Date post: | 17-Jul-2015 |
Category: |
Health & Medicine |
Upload: | denise-sheer |
View: | 180 times |
Download: | 0 times |
Gene iden'fica'on in complex neurological disorders
Denise Sheer
Overview
• Types of gene0c aberra0ons that can cause neurological disorders
• Approaches for iden0fying genes associated with neurological disorders:
1. Linkage studies 2. Homozygosity mapping 3. Exome & whole genome sequencing 4. Genome-‐wide associa0on studies 5. Detec0on of structural varia0on 6. Transcriptomics
46 chromosomes 2m DNA 3 x 109 base pairs ~ 22,000 genes
The human genome
Muta'ons of various types cause neurological disease
Muta'on type Muta'on subtype Example(s)
SINGLE NUCLEOTIDE
Point muta0ons, inser0ons, dele0ons
Missense, nonsense, frameshiU, splice site, addi0on or dele0on of amino acid(s)
Many neurological disorders with a gene0c basis
MICROSATELLITE EXPANSION
Triplet repeat (polyglutamine) Hun0ngton disease (HTT)
Triplet repeat (polyanaline) Congenital central hypoven0la0on syndrome (PHOXB2)
Triplet repeat (other) Fragile X mental retarda0on syndrome (CGG repeat expansion in FMR 5’UTR)
Myotonic dystrophy 1 (CTG repeat expansion in DMPK 3’UTR)
Adapted from P.M.Boone et al, Hum Genet 2011
Muta'ons of various types cause neurological disease
Muta'on type Muta'on subtype Example(s)
STRUCTURAL VARIATION
Karyotypic Aneuploidy Down syndrome
Transloca0on X-‐linked mental retarda0on 58
Copy number Genomic dele0on Hereditary neuropathy with liability to pressure palsies
Genomic duplica0on Charcot-‐Marie-‐Tooth disease, type 1A
Whole gene dele0on Autosomal recessive early onset Parkinson disease 6 (PINK1)
Whole gene duplica0on Early onset Alzheimer disease with cerebral amyloid angiopathy (APP)
Intragenic dele0on Duchenne muscular dystrophy (DMD)
Intragenic duplica0on Autosomal dominant dopa-‐responsive dystonia (GCH1)
Non-‐coding X-‐linked spas0c paraplegia type 2 (near PLP1)
Inversion -‐ Duchenne muscular dystrophy and other features inv(X)(p21.2q22.2)
Adapted from P.M.Boone et al, Hum Genet 2011
Disease gene iden'fica'on
1. Linkage studies 2. Homozygosity mapping 3. Exome & whole genome sequencing 4. Genome-‐wide associa0on studies 5. Detec0on of structural varia0on 6. Transcriptomics
Applica'on of current methods for disease gene iden'fica'on
A.B. Singleton, Trends in Genetics 2010 (based on T.A. Manolio, Nature 2009)
High risk, rare alleles APP, PS mut in AD LRKK2 mut in PD
Moderate risk, low frequency alleles
GBA mut in PD
Low risk, common alleles CLU, PICALM, CR1 mut in AD
SNCA, MAPT mut in PD
T.A. Manolio, Nature 2009
Feasibility of iden'fying gene'c variants by strength of gene'c effect (odds ra'o) and risk allele frequency
Phenotypic variation
Wilt Chamberlain, NBA basketball player
7 feet, 1 inch; 275 pounds Willie Shoemaker, horse racing jockey
4 feet, 11 inches; barely 100 pounds
1. Linkage studies
In human beings, 99.9% of the DNA sequence is the same Remaining 0.1% makes a person unique
- Different attributes/characteristics traits - Diseases he/she develops
These variations can be: - Harmless (change in phenotype) - Harmful (diabetes, cancer, heart disease, Huntington's
disease, and hemophilia ) - Latent (variations in coding and regulatory regions, are
not harmful on their own, and the change in each gene only becomes apparent under certain conditions)
Genetic variation underlies phenotypic differences
Single Nucleotide Polymorphism - SNP - Variation in DNA sequence (substitutions, deletions,
insertion, etc) that is present at a frequency greater than 1% in a population.
Mutation - Variation in DNA sequence (substitutions, deletions, etc)
that is present at a frequency lower than 1% in a population.
ATTGGCCTTAACCCCCGATTATCAGGAT ATTGGCCTTAACCTCCGATTATCAGGAT
Allele A Allele B
Linkage studies
• Loci are linked if they are close to each other • Search for co-‐inheritance of the disease with polymorphic
markers • Obtain loca0on of gene • Sequence • Limited applica0on for late-‐onset diseases
12
PARK8/LRRK2 Leucine-‐Rich Repeat Kinase 2 Autosomal Dominant Parkinson’s Disease
C. Paysan-Ruiz et al, Neuron 2004
2. Homozygosity mapping
• Genome-‐wide genotyping using high density SNP microarrays • Autosomal recessive diseases
Frontotemporal Demen'a – like disease
AA
AA
AB
Adapted from J.Bras et al, Nat Rev Neurosc 2012
Homozygosity mapping
C. Paysan-Ruiz et al, Ann Neurol 2009
p.R747W
+/+
Dystonia-‐Parkinsonism • PLA2G6 • Phospholipase A2, group VI
22
PLA2G6 rs7288109
rs16996781
3. Exome & whole genome sequencing
Exon 1 Exon 2 Exon 3
Intron 1 Intron 2
DNA
Transcription start site
Protein
Pre-mRNA
Transcription
Splicing
Translation
mRNA
Intergenic region Promoter Enhancer
Gene
Exome & whole genome sequencing
Adapted from J.Bras et al, Nat Rev Neurosc 2012
Examples of neurological disease genes iden'fied by exome sequencing
Disorder Gene
Au0s0c spectrum disorder Mul0ple, CHD8, KATNAL2
Au0sm UBE3B, CLTCL1,NCKAP5L, ZNF18, ANK2, SCN2A
AD cerebellar ataxia, deafness & narcolepsy DNMT1
AD early onset Alzheimer’s disease SORL1
AD spinocerebellar ataxia PRKCG, TGM6
AR infan0le onset spinocerebellar ataxia CC10orf2
AR pontocerebellar hypoplasia and spinal motor neuron degenera0on
EXOSC3
Brown-‐Vialeho-‐Van Laere syndrome (early onset ALS)
SLC52A3
Charcot-‐Marie-‐Tooth neuropathy Mul0ple heterozygous variants
Essen0al tremor FUS
Adapted from Handel et al, Exp Rev Neuropath 2013 AD, AR: Autosomal dominant, recessive
Clinical Whole-‐Exome Sequencing for the Diagnosis of Mendelian Disorders, Yang et al, NEJM 2013
250 pa0ents: 80% were children with neurologic phenotypes
Clinical Whole-‐Exome Sequencing for the Diagnosis of Mendelian Disorders, Yang et al, NEJM 2013
Clinical Whole-‐Exome Sequencing for the Diagnosis of Mendelian Disorders, Yang et al, NEJM 2013
Clinical Whole-‐Exome Sequencing for the Diagnosis of Mendelian Disorders, Yang et al, NEJM 2013
Clinical Whole-‐Exome Sequencing for the Diagnosis of Mendelian Disorders, Yang et al, NEJM 2013
Neurological disease genes iden'fied by whole genome sequencing
Disorder Gene
Charcot-‐Marie-‐ Tooth neuropathy SH3TC2
Familial Amyotrophic Lateral Sclerosis C9orf72
Infan0le epilep0c encephalopathy and SUDEP SCN8A
Complex motor and sensory axonal neuropathy plus microcephaly VRK1
Adapted from: Handel et al, Exp Rev Neuropath 2013 & C. Gonzaga-Jauregui et al, JAMA Neurol 2013
Whole genome sequencing in a pa'ent with Charcot-‐Marie-‐Tooth neuropathy, Lupski et al, NEJM 2010
Whole genome sequencing in a pa'ent with Charcot-‐Marie-‐Tooth neuropathy, Lupski et al, NEJM 2010
Professor James R Lupski, Baylor College of Medicine
Whole genome sequencing in a pa'ent with Charcot-‐Marie-‐Tooth neuropathy, Lupski et al, NEJM 2010
Charcot-‐Marie-‐Tooth neuropathy • Childhood onset neurodenera0ve disease • Characterised by demyelina0on of motor and sensory nerves • Most common inherited disorder of the peripheral nervous system • Two major phenotypic types according to electrophysiological, clinical, and
nerve-‐biopsy evalua0ons • glial myelinopathy (CMT type 1) • neuronal axonopathy (CMT type 2)
• Each type can be inherited in a dominant, recessive or X-‐linked manner • PMP22 duplica0on accounts for 70% of cases • Many other genes associated with remaining cases
• CMT4C is caused by homozygous or compound heterozygous muta0ons in SH3TC2 gene
Whole genome sequencing in a pa'ent with Charcot-‐Marie-‐Tooth neuropathy, Lupski et al, NEJM 2010
CMT: Charcot-‐Marie-‐Tooth neuropathy MMM: mild mononeuropathy of the median nerve
Whole genome sequencing in a pa'ent with Charcot-‐Marie-‐Tooth neuropathy, Lupski et al, NEJM 2010
Muta0ons in the SH3TC2 gene
R954X, with or without Y169H muta0on, muta0on was associated with Carpal Tunnel Syndrome
Whole genome sequencing in a pa'ent with Charcot-‐Marie-‐Tooth neuropathy, Lupski et al, NEJM 2010
SH3TC2 • SH3 domain and tetratricopep0de repeats-‐containing protein 2 • Expressed in Schwann cells • Localises in plasma membrane and to the perinuclear endocy0c
recycling compartment • Proposed to be an adaptor or docking molecule • Presumed role in myelina'on • Numerous homozygous and compound heterozygous muta0ons
have been iden0fied in CMT4C • Nonsense variant: p.R954X • Missense variant: p.Y169H
SH3TC2: A role in endocy'c recycling
Adapted from R.C.Roberts et al, Hum Mol Genet 2010
Y169H
R954X
Muta0ons iden0fied in Lupski et al, 2010
Muta0ons in CMT4C found to mistarget SH3TC2 away from the recycling endosome
Whole genome sequencing in a pa'ent with Charcot-‐Marie-‐Tooth neuropathy, Lupski et al, NEJM 2010
SH3TC2 • Nonsense variant: p.R954X • Missense variant: p.Y169H • High degree of conserva0on of Y169 in vertebrates
4. Genome-‐wide associa'on studies -‐ GWAS
Direct Associa0on Indirect Associa0on
Disease gene SNP
• Examine a large number of SNPs in large numbers of affected and control cases • Iden0fy SNPs that associate with the disease
Common Disease, Common Variant hypothesis: A common variable (i.e. with a high minor allele frequency that can therefore be seen in most individuals) modulates risk to disease development
Gibson & Muse: A primer of genome science
GWAS workflow
GWAS analysis of Parkinson’s disease MulZple genes at a single locus
GAK: cyclin G associated kinase TMEM175: transmembrane protein 175 DGKQ: diacylglycerol kinase theta 110 kDa
M.A.Nalls et al, Lancet 2011; J.Bras et al, Nat Rev Neurosc 2012
Examples of disease genes iden'fied by GWAS analysis
Disease Gene (locus)
Parkinson’s disease SYT11, ACMSD, STK39, MCC1/LAMP3; GAK, BST1, SNCA, HLADRB5, LRRK2, CCDC62/HIP1R, MAPT
PARK16, STBD1, GPNMB, FGF20, STX1B
SCARB2, SREBF1/RAI1
Alzheimer’s disease ABCA7, MS4A6A/MS4A4E, EPHA1, CD33, CD2AP
CLU, CR1, PICALM, BIN1, APOE, TOMM40
Stroke NINJ2-‐WNK1 HDAC9
Bipolar disorder ODZ4, CACNA1C, NCAN
Schizophrenia MIR137, VRK2,ZNF804A, PCGEM1, MHC, MMP16, CSMD1, LSM1, CNNM2, NT5C2, AMBRA1, NRGN, CCDC68, TCF4
Adapted from J.Bras et al, Nat Rev Neurosc 2012 & P.F. Sullivan, Nat Rev GeneZcs 2013
NHGRI GWA Catalog www.genome.gov/GWAStudies www.ebi.ac.uk/fgpt/gwas/
Published Genome-‐Wide Associa'ons through 12/2012 p≤5X10-‐8 for 17 trait categories
DATABASES
NCBI dbSNP http://www.ncbi.nlm.nih.gov/SNP/index.html
GWAS Central http://www.gwascentral.org/
1000 genomes project http://www.1000genomes.org/
5. Detec'on of structural varia'on
M.E.Hurles et al, TIG 2008
ALTERED GENE DOSAGE ALTERED STRUCTURE OF REGULATORY ELEMENTS
enhancer
represser
exons
Inser'on
Dele'on of repressor Exon duplica'on
Gene duplica'on
Adapted from M.E.Hurles et al, TIG 2008
Impact of structural varia'on on gene func'on
Structural varia'on
Copy number varia0on (CNV) • Array CGH/high density SNP microarrays
All structural varia0on • Exome and whole genome sequencing
Reference DNA
Test DNA
Examples of CNVs in neurodevelopmental syndromes
CGS: con0guous gene dele0on/duplica0on syndrome UPD: uniparental disomy
Syndrome Locus Aberra'on Gene(s)
Neurodevelopmental
Williams-‐Beuren del(7)q11.23; dup(7)q11.23
17q11.23 Dele0on; Duplica0on
CGS incl ELN
Angelman; Prader-‐Willi
15q11-‐q12
Mat dele0on, pat UPD15; Pat dele0on, mat UPD15
UBE3A; CGS
Smith-‐Magenis; Potocki-‐Lupski
17p11.2 Dele0on; Duplica0on
GCS incl RAI1; RAI1
Reh; Reh-‐like
Xq28 Dele0on; Duplica0on, triplica0on
MECP2; MECP2
Pelizaeus-‐Merzbacher Xq22.2 Duplica0on, dele0on PLP1
Adapted from Stankiewicz & Lupski, Ann Rev Med 2010
Neurodegenera've
Parkinson’s 4q21 Duplica0on, triplica0on SNCA
Spinal muscular dystrophy 5q13 Dele0on, gene conversion SMN1, SMN2
CMT1A; HNPP
17p12 Duplica0on; Dele0on
PMP22
Alzheimer’s 21q21 Duplica0on APP
Examples of CNVs in neurodegenera've syndromes
Adapted from Stankiewicz & Lupski, Ann Rev Med 2010
Peripheral myelin protein-‐22 (PMP22)
J.Li et al, Mol Neurobiol 2013
Gene structure • Ex 1a in myelina0ng
Schwann cells • Ex 1b in non-‐
neuronal cells
Predicted Protein Structure
J.Li et al, Mol Neurobiol 2013
Hypothe'cal mechanisms involving PMP22 in CMT1a, HNPP & CMT1E
Complex rearrangements at the PMP22 locus
Adapted from Zhang et al, Nat Genet 2009
PMP22: peripheral myelin protein 22 RAI1: re0noic acid induced 1
6. Transcriptomics Sequencing genome-‐wide RNA synthesis
Adapted from J.Bras et al, Nat Rev Neurosc 2012
Examples of transcriptomic approaches to complex neurological diseases
Disease RNA-‐seq experimental design Gene
Alzheimer’s disease Human brain 0ssue APOE
Amyotrophic lateral sclerosis
Drosophila TBPH
Au0sm Human brain 0ssue Adenosine-‐to-‐inosine edi0ng
Au0sm Human primary neural stem cells RBFOX1 splicing network
Canine neonatal cerebellar cor0cal degenera0on
Dogs SPTBN2
Mul0ple sclerosis Primary human CD4+ cells CD6
Schizophrenia, bipolar disorder, au0sm
Cultured neurons Noncoding RNA
Adapted from Handel et al, Exp Rev Neuropath 2013
Mosaic copy number varia'on in human neurons, M.J.McConnell et al, Science 2013
Human frontal cortex neurons
DNA copy number analysis & single-‐cell sequencing
13-‐41% have at least one de novo CNV Dele0ons twice as common as duplica0ons
Subset of neurons has mul0ple genomic altera0ons
M.J.McConnell et al, Science 2013
Copy number varia'on in postmortem human neurons using single cell sequencing
Male Female
Transmitting genomes Deletions, duplications, and other mutations may arise at
different places in a developmental lineage.
M.J.McConnell et al, Science 2013 Macosko & McCarroll Science 2013