Genes in complex neurological disorders

Gene iden'fica'on in complex neurological disorders

Denise Sheer

Overview

•  Types of gene0c aberra0ons that can cause neurological disorders

•  Approaches for iden0fying genes associated with neurological disorders:

1.  Linkage studies 2.  Homozygosity mapping 3.  Exome & whole genome sequencing 4.  Genome-‐wide associa0on studies 5.  Detec0on of structural varia0on 6.  Transcriptomics

46 chromosomes 2m DNA 3 x 109 base pairs ~ 22,000 genes

The human genome

Muta'ons of various types cause neurological disease

Muta'on type Muta'on subtype Example(s)

SINGLE NUCLEOTIDE

Point muta0ons, inser0ons, dele0ons

Missense, nonsense, frameshiU, splice site, addi0on or dele0on of amino acid(s)

Many neurological disorders with a gene0c basis

MICROSATELLITE EXPANSION

Triplet repeat (polyglutamine) Hun0ngton disease (HTT)

Triplet repeat (polyanaline) Congenital central hypoven0la0on syndrome (PHOXB2)

Triplet repeat (other) Fragile X mental retarda0on syndrome (CGG repeat expansion in FMR 5’UTR)

Myotonic dystrophy 1 (CTG repeat expansion in DMPK 3’UTR)

Adapted from P.M.Boone et al, Hum Genet 2011

Muta'ons of various types cause neurological disease

Muta'on type Muta'on subtype Example(s)

STRUCTURAL VARIATION

Karyotypic Aneuploidy Down syndrome

Transloca0on X-‐linked mental retarda0on 58

Copy number Genomic dele0on Hereditary neuropathy with liability to pressure palsies

Genomic duplica0on Charcot-‐Marie-‐Tooth disease, type 1A

Whole gene dele0on Autosomal recessive early onset Parkinson disease 6 (PINK1)

Whole gene duplica0on Early onset Alzheimer disease with cerebral amyloid angiopathy (APP)

Intragenic dele0on Duchenne muscular dystrophy (DMD)

Intragenic duplica0on Autosomal dominant dopa-‐responsive dystonia (GCH1)

Non-‐coding X-‐linked spas0c paraplegia type 2 (near PLP1)

Inversion -‐ Duchenne muscular dystrophy and other features inv(X)(p21.2q22.2)

Adapted from P.M.Boone et al, Hum Genet 2011

Disease gene iden'fica'on

1.  Linkage studies 2.  Homozygosity mapping 3.  Exome & whole genome sequencing 4.  Genome-‐wide associa0on studies 5.  Detec0on of structural varia0on 6.  Transcriptomics

Applica'on of current methods for disease gene iden'fica'on

A.B. Singleton, Trends in Genetics 2010 (based on T.A. Manolio, Nature 2009)

High risk, rare alleles APP, PS mut in AD LRKK2 mut in PD

Moderate risk, low frequency alleles

GBA mut in PD

Low risk, common alleles CLU, PICALM, CR1 mut in AD

SNCA, MAPT mut in PD

T.A. Manolio, Nature 2009

Feasibility of iden'fying gene'c variants by strength of gene'c effect (odds ra'o) and risk allele frequency

Phenotypic variation

Wilt Chamberlain, NBA basketball player

7 feet, 1 inch; 275 pounds Willie Shoemaker, horse racing jockey

4 feet, 11 inches; barely 100 pounds

1. Linkage studies

In human beings, 99.9% of the DNA sequence is the same Remaining 0.1% makes a person unique

-  Different attributes/characteristics traits -  Diseases he/she develops

These variations can be: -  Harmless (change in phenotype) -  Harmful (diabetes, cancer, heart disease, Huntington's

disease, and hemophilia ) -  Latent (variations in coding and regulatory regions, are

not harmful on their own, and the change in each gene only becomes apparent under certain conditions)

Genetic variation underlies phenotypic differences

Single Nucleotide Polymorphism - SNP -  Variation in DNA sequence (substitutions, deletions,

insertion, etc) that is present at a frequency greater than 1% in a population.

Mutation -  Variation in DNA sequence (substitutions, deletions, etc)

that is present at a frequency lower than 1% in a population.

ATTGGCCTTAACCCCCGATTATCAGGAT ATTGGCCTTAACCTCCGATTATCAGGAT

Allele A Allele B

Linkage studies

•  Loci are linked if they are close to each other •  Search for co-‐inheritance of the disease with polymorphic

markers •  Obtain loca0on of gene •  Sequence •  Limited applica0on for late-‐onset diseases

12

PARK8/LRRK2 Leucine-‐Rich Repeat Kinase 2 Autosomal Dominant Parkinson’s Disease

C. Paysan-Ruiz et al, Neuron 2004

2. Homozygosity mapping

•  Genome-‐wide genotyping using high density SNP microarrays •  Autosomal recessive diseases

Frontotemporal Demen'a – like disease

AA

AA

AB

Adapted from J.Bras et al, Nat Rev Neurosc 2012

Homozygosity mapping

C. Paysan-Ruiz et al, Ann Neurol 2009

p.R747W

+/+

Dystonia-‐Parkinsonism •  PLA2G6 •  Phospholipase A2, group VI

22

PLA2G6 rs7288109

rs16996781

3. Exome & whole genome sequencing

Exon 1 Exon 2 Exon 3

Intron 1 Intron 2

DNA

Transcription start site

Protein

Pre-mRNA

Transcription

Splicing

Translation

mRNA

Intergenic region Promoter Enhancer

Gene

Exome & whole genome sequencing


Examples of neurological disease genes iden'fied by exome sequencing

Disorder Gene

Au0s0c spectrum disorder Mul0ple, CHD8, KATNAL2

Au0sm UBE3B, CLTCL1,NCKAP5L, ZNF18, ANK2, SCN2A

AD cerebellar ataxia, deafness & narcolepsy DNMT1

AD early onset Alzheimer’s disease SORL1

AD spinocerebellar ataxia PRKCG, TGM6

AR infan0le onset spinocerebellar ataxia CC10orf2

AR pontocerebellar hypoplasia and spinal motor neuron degenera0on

EXOSC3

Brown-‐Vialeho-‐Van Laere syndrome (early onset ALS)

SLC52A3

Charcot-‐Marie-‐Tooth neuropathy Mul0ple heterozygous variants

Essen0al tremor FUS

Adapted from Handel et al, Exp Rev Neuropath 2013 AD, AR: Autosomal dominant, recessive

Clinical Whole-‐Exome Sequencing for the Diagnosis of Mendelian Disorders, Yang et al, NEJM 2013

250 pa0ents: 80% were children with neurologic phenotypes





Neurological disease genes iden'fied by whole genome sequencing

Disorder Gene

Charcot-‐Marie-‐ Tooth neuropathy SH3TC2

Familial Amyotrophic Lateral Sclerosis C9orf72

Infan0le epilep0c encephalopathy and SUDEP SCN8A

Complex motor and sensory axonal neuropathy plus microcephaly VRK1

Adapted from: Handel et al, Exp Rev Neuropath 2013 & C. Gonzaga-Jauregui et al, JAMA Neurol 2013

Whole genome sequencing in a pa'ent with Charcot-‐Marie-‐Tooth neuropathy, Lupski et al, NEJM 2010


Professor James R Lupski, Baylor College of Medicine


Charcot-‐Marie-‐Tooth neuropathy •  Childhood onset neurodenera0ve disease •  Characterised by demyelina0on of motor and sensory nerves •  Most common inherited disorder of the peripheral nervous system •  Two major phenotypic types according to electrophysiological, clinical, and

nerve-‐biopsy evalua0ons •  glial myelinopathy (CMT type 1) •  neuronal axonopathy (CMT type 2)

•  Each type can be inherited in a dominant, recessive or X-‐linked manner •  PMP22 duplica0on accounts for 70% of cases •  Many other genes associated with remaining cases

•  CMT4C is caused by homozygous or compound heterozygous muta0ons in SH3TC2 gene


CMT: Charcot-‐Marie-‐Tooth neuropathy MMM: mild mononeuropathy of the median nerve


Muta0ons in the SH3TC2 gene

R954X, with or without Y169H muta0on, muta0on was associated with Carpal Tunnel Syndrome


SH3TC2 •  SH3 domain and tetratricopep0de repeats-‐containing protein 2 •  Expressed in Schwann cells •  Localises in plasma membrane and to the perinuclear endocy0c

recycling compartment •  Proposed to be an adaptor or docking molecule •  Presumed role in myelina'on •  Numerous homozygous and compound heterozygous muta0ons

have been iden0fied in CMT4C •  Nonsense variant: p.R954X •  Missense variant: p.Y169H

SH3TC2: A role in endocy'c recycling

Adapted from R.C.Roberts et al, Hum Mol Genet 2010

Y169H

R954X

Muta0ons iden0fied in Lupski et al, 2010

Muta0ons in CMT4C found to mistarget SH3TC2 away from the recycling endosome


SH3TC2 •  Nonsense variant: p.R954X •  Missense variant: p.Y169H •  High degree of conserva0on of Y169 in vertebrates

4. Genome-‐wide associa'on studies -‐ GWAS

Direct Associa0on Indirect Associa0on

Disease gene SNP

•  Examine a large number of SNPs in large numbers of affected and control cases •  Iden0fy SNPs that associate with the disease

Common Disease, Common Variant hypothesis: A common variable (i.e. with a high minor allele frequency that can therefore be seen in most individuals) modulates risk to disease development

Gibson & Muse: A primer of genome science

GWAS workflow

GWAS analysis of Parkinson’s disease MulZple genes at a single locus

GAK: cyclin G associated kinase TMEM175: transmembrane protein 175 DGKQ: diacylglycerol kinase theta 110 kDa

M.A.Nalls et al, Lancet 2011; J.Bras et al, Nat Rev Neurosc 2012

Examples of disease genes iden'fied by GWAS analysis

Disease Gene (locus)

Parkinson’s disease SYT11, ACMSD, STK39, MCC1/LAMP3; GAK, BST1, SNCA, HLADRB5, LRRK2, CCDC62/HIP1R, MAPT

PARK16, STBD1, GPNMB, FGF20, STX1B

SCARB2, SREBF1/RAI1

Alzheimer’s disease ABCA7, MS4A6A/MS4A4E, EPHA1, CD33, CD2AP

CLU, CR1, PICALM, BIN1, APOE, TOMM40

Stroke NINJ2-‐WNK1 HDAC9

Bipolar disorder ODZ4, CACNA1C, NCAN

Schizophrenia MIR137, VRK2,ZNF804A, PCGEM1, MHC, MMP16, CSMD1, LSM1, CNNM2, NT5C2, AMBRA1, NRGN, CCDC68, TCF4

Adapted from J.Bras et al, Nat Rev Neurosc 2012 & P.F. Sullivan, Nat Rev GeneZcs 2013

NHGRI GWA Catalog www.genome.gov/GWAStudies www.ebi.ac.uk/fgpt/gwas/

Published Genome-‐Wide Associa'ons through 12/2012 p≤5X10-‐8 for 17 trait categories

DATABASES

NCBI dbSNP http://www.ncbi.nlm.nih.gov/SNP/index.html

GWAS Central http://www.gwascentral.org/

1000 genomes project http://www.1000genomes.org/

5. Detec'on of structural varia'on

M.E.Hurles et al, TIG 2008

ALTERED GENE DOSAGE ALTERED STRUCTURE OF REGULATORY ELEMENTS

enhancer

represser

exons

Inser'on

Dele'on of repressor Exon duplica'on

Gene duplica'on

Adapted from M.E.Hurles et al, TIG 2008

Impact of structural varia'on on gene func'on

Structural varia'on

Copy number varia0on (CNV) •  Array CGH/high density SNP microarrays

All structural varia0on •  Exome and whole genome sequencing

Reference DNA

Test DNA

Examples of CNVs in neurodevelopmental syndromes

CGS: con0guous gene dele0on/duplica0on syndrome UPD: uniparental disomy

Syndrome Locus Aberra'on Gene(s)

Neurodevelopmental

Williams-‐Beuren del(7)q11.23; dup(7)q11.23

17q11.23 Dele0on; Duplica0on

CGS incl ELN

Angelman; Prader-‐Willi

15q11-‐q12

Mat dele0on, pat UPD15; Pat dele0on, mat UPD15

UBE3A; CGS

Smith-‐Magenis; Potocki-‐Lupski

17p11.2 Dele0on; Duplica0on

GCS incl RAI1; RAI1

Reh; Reh-‐like

Xq28 Dele0on; Duplica0on, triplica0on

MECP2; MECP2

Pelizaeus-‐Merzbacher Xq22.2 Duplica0on, dele0on PLP1

Adapted from Stankiewicz & Lupski, Ann Rev Med 2010

Neurodegenera've

Parkinson’s 4q21 Duplica0on, triplica0on SNCA

Spinal muscular dystrophy 5q13 Dele0on, gene conversion SMN1, SMN2

CMT1A; HNPP

17p12 Duplica0on; Dele0on

PMP22

Alzheimer’s 21q21 Duplica0on APP

Examples of CNVs in neurodegenera've syndromes

Adapted from Stankiewicz & Lupski, Ann Rev Med 2010

Peripheral myelin protein-‐22 (PMP22)

J.Li et al, Mol Neurobiol 2013

Gene structure •  Ex 1a in myelina0ng

Schwann cells •  Ex 1b in non-‐

neuronal cells

Predicted Protein Structure

J.Li et al, Mol Neurobiol 2013

Hypothe'cal mechanisms involving PMP22 in CMT1a, HNPP & CMT1E

Complex rearrangements at the PMP22 locus

Adapted from Zhang et al, Nat Genet 2009

PMP22: peripheral myelin protein 22 RAI1: re0noic acid induced 1

6. Transcriptomics Sequencing genome-‐wide RNA synthesis


Examples of transcriptomic approaches to complex neurological diseases

Disease RNA-‐seq experimental design Gene

Alzheimer’s disease Human brain 0ssue APOE

Amyotrophic lateral sclerosis

Drosophila TBPH

Au0sm Human brain 0ssue Adenosine-‐to-‐inosine edi0ng

Au0sm Human primary neural stem cells RBFOX1 splicing network

Canine neonatal cerebellar cor0cal degenera0on

Dogs SPTBN2

Mul0ple sclerosis Primary human CD4+ cells CD6

Schizophrenia, bipolar disorder, au0sm

Cultured neurons Noncoding RNA

Adapted from Handel et al, Exp Rev Neuropath 2013

Mosaic copy number varia'on in human neurons, M.J.McConnell et al, Science 2013

Human frontal cortex neurons

DNA copy number analysis & single-‐cell sequencing

13-‐41% have at least one de novo CNV Dele0ons twice as common as duplica0ons

Subset of neurons has mul0ple genomic altera0ons

M.J.McConnell et al, Science 2013

Copy number varia'on in postmortem human neurons using single cell sequencing

Male Female

Transmitting genomes Deletions, duplications, and other mutations may arise at

different places in a developmental lineage.

M.J.McConnell et al, Science 2013 Macosko & McCarroll Science 2013

Please contact me if you have any quesZons

[email protected]

Date post:	17-Jul-2015
Category:	Health & Medicine
Upload:	denise-sheer
View:	180 times
Download:	0 times

Genes in complex neurological disorders

Health & Medicine