat to the
poultry industry causing up to 60 % layer mortality and
10 % broiler condemnations. Because vaccines are not
100 % effective, sporadic losses still occur, but they are no
longer as a serious problem [2]. Economic losses from
ALV-induced diseases are mainly attributed to either tumor
mortality amounting to around 1–2 % of birds, with
occasional losses of up to 20 % or more, or, subclinical
infection, leading to a depressed egg production and quality
[19].
A total of 25 chicken blood samples randomly collected
from broiler breeder flock were analyzed by PCR with eight
primer sets to detect the incidence of various oncogenic
viruses. MDV specific primers employed in this study could
differentiate between pathogenic and non-pathogenic sero-
type-1 MDV in lieu of their ability to amplify BamH1-H
132 bp tandem repeat from the genomic sequences of
pathogenic MDV-1 only [20]. Out of 25 samples, MDV
DNA could be amplified from four samples with a product of
*434 bp size (Fig. 1). These chicken flocks had the history
of vaccination at day one with HVT (herpesvirus of turkey)
strain. Despite their vaccination status, these birds were still
revealing the presence of MDV and this could be attributed
to another incidence of vaccine failure. MDV detection from
the apparently healthy birds indicated towards the presence
of a latent infection. Surprisingly, REV could be detected
from all the 25 blood samples (Fig. 2) suggesting the slow
transforming nature of the retroviruses that may take over
months to produce visible tumors [5]. Aly et al. [21] using
the same primer pair could detect REV in tissue and blood
samples of chickens that did not even seroconvert.
Out of six different primer pairs used for detection of
various ALV subgroups, H5/AD1 primer pair amplified
both endogenous and exogenous ALVs i.e. all subgroups
from A to E; another primer pair amplified viruses of two
subgroups i.e. B and D since their envelopes are similar
and share the same cellular receptor [17]; rest four primers
Table 1 Primer sequences used
for PCR amplification of
following genes
Virus Primer Sequence
MDV-1 M1-F 50 TACTTCCTATATAGATTGAGACGT 30
M2-R 50 GAGATCCTCGTAAGGTGTAATATA 30
REV R1-F 50 CATACTGGAGCCAATGGTT 30
R2-R 50 AATGTTGTACCGAAGTACT 30
ALV subgroups A–E H5-F 50 GGATGAGGTGACTAAGAAAG 30
AD1-R 50 GGGAGGTGGCTGACTGTGT 30
ALV-A H5-F 50 GGATGAGGTGACTAAGAAAG 30
EnvA-R 50 AGAGAAAGAGGGGYGTCTAAGGAGA 30
ALV-B and D BD-F 50 CGAGAGTGGCTCGCGAGATGG 30
BD-R 50 AGCCGGACTATCGTATGGGGTAA 30
ALV-C C-F 50 CGAGAGTGGCTCGCGAGATGG 30
C-R 50 CCCATATACCTCCTTTTCCTCTG 30
ALV-E E-F 50 CGAGAGTGGCTCGCGAGATGG 30
E-R 50 GGCCCCACCCGTAGACACCACTT 30
ALV-J H5-F 50 GGATGAGGTGACTAAGAAAG 30
H7-R 50 CGAACCAAAGGTAACACACG 30
b-actin Baf-F 50 CACAACCCACACGCAGCCCTG 30
Bar-R 50 TCTGGTGGTACCACAATGTACCCT 30
Early Detection of Avian Oncogenic Viruses 55
123
amplified the viruses of remaining subgroups i.e. A, C, E
and J, respectively. The primer pair specific for ALV
subgroup A–E (H5/AD1) gives 292–326 bp products [22].
Using this primer pair ALV could be detected from all 25
blood samples with an amplified product of *326 bp
(Fig. 3) and the results were confirmed with the standard
DNA for ALV subgroup A–E primer.
The 25 blood samples positive for ALV subgroup A–E
were further subjected to PCR with subgroup specific
primers. With subgroup E specific primer pair, a product of
*1,074 bp size was observed in 21 blood samples (Fig. 4).
This amplified product size coordinated with endogenous
ALV isolates SDO5O1 (GeneBank: EF467236.1) and ALV
strain ev-1 (GeneBank: AY013303.1) but was a little
smaller than the product size documented by Silva et al. [9]
i.e. 1,250 bp. This may be attributed to sequence heterol-
ogy between the isolates of different geographical regions.
Four blood samples that were positive by ALV subgroup
A–E primers did not yield any product with either of the
subgroup specific primers on repeated testing. Pham et al.
[23] also observed that three samples positive by ALV
subgroup A–E primers did not yield any product in PCR
using subgroup specific primers. It potentially indicates
towards some variation or mutation in the nucleotide
sequence complementary to the primers used in the present
study and necessitates towards the development of some
newer subgroup specific primers.
~434bp 400bp
M 1 2 3 4 N
Fig. 1 PCR amplified product of MDV from blood samples. Lane M100 bp plus molecular weight marker. Lane N negative control. Lane1–4 test samples
M 1 2 3 4 5
~291 bp
500bp
Fig. 2 PCR amplified product of REV from blood samples. Lane M100 bp plus molecular weight marker. Lane 1–5 Test samples
300 bp ~326 bp
1 2 3 4 5 6 7 M
Fig. 3 PCR amplified product of ALV subgroup A–E from blood
samples. Lane M 100 bp plus molecular weight marker. Lane 1–7 test
samples
1000 bp ~1074 bp
M 1 2 3 4 5 N M
Fig. 4 PCR amplified product of ALV subgroup E from blood
samples. Lane M and N 100 bp plus molecular weight marker and
negative control respectively. Lane 1–5 Test samples
56 N. Mitra et al.
123
From blood, REV?ALV combination could be detected
in 84 % (21/25) and MDV?REV?ALV combination in
16 % (4/25) samples. In the present study, the ALV present
in all the cases was subgroup E virus which is the ubiq-
uitous endogenous leukosis virus possessing very little or
no pathogenicity. However, embryonic infection with
endogenous ALV can lead to more persistent viremia and
neoplasms following infection with exogenous ALVs [24].
Likewise, subgroup E recombinants of endogenous and
exogenous viruses have been reported to be capable of
inducing neoplasm [25].
Till date, no commercial vaccine is available for the
protection of chickens from infection with ALV and REV.
Therefore, eradication of these viruses from the primary
breeding flocks itself seems to be the most effective means
for controlling infection in chickens. Commonly used
method to detect potential shedders in the primary flock is
ELISA for detecting virus from vaginal and cloacal swabs
but the problem associated with the application of ELISA
to swabs is the need to distinguish positive reactions due to
the presence of gs (group specific) antigen derived from
endogenous ALV from the reactions due to the presence of
exogenous ALV infection [26]. With increasing reports of
vaccination failures and emergence of more virulent
pathotypes, MD also poses a severe threat to the poultry
industry [27]. The relatively simple PCR technique as
described in this study could be helpful in the early
detection of oncogenic viruses in the chicken flocks and
can be used to differentiate between endogenous and var-
ious exogenous ALV subgroup infections in order to
eliminate the infected birds at the initial stage when the
bird has not even perpetuated disease.
Conclusion
It was observed that concurrent presence of two or more
oncogenic viruses in the same bird are more common than
the presence of single virus. The presence of REV and
ALV in apparently healthy birds revealed the slow trans-
forming nature of retroviruses which could perpetuate the
disease in near future. Current control programs for ALV
infection in chicken breeder flocks are based on selective
breeding and elimination of dams that test positive for virus
since there are no vaccines available for the control of ALV
commercially. Thus the relatively easier PCR technique
can be utilized to identify the birds not only with ALV
infection but also with REV and MDV infection conse-
quently paving the way for early control of avian onco-
genic virus infections.
Acknowledgments Guidance and support from Dr M.R. Reddy
(Senior Scientist, Avian Health laboratory, Project Directorate on
Poultry, Hyderabad) is greatly appreciated by the authors. He also
provided standard DNA for ALV subgroup A–E primer pair for which
the authors are thankful.
References
1. Davidson I, Silva RF (2008) Creation of diversity in animal virus
world by inter species and intra-species recombinations: lessons
learned from poultry viruses. Virus Genes 36:1–9
2. Schat KA, Nair V (2008) Marek’s disease. In: Saif YM, Fadly
AM, Glisson JR, McDougald LR, Nolan LK, Swayne DE (eds)
Diseases of poultry, 12th edn. Blackwell Publishing Company,
Ames, pp 452–514
3. Fadly AM, Zavala G, Witter RL (2008) Reticuloendotheliosis. In:
Saif YM, Fadly AM, Glisson JR, McDougald LR, Nolan LK,
Swayne DE (eds) Diseases of Poultry, 12th edn. Blackwell
Publishing Company, Ames, pp 568–588
4. Coffin JM (1992) Structure and classification of retroviruses. In:
Levy JA (ed) The Retroviridae. Plenum Press, New York,
pp 19–49
5. Fadly AM, Nair V (2008) Leukosis/Sarcoma group. In: Saif YM,
Fadly AM, Glisson JR, McDougald LR, Nolan LK, Swayne DE
(eds) Diseases of poultry, 12th edn. Blackwell Publishing Com-
pany, Ames, pp 514–568
6. Ewert DL, deBoer GF (1988) Avian lymphoid leukosis: Mech-
anism of lymphomagenesis. In: Perk K (ed) Immunodeficiency
disorders. Academic Press Inc. Boston, pp 37–53
7. Fadly AM, Witter RL (1997) Comparative evaluation of in vitro
and in vivo assays for the detection of reticuloendotheliosis virus
as a contaminant in a live vaccine of poultry. Avian Dis
41:695–701
8. Fadly A, Silva R, Hunt H, Pandiri A, Davis C (2006) Isolation
and characterization of an adventitious avian leukosis virus iso-
lated from commercial Marek’s disease vaccines. Avian Dis
50:380–385
9. Silva RF, Fadly AM, Taylor SP (2007) Development of a poly-
merase chain reaction to differentiate avian leukosis virus (ALV)
subgroups: detection of an ALV contaminant in commercial
Marek’s disease vaccines. Avian Dis 51:663–667
10. Biswas SK, Jana C, Chand K, Rehman W, Mondal B (2011)
Detection of fowl poxvirus integrated with reticuloendotheliosis
virus sequences from an outbreak in backyard chickens in India.
Vet Italy 47:147–153
11. Davidson I (2007) Avian oncogenic viruses: the correlation
between clinical signs and molecular virus identification,
knowledge acquired from the examination of over 1000 flocks.
Isr J Vet Med 62:42–47
12. Davidson I, Perl S, Malkinson M (1998) A 4-year survey of avian
oncogenic viruses in tumor-bearing flocks in Israel- a comparison
of PCR, serology and histology. Avian Pathol 27:90
13. Gopal S, Manoharan P, Kathaperumal K, Chidambaram B, Divya
KC (2012) Differential detection of avian oncogenic viruses in
poultry layer farms and turkeys by use of multiplex PCR. J Clin
Microbiol 50:2668–2673
14. Davidson I, Borenshtain R (2001) In vivo events of retroviral
long terminal repeat integration into Marek’s disease virus in
commercial poultry: detection of chimerical molecules as a
marker. Avian Dis 45:102–121
15. Sambrook J, Fritch EF, Maniatis T (1989) Molecular cloning: a
laboratory manual, 2nd edn. Cold Spring Harbor Laboratory,
Cold Spring Harbor
16. Davidson I, Borenshtain R (1999) Multiple infections of chickens
and turkeys with avian oncogenic viruses: prevalence and
molecular analysis. Acta Virol 43:136–142
Early Detection of Avian Oncogenic Viruses 57
123
17. Smith LM, Brown SR, Howes K, McLeod S, Arshad SS, Barron
G, Venugopal G, McKay JC, Payne LN (1998) Development and
application of polymerase chain reaction (PCR) tests for the
detection of subgroup J avian leukosis virus. Virus Res 54:87–98
18. Fenton SP, Reddy MR, Bagust TJ (2005) Single and concurrent
avian leukosis virus infections with avian leukosis virus-J and
avian leukosis virus-A in Australian meat-type chickens. Avian
Pathol 34:48–54
19. Gavora JS (1987) Influences of avian leukosis virus infection on
production and mortality and the role of genetic selection in the
control of lymphoid leukosis. In: de Boer GF (ed) Avian leukosis.
Martinus Nijhoff, Boston, pp 241–260
20. Becker Y, Asher Y, Tabor E, Davidson I, Malkinson M, Weisman
Y (1992) Polymerase chain reaction for differentiation between
pathogenic and non-pathogenic serotype 1 Marek’s disease
viruses (MDV) and vaccine viruses of MDV-serotype 2 and 3.
J Virol Methods 40:307–322
21. Aly MM, Smith EJ, Fadly AM (1993) Detection of reticuloen-
dotheliosis virus infection using polymerase chain reaction.
Avian Pathol 22:543–554
22. Abdel-Latif MM, Khalafalla AI (2005) Detection by PCR of
multiple subgroups of avian leukosis virus (ALV) in broilers in
Sudan. J Anim Vet Adv 4:407–413
23. Pham TD, Spencer JL, Johnson ES (1999) Detection of avian
leukosis virus in albumen of chicken eggs using reverse tran-
scription polymerase chain reaction. J Virol Methods 78:1–11
24. Crittenden LB, McMahon S, Halpern MS, Fadly AM (1987)
Embryonic infection with the endogenous avian leukosis virus
Rous-associated virus-0 alters responses to exogenous avian
leukosis virus infection. J Virol 61:722–725
25. Crittenden LB, Hayward WS, Hanafusa H, Fadly AM (1980)
Induction of neoplasms by subgroup E recombinants of exoge-
nous and endogenous avian retroviruses (Rous-associated virus
type 60). J Virol 33:915–919
26. Ignjatovic J (1986) Replication-competent endogenous avian
leukosis virus in commercial lines of meat chickens. Avian Dis
30:264–270
27. Payne LN, Venugopal K (2000) Neoplastic diseases: Marek’s
disease, avian leukosis and Reticuloendotheliosis. Rev Sci Tech
Off Int Epiz 19:544–564
58 N. Mitra et al.
123