A Systematic in planta Survey of 14-3-3 Protein
Interactions by Bimolecular Fluorescence
Complementation
This thesis is presented for the degree of Doctor of Philosophy
of The University of Western Australia
Hung-Chi Liu
Biochemistry and Molecular Biology
School of Biomedical, Biomolecular and Chemical Sciences
The University of Western Australia
November 2010
Supervisors: Dr Thomas Martin and Dr Martha Ludwig
Declaration I
Declaration
The work presented in this thesis is my own work except where stated. This work
was carried out in the School of Biomedical, Biomolecular and Chemical Sciences,
Faculty of Life and Physical Sciences, at the University of Western Australia. The
material presented in this thesis has not been presented for any other degree.
Hung-Chi Liu
Nov 2010
Acknowledgement II
Acknowledgement
I would like to express my sincere appreciation to my principal supervisor Dr.
Thomas Martin and my secondary supervisor Dr. Martha Ludwig for their support,
guidance and encouragement on not only scientific research, but everyday life during
the period of my PhD study at the University of Western Australia. Thanks must also
go to all the former and present members in the labs of Dr. Patrick Finnegan, Martha
and Thomas for their shared knowledge and inspiring discussions. I will not forget
the delightful feeling and atmosphere I was able to submerge in when talking about
science during our fortnightly group meetings. Special thanks go to Libby Thomas
for her countless chocolates and handmade cakes that recharged my energy for a lot
of late working hours in the lab.
I thank Dr. Anne Bersoult, Prof. Ian Small, Dr. John Bussell, Dr. Itsara
Pracharoenwattana and Prof. Steven Smith at ARC Centre of Excellence in Plant Energy
Biology, University of Western Australia (UWA, Perth, Australia) for their generosity in
providing plasmids and bacterial materials. My special thanks go to Profs. Claudia
Oecking and Klaus Harter for the BiFC vectors (pSPYNE-35S, pSPYCE-35S, pUC-SPYNE
and pUC-SPYCE), which became the starting material for the BiFC work presented in
this thesis. I am grateful to Mr. John Murphy at the UWA Microscopy Centre for his
technical guidance on the use of confocal microscopes. I would also like to
acknowledge Dr. Roger Hellens and Dr. Phil Mullineaux from the John Innes Centre
(Norwich, UK) for allowing us to use the pGreen vector set, Prof. David Baulcombe at
the Sainsbury Laboratory Plant Biosciences Limited (Norwich, UK) for allowing us to
use the p19 suppressor of gene silencing plasmid and Prof. Mike Jones at Murdoch
University (Perth, Australia) for the kind gift of Nicotiana benthamiana seeds.
I would like to acknowledge UWA for a SIRF/UIS Scholarships and the School of
Biomedical, Biomolecular and Chemical Sciences for the Ad Hoc Scholarship.
Acknowledgement III
Thanks to Mark Ching-Lung Chen for proofreading of my thesis. I am also
thankful to Mark and Tsun-Thai Chai for the many hours we spent together in Perth.
My deepest appreciation goes to my wife, Yin-Chen, for her love and support and
for bringing us four lovely daughters. I am truly grateful to my mom for her endless
support, especially for the help with looking after our triplets. Special thanks also go
to our neighbour aunties in Taiwan, who kindly gave us a big hand by helping us taking
care of our children when I was away from home during the later part of my PhD.
Abstract IV
Abstract
Proteins of the highly conserved eukaryotic 14-3-3 family act as key regulators of
a wide range of biological processes, such as metabolic enzyme regulation, cell cycle
control, ion transport, gene expression, protein assembly and translocation. Such
regulation is achieved by interactions of 14-3-3 homo- and heterodimers with target
proteins. To date, more than one hundred 14-3-3 binding targets have been
identified, mainly through far-Western analysis, immuno-precipitation, yeast
two-hybrid screening, proteomic approaches or in silico predictions. Currently, the
literature proposes two mechanisms that could contribute to 14-3-3 isoform-target
protein specificity. Firstly, it is suggested that the specificity is mediated via
interaction of the 14-3-3 protein’s carboxy-terminal ends with target proteins. On
the other hand, the variability of the amino-terminal ends of 14-3-3 proteins gave rise
to the idea that dimerisation is selective and can therefore contribute to 14-3-3
specificity. Analysing whether 14-3-3s can dimerise freely with each other would
further our understanding of the role the amino termini play during dimerisation and
whether specificity is associated with this.
Bimolecular fluorescence complementation (BiFC) enables the visualisation of
protein-protein interaction in planta. The technique is based on the interaction of
two candidate proteins translationally fused to non-fluorescent fragments of the
yellow fluorescent protein (YFP). Interaction of the candidate proteins leads to
functional YFP reconstitution and fluorescence. In this study, ten out of thirteen
expressed Arabidopsis 14-3-3 isoforms were analysed for dimerisation using a BiFC
approach in transiently transformed Nicotiana benthamiana leaf epidermal cells.
This approach demonstrated that all tested 14-3-3 isoforms were able to freely form
homo- and heterodimers with each other. Although almost all of the 14-3-3 dimers
tested localised to both the cytoplasm and nucleus, some 14-3-3 dimers showed
Abstract V
preferential nuclear localisation. Furthermore, a previously undescribed
endoplasmic reticulum associated distribution of 14-3-3 dimers was observed in
response to induced cell death. Differential cellular distribution patterns of 14-3-3
dimers were also observed in stable transformed Arabidopsis plants expressing 14-3-3
BiFC constructs.
In addition to 14-3-3 dimerisation, this study investigated the interaction of seven
14-3-3 isoforms with a potential target protein, histone deacetylase 2C (HD2C).
Interaction of 14-3-3s with HD2C was exclusively found to be in the nucleus and, most
prominently, in the nucleolus. Interaction with HD2C recruited even those 14-3-3s,
which in dimerisation experiments were classified as mostly cytosolic, to the nucleus
and the nucleolus.
List of abbreviations VI
List of abbreviations
ABA abscisic acid
ABRC Arabidopsis Biological Resource Centre
Ala alanine
AMP adenosine monophosphate
ATP adenosine triphosphate
Arabidopsis Arabidopsis thaliana
BiFC bimolecular fluorescence complementation
bp base pairs
BSA Bovine Serum Albumin
BZR1 brassinazole resistant-1
CaMV Cauliflower mosaic virus
cDNA complementary DNA
DAPI 4’, 6-diamidino-2-phenylindole
DNA deoxyribonucleic acid
E. coli Escherichia coli
ECL enhanced chemiluminescence
EmBP1 Em promoter binding protein 1
ER endoplasmic reticulum
EtBr ethidium bromide
FITC fluorescein isothiocyanate
GFP green fluorescent protein
H2O2 hydrogen peroxide
HA hemagglutinin
HDACs histone deacetylases
HD2C Arabidopsis histone deacetylase 2C
List of abbreviations VII
kDa kilo Dalton
LB medium Luria-Bertani Broth medium
MCS multiple cloning sites
MeJA methyl jasmonate
MES 2-(N-morpholino) ethanesulfonic acid
MQ H2O Milli-Q H2O
MS medium Murashige and Skoog medium
Nicotiana Nicotiana benthamiana
NR nitrate reductase
OD600 optical density at 600 nm
ORF open reading frame
PAGE polyacrylamide gel electrophoresis
PCR polymerase chain reaction
PEG polyethylene glycol
PM plasma membrane
RFP red fluorescent protein
PTGS post-transcriptional gene silencing
rpm revolutions per minute
SDS sodium dodecyl sulfate
Thr threonine
Tris tris (hydroxymethyl) aminomethane
YC (C-YFP) C-terminal fragment of YFP
YFP yellow fluorescent protein
YN (N-YFP) N-terminal fragment of YFP
Table of contents VIII
Table of contents
Declaration................................................................................................................................. I
Acknowledgement ................................................................................................................. II
Abstract ................................................................................................................................... IV
List of abbreviations ............................................................................................................ VI
Table of contents ................................................................................................................ VIII
Chapter 1 General Introduction ........................................................................................ 1
1.1. Introduction ..................................................................................................................... 2
1.2. The early history of 14-3-3 proteins ...................................................................... 2
1.3. Structure of 14-3-3 proteins ..................................................................................... 3
1.4. Modes of 14-3-3 action ................................................................................................ 5
1.5. 14-3-3 proteins in plants ............................................................................................ 7
1.6. Biological processes regulated by 14-3-3 proteins in plants ....................... 7
1.6.1. Metabolism .................................................................................................................................................. 8
1.6.2. Organelle functions ............................................................................................................................... 11
1.7. Redundancy versus specificity: the problem behind the analysis of
14-3-3 function ......................................................................................................... 11
1.8. Bimolecular fluorescence complementation (BiFC): live cell imaging
for protein-protein interaction ........................................................................... 13
1.9. Aims of this project .................................................................................................... 14
Chapter 2 Materials and Methods .................................................................................. 17
2.1. Materials ........................................................................................................................ 18
2.1.1. General Materials ................................................................................................................................... 18
2.1.2. Biological materials .............................................................................................................................. 18
2.1.2.1. Escherichia coli strains used in this study ................................................................................ 18
2.1.2.2. Agrobacterium strains used in this study ................................................................................ 18
2.1.2.3. Plant materials ......................................................................................................................... 18
2.1.2.4. Plasmids and primers ............................................................................................................... 19
2.2. Nucleic acid methods ................................................................................................ 20
2.2.1. Plasmid DNA isolation.......................................................................................................................... 21
2.2.1.1. Plasmid DNA preparation ........................................................................................................ 21
2.2.1.2. Isolation of plasmid DNA using a commercial kit ..................................................................... 22
2.2.2. Restriction enzyme digestion ............................................................................................................ 22
2.2.3. Agarose gel electrophoresis ............................................................................................................... 23
2.2.4. Ligation of DNA fragments into vectors ....................................................................................... 23
2.2.5. Polymerase Chain Reaction (PCR)................................................................................................... 24
Table of contents IX
2.2.6. TOPO TA Cloning® ................................................................................................................................. 24
2.2.7. Sample preparation for automated DNA sequence determination .................................... 25
2.3. Bacterial methods ....................................................................................................... 25
2.3.1. Preparation of competent E. coli cells ............................................................................................ 25
2.3.2. Transformation of E. coli competent cells .................................................................................... 26
2.3.3. Preparation of competent Agrobacterium cells ......................................................................... 26
2.3.4. Transformation of Agrobacterium cells ........................................................................................ 27
2.3.5. Colony PCR ................................................................................................................................................ 27
2.4. Plant methods ............................................................................................................... 28
2.4.1. Plant growth ............................................................................................................................................ 28
2.4.2. Isolation of Arabidopsis mesophyll protoplasts ......................................................................... 29
2.4.3. Polyethylene glycol-mediated transfection of A. thaliana mesophyll protoplasts ....... 30
2.4.4. Agroinfiltration of Arabidopsis and Nicotiana leaves ............................................................. 31
2.4.5. Transformation of Arabidopsis using floral dipping ................................................................ 32
2.4.6. Surface sterilisation of Arabidopsis seeds .................................................................................... 33
2.4.7. Screening Arabidopsis transformants ........................................................................................... 34
2.4.7.1. Screening transformants on plates ..........................................................................................34
2.4.7.2. Screening for transformants using Basta selection on soil-grown plantlets ............................34
2.4.8. Plant genomic DNA isolation ............................................................................................................. 35
2.4.8.1. Genomic DNA isolation using the cetyltrimethyl ammonium bromide (CTAB) method ..........35
2.4.8.2. Genomic DNA isolation using the method of Wang et al. (1993) ............................................36
2.4.9. PCR genotyping of transgenic plants ............................................................................................. 36
2.4.10. Biochemical treatments ....................................................................................................................... 36
2.4.10.1. Hydrogen peroxide treatment .................................................................................................36
2.4.10.2. Methyl jasmonate treatment ..................................................................................................37
2.5. Microscopy and imaging........................................................................................... 38
2.5.1. Fluorescence microscopy .................................................................................................................... 38
2.5.2. Confocal microscopy ............................................................................................................................. 38
2.5.3. Image analysis ......................................................................................................................................... 39
2.5.3.1. Quantification of fluorescence intensity using ImageJ ............................................................39
2.5.3.2. Image deconvolution ...............................................................................................................40
2.6. Protein expression analysis using denaturing gel electrophoresis and
Western blotting ....................................................................................................... 40
Chapter 3 Establishment of a Bimolecular Fluorescence Complementation
Assay System in planta ..................................................................................... 42
3.1. Introduction .................................................................................................................. 43
3.2. Results ............................................................................................................................. 45
3.2.1. Identification of a suitable vector system for a plant based BiFC assay system ............ 45
3.2.2. Construction of pGreen-based BiFC vectors ................................................................................. 49
Table of contents X
3.2.3. Cloning of Arabidopsis 14-3-3 open reading frames ................................................................ 52
3.2.4. Insertion of 14-3-3 ORFs into BiFC binary vectors .................................................................... 57
3.2.5. Generation of an Agrobacterium library carrying pGreen-14-3-3-BiFC constructs ... 61
3.2.6. Establishment of transient BiFC assay systems for 14-3-3 protein interaction
analysis ..................................................................................................................................................... 61
3.2.6.1. Transient BiFC assay in Arabidopsis leaves using agroinfiltration ........................................... 63
3.2.6.2. Transient BiFC assay in Arabidopsis mesophyll protoplasts .................................................... 67
3.2.6.3. Transient BiFC assay in Nicotiana leaves................................................................................. 70
3.2.6.4. Robustness of transient BiFC assays using Nicotiana leaves and reproducibility of results .... 73
3.2.7. Identification of subcellular distribution of 14-3-3-BiFC dimeric complexes ................ 76
3.3. Discussion ...................................................................................................................... 81
3.3.1. Generation of pGreen-based BiFC vectors .................................................................................... 81
3.3.2. The suitability of Arabidopsis mesophyll protoplasts for transient BiFC assays .......... 82
3.3.3. Assessment of BiFC assay using transient expression in Arabidopsis and Nicotiana
leaves via infiltration with Agrobacteria.................................................................................... 83
Chapter 4 A Systematic Survey of Subcellular Dimerisation of Arabidopsis
14-3-3 Isoforms by Bimolecular Fluorescence Complementation ... 87
4.1. Introduction .................................................................................................................. 88
4.1.1. Dimerisation of 14-3-3 proteins ....................................................................................................... 88
4.1.2. Subcellular localisation of 14-3-3 proteins in plants ............................................................... 90
4.1.3. Interaction of 14-3-3s with target proteins ................................................................................. 92
4.2. Results ............................................................................................................................. 95
4.2.1. A database analysis of the subcellular localisation of Arabidopsis 14-3-3 proteins
using the SUBcellular location database for Arabidopsis proteins (SUBA) .................. 95
4.2.2. Arabidopsis 14-3-3 isoforms can form dimers with each other in living plant cells ... 99
4.2.3. Subcellular localisation of 14-3-3-BiFC dimeric complexes ................................................ 101
4.2.3.1. Dual cytosolic/nuclear localisation of 14-3-3 dimers ............................................................. 101
4.2.3.2. 14-3-3 dimers were absent from chloroplast stroma but may be associated with
chloroplastic membranes ................................................................................................ 102
4.2.3.3. Variable nuclear localisation patterns of 14-3-3 dimers were observed ............................... 103
4.2.4. Some 14-3-3 dimers showed preferential subcellular localisations ................................ 105
4.2.5. Discovery of a novel localisation pattern of 14-3-3 dimers ................................................. 110
4.2.6. Investigation into the interaction of 14-3-3 proteins with the histone deacetylase
HD2C ....................................................................................................................................................... 112
4.3. Discussion .................................................................................................................... 116
4.3.1. 14-3-3 isoforms can dimerise freely with each other in vivo .............................................. 116
4.3.2. Subcellular localisation of 14-3-3 dimers ................................................................................... 116
4.3.3. Do nuclear localisation patterns reflect function of 14-3-3 dimers? ............................... 117
Table of contents XI
4.3.4. Is the novel 14-3-3 localisation associated with the ER and with wound induced cell
death? ......................................................................................................................................................120
4.3.5. Seven 14-3-3 isoforms can interact with histone deacetylase 2C .....................................121
4.3.6. 14-3-3-HD2C interactions occurs in the nucleoplasm and nucleolus ..............................122
Chapter 5 Analysis of 14-3-3 Dimerisation in Transgenic Arabidopsis Plants125
5.1. Introduction ............................................................................................................... 126
5.1.1. Arabidopsis 14-3-3 isoforms freely dimerise with each other in a heterologous plant
system .....................................................................................................................................................126
5.1.2. A literature review of 14-3-3 gene expression in Arabidopsis ............................................127
5.2. Results .......................................................................................................................... 129
5.2.1. A large number of endogenous 14-3-3s are co-expressed in Arabidopsis......................129
5.2.2. Generation of transgenic Arabidopsis plants constitutively expressing 14-3-3-split
YFP fusion proteins ............................................................................................................................131
5.2.3. Phenotypic changes were observed in some of the T1 transformants ............................134
5.2.4. Genetic analysis of T2 populations of 14-3-3-split YFP transformants ..........................134
5.2.5. Generation of “double” transgenic 14-3-3-YN and 14-3-3-YC Arabidopsis plants for
BiFC analysis of 14-3-3 dimerisation in a whole plant context ........................................137
5.2.5.1. Selection of BiFC expressing, double transgenic Arabidopsis plants .....................................138
5.2.5.2. Distribution of 14-3-3 dimers in double transgenic Arabidopsis plants as observed by BiFC 139
5.2.5.3. Genetic analysis of F2 offspring of double transgenic BiFC Arabidopsis plants .....................141
5.2.6. Distribution of 14-3-3 BiFC dimers in double transgenic Arabidopsis plants ..............143
5.2.6.1. Distribution of 14-3-3 dimers in roots of transgenic seedlings ..............................................143
5.2.6.2. Subcellular distribution of 14-3-3 dimers in cotyledon guard cells ........................................145
5.2.6.3. Subcellular distribution of 14-3-3 dimers in epidermal cells of rosette leaves ......................148
5.2.6.4. Distribution of 14-3-3 epsilon-YN/mu-YC dimer in flower tissues .........................................150
5.3. Discussion ................................................................................................................... 150
5.3.1. BiFC fluorescence in transgenic plants may reflect endogenous 14-3-3 dimerisations150
5.3.2. Visualising 14-3-3 dimerisations in a whole plant context .................................................152
5.3.3. Subcellular distribution of 14-3-3 dimer was somewhat dimer-dependent in some
tissues ......................................................................................................................................................154
Chapter 6 Cell Death Induced Aggregation and ER Association of 14-3-3
Dimers ................................................................................................................. 156
6.1. Introduction ............................................................................................................... 157
6.2. Results .......................................................................................................................... 159
6.2.1. Co-localisation of 14-3-3 dimers with fluorescent ER and Golgi markers .....................159
6.2.2. Chemical cell death inducers and wounding trigger changes of subcellular
localisation of 14-3-3 dimers in transgenic Arabidopsis ....................................................167
6.2.2.1. The subcellular distribution of 14-3-3 dimers changes in response to wounding in cotyledon
epidermal cells ................................................................................................................169
Table of contents XII
6.2.2.2. Subcellular distribution of 14-3-3 dimers in mesophyll protoplasts derived from double
transgenic Arabidopsis plants ......................................................................................... 171
6.2.2.3. Hydrogen peroxide treatment induces the novel subcellular localisation of 14-3-3 dimers . 173
6.2.2.4. Methyl jasmonate treatment induces the novel subcellular localisation of 14-3-3 dimers .. 174
6.3. Discussion .................................................................................................................... 180
6.3.1. The potential association with the ER upon cell death induction and wounding
suggest a role of 14-3-3s in ER mediated apoptosis ............................................................. 180
Chapter 7 General Discussion ...................................................................................... 183
7.1. Conclusion and discussion .................................................................................... 184
7.1.1. Analysis of 14-3-3 isoform specificity using bimolecular fluorescence
complementation ............................................................................................................................... 184
7.1.1.1. Isoform specificity in 14-3-3 dimerisation ............................................................................. 184
7.1.1.2. Isoform specificity with respect to 14-3-3 isoform-target interaction .................................. 185
7.1.1.3. Differential subcellular distribution of 14-3-3 dimers may contribute to specificity ............. 186
7.1.2. Advantages and limitations of bimolecular fluorescence complementation for the
analysis of 14-3-3 interactions ..................................................................................................... 188
7.1.3. Interpretation of the BiFC outcomes of 14-3-3 interactions in cells ................................ 191
7.2. Future perspectives ................................................................................................. 193
References ........................................................................................................................... 196
Appendices .......................................................................................................................... 213
Appendix I: Media and solutions ..................................................................................... 214
Appendix II: Supplementary figures and tables ........................................................ 218
Chapter 1. General introduction 1
Chapter 1
General Introduction
Chapter 1. General introduction 2
1.1. Introduction
Plants use many strategies to deal with environmental challenges because of
their sessile lifestyles. Challenges such as nutrient availability, light conditions,
abiotic and biotic stresses greatly affect resource acquisition and allocation and thus
the productivity of plants. In response to these challenges, plants integrate various
sensing and signalling mechanisms and exhibit a variety of responses to adapt to
surrounding conditions. Accumulating evidence has shown that signalling pathways
leading to these responses share steps or cross-talk to each other (Genoud and
Métraux, 1999). Understanding these signalling mechanisms is key to improving
crop productivity.
Reversible protein phosphorylation is a major mechanism for signal
transduction at the cellular level (Cohen, 2002). Phosphorylation can regulate
enzyme activity, cellular distribution of proteins, and assembly and disassembly of
protein complexes (Bridges and Moorhead, 2005). However, phosphorylation and
dephosphorylation of proteins, in many cases, are not sufficient for completion of
signalling cascades and even for the cross-talk of diverse signalling cues (Chevalier et
al., 2009). It appears that in many cases proteins that can interact with
phosphorylated signalling components play a role as intermediates to integrate
multiple signalling pathways. A class of proteins known as 14-3-3 proteins is one
group of these intermediate regulators (Bridges and Moorhead, 2005).
1.2. The early history of 14-3-3 proteins
14-3-3 proteins were discovered in 1967 by Moore and Perez during the
classification of bovine brain proteins (Moore and Perez, 1967). The name is based
on the fraction numbers of these proteins during isolation by diethylaminoethyl
cellulose chromatography and starch gel electrophoresis. After their discovery, the
Chapter 1. General introduction 3
role of 14-3-3s remained elusive for twenty years when it was shown that 14-3-3
proteins act as activators of tyrosine and tryptophan hydroxylases involved in
neurotransmitter biosynthesis (Ichimura et al., 1987). In 1992, 14-3-3 proteins from
plants were first described (Brandt et al., 1992; de Vetten et al., 1992; Hirsch et al.,
1992; Lu et al., 1992), drawing the attention to the role of “brain proteins” in plants.
Since then, it has been shown that 14-3-3s function as key regulators in many
biological processes in both plants and animals by physically interacting with target
proteins in a phosphorylation-dependent manner. It was further shown that 14-3-3
proteins act as protein dimers (Jones et al., 1995; Liu et al., 1995; Xiao et al., 1995).
To date, more than 300 14-3-3 interacting proteins have been identified or
proposed, including proteins involved in a wide range of biological processes such as
metabolic enzyme regulation, cell cycle control, ion transport, gene expression,
protein assembly and translocation (reviewed in Ferl et al., 2002; Comparot et al.,
2003; Roberts, 2003; MacKintosh, 2004).
1.3. Structure of 14-3-3 proteins
14-3-3 proteins, from all eukaryotes, are encoded by small gene families
comprising of two genes in the model yeast Saccharomyces cerevisiae to thirteen
expressed genes in the model plant Arabidopsis thaliana (van Heusden et al., 1996;
Rosenquist et al., 2001; Chevalier et al., 2009). The 14-3-3 family is a highly
conserved protein family, with high amino acid sequence similarities even between
animal and plant homologs, as shown by a phylogenetic analysis involving 153 14-3-3
protein sequences across 48 species (Rosenquist et al., 2000; Ferl et al., 2002). The
overall amino acid identity between the expressed Arabidopsis isoforms is 50% but
can be as high as 92% between two isoforms (Wu et al., 1997a). In general, large
blocks of conserved amino acids are found in the central region of the proteins, with
Chapter 1. General introduction 4
both the N- and C-terminal ends of 14-3-3s showing greater variation (Chung et al.,
1999; Ferl et al., 2002).
From the highly conserved protein sequences, it is anticipated that the
individual 14-3-3 isoforms share similar protein structures. Indeed, X-ray crystal
structure analyses of seven human and one plant isoforms confirmed that 14-3-3s
form very similar dimeric structures (Liu et al., 1995; Xiao et al., 1995; Rittinger et al.,
1999; Würtele et al., 2003; Gardino et al., 2006). As shown for the human 14-3-3
zeta dimer in Fig. 1-1, each 14-3-3 monomer consists of nine -helices arranged in an
anti-parallel fashion forming an L-shaped structure. The monomer interior consists
of four -helices containing charged and polar amino acids that form a concave
amphipathic groove, which interacts with mostly phosphorylated target peptides.
The less conserved C-terminal domains of 14-3-3 proteins are assumed to play a role
in target protein recognition and to contribute to isoform specificity (Chung et al.,
1999). In addition to the role in substrate recognition, the C-terminus of some
isoforms may also have an autoinhibitory role (Shen et al., 2003).
14-3-3 proteins are known to exist as homodimers and heterodimers (Jones et
al., 1995; Liu et al., 1995; Xiao et al., 1995; Chaudhri et al., 2003). The N-terminal
domains of two 14-3-3 monomers form the dimerisation interface. Structural
analysis of the human 14-3-3 zeta dimer suggests that dimer formation requires the
interaction of the N-terminal helix H1 of one monomer with helices H3 and H4 of the
other monomer (Liu et al., 1995). It is possible that the N-terminal sequence
variability determines which dimers are formed under physiological conditions and
hence it may contribute to specificity (Chung et al., 1999; Aitken et al., 2002);
however, this hypothesis lacks experimental support.
Chapter 1. General introduction 5
Fig. 1-1. Crystal structure of a 14-3-3 dimer bound to mode-1 target peptides.
Crystal structure analysis of a 14-3-3 dimer bound to mode-1 target peptides shows that the
central structure of the dimer forms a basket-like structure composed of anti-parallel
alpha-helices. Each monomer of the dimer creates a groove that forms a target binding
interface. The conservation of 14-3-3 sequences across large evolutionary distances allows
this structure to serve as an appropriate model for the fundamental structure of all 14-3-3s.
The extreme N- and C-termini are unresolved in this analysis as well as in similar 14-3-3 crystal
structure analysis. This image was created using Cn3D and PDB:1QJB. Reprinted from Physiol.
Plant. 120, Ferl, R. J., “14-3-3 proteins: Regulation of signal-induced events”, pp. 173-178,
copyright 2004, with permission from John Wiley and Sons.
1.4. Modes of 14-3-3 action
Plant and animal 14-3-3 proteins recognise the same set of conserved
phosphopeptide binding motifs, RSXpS/pTXP (mode-1) or RXXXpS/pTXP (mode-2)
(Yaffe et al., 1997; Bridges and Moorhead, 2005). However, binding motifs differing
from these two typical motifs were reported for some 14-3-3 target proteins, such as
the YpTV (Y: tyrosine, pT: phosphothreonine and V: valine) motif at the extreme
C-terminal end of the plant plasma membrane H+-ATPase (Würtele et al., 2003). In a
few examples, 14-3-3 proteins appear to bind to unphosphorylated target proteins (Fu
et al., 2000). The variety of binding motifs and the lack of recognisable motifs in a
Chapter 1. General introduction 6
great number of putative client proteins indicate that our current understanding of
14-3-3 target protein recognition is still incomplete.
14-3-3 proteins have no intrinsic enzyme activity and their biological function is
only revealed by their interaction with target proteins (MacKintosh, 2004). These
functions can be classified into several modes of 14-3-3 action (Roberts, 2003):
(a) Interaction of 14-3-3s with a client protein, where the client is an enzyme, can alter
the activity of the client protein by changing its specific activity or its turnover rate
(reviewed in Huber et al., 1996; Bunney et al., 2002; Comparot et al., 2003; Lillo et
al., 2004). Well-characterised examples are nitrate reductase (NR) and the plant
plasma membrane H+-ATPase. Binding to 14-3-3 inactivates NR activity whilst it
activates H+-ATPase activity (Oecking et al., 1994; Bachmann et al., 1996a; Huber et
al., 1996; Moorhead et al., 1996; Jahn et al., 1997; Oecking and Hagemann, 1999).
(b) 14-3-3 dimers can act as a scaffold, bringing two client proteins together or
stabilising oligomerisation of a target protein. Examples of this scenario are the
Bcr-Raf protein complex in mammalian cells (Braselmann and McCormick, 1995)
and the VP1-EmBP1 transcription factor complex regulating abscisic acid
(ABA)-responsive gene expression in plants (Schultz et al., 1998). In both cases
14-3-3 dimers bridge and connect the client proteins within the complexes. In
addition, 14-3-3 binding results in H+-ATPase hexamerisation (Kanczewska et al.,
2005; Ottmann et al., 2007), which also supports the adapter mode of 14-3-3
action.
(c) Binding of 14-3-3s to multiple interaction sites within a single target protein may
lead to conformational changes of the target, as is the case in 14-3-3 interaction
with Raf-1 (Tzivion et al., 1998; Yaffe, 2002).
(d) Facilitate import of nuclear-encoded chloroplast proteins into chloroplasts is
stimulated by 14-3-3s bound to the transit peptides of the precursor proteins (May
and Soll, 2000; Sehnke et al., 2000).
Chapter 1. General introduction 7
(e) 14-3-3s regulate nucleo-cytoplasmic shuttling of some nuclear proteins, such as
the plant transcription factor REPRESSION OF SHOOT GROWTH (RSG) and
mammalian histone deacetylases (HDACs). Here, interaction with 14-3-3s
sequesters RSG or HDACs in the cytosol (Grozinger and Schreiber, 2000; Eckardt,
2001; Igarashi et al., 2001).
(f) In animal cells, a model has been proposed that suggests that interaction with
14-3-3 proteins facilitates transport of correctly assembled multimeric
channels/receptors from the endoplasmic reticulum (ER) to the plasma membrane
(Nufer and Hauri, 2003).
1.5. 14-3-3 proteins in plants
Multigene families encoding 14-3-3s were found in both monocotyledonous (e.g.
barley and rice) and dicotyledonous (e.g. tomato and Arabidopsis) plants. At least
five 14-3-3 encoding genes, named Hv14-3-3A to Hv14-3-3E, are found in barley
(Schoonheim et al., 2007b). In rice, all of the eight identified 14-3-3 genes in the
genome are expressed and are given the names OsGF14a to OsGF14h (Chen et al.,
2006; Yao et al., 2007). In tomato, twelve 14-3-3 genes (TFT1 to TFT12; Roberts,
2003; Xu and Shi, 2006) were identified, whilst Arabidopsis has fifteen 14-3-3 genes,
named GRF1 to GRF15 of which thirteen are expressed (Rosenquist et al., 2001;
Sehnke et al., 2006). To differentiate the Arabidopsis isoforms, individual members
are designated by Greek names and letters (Table 1-1).
1.6. Biological processes regulated by 14-3-3 proteins in
plants
Plant 14-3-3 proteins interact with a wide range of target proteins and are
Chapter 1. General introduction 8
Table 1-1. The Arabidopsis 14-3-3 family.
Gene name Greek name
of protein Greek letter AGI number*
GRF1 Chi χ At4g09000
GRF2 Omega ω At1g78300
GRF3 Psi ψ At5g38480
GRF4 Phi φ At1g35160
GRF5 Upsilon υ At5g16050
GRF6 Lambda λ At5g10450
GRF7 Nu ν At3g02520
GRF8 Kappa κ At5g65430
GRF9 Mu μ At2g42590
GRF10 Epsilon ε At1g22300
GRF11 Omicron ο At1g34760
GRF12 Iota ι At1g26480
GRF13 Pi π At1g78220
GRF14 - - At1g22290
GRF15 - - At2g10450
* AGI number: Arabidopsis thaliana Gene Index. - Protein name has not been given since the corresponding gene is
proposed to be a pseudogene.
assumed to regulate or impact on such diverse biological functions as plant
metabolism, gene expression, protein translocation into organelles, signal
transduction, hormone biosynthesis and cell cycle regulation (reviewed in Ferl et al.,
2002; Comparot et al., 2003; Roberts, 2003; MacKintosh, 2004). In this section,
some of the well-known processes that are regulated by 14-3-3 proteins in plants are
highlighted.
1.6.1. Metabolism
A large number of metabolic enzymes, most of which are involved in nitrogen
and carbohydrate metabolism, generation of proton gradients and energy
Chapter 1. General introduction 9
metabolism, are regulated by 14-3-3 proteins (Huber et al., 2002; Comparot et al.,
2003; Chevalier et al., 2009). One of the best-studied roles of plant 14-3-3s is the
inhibition of NR activity upon transition from light to dark, which is regulated by a
two-step process (Bachmann et al., 1996a; Moorhead et al., 1996). Nitrate
reductase catalyses the reduction of nitrate to nitrite, the first step of nitrogen
assimilation in plants (Huber et al., 1996; Campbell, 1999). The first step in the
inhibition process involves the phosphorylation of NR at a serine residue within a
conserved peptide motif by a sucrose non-fermenting related kinase (SnRK) and/or a
calcium-dependent protein kinase (CDPK; Su et al., 1996; Douglas et al., 1998; Sugden
et al., 1999). Subsequently, the phosphorylated NR is bound by 14-3-3 dimers
leading to inactivation of the enzyme (Mackintosh et al., 1995; Bachmann et al.,
1996a). The binding of 14-3-3s to phosphorylated NR is dependent on millimolar
concentrations of a divalent cation, such as Ca2+ or Mg2+ (Lu et al., 1994; Athwal et al.,
1998a), and loop 8 of 14-3-3 proteins is involved in the cation binding (Athwal and
Huber, 2002). Further evidence that 14-3-3 proteins play a role in the inactivation of
NR was obtained by the mutation of the 14-3-3 binding site of tobacco NR, which
resulted in the constitutive activation of the enzyme (Lillo et al., 2003). In addition,
binding of 14-3-3s leads to degradation of the enzyme by an unknown mechanism
(Sehnke and Ferl, 2000). The interaction of 14-3-3s and NR can be disrupted by
adenosine monophosphate (AMP), leading to activation of the enzyme (Athwal et al.,
1998b). This and a putative AMP binding site present in some 14-3-3s suggest that
14-3-3 activity may be under metabolic control (Athwal et al., 1998b).
In addition to NR, 14-3-3 proteins also bind to both the cytosolic and
chloroplastic isoforms of glutamine synthetase (GS1 and GS2, respectively;
Finnemann and Schjoerring, 2000; Riedel et al., 2001). Darkness and high ATP/AMP
ratios lead to phosphorylation of GS1 and subsequent binding of 14-3-3s, causing high
Chapter 1. General introduction 10
GS1 activity (Finnemann and Schjoerring, 2000). For GS2, only the phosphorylated
and 14-3-3 bound form of the isoform is catalytically active (Riedel et al., 2001).
Thus, regulation of nitrogen metabolism is strongly controlled by the interaction of
14-3-3 proteins with nitrogen assimilating enzymes.
Numerous enzymes involved in carbohydrate metabolism are found to
associate with 14-3-3s, such as sucrose-phosphate synthase (SPS; Toroser et al., 1998),
trehalose-6-phosphate synthase (TPS; Moorhead et al., 1999), starch synthase III
(Sehnke et al., 2001), glyceraldehyde-3-phosphate dehydrogenase (GAPN; Bustos and
Iglesias, 2003) and fructose-2,6-biphosphatase (Kulma et al., 2004). Direct evidence
for the regulation of carbohydrate metabolism by 14-3-3s came from antisense
approaches, which showed that a reduction of the granule-associated Arabidopsis
14-3-3 isoforms epsilon and mu by antisense approaches led to increased starch
accumulation in leaves (Sehnke et al., 2001).
Another well-studied example is the regulation of the plant plasma membrane
(PM) H+-ATPase by 14-3-3s. The primary role of PM H+-ATPase is the generation of a
proton gradient across the PM to provide an energy source for transport of nutrients
into cells, phloem loading and opening and closure of stomata (Palmgren, 2001).
Binding of 14-3-3 proteins to the phosphorylated, C-terminal autoinhibitory domain
of the PM H+-ATPase activates the pump (Jahn et al., 1997; Baunsgaard et al., 1998;
Olsson et al., 1998; Oecking and Hagemann, 1999; Svennelid et al., 1999; Maudoux et
al., 2000). Addition of the fungal phytotoxin fusicoccin to the 14-3-3-H+-ATPase
complex leads to irreversible activation of the pump that results in consistent opening
of stomata and thereby wilting of the leaf (de Boer, 1997; Jahn et al., 1997; Oecking
et al., 1997).
Chapter 1. General introduction 11
1.6.2. Organelle functions
Together with heat shock protein 70, 14-3-3s facilitate translocation of
phosphorylated chloroplast precursor proteins into wheat chloroplasts (May and Soll,
2000). In addition, 14-3-3s bind to a thylakoid-targeted precursor protein, the
Arabidopsis photosystem I N-subunit (At pPS1-N) as shown using yeast two-hybrid
assays (Sehnke et al., 2000). It was further demonstrated that four Arabidopsis
14-3-3 isoforms, epsilon, mu nu, and upsilon, localised to the chloroplast stroma
despite having no import signals of their own (Sehnke et al., 2000). In another study,
14-3-3 proteins were found in the matrix protein fraction of isolated mitochondria
using immunoblotting analyses (Bunney et al., 2001). Potential target proteins for
14-3-3 action in mitochondria, as well as chloroplasts, were the organelle specific ATP
synthases. Binding of the ATP synthases to 14-3-3s were in a phosphorylation-
dependent manner and down-regulated the activity of the ATP synthases (Bunney et
al., 2001). The mechanism of 14-3-3 translocation into organelles is currently unclear.
Co-translocation with bound target proteins across the organelle membranes is a
commonly proposed mechanism for divergent subcellular localisations of 14-3-3s
since they contain no apparent signal sequences (Paul et al., 2005).
1.7. Redundancy versus specificity: the problem behind the
analysis of 14-3-3 function
The high conservation of amino acids in the internal groove suggests that all
14-3-3 proteins have the general ability to interact with the same subset of target
proteins (Aitken et al., 2002; MacKintosh, 2004). This is likely to account for the
ability of 14-3-3s to complement for each other, even across species. For example,
several 14-3-3 isoforms from Arabidopsis could complement a lethal yeast mutant in
which the two 14-3-3 genes BMH1 and BMH2 were non-functional (van Heusden et
Chapter 1. General introduction 12
al., 1996). Furthermore, several in vitro and in vivo studies showed that many 14-3-3
isoforms can interact with the same target protein (Bachmann et al., 1996b;
Kanamaru et al., 1999; Rosenquist et al., 2000; Schoonheim et al., 2007a; Sullivan et
al., 2009). For example, it was shown that twelve recombinant Arabidopsis 14-3-3
isoforms were able to bind to the leaf cell PM H+-ATPase by using far-Western blotting
analysis (Alsterfjord et al., 2004). These results can be taken as indication of a high
degree of functional redundancy within 14-3-3 proteins.
On the other hand, differential target protein binding affinities between 14-3-3
isoforms were detected in a number of studies. For instance, it was shown that
seven of the Arabidopsis 14-3-3 isoforms were able to bind to NR in a yeast
two-hybrid assay (Kanamaru et al., 1999). The strongest affinity to NR was observed
for 14-3-3 omega, followed by and in the order phi, kappa, lambda, psi and chi, with
upsilon showing a very poor affinity. Alternative approaches, however, have shown
somewhat conflicting results. Bachmann et al. (1996) used synthetic phospho-NR
peptides to study the interaction between 14-3-3 isoforms and NR and also showed
the strongest binding to NR was by 14-3-3 omega. However, in contrast to the work
of Kanamaru et al. (1999), Bachmann and co-workers found that the 14-3-3 isoforms
chi and upsilon interact strongly with NR whilst phi showed only weak interaction in
their test system (Bachmann et al., 1996b). As shown by Athwal et al. (2000) these
differences in experimental outcome strongly depend on the parameters used in the
test system, for example, the binding affinities of 14-3-3s to NR changed dramatically
when the pH or the divalent cation concentration was altered (Athwal et al., 2000).
The discrepant results discussed above reveal a profound weakness of
interaction studies that are based on in vitro experiments or take place in
non-homologous in vivo systems such as the yeast two-hybrid analysis. Taking into
account that 14-3-3 proteins have a high degree of sequence similarity, especially in
Chapter 1. General introduction 13
the substrate binding internal groove, a degree of redundancy in the function of
14-3-3s is not surprising. Furthermore, those test systems do not take into account
that 14-3-3 genes are differentially expressed as shown for a large number of plant
isoforms (Daugherty et al., 1996; Roberts and Bowles, 1999; Rosenquist et al., 2001).
The subcellular localisation of 14-3-3s and target proteins may also determine
whether an interaction takes place as 14-3-3 proteins can be localised in the cytosol,
nucleus, chloroplasts and mitochondria (reviewed in Comparot el al., 2003).
Additionally, a 14-3-3 isoform shown to interact with a certain target protein in vitro
or in a heterologous system may not do so in a whole plant context due to spatial and
temporal expression patterns and regulatory mechanisms impacting on the ability of
14-3-3 isoforms to bind to the target protein. Thus, a homologous system is needed
in which 14-3-3 target protein interaction can be tested for, i.e. Arabidopsis 14-3-3
protein interactions will ideally be tested in Arabidopsis or at least in a plant system.
Such a system became available in form of the bimolecular fluorescence
complementation (BiFC) analysis (Bracha-Drori et al., 2004; Walter et al., 2004).
1.8. Bimolecular fluorescence complementation (BiFC):
live cell imaging for protein-protein interaction
Bimolecular fluorescence complementation, developed by Kerppola and
colleagues in 2002, is a very powerful technique to visualise protein interactions in a
native system. It was first used to show protein-protein interactions in living
mammalian cells (Hu et al., 2002; Hu and Kerppola, 2003), but was soon adapted to
fungal and plant systems (Bracha-Drori et al., 2004; Walter et al., 2004; Hoff and Kück,
2005). In plants, BiFC was used to test for the interaction of the Arabidopsis bZIP63
transcription factor with the zinc finger protein LSD1 and to demonstrate 14-3-3 dimer
formation in tobacco (Walter et al., 2004). Now BiFC is one of the most commonly
Chapter 1. General introduction 14
used techniques for the analysis of protein-protein interactions (reviewed in Kerppola,
2008). The technique is based on the re-association of two non-fluorescent
fragments of the yellow fluorescent protein (YFP). The coding regions of these two
fragments comprising of roughly equal sized amino (N-YFP) and carboxyl terminal
(C-YFP) parts of YFP are translationally fused to the coding regions of two proteins (e.g.
candidate protein 1 and 2), which are to be tested for interaction. The constructs
(candidate protein 1: N-YFP and candidate protein 2: C-YFP) are co-transformed into a
host system, which can be the native system from which the genes encoding the
candidate proteins were isolated. Re-association of a fluorescent YFP complex would
occur when the two candidate proteins interact with each other and the two YFP
fragments are brought closely together. The technique has the great advantage that
it can be used for the fast and relatively simple screening of protein-protein
interactions in transient expression systems. However, the greatest strength of the
system is that it allows for the detailed characterisation of such interactions in the
native biological system. Here, spatial and temporal interaction patterns can be
studied in living organisms, taking into account regulatory factors such as the
availability of light and nutrients or the impact of stresses such as low temperatures
or pathogens.
1.9. Aims of this project
The overall aim of this project was to investigate the functional specificity of
Arabidopsis 14-3-3 proteins with regards to physical protein interactions in vivo using
BiFC analyses. It was first necessary to adapt a BiFC assay system in planta for the
analysis of 14-3-3 interactions. Walter et al. (2004) had previously demonstrated
homodimerisation of a tobacco 14-3-3 isoform, T14-3c, using BiFC analysis in
transiently transformed Arabidopsis protoplasts and Nicotiana benthamiana leaves.
Chapter 1. General introduction 15
Thus, the same BiFC expression vectors described in Walter et al. (2004) were initially
used to establish the BiFC assay system for the analysis of Arabidopsis 14-3-3
interactions (Chapter 3). For this it was essential to generate a library of Arabidopsis
14-3-3 isoform genes in the BiFC vectors. In parallel, a suitable transient assay
system to study a large number of 14-3-3 dimers had to be established (Chapter 3).
It was proposed that dimerisations among 14-3-3 isoforms and localisation of 14-3-3
proteins may contribute to functional specificity (discussed in Chapter 4, Section 4.1).
Using the transient BiFC assay established in this project, a systematic study was
performed on the dimerisation and subcellular localisation of Arabidopsis 14-3-3
isoforms in living plant cells (Chapter 4). This was extended to the analysis of 14-3-3
dimers in transgenic Arabidopsis plants, allowing the analysis to be performed in a
whole plant context (Chapter 5). Furthermore, a preliminary study was conducted to
test for interactions of 14-3-3 isoforms with a potential 14-3-3 target protein, histone
deacetylase 2C (HD2C) and to establish if this interaction occurs in a 14-3-3
isoform-specific manner (Chapter 4).
During observation of the subcellular localisation of 14-3-3 dimerisations in the
transient BiFC assay, an atypical cytoplasmic distribution pattern – aggregation of BiFC
fluorescence into punctuate bodies – was detected. Attempts to identify possible
organellar destination for the 14-3-3 dimers and possible mechanism for the induction
of 14-3-3 dimer aggregations were conducted (Chapter 6).
In summary, aims of this project were to:
establish an in planta BiFC assay system for the analysis of 14-3-3 interactions
(Chapter 3).
test for dimerisations between Arabidopsis 14-3-3 isoforms and determine
subcellular localisation of the 14-3-3 dimers (Chapter 4).
test for interaction specificity of 14-3-3 isoforms with the potential target HD2C
and subcellular localisation of the 14-3-3-HD2C interaction (Chapter 4).
Chapter 1. General introduction 16
verify the 14-3-3 dimerisations in a whole plant context using transgenic
Arabidopsis plants (Chapter 5).
identify possible organellar destinations and mechanisms for the induced
aggregation of 14-3-3 dimer into punctuate bodies (Chapter 6).
Chapter 2. Materials and Methods 17
Chapter 2
Materials and Methods
Chapter 2. Materials and Methods 18
2.1. Materials
2.1.1. General Materials
General chemicals used in this study were of analytical or molecular biology
grade, and were purchased from Amresco (OH, USA), Sigma-Aldrich (MO, USA), Ajax
Finechem (NSW, Australia) and BDH/VWR International Ltd (UK) unless otherwise
stated. Water used in this work for preparation of buffers, solutions and media was
purified using a Milli-Q® Plus Ultra Pure Water System (Millipore, USA) prior to use.
2.1.2. Biological materials
2.1.2.1. Escherichia coli strains used in this study
TOP10: F- mcrA Δ (mrr-hsdRMS-mcrBC) Φ80lacZΔM15 ΔlacX74 recA1 araD139
Δ(araleu)7697 galU galK rpsL (StrR) endA1 nupG (Invitrogen, CA, USA)
DH5α: F- Φ80lacZΔM15 Δ (lacZYA-argF)U169 recA1 endA1 hsdR17(rk-, mk
+) phoA
supE44 thi-1 gyrA96 relA1 λ- (Invitrogen)
2.1.2.2. Agrobacterium strains used in this study
Agrobacterium tumefaciens strain GV3101/pMP90 (Koncz and Schell, 1986)
carrying the pSOUP plasmid was a gift of Dr. Isara Pracharoenwattana and Prof. Steven
Smith, ARC Centre of Excellence in Plant Energy Biology, UWA, Perth, Australia. A.
tumefaciens strain C58C1/pCH32 was kindly given by Dr. Anne Bersoult and Prof. Ian
Small, ARC Centre of Excellence in Plant Energy Biology, UWA, Perth, Australia.
2.1.2.3. Plant materials
Arabidopsis thaliana (Columbia ecotype; Col-0) seeds were purchased from the
Arabidopsis Biological Resource Centre (ABRC).
Chapter 2. Materials and Methods 19
Nicotiana benthamiana (Nicotiana) seeds were generously provided by Prof.
Mike Jones, Murdoch University, Perth, Australia.
2.1.2.4. Plasmids and primers
Plasmids:
The pUC-SPYNE and pUC-SPYCE plasmids were kindly provided by Profs. Claudia
Oecking, and Klaus Harter, ZMBP, Pflanzenphysiologie, Universität Tübingen,
Tübingen, Germany (Walter et al., 2004).
The pCRII-TOPO® vector was provided with the TOPO TA Cloning® kit
(Invitrogen).
The p19 suppressor of gene silencing plasmid (Voinnet et al., 2003) was a gift of
Prof David Baulcombe at the Sainsbury Laboratory Plant Biosciences Limited, Norwich,
UK.
The pSOUP plasmid and pGreen vectors (Hellens et al., 2000b), pGreen0179 and
pGreen0229, were obtained from John Innes Centre, Norwich, UK
(http://www.pgreen.ac.uk).
The pCAMBIA 1302 plasmid was obtained from CAMBIA, Canberra, ACT,
Australia (http://www.cambia.org).
Constructs encoding four different fluorescent protein-tagged organelle
markers, targeting to the mitochondrion, ER, Golgi or peroxisome, were gifts of Dr.
John Bussell and Prof. Steven Smith (ARC Centre of Excellence in Plant Energy Biology,
UWA, Perth, Australia) and are available through the DNA Stock Centre of the ABRC
(http://www. arabidopsis.org). These organelle markers, comprising of a
multicoloured set, were generated by Nelson and co-workers (Nelson et al., 2007).
The mitochondrial, ER and Golgi markers, tagged with mCherry fluorescent protein, a
Chapter 2. Materials and Methods 20
derivative of the monomeric red fluorescent protein, mRFP1, (Shaner et al., 2004),
were used in this study. The mitochondrial marker was created by incorporating the
transit peptide sequence of the yeast mitochondrial cytochrome c oxidase IV (ScCOX4;
Köhler et al., 1997) upstream of the mCherry sequence. The ER targeting marker
was made by adding the signal peptide of the Arabidopsis cell wall-associated kinase
2 (AtWAK2; He et al., 1999) at the N-terminus and the ER retention signal
His-Asp-Glu-Leu (HDEL) at the C-terminus of the mCherry sequence (Gomord et al.,
1997). The Golgi targeting marker was generated by integrating the first 49 amino
acids of soybean α-1, 2-mannosidase I (GmMan1; Saint-Jore-Dupas et al., 2006) at the
N-terminus of the mCherry marker. All of these marker genes are under the control
of a double 35S promoter and carried by the pBIN-based binary plasmid (Nelson et al.,
2007).
The peroxisome marker used in this study is genetically engineered by addition
of the peroxisomal targeting signal 1 (PTS1) sequence (IHHPRELSRL) of pumpkin
malate synthase (MLS) at the C-terminus of the mRFP (Pracharoenwattana et al.,
2005). The peroxisome marker construct is driven by a double 35S promoter
(Pracharoenwattana et al., 2005).
Primers:
Primers used in this study are summarised in the following tables. The primers
used for the amplification of the open reading frame (ORF) of twelve 14-3-3 isoform
genes are listed in Table 2-1. The primers used for general purposes are listed in
Table 2-2.
2.2. Nucleic acid methods
All molecular cloning manipulations and procedures were done according to the
standard protocols in Sambrook et al. (1989) unless otherwise stated.
Chapter 2. Materials and Methods 21
Table 2-1. Primers for amplification of full-length coding regions of 14-3-3s
or the coding regions of N-terminally truncated (N-Δ) 14-3-3s.
14-3-3 Forward primer (for full-length) Reverse primer* Forward primer (for N-Δ)
chi 5’-CAACAATGGCGACACCAGGAG 5’-tcgcctcgagGGATTGTTGCTCGTCAGC 5’-ATGGAGAAAGTCGCGAAAG
epsilon 5’-CTATGGAGAATGAGAGGGAAAAGC 5’-tcgcctcgagGTTCTCATCTTGAGGCTCATC 5’-ATGAAGAAAGTTGCTCAGCTTG
iota 5’-ACAAAATGTCATCATCAGGATCCG 5’-tcgcctcgagGTTCTCAGTGGCATCGG 5’-ATGAAGAAAGTGGCGAGG
kappa 5’-CTCTAATGGCGACGACCTTAAGC 5’-tcgcctcgagGGCCTCATCCATCTGCTC 5’-ATGGAACAGCTCGTAAGTG
lambda 5’-CTCTAATGGCGGCGACATTAGG 5’-tcgcctcgagGGCCTCGTCCATCTGCTC 5’-ATGGAACAGCTCGTTACAG
mu 5’-CAGTCATGGGTTCTGGAAAAGAG 5’-tcgcctcgagCTCTGCATCGTCTCCAC 5’-ATGAAAAGTGTTGCGAAATTAAATG
nu 5’-ATAAGATGTCGTCTTCTCGGGAAG 5’-tcgcctcgagCTGCCCTGTCTCAGCTG 5’-ATGGAGAAAGTTGCAAAGAC
omega 5’-CAACAATGGCGTCTGGGCGTG 5’-tcgcctcgagCTGCTGTTCCTCGGTCG 5’-ATGGAGAAAGTCTCCGCC
omicron 5’-CTATGGAGAACGAGAGAGCGAAGC 5’-tcgcctcgagCTTACCTCCTTCCTCTAGATC 5’-ATGAAGAAAGTTGCAGCTCTTG
phi 5’-TAATGGCGGCACCACCAGCATC 5’-tcgcctcgagGATCTCCTTCTGTTCTTCAGC 5’-ATGGAAAAAGTCGCTGAAGC
psi 5’-CGAAGATGTCGACAAGGGAAGAG 5’-cgccctcgagCTCGGCACCATCGGG 5’-ATGGAGAAAGTTGCGAAAACTG
upsilon 5’-CAAAGATGTCTTCTGATTCGTCCCG 5’-tcgcctcgagCTGCGAAGGTGGTGG 5’-ATGGAGAAAGTTGCAAAGACC
* Artificially designed sequence adaptors are in lower case. The first ATG for the 14-3-3 ORFs is
shown in bold. The XhoI restriction site sequence (ctcgag), which replaced the nucleotides
encoding the stop codons of 14-3-3 isoforms, is underlined.
Table 2-2. Primers used for general purposes.
Primer name Primer sequences Description
35S-Seq (forward)
5’-GTAAAGACTGGCGAACAG For sequence determination of 14-3-3 ORFs in the pGreen-based BiFC vectors and for PCR genotyping
NYFPsp1 (reverse)
5’-ATGAACTTCAGGGTCAGC as above
CYFPsp1 (reverse)
5’-AGCTCAGGTAGTGGTTGTC as above
2.2.1. Plasmid DNA isolation
2.2.1.1. Plasmid DNA preparation
All of the following procedures were performed at room temperature. A single
transformant colony was picked from selective Luria-Bertani Broth [LB; Sambrook et
al. (1989)] plates and grown overnight at 37°C in liquid selective LB with shaking at
Chapter 2. Materials and Methods 22
225 rpm. Cells were collected by centrifugation (12000 x g; Eppendorf centrifuge
5415D, Hamburg, Germany) and re-suspended in Miniprep Solution I (Appendix I).
Miniprep Solution II (Appendix I) was added to lyse the cells, and the suspension was
then neutralised by adding Miniprep Solution III (Appendix I). The cell debris was
collected at 12000 x g for 5-10 min and the supernatant was transferred to a new
microfuge tube. Ice-cold 100% ethanol was added into the supernatant to
precipitate the plasmid DNA. After a centrifugation at 12000 x g for 2 min, the
plasmid DNA was washed in 70% ethanol, air-dried and re-suspended in sterile Milli-Q
H2O (MQ H2O).
2.2.1.2. Isolation of plasmid DNA using a commercial kit
Highly purified plasmid DNA was used for automated DNA sequence
determination (Section 2.2.7), transformation of bacteria (Section 2.3.2 and 2.3.4) and
polyethylene glycol (PEG)-mediated transfection of Arabidopsis mesophyll protoplasts
(Section 2.4.3). High purity plasmid DNA was isolated using a commercial miniprep
kit, the Wizard® Plus SV Minipreps DNA purification System (Promega Co., WI, USA)
according to the manufacturer’s instructions.
2.2.2. Restriction enzyme digestion
The restriction enzymes used in this study were purchased from either TaKaRa
Bio Inc. (Shiga, Japan), New England Biolabs Inc. (MA, USA) or Promega. A typical
restriction digestion procedure was done by using 0.5-2 μg of plasmid DNA digested
with 2-10 units of restriction enzyme in 1 x supplied enzyme buffer to a final volume
of 20 μl. Sometimes bovine serum albumin (BSA) was added, according to
manufacturer’s instruction. RNase A (0.5-1 μg; Invitrogen) was added to digest RNA
molecules in the plasmid DNA preparation (section 2.2.1.1). Temperature and
Chapter 2. Materials and Methods 23
incubation time for restriction digests were used as recommended by the suppliers.
The digested plasmids were analysed by agarose gel electrophoresis (section 2.2.3).
2.2.3. Agarose gel electrophoresis
In general, 0.6%-2% agarose TAE (Appendix I; Sambrook et al., 1989) gels
containing 0.5 μg ml-1 ethidium bromide (EtBr) were used to separate linear DNA
fragments, depending on their molecular sizes. DNA samples were mixed with
one-fifth (1/5) volume of Orange G loading dye (Appendix I) before loading into gel
wells. Samples were separated in 1x TAE buffer in an electrophoresis apparatus
(SUB-CELL® GT or MINI-SUB CELL® GT, Bio-Rad Laboratories Pty., Ltd., NSW, Australia)
at a constant voltage between 50 and 100 V, depending on the percent agarose, until
the dye migrated to the bottom of the gel. Images were taken using a Gel Doc™ XR
and ChemiDoc™ XRS Gel Documentation System and Quantity One software (Bio-Rad),
and then were processed using Adobe Photoshop® 5.0 software (Adobe System Inc.,
CA, USA).
2.2.4. Ligation of DNA fragments into vectors
For subcloning purposes, DNA fragments (inserts and vectors) were purified
from agarose gels using the Wizard® SV Gel and PCR Clean-up System (Promega). In
general, the purified inserts were mixed with the destination vectors in a molar ratio
of 3:1 for ligation, and with 0.1-1 unit of T4 DNA ligase (Promega) and 1 x ligase buffer
in a total volume of 10 μl. The ligation reaction was incubated at 14°C overnight.
The recombinant plasmids were then transformed into chemically competent
Escherichia coli (E. coli) cells (Section 2.3.2).
Chapter 2. Materials and Methods 24
2.2.5. Polymerase Chain Reaction (PCR)
A typical 25 μl PCR mixture for an analytical PCR included: 1 x NH4 Reaction
Buffer (Bioline), 2 mM MgCl2, 1 mM dNTP mix (250 μM each), 0.25 μM forward and
reverse primers, and 0.625 unit of Taq polymerase (BIOTAQ®, Bioline). The amount
of required template depended on the source of DNA sample. Generally, picogram
levels of plasmid DNA or microgram levels of genomic DNA were required as a PCR
template.
A typical thermocycling program generally used for amplification of an 1 kb DNA
fragment was as follows: 96°C for initial denaturation for 5 min, 30-35 cycles of 96°C
for 30 s, 55°C (for primers annealing) for 30 s and 72°C (for elongation) for 1 min,
followed by a final elongation step at 72°C for 6 min. PCR was done using a
programmable thermal cycler (PTC-100, MJ Research Inc., MA, USA). PCR products
were analysed by agarose gel electrophoresis (Section 2.2.3).
In order to minimise the possibility of PCR errors, a high-fidelity Taq polymerase
(Accuzyme®, Bioline) was used to amplify coding sequences of Arabidopsis 14-3-3
isoforms. The DNA templates used for the amplification were from either an
Arabidopsis cDNA library (Minet et al., 1992), a mixture of first strand cDNA
generated from Arabidopsis leaves and roots (Dr. T. Martin laboratory), or 14-3-3
cDNA clones purchased from the ABRC. The primers used in the amplification
reactions are listed in Table 2-1. The thermocycling program used for the
high-fidelity Taq polymerase, Accuzyme®, was similar to a typical PCR, except a longer
elongation time was used (1.5-2 min for 1 kb).
2.2.6. TOPO TA Cloning®
The PCR products encoding DNA fragments of interest were cloned into the
pCRII-TOPO® vectors using the TOPO TA Cloning® kit (Invitrogen) as per the
manufacturer’s instructions.
Chapter 2. Materials and Methods 25
2.2.7. Sample preparation for automated DNA sequence determination
The BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) was
used for automated DNA sequence determination. Purified plasmid DNA or PCR
fragments were used as template for the sequencing reactions. A sequencing
reaction was prepared by mixing 2 μl of BigDye® Terminator reaction mix, 2 μl of 2.5 x
sequencing buffer (Applied Biosystems), 100-250 ng of double-stranded DNA and 1.6
pmol of sequencing primer in a final volume of 10 μl. Cycle sequencing was done
with a thermal cycler (PTC-100, MJ Research) using the following program: an initial
denaturation at 96°C for 1 min, followed by 30 cycles of 96°C for 10 s, 50°C for 5 s and
60°C for 4 min. Samples were added to 1 μl of 3 M sodium acetate, pH 4.6-4.7 and
25 μl of 95% ethanol for DNA precipitation. After 15 min, the sample was collected
at 16000 x g for 20 min, washed gently with 70% ethanol and then collected again at
16000 x g for 5 min. After drying, the samples were submitted to the Lotterywest
State Biomedical Facility Genomics (LSBFG), Perth, Australia
(http://lsbfg.meddent.uwa.edu.au/) for sequence determination.
2.3. Bacterial methods
2.3.1. Preparation of competent E. coli cells
The rubidium chloride method for preparation of competent cells was used as
described by Hanahan (1985). An E. coli strain (section 2.1.2.1) was streaked on a LB
plate and grown overnight at 37°C. A single colony from the plate was used to
inoculate 3 ml LB liquid medium and the bacteria were grown overnight at 37°C with
shaking at 225 rpm. An aliquot of the starter culture was used to inoculate a 100 x
volume of LB medium containing 20 mM MgSO4. Cells were grown at 37°C with
shaking at 225 rpm until the optical density at 600 nm (OD600) of the culture reached
0.4-0.6. The cells were collected by centrifugation at 4500 x g for 5 min at 4°C.
Chapter 2. Materials and Methods 26
Cells were kept at 4°C or on ice for the rest of the procedure and all of the following
preparation steps were performed in a cold room. The cell pellet was gently
re-suspended in a 0.4 volume of ice-cold TFB 1 (Appendix I). Cells were incubated
on ice for 5 min and subsequently collected by centrifugation at 4500 x g for 5 min at
4°C. The supernatant was decanted and the cell pellet was re-suspended very gently
in 1/25 volume of the subculture volume using ice-cold TFB 2 (Appendix I). The cell
suspension was incubated on ice for 15-60 min, and then divided into 100 or 200 μl
aliquots, snap-frozen in liquid nitrogen and then stored at -80°C.
2.3.2. Transformation of E. coli competent cells
Competent cells were thawed on ice. An aliquot (minimum 10 μl) of
competent cells was mixed gently with 1 μl of plasmid DNA (approximately 10 ng of a
ligation reaction). The suspension was incubated on ice for 30 min. The cells were
heat shocked in a 42°C water bath for 45-60 s, followed by incubation on ice for 2 min.
LB medium (150 μl) was added to the cell suspension and the cells were incubated at
37°C for 1 h with shaking (225 rpm). A 20 μl aliquot of the transformed cells was
spread onto a selective LB plate with appropriate antibiotic(s) or selection of
transformants. The remainder of the transformation mix was spread on a second
selective LB plate. The cells were incubated overnight at 37°C.
For selection of E. coli cells carrying pCRII-TOPO-based recombinant vectors,
ampicillin (100 μg ml-1) or kanamycin (50 μg ml-1) was used. For E. coli cells carrying
the pCAMBIA 1302 vector or pGreen-based vectors, kanamycin (50 μg ml-1) was used.
2.3.3. Preparation of competent Agrobacterium cells
The A. tumefaciens strain GV3101/pMP90 containing the pSOUP plasmid was
streaked and grown on a LB plate with rifampicin (50 μg ml-1), gentamicin (5 μg ml-1)
Chapter 2. Materials and Methods 27
and tetracycline (2 μg ml-1) at 28-30°C for 2-3 days. A single colony was used to
inoculate 3 ml LB medium with rifampicin (50 μg ml-1) and gentamicin (5 μg ml-1) and
cells were grown at 28-30°C with 225-250 rpm shaking overnight. An aliquot (1 ml)
of the overnight culture was used to inoculate 100 ml LB medium containing
rifampicin and gentamicin and the cells were grown at 28-30°C with 225-250 rpm
shaking until the culture reached an OD680 of 0.5-1.0. The culture was chilled on ice
for 10 min, then transferred to pre-chilled tubes and cells were collected at 3000 x g
for 10 min at 4°C. The cell pellet was rinsed with 1 ml of ice-cold 20 mM CaCl2 and
collected again by centrifugation to remove the residual antibiotics. The cell pellet
was re-suspended in 2 ml ice-cold 20 mM CaCl2 (1/50 volume of culture) and 0.2 ml
aliquots were snap-frozen in liquid nitrogen and stored at -80°C.
2.3.4. Transformation of Agrobacterium cells
The freeze-thaw method described here for transformation of Agrobacterium
cells was an adaptation from the protocol of Höfgen and Willmitzer (1988).
Competent Agrobacterium cells were thawed on ice. A 20 μl aliquot of the cells was
mixed with 1-2 μl of purified plasmid DNA, incubated on ice for 5 min, frozen in liquid
nitrogen for 5 min and then thawed in a 37°C water bath for 5 min. LB medium (100
μl) was added and the cell suspension was mixed. The suspension was incubated at
28-30°C with shaking at 250 rpm for 2 h. The cells were spread on LB plates
containing appropriate antibiotics (Table 2-3) and grown at 28-30°C for 2-3 days.
Positive clones were confirmed using colony PCR analysis (Section 2.3.5).
2.3.5. Colony PCR
Transformed Agrobacterium cells were confirmed by PCR. A single
transformant colony was re-suspended in 10 μl sterile MQ H2O. A 5 μl aliquot of the
Chapter 2. Materials and Methods 28
cell suspension was used as the template for a general PCR (Section 2.2.5) with
specific primers for the target sequence in the recombinant plasmids. The remaining
5 μl of the suspension was used to make a glycerol stock (Sambrook et al., 1989) for
subsequent use.
Table 2-3. Antibiotics used for selection of Agrobacterium cells.
Agrobacterium
strain
for chromosomal
selection
for Ti-plasmid
selection
for binary vector
selection
for helper plasmid
selection
GV3101 rifampicin
(50-100 μg ml-1)
pMP90
(gentamycin 5-10 μg ml-1)
pGreens or
pCAMBIA 1302
(kanamycin 50 μg ml-1)
pSOUP
(tetracycline 2 μg ml-1)
C58C1 rifampicin
(50-100 μg ml-1)
pCH32
(tetracycline 2 μg ml-1)
p19 vector
(kanamycin 50 μg ml-1) -
2.4. Plant methods
2.4.1. Plant growth
In general, A. thaliana and N. benthamiana plants were grown on compost mix,
which was prepared using 70% volume of Shamrock® composts (Seed & Modular
propagating medium, Scotts, UK) with 30% of fine vermiculite from a local supplier
(Perlite & Vermiculite Factory, WA, Australia). Plants were grown in a growth cabinet
at 22 ± 1°C under a long day photoperiod (16 h of approximately 100 μE m-2 s-1 light
and 8 h dark) unless otherwise stated. Water was provided from the bottom of pots.
For germination, Arabidopsis seeds were stratified at 4°C in the dark for 2 days before
transfer into the growth cabinets; while Nicotiana seeds did not need stratification for
germination.
Chapter 2. Materials and Methods 29
2.4.2. Isolation of Arabidopsis mesophyll protoplasts
The following procedures to isolate mesophyll protoplasts from Arabidopsis
leaves were combinations of protocols from Huang and Chen (1988) and Yoo et al.
(2007), with minor modifications to adapt to facilities available in the laboratory.
Mesophyll protoplasts were prepared from rosette leaves of 4-5 week-old
soil-grown Arabidopsis plants. Approximately 0.5 g of leaves were detached and
briefly surface sterilised in 70% ethanol for 1 min, followed by three washes with
sterile MQ H2O. The leaves were sliced into 1-2 mm wide strips in 10 ml of
protoplasting solution [1% cellulase (onozuka R-10; Duchefa Biochemie, Netherlands),
0.2% macerozyme (Duchefa Biochemie), 0.4 M sucrose, 20 mM KCl, 10 mM CaCl2, 20
mM 2-(N-morpholino) ethanesulfonic acid (MES)-KOH, pH 5.7, 0.45 μm filtered]
within a 9 cm Petri dish, and then vacuum-infiltrated for 25 min to allow the
protoplasting solution to permeate the intercellular airspaces. Subsequently, the
leaf strips were incubated at room temperature in the dark for 3-16 h to give the
enzymes sufficient time to digest cell walls. The release of protoplasts gradually
turned the yellowish, clear protoplasting solution into greenish over time. The
greenness of the solution and the digested leaf strips were used as primary indicators
for the release of protoplasts. The protoplast suspension was passed through a
sieve (approximate 1 mm pore) to remove the large pieces of undigested debris.
The crude protoplast suspension was carefully transferred to a 15 ml Falcon tube
using a wide-bore pipet, and the cell debris was pelleted by centrifugation at 100 x g
for 5 min using a swing bucket centrifuge (Eppendorf centrifuge 5804). The floating
protoplasts (as a thin, green layer at the top of supernatant) were transferred
(approximately 1 ml) to a 15 ml tube. The volume was brought to 10 ml with W5
solution (154 mM NaCl, 125 mM CaCl2, 5 mM KCl, 2 mM MES-KOH, pH 5.7) and the
suspension then mixed gently by inversion. The protoplasts were collected as
Chapter 2. Materials and Methods 30
described above. The supernatant was removed using a wide-bore pipet and the
protoplast pellet was re-suspended 5 ml of fresh W5 solution.
2.4.3. Polyethylene glycol-mediated transfection of A. thaliana mesophyll
protoplasts
The number of protoplasts was estimated by diluting the suspension at least
100 x in W5 solution. Three aliquots of 10 μl of diluted protoplasts were placed on a
glass slide and the number of protoplasts was counted using an inverted microscope
(Olympus IX71). To assess protoplast viability, a 50 μl aliquot of protoplast
suspension was stained with 400 μg ml-1 methylene blue (Huang et al., 1986).
Damaged protoplasts and contaminating cell debris were stained blue, whereas viable
protoplasts excluded the dye and remained green. More than 90% of the
protoplasts were viable in a typical preparation.
This PEG-mediated transfection of protoplasts followed the protocol described
by Yoo et al. (2007). The protoplast suspension (Section 2.4.2) was incubated on ice
for at least 30 min. The chilled protoplasts were collected at 100 x g for 5 min and
gently re-suspended to a density of 2 x 105 cells ml-1 in MaMg solution (0.4 M
mannitol, 15 mM MgCl2, 5 mM MES-KOH, pH 5.7). A 100 μl aliquot of protoplast
suspension (approximate 2 x 104 protoplasts) was mixed with 10 μl of purified
plasmid DNA (10-20 μg plasmid DNA) by gentle swirling using a pipet tip.
PEG-calcium solution [110 μl; 40% (w/v) PEG 3350 (Sigma), 0.2 M mannitol, 100 mM
CaCl2; Appendix I] was added to the protoplast-DNA mixture and then the entire
suspension was mixed to homogeneity by gently swirling. The suspension was
incubated at room temperature for 5-30 min, followed by the addition of 0.44 ml of
W5 solution and gentle mixing. The protoplasts were collected again at 100 x g for 5
min and the pellet was diluted gradually with W5 solution to a final volume of 1 ml.
Chapter 2. Materials and Methods 31
The transfected protoplasts were incubated in a growth cabinet at 22°C in the dark.
After 16-24 h incubation, the protoplasts were analysed for transgene expression.
For the BiFC analysis of 14-3-3 dimerisation, equal amounts of a 14-3-3-YN and a
14-3-3-YC plasmid (Section 3.2.4 and Table 3-2) were combined for the transfection of
Arabidopsis mesophyll protoplasts following the procedures described above. In
parallel using a second protoplast sample, a green fluorescent protein (GFP)
gene-containing plasmid, pCAMBIA 1302, was used as a positive control to evaluate
the efficiency of the transfection method. Fluorescence was examined 24-48 h after
transfection using a conventional fluorescence microscope (Section 2.5.1).
2.4.4. Agroinfiltration of Arabidopsis and Nicotiana leaves
The procedures for agroinfiltration of Arabidopsis leaves were as previously
described in Bracha-Drori et al. (2004). The agroinfiltration of Nicotiana leaves was
based on several previous studies (Voinnet et al., 2003; Walter et al., 2004; Schütze et
al., 2009) with minor modifications. Briefly, a colony of the Agrobacterium strain
harbouring a plant expression vector was grown in 3 ml of LB medium with
appropriate antibiotics (Table 2-3). Cells were grown overnight at 28-30°C with
shaking (225 rpm). The cells of the overnight culture were collected at 16000 x g for
30 s and re-suspended in 1 ml of infiltration buffer without acetosyringone (10 mM
MgCl2, 10 mM MES-KOH, pH 5.6). Then the cell suspension was diluted to an OD600
0.7-0.8 with the infiltration buffer containing 200 μM acetosyringone and incubated
at room temperature for 1 h. Working suspensions for the infiltration were
prepared by mixing desired Agrobacterium clones for the transient assay.
For the BiFC assay, the working suspensions were prepared by mixing
appropriate clones containing the BiFC constructs and the p19 plasmid at a 1:1:1 ratio.
For a GFP positive control, the pCAMBIA 1302 (35S-GFP)-containing Agrobacterium
Chapter 2. Materials and Methods 32
clone was combined with the p19 clone for leaf infiltration. In addition, the working
suspensions for the co-localisation study of 14-3-3 dimeric complexes and organelle
markers (Section 2.1.2.4) were prepared by mixing appropriate clones containing the
BiFC constructs, the p19 plasmid and an organelle marker construct at a 1:1:1:0.1
ratio (Section 4.2.5).
Infiltration mixtures were injected into the abaxial air space of leaves of 6-8
week-old Nicotiana plants using a 1 ml syringe (without a needle) until the entire leaf
air space was filled up with the Agrobacterium suspension. The injected leaves were
marked with a pen. Lower epidermal layers of infiltrated leaves were examined for
fluorescence three days after infiltration using a fluorescence microscope or a
confocal microscope (Section 2.5.1 and 2.5.2).
2.4.5. Transformation of Arabidopsis using floral dipping
The floral dip method for Arabidopsis transformation was an adaptation of
protocols of Clough and Bent (1998) and Logemann et al. (2006). Growth of
Arabidopsis plants was as previously described (Section 2.4.1). Primary bolts of
healthy, flowering Arabidopsis plants were clipped to trigger the growth of more
flowering branches. The floral dip transformation was performed when the new
flowering branches grew to approximately 10 cm in height and contained some open
flowers and few green siliques (approximately 4-6 days after clipping).
A colony of transformed Agrobacterium cells was completely re-suspended in
20 μl sterile MQ H2O. The bacterial suspension was evenly spread on the entire
surface of a LB plate containing appropriate antibiotics (Table 2-3). The bacteria
were grown at 28-30°C for 2-3 days until a confluent bacterial lawn was obtained. To
collect the densely grown bacteria, approximate 4 ml of 5% sucrose were added to
the plate, and the bacteria were scraped off from the agar and suspended in the
Chapter 2. Materials and Methods 33
sucrose solution. The bacterial suspension was then transferred to microfuge tubes.
The cells were collected at 4000 x g for 10 min at room temperature and the
supernatant was decanted. The pellets were re-suspended in 5% sucrose containing
0.01% silwet L-77 to reach an OD600 of 0.8 for the floral dipping. The suspension was
poured into a disposable plastic bag and the inflorescences of plants (approximately
20 plants per pot) were dipped into the solution for 30 s with gentle agitation. The
inflorescences were covered loosely by placing a plastic bag over the pot for 16 to 24
h to maintain high humidity in the micro-environment surrounding the dipped flowers.
A second dip was performed seven days after the first dip. The plants were then
grown under the conditions described in Section 2.4.1 until seeds matured. Mature
seeds were collected and screened for transformation events using appropriate
antibiotics or herbicides selection methods (Section 2.4.7).
2.4.6. Surface sterilisation of Arabidopsis seeds
Approximately 20 mg of seeds were mixed with 1 ml of seed sterilisation
solution (Appendix I) in a microfuge tube and shaken vigorously for 5 min. Seeds
were then washed two times with 1 ml of 95% ethanol. After each wash, ethanol
was removed using a micro pipette. The seeds were left in a laminar flow hood for a
few hours to evaporate residual ethanol.
To surface sterilise a small amount of seeds (20-50 seeds), seeds were
dampened with 70% ethanol on a sterile filter paper in a laminar flow hood, followed
by rinsing the seeds with 95% ethanol. When the ethanol completely evaporated,
the dry, sterilised seeds were sprinkled on the surface of a 0.5 x Murashige and Skoog
(MS) medium plate (Appendix I).
Chapter 2. Materials and Methods 34
2.4.7. Screening Arabidopsis transformants
2.4.7.1. Screening transformants on plates
Arabidopsis seeds harvested after floral-dip transformation (T1 seeds) were
screened for transformants using antibiotics or herbicide, depending on the plant
selection marker gene carried in the binary vector. For the pGreen0179-based
14-3-3 BiFC constructs, hygromycin B was used; while Basta® (glufosinate ammonium,
a herbicide) was used for the pGreen0229-based constructs. The selection procedures
for transformants were done according to Harrison et al. (2006). Sterilised T1 seeds
(Section 2.4.6) were sprinkled on 0.5 x MS medium plates containing 30-50 μM Basta
or 10-15 μg ml-1 hygromycin B, and then stratified at 4°C in the dark for 2 days.
After stratification, the plates were transferred to growth cabinets and incubated for
4-6 h at 22°C in continuous white light to stimulate seed germination. The plates
were then wrapped with aluminium foil to protect the seeds from light, and
incubated at 22°C for 2 days. After the foil was removed, germinated seedlings were
grown at 22°C in continuous white light for 24-48 h or in a 16 h day:8 h night
photoperiod for the selection of phenotypes. Transformants were screened based
on the following phenotypes: Basta-resistant seedlings would have long hypocotyls
and green cotyledons, non-resistant seedlings would have long hypocotyls and pale
cotyledons. In contrast, seedlings resistant to hygromycin B would have long
hypocotyls, green cotyledons and elongated roots, whereas non-resistant seedlings
would have short hypocotyls and short roots, but had also green cotyledons.
Candidate transformants were transferred to pots containing compost:vermiculite
mix (Section 2.4.1) and transgenes were confirmed by PCR genotyping (Section 2.4.9)
once leaves had developed.
2.4.7.2. Screening for transformants using Basta selection on soil-grown
plantlets
Chapter 2. Materials and Methods 35
Basta resistant transgenic Arabidopsis plants can also be selected for when
grown in soil (Weigel and Glazebrook, 2002). To do this, T1 seeds were sown on
pre-dampened compost mix (Section 2.4.1) and then stratified at 4 oC in the dark for 2
days. Pots were removed from 4 oC conditions and transferred to growth cabinets
for germination and growth of seedlings. Once green cotyledons of seedlings were
fully expanded, seedlings were sprayed with Basta solution (200 μM in water) 2-3
times over a two-day period. Cotyledons of transformants stayed green and such
seedlings continued to grow. Cotyledons of untransformed plants and wild type
controls turned yellow and wilted with no further growth. Potential transformants
were transferred individually to pots with new compost mix and grown until they
developed several leaves. Leaves were used to confirm positive transformation
events by PCR genotyping (Section 2.4.9).
2.4.8. Plant genomic DNA isolation
2.4.8.1. Genomic DNA isolation using the cetyltrimethyl ammonium
bromide (CTAB) method
The CTAB method to isolate plant genomic DNA was performed according to
Gawel and Jarret (1991). Approximately 10 mg of leaf tissues were ground at room
temperature with 500 μl CTAB extraction buffer (Appendix I). The CTAB extraction
buffer was added in two aliquots: initially 50 μl were added to initiate the grinding
process. The remaining buffer was added when most of the tissue was separated
into smaller pieces. The sample was incubated at 65°C for 2 h with frequent mixing
and then cooled to room temperature. Following the addition of 4 μg of RNase A
(Invitrogen), the sample was incubated at 37°C for 1 h. The sample was extracted
twice with an equal volume of chloroform:isoamyl alcohol (24:1, v/v). The final
aqueous phase was added to two-thirds volume of 100% isopropanol and mixed
Chapter 2. Materials and Methods 36
gently to precipitate the DNA at -20°C overnight. The DNA was collected at 16000 x
g at room temperature for 15 min and washed twice with two-thirds volume of 70%
ethanol. The DNA pellet was air-dried at room temperature for 5-20 min and then
re-suspended in 50 μl of sterile MQ H2O. A 5 μl aliquot was used to check the
quality of DNA by agarose gel electrophoresis (Section 2.2.3).
2.4.8.2. Genomic DNA isolation using the method of Wang et al. (1993)
Genomic DNA from plants prepared using the CTAB method (section 2.4.8.1)
was of a high quality and well suited for PCR characterisation. Alternatively, a faster
protocol described by Wang et al. (1993) was used to obtain genomic plant DNA for
PCR analysis if the quality of the DNA was not required to be so high, and it is briefly
described as below. One to two pieces of leaves (a few milligrams) were ground in
0.5 N NaOH (5 μl mg-1 leaf tissue) using a microfuge tube pestle until no large pieces
of tissues remained. A 10 μl aliquot of the extract was mixed with 490 μl of 100 mM
tris (hydroxymethyl) aminomethane (Tris)-Cl pH 8.0. An aliquot (5 μl) of the diluted
extract was used directly as a template for an analytical PCR (Section 2.2.5).
2.4.9. PCR genotyping of transgenic plants
The existence of a transgene in a putative transgenic plant was determined by
using microgram amounts of plant genomic DNA (Section 2.4.8) as the template in
combination with specific primers for the gene of interest in a typical PCR (Section
2.2.5), followed by agarose gel electrophoresis (Section 2.2.3).
2.4.10. Biochemical treatments
2.4.10.1. Hydrogen peroxide treatment
Protoplasts were isolated from rosette leaves of transgenic Arabidopsis showing
GFP or BiFC fluorescence (Section 2.4.2). Aliquots of the protoplast suspension
Chapter 2. Materials and Methods 37
(approximately 2 x 103 protoplasts each) were individually treated with 0, 0.2 and 1
mM Hydrogen peroxide (H2O2) at room temperature and in the dark. Fluorescence
in the protoplasts was examined at 12 and 24 h post-treatment using conventional
fluorescence microscopy.
2.4.10.2. Methyl jasmonate treatment
Aliquots from the same batch of protoplast suspension used in the H2O2
treatment (Section 2.4.10.1) were used for the methyl jasmonate (MeJA) treatment.
Protoplasts were treated with 0.1% ethanol (solvent of MeJA as a mock-treated
control; 0 μM of MeJA) 5, or 50 μM MeJA at room temperature in the dark.
Fluorescence in the protoplasts was examined at 12 and 24 h post-treatment using
conventional fluorescence microscopy.
For MeJA treatment of leaves, detached rosette leaves from 5-6 week-old
transgenic Arabidopsis plants expressing GFP or 14-3-3-BiFC constructs were
sub-immersed in 0.1% ethanol (mock-treated control) or in 50 μM MeJA solution for
38 h. Effects of the MeJA treatment on fluorescence distribution in epidermal cells
were examined by conventional fluorescence microscopy.
For MeJA treatment of seedlings, ten day-old transgenic seedlings with GFP or
BiFC fluorescence were transferred from hygromycin selective plates (1/6 x MS, 1%
sucrose, 15 μg ml-1 hygromycin B) to 0 μM or 50 μM MeJA containing plates (1/6 x MS,
1% sucrose) for 4 days. Absolute root growth during this period was measured.
Epifluorescence images were taken of newly grown tissues (first pair of leaves or
primary root tips) at the end of treatment using conventional fluorescence
microscopy.
Chapter 2. Materials and Methods 38
2.5. Microscopy and imaging
2.5.1. Fluorescence microscopy
Leaf discs were removed from the Agrobacterium injected area of leaves
(Section 2.4.4) and mounted on glass slides in water for fluorescence microscopy.
For higher resolution of the intracellular distribution of expressed fluorescent
proteins, peels of the lower leaf epidermis were prepared. Both types of
preparations were examined using an Olympus IX71 fluorescence microscope
equipped with a DP70 CCD camera (Olympus). Filter sets (Olympus) used for the
observation of fluorescence in this study are summarised in Table 2-4.
Table 2-4. Filter sets used in fluorescence microscopy in this study.
Information regarding the characteristics of the listed filter sets is based on the Olympus
manual for the IX71 fluorescence microscope.
Mirror Unit Excitation filter
Dichroic mirror
Barrier filter Fluorochromes
U-MWU2 300-385 nm 400 nm 420 nm DAPI
U-MGFPHQ 460-480 nm 485 nm 495-540 nm GFP (and BiFC fluorescence in this
study)
U-MWIB3 460-495 nm 505 nm 510 nm FITC (showing concurrently BiFC
and chlorophyll autofluorescence)
U-MRFPHQ 535-555 nm 565 nm 570-625 nm RFP (for detection of expression of
organelle markers in this study)
Images were captured using the DPController software (Olympus), and then
processed using Adobe Photoshop 5.0® software. In general, the contrast and
dark/light levels of images were manipulated by Photoshop for optimal image
presentation.
2.5.2. Confocal microscopy
Leaf discs from the infiltrated area of Nicotiana leaves or the leaves of transgenic
Arabidopsis expressing 14-3-3 BiFC constructs were placed in water on glass slides and
Chapter 2. Materials and Methods 39
covered with coverslips for Confocal Laser Scanning Microscopy (CLSM) using a TCS SP2
AOBS Confocal Microscope (Leica). Mesophyll protoplasts were analysed by CLSM
directly in W5 solution on glass slides and covered with coverslips (with little paper
strips as spacers in between coverslips and glass slides to create space for protoplasts).
Confocal images were collected using the Leica Conical Software with appropriate
settings for excitation and emission channels as follows:
GFP: 488 nm for excitation; 510-540 nm for emission.
YFP: 514 nm for excitation; 520-550 nm for emission.
mCherry: 561 nm for excitation; 580-610 nm emission.
Chlorophyll autofluorescence: 514 nm for excitation; 660-700 nm for emission.
Confocal microscopy enables the detection of fluorescence in optical section
scans through a tissue or cell. Projection images of serial optical sections were
compiled and processed using the default setting of the Leica Conical Software. Some
of the confocal images (single optical sections or projection images) were further
processed for contrast or dark/light level manipulations using Adobe Photoshop 5.0®
software.
2.5.3. Image analysis
2.5.3.1. Quantification of fluorescence intensity using ImageJ
The analysis of the subcellular localisation patterns of 14-3-3 dimers in transiently
transformed Nicotiana leaf epidermal cells (Chapter 4, Section 4.2.3.3) was based on
BiFC fluorescence intensity in the nucleus and cytoplasm. These intensities were
determined from obtained micrographs using ImageJ (http://rsbweb.nih.gov/ij/). In
detail, five circular, 10 pixel areas were selected within the nucleus and also within the
cytoplasm. Great care was taken to place these selections within areas showing
representative fluorescence of the individual dimers and cells. The mean grey values
Chapter 2. Materials and Methods 40
were obtained for the nuclear and cytoplasmic areas using ImageJ. Values obtained in
a similar way for the non-fluorescent background were zero in each case. Thus, the
mean values for nuclear and cytoplasmic signal were used directly to calculate the
nuclear to cytosolic signal ratio for each cell. The ratios were then used to generate
scatter plot diagrams for further analysis of subcellular localisation patterns of 14-3-3
dimers (Fig. 4-3 to 4-5).
2.5.3.2. Image deconvolution
Epifluorescence images were deconvolved using Huygens Essential software
(version 3.4, Scientific Volume Imaging B.V., The Netherlands; http://www.svi.nl/) to
exclude out-of-focus information. For the image deconvolution, default settings of
the programs were used except: (1) the “max iterations” was changed from 50 to 10
and (2) the “signal to noise ratio” was changed from 40 to 2. Deconvoluted images
were further processed for contrast or dark/light level manipulations using Adobe
Photoshop 5.0® software.
2.6. Protein expression analysis using denaturing gel
electrophoresis and Western blotting
Total proteins were isolated from the Agrobacterium infiltrated area of Nicotiana
leaves or transgenic Arabidopsis leaves expressing BiFC constructs. Approximately 15
mg of homogenised leaf tissues were incubated with 150 μl of 1 x sodium dodecyl
sulfate (SDS) sample buffer (62.5 mM Tris-HCl, 2% SDS, 5% β-mercaptoethanol, 10%
glycerol, 0.01% bromophenol blue, pH 6.8) at 95°C for 5 min. The suspension was
clarified by centrifugation at 16000 x g for 5 min. Aliquots (10 μl) of protein extract
were separated by duplicate 10% SDS-polyacrylamide gel electrophoresis (SDS-PAGE;
Laemmli, 1970). One gel was stained with Coomassie Brilliant Blue R250 to compare
Chapter 2. Materials and Methods 41
protein loading amounts while the proteins on the other gel were transferred to a
nitrocellulose membrane (Protran®, Schleicher and Schuell) using a semi-dry transfer
system (Bio-Rad) for immunoblotting analysis. Immunodetection of fusion proteins
was done with monoclonal anti-c-myc antibodies or anti-HA antibodies (Santa Cruz
Biotechnology Inc.) followed by Amersham ECL™ Western Blotting System (GE
Healthcare, Buckinghamshire, UK). Chemiluminescent signals were detected using
the Gel Doc™ XR and ChemiDoc™ XRS Gel Documentation System and the Quantity
One software (Bio-Rad). Images were then processed for contrast or dark/light level
manipulations using Adobe Photoshop 5.0® software.
Chapter 3. Establishment of a BiFC assay system in planta 42
Chapter 3
Establishment of a Bimolecular
Fluorescence Complementation
Assay System in planta
Chapter 3. Establishment of a BiFC assay system in planta 43
3.1. Introduction
As discussed in detail in Chapter 1, 14-3-3 proteins act as key regulators of a
large number of biological processes by binding as homo or heterodimers to target
proteins. In vitro, in silico and non-homologous in vivo systems have led to the
identification of more than 300 potential 14-3-3 target proteins (Roberts, 2003;
Mhawech, 2005; Schoonheim et al., 2007a; Chang et al., 2009; Paul et al., 2009).
However, it appears that such systems, as they do not truly represent the native
protein environment, can lead to conflicting or misleading results as demonstrated by
Athwal and co-workers when testing 14-3-3:nitrate reductase interactions using
different ion and pH conditions (Athwal et al., 2000). Additionally, as discussed
earlier in detail (Section 1.7), the high amino acid sequence similarities of 14-3-3
isoforms supports experimentally observed functional redundancy of 14-3-3s (van
Heusden et al., 1996; Rosenquist et al., 2000; Ferl et al., 2002; Alsterfjord et al., 2004)
whilst differences in binding affinities of 14-3-3 isoforms for a given target protein
suggest functional specificity (Bachmann et al., 1996b; Kanamaru et al., 1999;
Rosenquist et al., 2000; Sinnige et al., 2005). Hypothetically, an in vivo assay system
that allows for protein-protein interactions to be studied in the native environment
has the potential to resolve the above discrepancies. This could be used to study the
still open question of 14-3-3 isoform specificity during dimer formation or target
protein interaction.
Bimolecular fluorescence complementation (BiFC) allows for the visualisation of
protein-protein interaction in vivo (Hu et al., 2002). This technique requires that the
coding regions of two candidate proteins are transcriptionally fused to two
non-fluorescent fragments of YFP. Co-expression of interacting proteins results in
reconstitution of functional YFP, which can be detected by monitoring YFP
fluorescence, for example via fluorescence microscopy techniques. BiFC analysis was
Chapter 3. Establishment of a BiFC assay system in planta 44
first used to demonstrate protein-protein interactions in living mammalian cells (Hu et
al., 2002; Hu and Kerppola, 2003) and was subsequently adapted for the use in plant
systems (Bracha-Drori et al., 2004; Walter et al., 2004). These first publications
reporting the use of BiFC in plants demonstrated its successful application to the
analysis of protein interactions in transient systems using Nicotiana benthamiana
(Nicotiana) or Arabidopsis thaliana (Arabidopsis) plants or protoplasts. Hence,
visualisation of protein interactions between reported 14-3-3 target proteins and each
14-3-3 isoform in living cells using the BiFC analyses would allow the functional
specificity of 14-3-3 proteins to be explored and determined.
To perform such studies, a system has to be developed that allows for testing of
a large number of protein interactions in a time and material efficient way. This
requires cloning of cDNA sequences encoding for proteins to be studied into suitable,
easy to handle vectors. It also needs a reliable and robust analysis platform in planta
for the medium-throughput BiFC assays for 14-3-3 protien interactions.
The aims of this part of project were:
(1) Develop a T-DNA binary vector system suitable for BiFC analysis of transiently and
stably transformed plants.
(2) Generate a library of Arabidopsis 14-3-3 BiFC vectors for protein interaction
analysis.
(3) Establish and evaluate a test system for BiFC analysis of transiently and stably
transformed plants.
Chapter 3. Establishment of a BiFC assay system in planta 45
3.2. Results
3.2.1. Identification of a suitable vector system for a plant based BiFC assay
system
To adapt a BiFC assay system in planta for 14-3-3 interaction analyses, two sets
of BiFC expression vectors were obtained from Profs. Claudia Oecking, and Klaus
Harter, ZMBP, Pflanzenphysiologie, Universität Tübingen, Tübingen, Germany (Walter
et al., 2004). One set of vectors is designated as pUC-SPYNE and pUC-SPYCE (for
split-YFP N-terminal/C-terminal fragment expression), and the other is pSPYNE-35S
and pSPYCE-35S (Walter et al., 2004; Fig. 3-1). Both sets of vectors contain the same
BiFC cassettes, which allow for the insertion of the coding region and expression of
proteins of interest translationally fused to a protein tag and either a 155 amino acid
N-terminal (SPYNE) or an 84 amino acid C-terminal fragment (SPYCE) of the enhanced
yellow fluorescent protein (eYFP). The sequences encoding the fusion proteins are
expressed under the control of a constitutive cauliflower mosaic virus (CaMV) 35S
promoter and the nopaline synthase gene terminator (NosT; Fig. 3-1). The protein
tags, a c-myc epitope tag in SPYNE vectors and a hemagglutinin (HA) epitope tag in
SPYCE vectors, allow for the detection of fusion proteins using immunoblot analysis
via commercially available antibodies directed towards the protein tags.
The major difference between the two sets of vectors is that the pUC-SPYNE and
pUC-SPYCE vectors are based on pUC19 and are specially designed for transient plant
cell transformation (Walter et al., 2004). On the other hand, pSPYNE-35S and
pSPYCE-35S are T-DNA binary vectors suitable for Agrobacterium-mediated transient
or stable plant transformation (Walter et al., 2004). As it was anticipated that
14-3-3 proteins would be tested for interaction in both transiently and stably
transformed plants during this project, it was initially decided to use only the BiFC
vectors, pSPYNE-35S/pSPYCE-35S, which are based on T-DNA binary vectors.
Chapter 3. Establishment of a BiFC assay system in planta 46
Fig. 3-1. Schematic representation of expression cassettes in BiFC vectors (modified after
Walter et al., 2004)
The figure shows the basic features of BiFC expression cassettes in the vector pairs
pUC-SPYNE and pUC-SPYCE as well as SPYNE-35S and SPYCE 35S as described by Walter et al.
(2004). Genes coding for proteins of interest are cloned into the multiple cloning site (MCS) to
allow for translational fusions with a protein tag (c-myc: c-myc affinity tag; HA: hemagglutinin
affinity tag) and the N-terminal 155 amino acids of enhanced YFP (N-YFP or YN) or the 84
amino acids of the C-terminal end of eYFP (C-YFP or YC). The DNA and predicted amino acid
sequences and unique restriction sites of the MCS are shown at the top of the figure. The
fusion construct can be expressed under the transcriptional control of the CaMV 35S
promoter (35S), and the transcriptional terminator of the nopaline synthase gene from
Agrobacterium tumefaciens (NosT).
When transforming E.coli with these vectors for amplification, it was found that the
pUC-SPYNE and pUC-SPYCE were easily taken up by E. coli, but the pSPYNE-35S and
pSPYCE-35S were not (data not shown). A possible reason for this is the relatively
large size of the pSPYNE-35S and pSPYCE-35S vectors (> 13 kb), compared to that of
pUC-SPYNE and pUC-SPYCE (~4.8 kb). To improve the efficiency of the
transformation step and streamline it for the planned large-scale analyses of
protein-protein interactions, it was decided to transfer the BiFC cassettes into a high
copy vector of smaller size, which should also be suitable for transient and stable
transformation of plant cells.
pUC-SPYNE/SPYNE-35S
pUC-SPYCE/SPYCE-35S
XbaI HpaI StuI SpeI BamHI SalI XhoI KpnI SmaI
_|_______|____________|___________|_____|_________________|_____|_________|______|
TCTAGAGTTAACCGGGCTCAGGCCTGGCGCGCCACTAGTGGATCCATCGATAGTACTGTCGACCTCGAGGGTACCGCTCCCGGGATG
_S__R__V__N__R__A__Q__A__W__R__A__T__S__G__S__I__D__S__T__V__D__L__E__G__T__A__P__G__M
c-myc
35S MCS N-YFP (YN) NosT
HA
35S MCS C-YFP (YC) NosT
Chapter 3. Establishment of a BiFC assay system in planta 47
Binary vectors widely used for plant transformation have been summarised by
Hellens et al. (2000a). Many of these are larger than 10 kb and might have similar
drawbacks on genetic manipulation as described above for pSPYNE-35S/pSPYCE-35S.
Hellens et al. (2000a) also describe a vector series based on the high copy vector
pGreen, which has a relatively small size (3.3-7 kb). In addition, the pGreen series is
highly flexible with respect to components such as plant selectable markers,
promoters and terminators. This feature is a further advantage when transformation
of a plant with two or more different gene constructs is desirable (Hellens et al.,
2000b).
The pGreen vectors are widely used to generate transgenic plants via
Agrobacterium-mediated transformation (Hellens et al., 2000b; Vain et al., 2003; Cao
et al., 2007; Yang et al., 2008) and to perform transient gene expression in Nicotiana
leaves by agroinfiltration (Hamilton et al., 2002; Aparicio et al., 2005; Hellens et al.,
2005) or in onion epidermis by particle bombardment (Zhong et al., 2008). Based on
the versatility, copy number and transformation efficiency, it was decided to transfer
the BiFC cassettes from pUC-SPYNE/pUC-SPYCE into the pGreen vector backbone to
generate a new set of binary BiFC vectors for this study.
The pGreen vectors chosen as recipient vectors for the YN and YC cassettes were
pGreen0179 and pGreen0229. The two vectors contain different plant selectable
markers; pGreen0179 carries a hygromycin resistance gene (35S-hyg) whereas
pGreen0229 carries a bialaphos (Basta) herbicide resistance gene (Nos-bar; Fig. 3-2).
Using these two plasmids in combination is a convenient way of introducing two BiFC
constructs into the same plant as it allows for selection of two independent
transformation events, i.e. the transformation with two independent constructs
(Chapter 5).
Fig. 3-2. Generation of pGreen vector derivatives for the construction of BiFC vectors.
The MCS of pGreen0179 and pGreen0229 was modified by elimination of a number of restrictionsites, which were duplicated in the MCS of BiFC cassettes which were to be cloned into the pGreenvector backbones (Fig. 3-1). The first level of modification was done by eliminating the XhoI site toproduce the vectors pG179N and pG229N. The second level of modification was achieved byremoving the region between the SmaI and the SacI restriction sites to generate the vectorspG179NS and the pG229NS.Abbreviations: ColE1ori/pSa-ORI, E. coli/Agrobacterium origin of replications; LB/RB, T-DNAleft/right borders; Nos-bar/35S-hyg, plant Basta/hygromycin resistance genes; nptI, bacterialkanamycin resistance gene.
Chapter 3. Establishment of a BiFC assay system in planta 48
pG179N
MCS
pG229N
MCS
SacI digestionBlunted the protruding ends SmaI digestionReligation
EcoRV PstI BamHI
KpnI HindIII EcoRI SmaI SpeI XbaI NotI SacI| | | | | | | | | | |
GGTACCGGGCCCCCCCTCGACGGTATCGATAAGCTTGATATCGAATTCCTGCAGCCCGGGGGATCCACTAGTTCTAGAGCGGCCGCCACCGCGGTGGAGCTC
CCATGGCCCGGGGGGGAGCTGCCATAGCTATTCGAACTATAGCTTAAGGACGTCGGGCCCCCTAGGTGATCAAGATCTCGCCGGCGGTGGCGCCACCTCGAG
pG229NS
MCS
pG179NS
MCS
EcoRV PstI
KpnI HindIII EcoRI | | | | |
GGTACCGGGCCCCCCCTCGACGGTATCGATAAGCTTGATATCGAATTCCTGCAGCCCC
CCATGGCCCGGGGGGGAGCTGCCATAGCTATTCGAACTATAGCTTAAGGACGTCGGGG
pGreen0179
MCS
pGreen0229
MCS
XhoI / SalI double digestionReligation
EcoRV PstI BamHI
KpnI XhoI SalI HindIII EcoRI SmaI SpeI XbaI NotI SacI| | | | | | | | | | | | |
GGTACCGGGCCCCCCCTCGAGGTCGACGGTATCGATAAGCTTGATATCGAATTCCTGCAGCCCGGGGGATCCACTAGTTCTAGAGCGGCCGCCACCGCGGTGGAGCTC
CCATGGCCCGGGGGGGAGCTCCAGCTGCCATAGCTATTCGAACTATAGCTTAAGGACGTCGGGCCCCCTAGGTGATCAAGATCTCGCCGGCGGTGGCGCCACCTCGAG
Chapter 3. Establishment of a BiFC assay system in planta 49
The multiple cloning sites (MCS) of pGreen vectors are largely identical to the
MCS within the BiFC cassettes (Figs. 3-1, 3-2). Introducing the BiFC cassettes directly
into pGreen vectors would have created plasmids in which several of the MCS
restriction sites were present more than once, making the sites unsuitable for
subsequent cloning of genes of interest. To circumvent this problem, the pGreen
vectors were modified by deleting restriction sites in their MCS. The XhoI site in the
MCS of the pGreen vectors was eliminated by performing a digest using the enzymes
XhoI and SalI, followed by religation of the complementary ends generated (Fig. 3-2).
This resulted in the two vectors pG179N and pG229N. Furthermore, restriction sites
between SmaI and SacI were eliminated to generate the vectors pG179NS and
pG229NS. This left only a few duplicated restriction sites in the vector MCS and the
inserted BiFC cloning cassettes. The HindIII and EcoRI sites in these modified pGreen
vectors were maintained to allow for insertion of BiFC cloning cassettes (Fig. 3-2).
3.2.2. Construction of pGreen-based BiFC vectors
The BiFC cassettes were released from pUC-SPYNE and pUC-SPYCE by HindIII and
EcoRI double digest and inserted into the modified pGreen vectors, pG179N/pG229N
and pG179NS/pG229NS. The cloning strategy is depicted in Fig. 3-3 and resulted in
four pairs of BiFC vectors containing either 35S-hyg (pG179 derivatives) or Nos-bar
(pG229 derivatives) plant selection markers. These were designated pG179N-YN/-YC,
pG229N-YN/-YC, pG179NS-YN/-YC and pG229NS-YN/-YC (Fig. 3-3). Several unique
restriction sites suitable for subcloning DNA fragment of interest are present in these
vectors (Fig. 3-4). More specifically, the “N” series (pGxxxN-xx) vectors have two
unique cloning sites, HpaI and XhoI sites whilst the “NS” vector series (pGxxxNS-xx)
has more unique cloning sites (see Fig. 3-4 for details).
Fig. 3-3. Cloning strategy for the generation of pGreen-based BiFC vectors.
BiFC cassettes (35S::c-myc-YN or 35S::HA-YC) were isolated from pUC-SPYNE or pUC-SPYCE byHindIII/EcoRI digest and then inserted into HindIII/EcoRI linearised pGreen based vectorspG179N/pG229N and pG179NS/pG229NS. This resulted in two sets of pGreen-based BiFCvectors, carrying either the 35S-hyg or the Nos-bar plant selection genes.Abbreviations: bar/hyg, Basta herbicide/hygromycin resistance genes; c-myc/HA,c-myc/hemagglutinin epitope tags; N-YFP(YN)/C-YFP(YC), N/C-terminal fragment (amino acids1 to 155 or 156-239) of enhanced YFP; LB/RB, T-DNA left/right borders; MCS, multiple cloningsites; NosT, nopaline synthase gene terminator; 35S/Nos, cauliflower mosaic virus 35S/nopaline synthase gene promoters.
35S MCS NosTN-YFP (YN)
c-myc
pUC-SPYNE
SacI EcoRIHindIII
35S MCS NosTC-YFP (YC)
HA
pUC-SPYCE
SacI EcoRIHindIII
HindIII / EcoRIHindIII / EcoRI linearised
pG179N/pG229Nor
pG179NS/pG229NS
35S MCS NosTN-YFP (YN)
c-myc
pG179N-YN
SacI EcoRIHindIII
35S-hyg
RB
LB
35S MCS NosTC-YFP (YC)
HA
pG179N-YC
SacI EcoRIHindIII
RB
35S-hygLB
35S MCS NosTN-YFP (YN)
c-myc
pG229N-YN
SacI EcoRIHindIII
Nos-bar
RB
LB
35S MCS NosTC-YFP (YC)
HA
pG229N-YC
SacI EcoRIHindIII
RB
Nos-barLB
35S MCS NosTN-YFP (YN)
c-myc
pG179NS-YN
SacI EcoRIHindIII
35S-hyg
RB
LB
35S MCS NosTC-YFP (YC)
HA
pG179NS-YC
SacI EcoRIHindIII
RB
35S-hygLB
35S MCS NosTN-YFP (YN)
c-myc
pG229NS-YN
SacI EcoRIHindIII
Nos-bar
RB
LB
35S MCS NosTC-YFP (YC)
HA
pG229NS-YC
SacI EcoRIHindIII
RB
Nos-barLB
Chapter 3. Establishment of a BiFC assay system in planta 50
Fig. 3-4. Restriction maps of pGreen-based BiFC vectors.
Schematic representation of expression cassettes and polylinker sequences of thepG179N/pG229N derivative BiFC vectors (A) and the pG179NS/pG229NS derivative BiFCvectors (B). Unique restriction sites are indicated by an asterisk. Abbreviations are as indicatedin Fig. 3-3.
XbaI HpaI* SpeI BamHI SalI XhoI* SmaI
| | | | | | |
TCTAGAGTTAACCGGGCTCAGGCCTGGCGCGCCACTAGTGGATCCATCGATAGTACTGTCGACCTCGAGGGTACCGCTCCCGGGATG
S R V N R A Q A W R A T S G S I D S T V D L E G T A P G M
35S MCS NosTYN or YCTag
EcoRV PstI BamHI
KpnI HindIII* EcoRI* SmaI SpeI XbaI NotI SacI
| | | | | | | | | | |
GGTACCGGGCCCCCCCTCGACGGTATCGATAAGCTTGATATCGAATTCCTGCAGCCCGGGGGATCCACTAGTTCTAGAGCGGCCGCCACCGCGGTGGAGCTC
pG179N-YN/-YCor
pG229N-YN/-YC
A
XbaI* HpaI* SpeI* BamHI* SalI XhoI* SmaI*
| | | | | | |
TCTAGAGTTAACCGGGCTCAGGCCTGGCGCGCCACTAGTGGATCCATCGATAGTACTGTCGACCTCGAGGGTACCGCTCCCGGGATG
S R V N R A Q A W R A T S G S I D S T V D L E G T A P G M
35S MCS NosTYN or YCTag
KpnI HindIII* EcoRI* PstI
| | | |
GGTACCGGGCCCCCCCTCGACGGTATCGATAAGCTTGATATCGAATTCCTGCAGCCCC
pG179NS-YN/-YCor
pG229NS-YN/-YC
B
Chapter 3. Establishment of a BiFC assay system in planta 51
Chapter 3. Establishment of a BiFC assay system in planta 52
3.2.3. Cloning of Arabidopsis 14-3-3 open reading frames
The Arabidopsis 14-3-3 gene family is comprised of 15 genes that are called
General Regulatory Factor (GRF) with an Arabic number. Thirteen of these are
expressed while the remaining two are considered to be pseudogenes (Chevalier et al.,
2009). The expressed Arabidopsis 14-3-3 proteins are designated by Greek letters.
The nomenclature of the 14-3-3 family is summarised in Chapter 1 (Table 1-1).
In this study, a PCR approach was used to clone all ORFs of expressed
Arabidopsis 14-3-3 isoforms with the exception of 14-3-3 π (pi). The 14-3-3 pi was
not included because evidence for its transcription was not verified until after this
project was well underway (Sehnke et al., 2006; Cao et al., 2007). Primers for PCR
amplification of individual isoforms are listed in Table 2-1 (Section 2.1.2.4). To fuse
14-3-3 sequences to a protein tag and in frame with either the C- or N-terminal part
of the YFP coding region, an XhoI restriction enzyme site (CTCGAG) was introduced
into all 3’ primers. This also allowed the directional subcloning of 14-3-3
amplification products. This enzyme site was chosen as it eliminates the TAG stop
codon found in most of the 14-3-3 ORFs with minimal changes of surrounding base
pairs. The site was chosen also because all the Arabidopsis 14-3-3 cDNAs lack an
XhoI site. The 5’ primer included the ATG start codon of 14-3-3 ORFs and up to five
bases upstream of the ATG.
The N-terminal regions of 14-3-3s are essential for dimerisation, and truncation
of 14-3-3 ORFs by about 30 amino acids prevented dimerisation of these proteins
(Jaspert and Oecking, 2002; Walter et al., 2004). Thus, 14-3-3 sequences truncated
at their N-termini were used to assess non-specific interactions of 14-3-3 proteins in
negative control experiments. Non-specific interaction may occur due to molecular
crowding, leading to reconstitution of YFP without the requirement of target protein
interaction, a problem when using highly active promoters such as the CaMV 35S
Chapter 3. Establishment of a BiFC assay system in planta 53
promoter which leads to strong expression of proteins (Bhat et al., 2006; Lalonde et
al., 2008). To obtain these truncated 14-3-3s, a second set of primers was designed
for the 5’-ends. These primers were placed 78 to 99 bp downstream to the start
codon of the full-length ORF and included a second, in frame ATG present in all of the
14-3-3 ORFs. Amplicons obtained using these primers were expected to be
truncated between 26 and 33 amino acids at the N-terminal ends compared to the
full-length amplicons (Table 3-1). To differentiate between the two amplicons for
each of the 14-3-3 isoforms, full-length ORFs are indicated by an “X” after the isoform
name whilst the names of the truncated clones contain the symbol delta (Δ). For
example, the full-length ORF of the 14-3-3 isoform chi was named chiX whilst the
N-terminal truncated ORF of this isoform was named chiΔ (Table 3-1).
Plasmids containing either 14-3-3 cDNAs or cDNA libraries or self made cDNA
populations obtained from a mix of root and leaf mRNA were used as templates for
the PCR amplification of full-length and N-terminal shortened 14-3-3 ORFs as shown
in Table 3-1. The identities of all the PCR products were verified by sequence
analysis after subcloning (data not shown). In some cases nucleotide exchanges
were observed (Table 3-1). A representative result of PCR for amplification of the
14-3-3 ORFs from the leaf and root cDNA mixture is shown in Fig. 3-5. PCR products
were obtained for the full-length ORFs of the 14-3-3s kappa, nu and omega and for
the truncated ORFs of 14-3-3s chi, epsilon, mu and omega. These PCR products had
the expected amplicon size. The predicted size differences between full-length and
truncated versions of the omega isoform were observed (Fig. 3-5, lanes 8 and 9), and
are representative of those for other 14-3-3 isoforms (Fig. 3-5). Attempts to clone
14-3-3 iota ORFs using the leaf and root cDNA mix as template failed (Fig. 3-5, lanes 3
and 4). This is consistent with the reported observation that 14-3-3 iota is expressed
in Arabidopsis flowers but not in root and leaf tissues (Rosenquist et al., 2001).
Chapter 3. Establishment of a BiFC assay system in planta 54
Table 3-1. Templates and open reading frame specifications for cloned
Arabidopsis 14-3-3 sequences.
This table summarises the names of cloned 14-3-3 DNAs, the templates used to obtain these
DNAs with PCR-based cloning approaches and specifications of the 14-3-3 DNA sequences.
All the DNAs contain 14-3-3 open reading frames (ORFs) beginning with an ATG and ending
with the last amino acid encoding codon prior to the native stop codon. The stop codon was
omitted to allow translational fusion of 14-3-3 DNAs to other protein encoding DNAs.
Clones containing full-length 14-3-3 ORFs are designated with ‘X’ after the allele name.
Clones containing the shortened 14-3-3 ORFs designed for the deletion of the N-terminal
dimerisation domain are designated with ‘Δ’ after the allele name. The length of the
N-terminal deletions was determined by the position of a second in frame ATG start codon.
The details of the template sources are describe in the Materials and Methods. The cDNA
clones of 14-3-3 ORFs from the Arabidopsis stock centre are indicated by “*”. Nucleotide
sequence changes and resulting amino acid exchanges are shown in the table.
14-3-3 Template for PCR
amplification Sequence changes
(nucleotide/amino acid) Number of amino acids deleted
from the N-termini
chiX cDNA mix - -
chi∆ chiX - 32 aa
epsilonX cDNA library - -
epsilon∆ cDNA mix - 27 aa
kappaX CD3-360* - -
kappa∆ CD3-360* - 29 aa
lambdaX cDNA library C18G/silent mutation -
lambda∆ lambdaX - 29 aa
muX CD3-363* - -
mu∆ cDNA mix - 29 aa
nuX cDNA mix - -
omegaX CD3-202* A247G/Thr83Ala -
omega∆ cDNA mix - 27 aa
omicron∆ cDNA library - 27 aa
phiX cDNA mix - -
phi∆ phiX - 33 aa
psiX cDNA mix - -
psi∆ cDNA library - 26 aa
upsilonX CD3-203* C486T/silent mutation -
upsilon∆ CD3-203* C486T/silent mutation 29 aa
Chapter 3. Establishment of a BiFC assay system in planta 55
B
Lane 14-3-3
amplicon
Predicted
size (bp)
1 chiΔ 715
2 epsilonΔ 691
3 iotaX 819
4 iotaΔ 718
5 kappaX 759
6 muΔ 712
7 nuX 810
8 omegaX 792
9 omegaΔ 706
Fig. 3-5. PCR amplifications of Arabidopsis 14-3-3 encoding DNAs.
Several 14-3-3 encoding DNAs were PCR amplified using cDNA mixtures generated from
leaves and roots as templates and gene-specific primers for full-length and truncated 14-3-3
products. PCR products were analysed on a 1% agarose gel (A). The position of an 850 bp
molecular size marker is indicated. The identity and predicted sizes of the 14-3-3 amplicons
are shown in the table (B). Note, iotaX and iotaΔ were not amplified under the conditions
used in this experiment (see Section 3.2.3).
The amplicons of 14-3-3 ORFs, inserted into pCRII-TOPO cloning vectors, were
analysed for size and orientation in the vectors by restriction digestion. A
pCRII-TOPO construct can contain a 14-3-3 amplicon in either a forward orientation or
a reverse orientation. The orientation was defined by the relative position of the
5’-end of the 14-3-3 ORF to the unique HindIII site upstream the TOPO-TA cloning site
(Fig. 3-6 and pCRII-TOPO map, Invitrogen TA-cloning manual). If the 5’-end was
closer to the HindIII site, then the clone was designated as being in the forward
orientation; otherwise it was defined as being in the reverse orientation.
Fig. 3-6. Determining the orientation of cloned 14-3-3 encoding DNA fragments in TOPOvectors by restriction digestion.
Schematic diagrams demonstrate the elucidation of the orientation of cloned full-length 14-3-3phi coding sequences (phiX) in the pCRII-TOPO vector. The orientation of 14-3-3 fragments wasdefined by the relative position of the 5’-end of the 14-3-3 ORF to the unique HindIII site (asindicated by an asterisk) upstream of the TOPO-TA cloning site. If the 5’-end was closer to theHindIII site, then the clone was designated as being in the forward orientation (A), otherwisethe reverse orientation (B). The phiX contains an internal HindIII site that was used todifferentiate the orientation of positive clones by HindIII digestion. Plasmids isolated from twopositive clones were examined by HindIII digestion and 1% agarose gel electrophoresis (C). Theshorter HindIII fragment (393 bp) indicated the ‘forward’ orientation (lane 1); whilst the largerHindIII fragment (534 bp) indicated the ‘reverse’ orientation (lane 2). Additionally a bandrepresenting the vector backbone and the remainder of the cloned fragment was obtained ineach digest (4.39 kb in forward, 4.25 kb in reverse). M: 1 kb Plus DNA ladder (Invitrogen). Theposition of a 500 bp molecular size marker fragment is indicated.
C 1 2 M
500 bp
A 393 bp
B 534 bp
*
*
Chapter 3. Establishment of a BiFC assay system in planta 56
Chapter 3. Establishment of a BiFC assay system in planta 57
An example of an insert orientation analysis is shown in Fig. 3-6. The
orientation of the phiX ORF in pCRII-TOPO was determined by HindIII digestion and
agarose gel electrophoresis by taking advantage of two HindIII sites, one in the MCS of
the pCRII-TOPO vector and the other in the phiX ORF (Fig. 3-6 A-B). Depending on
the orientation, two different sets of HindIII fragment sizes were expected: the 393
bp/4.39 kb fragments with the forward orientation (Fig. 3-6 A and the lane 1 in C) and
the 534 bp/4.25 kb fragments with the reverse orientation (Fig. 3-6 B and the lane 2 in
C). All of the cloned 14-3-3 amplicons were analysed following this approach. To
allow for similar subcloning procedures, all clones used in subsequent experiments
were in the reverse orientation. The sequences of the inserts in these clones were
determined to confirm the presence of correct, non-mutated 14-3-3 ORFs. A
difference to the omega sequence At1g78300 as published in GeneBank was found in
the sequence of the omegaX clone. The nucleotide exchange from A to G at
nucleotide position 247 resulted in a deduced amino acid exchange from threonine to
alanine (Thr83Ala; Table 3-1). The omegaX ORF was PCR amplified using a
high-fidelity DNA polymerase (Section 2.2.5) from a cDNA clone obtained from the
Arabidopsis stock centre ABRC (clone No. CD3-202), so the nucleotide difference was
potentially in the original 14-3-3 omega cDNA clone.
3.2.4. Insertion of 14-3-3 ORFs into BiFC binary vectors
In general, cloned 14-3-3 ORFs were transferred from TOPO vectors into
pGreen based BiFC vectors generated during the work presented in this thesis. This
was achieved in most cases by EcoRV/XhoI digestion of the TOPO vectors to release
the 14-3-3 encoding DNA fragment and insertion of the 14-3-3 ORF into HpaI/XhoI
linearised pGreen-based BiFC vectors. This strategy allowed for the directional
cloning of 14-3-3 ORFs and translational fusion to protein tags and YFP fragments
contained in the BiFC vectors. Alternative restriction enzymes were used for the
Chapter 3. Establishment of a BiFC assay system in planta 58
subcloning of the 14-3-3 chi and lambda ORFs because an EcoRV site is present in
these two ORFs. In some cases, the PCR amplicons of 14-3-3 ORFs were directly
inserted into BiFC destination vectors to facilitate the cloning processes (in
circumvention of TOPO cloning). This was achieved by digesting the PCR products of
14-3-3 ORFs amplified with a high-fidelity Taq DNA polymerase with XhoI, a restriction
site introduced via the 3’-located amplification primer. The resulting blunt/XhoI
fragments were inserted into HpaI/XhoI linearised BiFC vectors. This strategy was
applied to the cloning of 14-3-3 kappaX into pG-229N-YN/-YC to generate the plasmid
pG-kappaXPCR-229N-YN/-YC (kappa-YN/-YC) as well as for the cloning of kappaΔ,
iotaX, iotaΔ, lambdaX, omegaX, omicronX, omicronΔ and upsilonΔ into the
pGreen-based BiFC vectors to generate the plasmids as shown in Table 3-2. In all
cases, the correctness of the 14-3-3 sequences inserted into destination vectors as
well as translational fusions to the protein tags and YFP fragments were confirmed by
sequence analysis (data not shown). Such sequence analyses indicated that
translational fusions of 14-3-3 full-length ORFs to both the YN and YC fragment were
correctly obtained for ten Arabidopsis 14-3-3 isoforms (chi, epsilon, iota, kappa, mu,
nu, omega, omicron, phi and psi) and in addition for the YN fusion of the full-length
14-3-3 lambda ORF (Table 3-2). Plasmids containing the upsilon isoform were not
used in subsequent work as errors in the coding region led to the loss of the ATG start
codon. In addition to full-length clones, correct YN and YC fusions were obtained for
seven N-terminally truncated 14-3-3s, namely epsilonΔ, kappaΔ, lambdaΔ, muΔ,
omegaΔ, phiΔ and psiΔ (Table 3-2).
Chapter 3. Establishment of a BiFC assay system in planta 59
Table 3-2. Plant expression vectors used in this study.
Characteristics of the plant expression vectors used in this study are shown, including the
35S-GFP containing pCAMBIA 1302 vector, the obtained BiFC cassettes and the generated
14-3-3-split YFP constructs in the pGreen vector backbones.
Plasmid name Description Bacterial selection
Plant selection
Source or reference
pCAMBIA 1302 35S-mGFP5-His x 6; 2x35S-hyg;
T-DNA-based binary vector Kanamycin Hygromycin CAMBIA
pUC-SPYNE 35S-c-myc-YN; pUC19-based Ampicillin - Walter et al., 2004
pUC-SPYCE 35S-HA-YC; pUC19-based Ampicillin - Walter et al., 2004
pG-chiX-179NS-YC 35S-chi-YC; 35S-hyg;
T-DNA-based binary vector Kanamycin Hygromycin This study
pG-chiX-179NS-YN 35S-chi-YN; 35S-hyg;
T-DNA-based binary vector Kanamycin Hygromycin This study
pG-epsilon∆-179N-YC 35S-epsilon∆-YC; 35S-hyg;
T-DNA-based binary vector Kanamycin Hygromycin This study
pG-epsilon∆-179N-YN 35S-epsilon∆-YN; 35S-hyg;
T-DNA-based binary vector Kanamycin Hygromycin This study
pG-epsilon∆-229N-YC 35S-epsilon∆-YC; pNos-bar;
T-DNA-based binary vector Kanamycin Basta This study
pG-epsilon∆-229N-YN 35S-epsilon∆-YN; pNos-bar;
T-DNA-based binary vector Kanamycin Basta This study
pG-epsilonX-179N-YN 35S-epsilon-YN; 35S-hyg;
T-DNA-based binary vector Kanamycin Hygromycin This study
pG-epsilonX-229N-YC 35S-epsilon-YC; pNos-bar;
T-DNA-based binary vector Kanamycin Basta This study
pG-epsilonX-229N-YN 35S-epsilon-YN; pNos-bar;
T-DNA-based binary vector Kanamycin Basta This study
pG-iota∆PCR-229N-YC 35S-iota∆-YC; pNos-bar;
T-DNA-based binary vector Kanamycin Basta This study
pG-iotaXPCR-229N-YC 35S-iota-YC; pNos-bar;
T-DNA-based binary vector Kanamycin Basta This study
pG-iotaXPCR-229N-YN 35S-iota-YN; pNos-bar;
T-DNA-based binary vector Kanamycin Basta This study
pG-kappa∆PCR-229N-YC 35S-kappa∆-YC; pNos-bar;
T-DNA-based binary vector Kanamycin Basta This study
pG-kappa∆PCR-229N-YN 35S-kappa∆-YN; pNos-bar;
T-DNA-based binary vector Kanamycin Basta This study
pG-kappaXPCR-229N-YC 35S-kappa-YC; pNos-bar;
T-DNA-based binary vector Kanamycin Basta This study
pG-kappaXPCR-229N-YN 35S-kappa-YN; pNos-bar;
T-DNA-based binary vector Kanamycin Basta This study
pG-lambda∆PCR-229N-YC 35S-lambda∆-YC; pNos-bar;
T-DNA-based binary vector Kanamycin Basta This study
pG-lambda∆PCR-229N-YN 35S-lambda∆-YN; pNos-bar;
T-DNA-based binary vector Kanamycin Basta This study
pG-lambdaX-179N-YN 35S-lambda-YN; 35S-hyg;
T-DNA-based binary vector Kanamycin Hygomycin This study
Chapter 3. Establishment of a BiFC assay system in planta 60
Table 3-2. Plant expression vectors used in this study (continued).
Plasmid name Description Bacterial selection
Plant selection
Source or reference
pG-mu∆-179NS-YC 35S-mu∆-YC; 35S-hyg;
T-DNA-based binary vector Kanamycin Hygromycin This study
pG-mu∆-179NS-YN 35S-mu∆-YN; 35S-hyg;
T-DNA-based binary vector Kanamycin Hygromycin This study
pG-muX-179NS-YC 35S-mu-YC; 35S-hyg;
T-DNA-based binary vector Kanamycin Hygromycin This study
pG-muX-179NS-YN 35S-mu-YN; 35S-hyg;
T-DNA-based binary vector Kanamycin Hygromycin This study
pG-nuX-229N-YC 35S-nu-YC; pNos-bar;
T-DNA-based binary vector Kanamycin Basta This study
pG-nuX-229N-YN 35S-nu-YN; pNos-bar;
T-DNA-based binary vector Kanamycin Basta This study
pG-omega∆-179N-YC 35S-omega∆-YC; 35S-hyg;
T-DNA-based binary vector Kanamycin Hygromycin This study
pG-omega∆-179N-YN 35S-omega∆-YN; 35S-hyg;
T-DNA-based binary vector Kanamycin Hygromycin This study
pG-omega∆-229N-YC 35S-omega∆-YC; pNos-bar;
T-DNA-based binary vector Kanamycin Basta This study
pG-omega∆-229N-YN 35S-omega∆-YN; pNos-bar;
T-DNA-based binary vector Kanamycin Basta This study
pG-omegaXPCR-179N-YN 35S-omega-YN; 35S-hyg;
T-DNA-based binary vector Kanamycin Hygromycin This study
pG-omegaXPCR-229N-YC 35S-omega-YC; pNos-bar;
T-DNA-based binary vector Kanamycin Basta This study
pG-omicron∆PCR-229N-YN 35S-omicron∆-YN; pNos-bar;
T-DNA-based binary vector Kanamycin Basta This study
pG-omicronXPCR-229N-YC 35S-omicron-YC; pNos-bar;
T-DNA-based binary vector Kanamycin Basta This study
pG-omicronXPCR-229N-YN 35S-omicron-YN; pNos-bar;
T-DNA-based binary vector Kanamycin Basta This study
pG-phi∆-179NS-YC 35S-phi∆-YC; 35S-hyg;
T-DNA-based binary vector Kanamycin Hygromycin This study
pG-phi∆-179NS-YN 35S-phi∆-YN; 35S-hyg;
T-DNA-based binary vector Kanamycin Hygromycin This study
pG-phiX-179NS-YC 35S-phi-YC; 35S-hyg;
T-DNA-based binary vector Kanamycin Hygromycin This study
pG-phiX-179NS-YN 35S-phi-YN; 35S-hyg;
T-DNA-based binary vector Kanamycin Hygromycin This study
pG-psi∆-179NS-YC 35S-psi∆-YC; 35S-hyg;
T-DNA-based binary vector Kanamycin Hygromycin This study
pG-psi∆-179NS-YN 35S-psi∆-YN; 35S-hyg;
T-DNA-based binary vector Kanamycin Hygromycin This study
pG-psiX-179NS-YC 35S-psi-YC; 35S-hyg;
T-DNA-based binary vector Kanamycin Hygromycin This study
pG-psiX-179NS-YN 35S-psi-YN; 35S-hyg;
T-DNA-based binary vector Kanamycin Hygromycin This study
pG-upsilon∆PCR-229N-YC 35S-upsilon∆-YC; pNos-bar;
T-DNA-based binary vector Kanamycin Basta This study
Chapter 3. Establishment of a BiFC assay system in planta 61
3.2.5. Generation of an Agrobacterium library carrying pGreen-14-3-3-BiFC
constructs
The generated 14-3-3 full-length and N-terminally shortened 14-3-3 BiFC
plasmids were individually transferred into the Agrobacterium strain GV3101/pMP90
containing the pSOUP helper plasmid, which provides in trans activities required for
transformation of plants with pGreen based vectors (Hellens et al., 2000b). In this
library, each clone contained only one 14-3-3-split YFP construct, either the 14-3-3-YN
or the 14-3-3-YC. The presence of BiFC vectors in transgenic Agrobacteria was
confirmed by antibiotic selection and colony PCR analysis (Section 2.3.5). Examples
for the outcome of colony PCR analyses are shown in Fig. 3-7. In this experiment,
nine different Agrobacterium clones containing 14-3-3-split YFP plasmids were
analysed using a 14-3-3 isoform specific 5’-cloning primer (Table 2-1) as the forward
primer and a primer homologous to the coding region of YN (NYFPsp1; Table 2-2) or
YC (CYFPsp1; Table 2-2) as the reverse primer. Amplification products were analysed
by agarose gel electrophoresis. A single amplicon with the expected size was found
for each of the clones shown (Fig. 3-7).
3.2.6. Establishment of transient BiFC assay systems for 14-3-3 protein
interaction analysis
To establish the BiFC assay systems, a suitable plant system had to be identified.
In general, such a system could be based on transient or stable expression of BiFC
constructs. Agrobacterium-mediated transient transformation was first used as the
method for the delivery of transgenes into plant cells based on its simplicity, the
ability to obtain results rapidly when compared to stable transformation and the
potential for a medium-throughput evaluation of protein pair interactions.
35S 14-3-3X or 14-3-3Δ NosTYN or YCTag
5’ primer
3’ primer
A
1 2 3 4 5 6 7 8 9B
1 kb
Fig. 3-7. PCR based analysis of transgenic Agrobacterium lines containing 14-3-3-BiFCexpression vectors.
The presence of 14-3-3 BiFC expression vectors in transgenic Agrobacteria was confirmed viaPCR and gel electrophoresis. Cells picked from transgenic colonies were used directly in PCRsto provide the DNA template. PCRs were performed using 14-3-3 gene specific primers (A, 5’primer) in combination with either a N-YFP or C-YFP specific primer (A, 3’ primer) to confirmthe presence of the transgenes (see Materials and Methods for details). In the experimentshown, nine positive Agrobacterium clones were selected for the PCR based analysis. PCRproducts obtained from the corresponding constructs as listed in the table (C) were analyzedusing 1% agarose gel electrophoresis (B). The position of a 1 kb molecular size marker isindicated (B). The expected sizes of amplicons for each construct are summarised in (C).
Lane Construct Expected size (bp)
1 pG-epsilonX-229N-YN 961
2 pG-epsilonX-229N-YC 960
3 pG-epsilonX-179N-YN 961
4 pG-epsilon∆-229N-YC 877
5 pG-epsilon∆-179N-YN 878
6 pG-epsilon∆-229N-YN 878
7 pG-kappa∆PCR-229N-YN 854
8 pG-lambdaX-179N-YN 946
9 pG nuX-179N-YN 997
C
Chapter 3. Establishment of a BiFC assay system in planta 62
Chapter 3. Establishment of a BiFC assay system in planta 63
Agrobacterium infiltration (agroinfiltration) of leaves is a widely used transient
transformation method for gene function analysis, promoter analysis and protein
production (Voinnet et al., 2003; Wroblewski et al., 2005; Ueki et al., 2008). This
method was applied to many plant species and performed very well when used for
transient transformation of Nicotiana leaves (Romeis et al., 2001; Voinnet et al., 2003;
Witte et al., 2004; Hellens et al., 2005; Wroblewski et al., 2005). It was shown that this
method could also be used for the transient transformation of Arabidopsis thaliana
leaves (Bracha-Drori et al., 2004; Wroblewski et al., 2005). The stated advantages of
this method and its wide applicability for transient plant transformation led to the
decision to adapt this method for Nicotiana and Arabidopsis to study 14-3-3 protein
interaction.
3.2.6.1. Transient BiFC assay in Arabidopsis leaves using agroinfiltration
The experimental conditions described in Bracha-Drori et al. (2004) for transient
BiFC assays in Arabidopsis leaves were applied in this study where possible, including
the experimental procedures, the Agrobacterium strain (GV3101/pMP90) and the
Arabidopsis ecotype (Col-0). However, the present study differed from the published
work as different T-DNA binary vectors and a helper plasmid (pSOUP) and different
gene sets were used.
For transient transformation, two Agrobacterium strains, one harbouring a
14-3-3-YN and the other a 14-3-3-YC vector were co-infiltrated into the abaxial air
space of 4-5-week-old Arabidopsis leaves (Section 2.4.2). In an initial evaluation
experiment, non-treated leaves were used to detect background fluorescence, and
infiltration with buffer only or with only one 14-3-3 BiFC construct (e.g. epsilon-YN)
were used as negative controls. To evaluate the efficiency of the transgene delivery
method, a single Agrobacterium strain carrying the vector pCAMBIA 1302, which
Chapter 3. Establishment of a BiFC assay system in planta 64
encodes the GFP reporter gene under the regulatory control of a CaMV 35S promoter,
was used to infiltrate leaves (positive control).
Three days after infiltration, the lower epidermal layers of infiltrated leaves were
examined by fluorescence microscopy. Fluorescence was not detectable in
non-treated leaves (Fig. 3-8 A), in leaves infiltrated with infiltration buffer only (Fig.3-8
B), nor in leaves infiltrated with the 14-3-3 epsilon-YN construct only (Fig. 3-8 D).
GFP fluorescence was detected in only some of the leaves infiltrated with the 35S-GFP
clones (Fig. 3-8 C), suggesting the competency of Arabidopsis leaf cells for receiving or
expressing transgenes via the agroinfiltration method varied from plant to plant
and/or leaf to leaf.
Leaves co-infiltrated with a 1:1 volume ratio of Agrobacteria harbouring
epsilon-YN and epsilon-YC constructs showed fluorescence, which was stronger than
the background fluorescence observed in negative control experiments. This
suggested YFP reconstitution by 14-3-3 epsilon homodimer formation (Fig. 3-8 E).
For another 14-3-3 dimer combination, psi-YN and psi-YC, the BiFC fluorescence was
dim and could not easily be differentiated from background fluorescence (Fig. 3-8 F).
Notably, BiFC fluorescence by the epsilon or the psi homodimerisation was not
consistently observed in replicate infiltrations, or in a repeat experiment (data not
shown).
Strong background fluorescence was often observed in cells surrounding
wounded tissues of Arabidopsis (Fig. S1; Appendix II). The wounds were possibly
caused by the infiltration procedure. These wounded areas became yellowish three
days after infiltration, and demonstrated very strong, green background fluorescence
(Fig. S1). Such strong background fluorescence severely hindered the detection of
BiFC fluorescence driven by potential 14-3-3 dimer formation in adjacent cells, and
made the system impractical for studying protein-protein interactions.
Fig. 3-8. Bimolecular fluorescence complementation analysis of 14-3-3 dimerisation intransiently transformed Arabidopsis leaves.
Arabidopsis leaves (4-5-week-old) were: not infiltrated (no treatment control; A and A’) orinfiltrated with buffer only (infiltration control; B and B), an Agrobacterium strain harboring avector encoding a 14-3-3 epsilon-YN fusion protein (negative control; C and C’), anAgrobacterium strain harboring the 35S-GFP vector pCAMBIA1302 (positive control; D and D’),a mix of two Agrobacterium strains harboring vectors which encode either a 14-3-3 epsilon-YNor a 14-3-3 epsilon-YC fusion protein (epsilon BiFC; E and E’), a mix of two Agrobacteriumstrains harboring vectors which encode either a 14-3-3 psi-YN or a 14-3-3 psi-YC fusion protein(psi BiFC; F and F’). Fluorescence was monitored 3 days after infiltration using a fluorescencemicroscope (A to F) fitted with a GFP filter or under bright field (A’ to F’). GFP fluorescencewas clearly observable in leaves infiltrated with the positive control (D) and a low level of BiFCfluorescence was observed in leaves infiltrated with the two pairs of 14-3-3 BiFC constructs (Eand F), but fluorescence was absent or very low in control treatments (A to C). Scale bars = 50μm.
GFP filter Bright field
A
B
D D’
C
E
F
A’
E’B’
F’C’
GFP filter Bright field
Chapter 3. Establishment of a BiFC assay system in planta 65
Chapter 3. Establishment of a BiFC assay system in planta 66
Factors that affect the virulence of Agrobacterium or the physiological condition
of a plant would have an impact on the efficiency of transient assays (Wroblewski et
al., 2005). Wroblewski and co-workers examined several parameters affecting
transgene expression in the transient agroinfiltration assays, such as the density of the
Agrobacterium suspension, Agrobacterium strains, Arabidopsis ecotypes, effect of
culture conditions and chemical components (Wroblewski et al., 2005). Two of these
parameters were investigated as means of improving the BiFC assay system in this
study: these were the cell density of the Agrobacterium suspension and the
Arabidopsis ecotypes.
When the OD600 of the Agrobacterium cell suspension used for agroinfiltration
was increased from 0.2 to 0.6 or 1.0, the efficiency and reproducibility in GFP
transformation experiments increased slightly as observed by slightly stronger
fluorescence in more cells and a more uniform distribution of fluorescent cells (data
not shown). No significant difference was observed between infiltration
experiments in which cells at a density of OD600= 0.6 and 1.0 were used (data not
shown). In contrast to the positive GFP control, no improvement was observed in
14-3-3 co-infiltration assays (data not shown). Using other ecotypes of Arabidopsis
such as Col-6 and Wassilewskija-2 (WS-2), led to no obvious improvement in the
fluorescence intensity or the number of cells transformed (data not shown).
The results from these evaluation experiments suggested that agroinfiltration of
Arabidopsis leaves was not a very reliable technique to study 14-3-3 protein
interaction using BiFC, at least under the experimental conditions tested. Although
not all of the assay parameters were exhaustively examined, further optimisation of
this system would have delayed achieving the main aims of this project.
Consequently, other transient assay systems for BiFC analysis were tested.
Chapter 3. Establishment of a BiFC assay system in planta 67
3.2.6.2. Transient BiFC assay in Arabidopsis mesophyll protoplasts
To maintain the transient BiFC assay in the homologous system, i.e. test
Arabidopsis proteins in Arabidopsis, an alternative approach was needed to deliver
transgenes into Arabidopsis cells. Two other approaches widely used in transient
assays in Arabidopsis are biolistic bombardment and PEG-mediated transformation of
protoplasts (Ueki et al., 2008).
Microparticle bombardment is a widely used technique for transient gene
expression, and is used with a variety of plant species (Taylor and Fauquet, 2002), but
was not applied here as bombardment of Arabidopsis tissues is reportedly low in
efficiency and reproducibility (Helenius et al., 2000).
PEG-mediated transformation of protoplasts is an efficient method for transient
gene expression (Yoo et al., 2007), and has been used for in planta BiFC assays (Walter
et al., 2004; Schütze et al., 2009). Walter and co-workers demonstrated the
homodimerisation of a tobacco 14-3-3 isoform (T14-3c) in Arabidopsis cell culture
protoplasts using the BiFC assay (Walter et al., 2004). The feasibility of the
protoplast system was evaluated here using the established pGreen-based 14-3-3-split
YFP vectors described in this thesis (Section 3.2.4).
To maintain Arabidopsis cell suspension cultures as the protoplast source for the
transient assay is relatively time and labour consuming. An alternative source for
protoplasts is leaf mesophyll cells of soil-grown Arabidopsis plants (Kovtun et al., 2000;
Sheen, 2001; Yoo et al., 2007). High transfection efficiency (60%-90%) was reported
with the use of mesophyll protoplasts (Yoo et al., 2007). Thus it was decided to use
mesophyll protoplasts for a transient BiFC assay of 14-3-3 dimerisation.
To test the feasibility of the protoplast system for a transient BiFC assay,
approximately 2 x 104 mesophyll protoplasts were transfected with the constructs
indicated in Table 3-3. Protoplasts were tested for viability after transfection (data
Chapter 3. Establishment of a BiFC assay system in planta 68
not shown) and only viable protoplasts were analysed for fluorescence. In addition
to testing for fluorescence caused by GFP or YFP reconstitution, a filter set for the
fluorophore fluorescein isothiocyanate (FITC; Section 2.5.1) was used to visualise
autofluorescence of chlorophyll in the chloroplasts. Non-transformed protoplasts
showed no fluorescence with the GFP filter and only red chlorophyll autofluorescence
with the FITC filter (data not shown).
Following transfection with pCAMBIA 1302, a 35S-GFP construct used as a
positive transformation control, about 10% of the viable protoplasts (approximately
100 protoplasts) presented GFP fluorescence (Fig. 3-9 A, Table 3-3). The
fluorescence observed after transformation with the GFP construct was strong and
distributed throughout the cell, with a high intensity in the nucleus (Fig. 3-9 A, left).
In addition to GFP fluorescence, red chlorophyll autofluorescence was detected
indicating the position of chloroplasts (Fig. 3-9 A, middle).
BiFC fluorescence was observed using a GFP filter for all the tested 14-3-3
dimeric combinations. With 2 to 6.6 μg of total plasmid DNA used for the protoplast
transfection, the approximate frequency of protoplasts showing BiFC fluorescence for
each 14-3-3 dimeric combinations tested ranged from 0.1% to 5% (Table 3-3). There
was no significant correlation of the DNA amount used for transfection and the
frequency of protoplasts showing BiFC fluorescence from the tested 14-3-3 dimers.
BiFC fluorescence observed in protoplasts co-transfected with plasmids
pG-muX-179NS-YN and pG-muX-179NS-YC (muX-YN + muX-YC; Fig. 3-9 B) or
pG-psiX-179NS-YN and pG-psiX-179NS-YC (psi-YN + psi-YC; Fig. 3-9 C) indicated that
mu and psi homodimers accumulated in the cytosol and possibly in the nucleus (Fig.
3-9). A small degree of overlap between the BiFC and chlorophyll fluorescence
patterns was detected; consequently, it could not be unequivocally resolved if 14-3-3
psi-YN + psi-YCC
Fig. 3-9. Bimolecular fluorescence complementation analysis of 14-3-3 dimerisation intransiently transformed Arabidopsis mesophyll protoplasts.
Arabidopsis mesophyll protoplasts were transformed using a PEG based transformationprotocol with either a GFP expressing pCAMBIA 1302 vector (A) or co-transfected withconstructs encoding the 14-3-3 fusion proteins mu-YN and mu-YC (B) or psi-YN and psi-YC (C).Protoplasts were analysed 36 hours after transformation using a fluorescence microscopefitted with a GFP filter for the detection of fluorescence caused by GFP expression and YFPreconstitution upon 14-3-3 dimerisation (green), or a FITC filter for the simultaneousdetection of chlorophyll autofluorescence (red) and GFP/YFP fluorescence (green). Thebright field image is also shown for each cell. Scale bars = 50 μm.
GFP filter FITC filter Bright field
mu-YN + mu-YCB
GFPA
Chapter 3. Establishment of a BiFC assay system in planta 69
Chapter 3. Establishment of a BiFC assay system in planta 70
Table 3-3. Constructs used in the PEG-mediated transfection of Arabidopsis
mesophyll protoplasts for BiFC analysis of 14-3-3 dimerisation.
Highly purified pCAMBIA 1302 DNA (GFP positive control) or a combination of 14-3-3-BiFC
constructs was introduced into Arabidopsis leaf mesophyll protoplasts. The total amount of
plasmid DNA used is indicated. For BiFC experiments, both plasmids contributed equally to
the total amount of DNA used. The approximate frequency of protoplasts showing GFP or
BiFC fluorescence is shown.
Constructs Total plasmid DNA used
in transfections (μg)
Approximate frequency of
protoplasts showing fluorescence
pCAMBIA 1302
(GFP, positive control) 2.0 10.0%
chi-YN + kappa-YC 4.0 1.8%
chi-YN + nu-YC 4.0 1.4%
epsilon-YN + epsilon-YC 2.5 5.0%
iota-YN + iota-YC 6.0 4.0%
kappa-YN + kappa-YC 4.5 0.8%
mu-YN + mu-YC 3.0 3.0%
omega-YN + omega-YC 2.5 2.0%
omicron-YN + omicron-YC 3.4 0.1%
phi-YN + phi-YC 6.6 2.8%
psi-YN + psi-YC 2.0 3.0%
mu and psi homodimer formation occurred in chloroplasts (Fig. 3-9 B and C). From
these results, it appeared that the protoplast transfection system is suitable for the
evaluation of protein interactions using BiFC analysis. This method can potentially
be used to identify the subcellular localisation of such interactions. However, due to
the variation in fluorescent cell frequency, further improvement and optimisation of
this assay system appeared necessary.
3.2.6.3. Transient BiFC assay in Nicotiana leaves
Because of the limitations of the Arabidopsis agroinfiltration and protoplast
systems, which displayed low reproducibility and variable co-transfection frequency,
Chapter 3. Establishment of a BiFC assay system in planta 71
respectively, an alternative system, agroinfiltration of Nicotiana leaves, was assessed
for BiFC assays of 14-3-3 dimerisation. Nicotiana is used in a variety of transient
expression assays, including BiFC analyses for protein interactions (Bracha-Drori et al.,
2004; Walter et al., 2004; Desprez et al., 2007; Gampala et al., 2007; Waadt et al.,
2008).
Leaves of 5-7-week-old Nicotiana plants were infiltrated, through the abaxial air
spaces as described in Section 2.4.5, with a mixture of Agrobacterium clones
harbouring 14-3-3-YN and 14-3-3 YC constructs. In parallel, another set of leaves
was infiltrated with Agrobacteria harbouring the GFP-encoding vector pCAMBIA 1302
to serve as a positive control. As shown in Fig. 3-10 A, GFP fluorescence was
detected in the infiltrated leaf area, but only a few cells showed fluorescence.
Similarly in the leaves co-infiltrated with chi-YN and chi-YC constructs, the BiFC
fluorescence caused by homodimerisation of 14-3-3 chi isoform was detected only in
a small number of cells (Fig. 3-10 C). Further improvements in this approach were
needed for it to be a robust BiFC assay system.
It has been shown that high level of transgene expression following
agroinfiltration in Nicotiana leaves triggers post-transcriptional gene silencing (PTGS)
(Voinnet et al., 2003). Co-expression of a silencing suppressor, such as the p19
protein from tomato bushy stunt virus, with the proteins of interest in the
Agrobacterium-mediated transient assay system, can attenuate PTGS (Voinnet et al.,
2003). This strategy has been used in a number of transient assays to enhance
transgene expression (Hellens et al., 2005; Wroblewski et al., 2005; Jach et al., 2006;
Grefen et al., 2008), including BiFC analyses (Walter et al., 2004; Waadt et al., 2008;
Schütze et al., 2009).
Fig. 3-10. The impact of gene silencing in transiently transformed Nicotiana benthamianaleaves on bimolecular fluorescent complementation signals.
N. benthamiana leaves were infiltrated with Agrobacteria harboring the 35S-GFP vectorpCAMBIA 1302 (positive control, A and B; GFP) or with a mix of Agrobacteria harboringvectors expressing either a 14-3-3 chi-YN or a 14-3-3 chi-YC fusion proteins (C and D; chi-YN/chi-YC). These infiltrations were performed in the absence (A and C; -p19) or presence (Band D; +p19) of an Agrobacterium strain harboring a vector encoding the p19 silencingsuppressor. Injected leaves were monitored for epifluorescence, indicating GFP expression or14-3-3 dimerisation, 3 days after injection using a fluorescence microscope fitted with a GFPfilter (A to D, left). Bright field images of the infiltrated leaf areas are also shown (A to D, right).Scale bars = 50 μm.
GFP filter Bright field GFP filter Bright field
+ p19- p19
GFP
chi-YN/chi-YC
A
C
B
D
Chapter 3. Establishment of a BiFC assay system in planta 72
Chapter 3. Establishment of a BiFC assay system in planta 73
To determine if co-expression of BiFC constructs and the silencing suppressor
p19 could enhance transgene expression in the system used here, an Agrobacterium
strain containing the p19 construct was co-infiltrated with GFP or BiFC constructs into
Nicotiana leaves. As shown in Fig. 3-10, co-expression of GFP and p19 lead to a
strong increase in the number of cells showing GFP fluorescence as well as in the
intensity of the fluorescent signal observed in individual cells (Fig. 3-10 B). Similarly,
a strong increase in fluorescence was observed when Nicotiana leaves were
co-transformed with p19 and two 14-3-3 chi-split YFP constructs (chi-YN/chi-YC; Fig.
3-10 D). Approximately 90% of the cells in the infiltrated area demonstrated strong
fluorescent signals in both co-infiltration experiments. The fluorescence started to
appear 2-3 days post agroinfiltration and continued for up to 7 days. In general, the
best observation time for BiFC fluorescence was 4-5 days post-infiltration, after which
the fluorescent signal began to fade.
The results suggested that high expression of GFP and 14-3-3 proteins was
induced or stabilised by co-expression of p19 in Nicotiana leaf cells. The increase in
fluorescence intensity and number of cells showing fluorescence when using p19 was
reproducible and also observed using other 14-3-3 combinations (Fig. 3-11). This
improvement in signal output and experimental reliability was the reason the p19
silencing suppressor was included in subsequent transient BiFC analyses (Chapter 4).
3.2.6.4. Robustness of transient BiFC assays using Nicotiana leaves and
reproducibility of results
Overexpression of two proteins using highly active promoters, such as the CaMV
35S promoter, can lead to molecular crowding. In combination with ‘stickiness’ of
such proteins this may lead to false positive interactions, which could lead to
reconstitution of YFP and hence fluorescence. To verify that the observed BiFC
Chapter 3. Establishment of a BiFC assay system in planta 74
signals were specific to 14-3-3 dimerisation and not caused by auto-reconstitution of
the split YFP parts of the fusion proteins or stickiness of the expressed fusion proteins,
BiFC assays were performed using constructs encoding N-terminally truncated 14-3-3
proteins. Several in vivo and in vitro approaches have shown that such N-terminally
truncated 14-3-3s, lacking the dimerisation domains, are unable to dimerise (Wu et al.,
1997b; Abarca et al., 1999; Jaspert and Oecking, 2002; Walter et al., 2004). Thus,
such N-terminally truncated 14-3-3s could serve as negative controls for BiFC assays
(Walter et al., 2004). Any fluorescent signals obtained with such constructs would
reflect non-specific interactions of expressed proteins or tags.
The BiFC fluorescence of full-length 14-3-3 combinations was compared to that
of N-terminally truncated 14-3-3s to verify that only 14-3-3 dimerisation can lead to
reconstitution of YFP and hence fluorescence. Intense BiFC fluorescence was
observed in leaf cells infiltrated with full-length kappa-YN/kappa-YC, indicating the
formation of 14-3-3 kappa homodimers within the cells (Fig. 3-11, I-A). In contrast,
BiFC fluorescence was not detectable in leaves transformed with kappaΔ-YN/kappa-YC
or with kappaΔ-YN/kappaΔ-YC (Fig. 3-11, I-B and I-C, respectively). The results
confirmed that N-terminally truncated 14-3-3 kappa monomers were unable to
dimerise with a full-length or another truncated 14-3-3 kappa monomer, and that the
fluorescent signals were due to dimerisation of the full-length 14-3-3 proteins.
Western blot analysis was used to verify that lack of fluorescence was not
caused by a lack of expression of N-terminally truncated 14-3-3s. Protein extracts
were prepared from leaf areas infiltrated with full-length and N-terminally truncated
BiFC constructs. Proteins were separated by size using 10% denaturing
polyacrylamide gels and followed by immunoblot analyses using primary antibodies
directed against the c-myc or HA tags encoded in the BiFC constructs (Fig. 3-11, II).
Fig. 3.11. Bimolecular fluorescence complementation analysis of Arabidopsis 14-3-3 kappahomodimerisation and western blot analysis of the transgene expression in N.benthamiana leaves.
I. (A-C) Bright field images (upper panel) and epifluorescence images (lower panel) of thelower epidermal layer of leaves infiltrated with a mixture of Agrobacteriumsuspensions harbouring constructs encoding the 14-3-3 fusion proteins:kappa-YN/kappa-YC (A), kappaΔ-YN/kappa-YC (B) or kappaΔ-YN/kappaΔ-YC (C). Similaroutcomes were observed in duplicate experiments (data not shown). Scale bars = 50 μm.II. Immunodetection of 14-3-3 fusion protein expression with anti-c-myc (α-c-myc) and anti-hemagglutinin (α-HA) antibodies. Total proteins were extracted separately from the leavesshown in I, A-C, separated by 10% SDS-polyacrylamide gel electrophoresis and transferredto nitrocellulose membrane (lanes A-C, respectively). The membrane was probed with α-c-myc antibodies and then with α-HA antibodies as the primary antibodies. Horseradishperoxidase-conjugated anti-mouse antibodies were used as the second antibody. Labelledpolypeptides were visualised by the ECL™ Western Blotting System (GE Healthcare) and theGel Doc™ XR and ChemiDoc™ XRS Gel Documentation System (Bio-Rad).III. A duplicate gel to that shown in II stained with Coomassie Blue, showing protein amountsloaded. The abundant protein at about 54 kDa is likely the large subunit of ribulose-1,5-bisphosphate carboxylase/oxygenase (RubisCO).Positions of the 40 and 50 kDa protein markers are indicated. Note, irrelevant lanesbetween lanes B and C (in II and III) were removed.
Coomassie Blue staining
III
40
50
A B CkDa
A B CI
Chapter 3. Establishment of a BiFC assay system in planta 75
kappa-YN/kappa-YC kappaΔ-YN/kappa-YC kappaΔ-YN/kappaΔ-YC
Immunoblot
α-c-myc
α -HA
kDa
40
A B CII
50
Chapter 3. Establishment of a BiFC assay system in planta 76
A horseradish peroxidase-conjugated anti-mouse antibody was used as secondary
antibody, allowing for the simultaneous visualisation of YN and YC fused 14-3-3s.
Two intensely labelled bands with the expected sizes, i.e. 47 kDa for kappa-YN and 44
kDa for kappa-YC, were detected in extracts from leaves infiltrated with full-length
14-3-3 kappa constructs (Fig. 3-11, II lane A). Two bands of 39 kDa and 36 kDa were
observed in extracts obtained from leaves infiltrated with the N-terminally shortened
14-3-3 kappa constructs (Fig. 3-11, II lane C). These sizes corresponded to the
expected reduction in molecular weight of the 14-3-3s caused by the loss of 29 amino
acids at the N-terminal end of 14-3-3 kappa.
Other full-length and N-terminally truncated 14-3-3s were tested in the BiFC
assay as described above to confirm that the results obtained for the two forms of
14-3-3 kappa could be generalised for 14-3-3s (Table 3-4). As with N-terminally
truncated 14-3-3 kappa, none of the tested dimeric combinations containing at least
one truncated 14-3-3 showed intense BiFC fluorescence when compared to full-length
14-3-3s. Most of the combination with one or two truncated 14-3-3s displayed no
detectable BiFC fluorescence at all, whilst a few showed weak fluorescence in a small
number of cells (low level; Table 3-4 and data not shown). These data supported the
notion that BiFC fluorescence was caused by 14-3-3 dimerisations and not because of
YFP reconstitution by other mechanisms or to a general ‘stickiness’ of the proteins.
The results further supported that of others showing N-terminally truncated 14-3-3s
can serve as negative controls in 14-3-3 dimerisation experiments using BiFC
(Chapters 4 and 5).
3.2.7. Identification of subcellular distribution of 14-3-3-BiFC dimeric
complexes
When observing BiFC fluorescence from 14-3-3 dimerisations in intact leaves,
Chapter 3. Establishment of a BiFC assay system in planta 77
Table 3-4. Negative controls of 14-3-3 dimerisation tested in the transient
BiFC assay in Nicotiana leaves.
Selected N-terminally truncated 14-3-3 mutants were used to test for 14-3-3 dimerisations in
the transient BiFC assay. Some dimeric combinations showed undetectable BiFC
fluorescence and others showed low levels of fluorescence.
Constructs BiFC*
epsilonΔ-YN/epsilonΔ-YC ND
iota-YN/iotaΔ-YC Low level
kappa-YN/iotaΔ-YC Low level
kappa-YN/kappaΔ-YC ND
kappaΔ-YN/kappa-YC ND (Fig. 3-11)
kappaΔ-YN/kappaΔ-YC ND (Fig. 3-11)
muΔ-YN/chi-YC ND
mu-YN/muΔ-YC Low level
muΔ-YN/mu-YC ND
muΔ-YN/muΔ-YC Low level
omegaΔ-YN/omega-YC Low level
omegaΔ-YN/omegaΔ-YC Low level
* ND: not detectable. Low level: few cells showed weak BiFC
fluorescence in the infiltrated leaf areas.
for instance the kappa homodimerisation shown in Figures 3-11 A and 3-12 A, 14-3-3
dimers were usually detectable in the cytoplasm and sometimes also in nucleus-like
structures (Fig. 3-12 A). However, it was often difficult to identify subcellular
structures, such as the nucleus, with absolute certainty. To improve the resolution
and quality of the observation and imaging of fluorescent signals, peels of the lower
leaf epidermis were used. This procedure reduced the number of layers of cells for
microscopic observation, which dramatically increased image resolution (Fig. 3-12 C
and D). This led to more confident identification of the subcellular localisation of
14-3-3-BiFC dimeric complexes. In addition, this approach also allowed for an
Fig. 3-12. Comparison of 14-3-3 dimerisation mediated bimolecular fluorescencecomplementation signals in lower epidermal cells of intact leaves and in cells of peeledepidermal layers of Nicotiana benthamiana.
14-3-3 dimerisation, as indicated by reconstitution of YFP, was detected in N. benthamianaleaves infiltrated with two Agrobacterium strains, one carrying an expression construct for14-3-3 kappa-YN and the other a 14-3-3 kappa-YC expression vector. Epifluorescence imageswere taken from the lower epidermal layer of intact leaves (A) or from lower epidermalpeels (C). The fluorescent images demonstrate the increase in resolution of labeledintracellular structures such as the nucleus when using peeled epidermal layers (C) overintact leaves (A). In peeled epidermal cells (C), 14-3-3 kappa dimerisation was clearlydetectable via YFP fluorescence in the cytosol (Cyt) and the nucleus (N). In contrast, theBiFC signals of 14-3-3 kappa dimerisation were very low or below detectable levels in thenucleolus (No), in the vacuolar space (V) or in chloroplasts (Chl) surrounding the nucleus.Corresponding bright field images are shown (B and D). Scale bars = 50 μm.
GFP filter Bright field
A
C
B
D
N
V
Chl
Cyt
N
V
Cyt
No
Chapter 3. Establishment of a BiFC assay system in planta 78
Chapter 3. Establishment of a BiFC assay system in planta 79
estimation of fluorescence intensity caused by dimerisation in the different
subcellular compartments. As shown in Fig. 3-12 C, the fluorescence intensity of
14-3-3 kappa homodimerisation in nucleus-like structures was much stronger than
that observed in the cytoplasm, suggesting that kappa homodimers accumulated to
relatively high levels in the nucleus. A darker, possibly un-labelled structure
observed within the labelled nucleus resembled a nucleolus, suggesting the 14-3-3
dimer were low or absent from the nucleolus (Fig. 3-12 C and Fig. 3-13 A).
Fig. 3-13. Identification of the subcellular distribution of 14-3-3-BiFC dimeric complexes in
transiently transformed N. benthamiana leaves.
Epifluorescence images were obtained from abaxial epidermal peels of N. benthamiana
leaves infiltrated with a mixture of Agrobacterium suspensions harbouring constructs
encoding kappa-YN/kappa-YC (A-D) or phi-YN/omega-YC (E-H). The epidermal peels were
stained with 4’, 6-diamidino-2-phenylindole (DAPI) to detect the nuclei. BiFC fluorescence
from 14-3-3 dimerisations was detected as green under filters for GFP (A and E) and FITC (B
and F). Chlorophyll autofluorescence was red under the FITC filter (B and F). DAPI-stained
nuclei presented blue-white fluorescence under the DAPI filter (C and G). The kappa
homodimer and the phi-omega heterodimer localised to the cytosol, the nuclei (N) but were
absent from the nucleoli (No) and chloroplasts (Chl). DAPI-staining outside the cell was due to
debris. Scale bars = 50 μm.
Chapter 3. Establishment of a BiFC assay system in planta 80
The nuclear-like structure was confirmed to be the nucleus by 4’,
6-diamidino-2-phenylindole (DAPI) staining. Epidermal cells showing BiFC
fluorescence due to kappa homodimerisation (Fig. 3-13 A) or phi-omega
heterodimerisation (Fig. 3-13 E) were co-stained with DAPI, a fluorescent dye that
binds to double-stranded DNA resulting in blue-white fluorescence when excited with
UV light (Kubista et al., 1987). Using an appropriate filter set for DAPI (Section 2.5.1),
the location of the nuclei was confirmed to coincide with the observed nuclear-like
structures exhibiting BiFC fluorescence (Fig. 3-13). Chlorophyll autofluorescence
detectable as red fluorescence when using a FITC filter (Fig. 3-13 B and F) was used to
identify the location of chloroplasts. By comparison of FITC filter images with BiFC
images and overlays of the two, it was shown that both, kappa homodimers and
phi-omega heterodimers were absent from chloroplasts (Fig. 3-13).
A negative impact of using epidermal peels was the dramatic decrease of the
number of cells showing fluorescence when compared to intact leaves. After peeling,
approximately 5% to 15% of the epidermal cells still remained fluorescent. This
decrease may have been largely due to wound effects caused by the invasive
preparation of epidermal peels and by removing and observing only one cell layer.
Despite this reduction in fluorescent cell numbers, sufficient cells were available for
observation and determination of BiFC distribution. Thus, it was considered that the
improvement in image quality and the enhanced ability to clearly identify subcellular
localisation of 14-3-3 dimers outweighed the reduction in fluorescent cell numbers.
Thus, epidermal peels were used for all subsequent 14-3-3 dimerisations tested
(Chapter 4).
Chapter 3. Establishment of a BiFC assay system in planta 81
3.3. Discussion
3.3.1. Generation of pGreen-based BiFC vectors
A series of pGreen-based BiFC vectors was generated, which can be used to test
any two proteins of interest for interaction in living plant cells (Section 3.2.2). In
contrast to previously described vectors, the plasmids developed here are based on
the relative small, high copy number pGreen plasmid, which is easy to handle when
preparing plasmid DNA and in bacterial transformation experiments. In addition, the
flexibility of the pGreen series given by the large number of available cloning cassettes
(Hellens et al., 2000b), is maintained in the BiFC vectors produced in this study,
allowing for the use of various selection markers, promoters and terminators.
A library of Arabidopsis 14-3-3 ORFs in the generated BiFC vectors was
established, including eleven out of the thirteen expressed Arabidopsis 14-3-3
isoforms were inserted into the YN vectors and ten out of the thirteen were cloned
into the YC vectors (Table 3-2). These constructs comprise a basic 14-3-3-split-YFP
library that can be used to analyse localisation and specificity of 14-3-3 dimerisation.
Furthermore, this library can be used to test putative 14-3-3 target proteins for
interaction with 14-3-3 isoforms (Chapters 4). Moreover, a set of 14-3-3
N-terminally shortened ORFs were inserted into pairs of BiFC YN and YC vectors.
These can be used to study the impact of a loss of the dimerisation domain on 14-3-3
dimer formation and on target protein interaction. The experiments described in
this chapter (Section 3.2.6.4) clearly show that such truncated versions do not interact
with each other or with a full-length 14-3-3 protein, thus confirming their use as a
suitable negative control for molecular crowding or non-specific protein interaction as
shown previously by others (Walter et al., 2004).
Chapter 3. Establishment of a BiFC assay system in planta 82
3.3.2. The suitability of Arabidopsis mesophyll protoplasts for transient
BiFC assays
Three transient assay systems, Arabidopsis mesophyll protoplast transfection,
agroinfiltration of Arabidopsis leaves and agroinfiltration of Nicotiana leaves were
tested for their suitability in studies of protein interactions using BiFC. BiFC
fluorescence indicating 14-3-3 dimerisation was observed in Arabidopsis mesophyll
protoplasts chemically transfected with two pGreen-based 14-3-3-BiFC plasmids
(14-3-3-YN and 14-3-3-YC; Fig. 3-9). Ten pairs of 14-3-3 dimers have been tested in
this assay system and all of them showed BiFC fluorescence (Table 3-3).
Generally, each PEG-mediated protoplast transfection involves combining 10-20
μg of total plasmid DNA (10 μl) with 2 x 104 protoplasts (100 μl), although the plasmid
DNA/protoplast ratio for the transfection should be examined empirically (Yoo et al.,
2007). Following this general procedure, a transformed protoplasts frequency of
90% can be expected (Yoo et al., 2007). In the experiments conducted here, the
frequency of protoplasts successfully transformed was below the expected value.
For example, the use of 2 μg of a single 35S-GFP carrying plasmid for transfection
resulted in approximately 10% of the protoplasts exhibiting GFP fluorescence (Table
3-3). Co-transfection of two 14-3-3-BiFC constructs using 2 μg to 6.6 μg of total
plasmid DNA in a 1:1 ratio led to an even lower frequency of fluorescent cells
(approximately 0.1% to 5%; Table 3-3). The lower frequency of fluorescent cells in
BiFC experiments compared to GFP experiments was expected as BiFC fluorescence
requires successful co-transformation and co-expression of two BiFC constructs whilst
fluorescence in GFP transfection experiments requires only one plasmid to be
successfully taken up and expressed by the cells.
The overall low transformation rate indicated this protoplast system has limited
value for mass screening of protein interactions using BiFC. Instead, a protoplast
Chapter 3. Establishment of a BiFC assay system in planta 83
approach may be useful for studies investigating a small number of proteins.
Furthermore, this technique may be useful when transfecting protoplasts derived
from transgenic plants already expressing one of the BiFC constructs.
3.3.3. Assessment of BiFC assay using transient expression in Arabidopsis
and Nicotiana leaves via infiltration with Agrobacteria
Agrobacterium infiltration (agroinfiltration) is widely used to deliver transgenes
into plants for transient and stable analyses of gene function, promoter activity and
for protein interaction studies. This approach can be used for analysis in
homologous and non-homologous plant systems. The present study initially
favoured performing transient BiFC assays of Arabidopsis 14-3-3 isoforms in the
homologous Arabidopsis system using agroinfiltration. This approach has been
previously used to demonstrate interactions of α and β subunits of the Arabidopsis
farnesyltransferase (Bracha-Drori et al., 2004).
To evaluate the agroinfiltration of Arabidopsis leaves for the BiFC analysis of
14-3-3 dimerisations, as many of the parameters as possible used by Bracha-Drori et
al. (2004) were maintained in the present study, including the Agrobacterium strain
(GV3101/pMP90), Arabidopsis ecotype (Col-0) and experimental conditions.
Differences were the T-DNA binary vectors used (pGreen-based instead of
pCAMBIA-based) and the proteins of interest tested (14-3-3 proteins instead of
farmesyltransferase subunits). The results obtained with 14-3-3 proteins
demonstrated a high variability of fluorescence intensity and cell numbers showing
BiFC fluorescence (Fig. 3-8 E and F and data not shown). From these results, it was
difficult to determine which step of the assay caused this problem. Possible reasons
were that the transgenes were not efficiently delivered into a large number of plant
Chapter 3. Establishment of a BiFC assay system in planta 84
cells, that the transgenes were not well expressed, and/or that the 14-3-3 isoform did
not dimerise.
A successful agroinfiltration based BiFC assay requires that transgenes are
delivered into and expressed by the cells to a detectable level. For the BiFC assay, an
additional requirement, which must be fulfilled, is that the co-expressed candidate
proteins (here 14-3-3 proteins) interact with each other in a way that allows the YN
and YC parts of the YFP protein to interact, leading to BiFC fluorescence. The
efficiency of the gene delivery method can be evaluated, at least for the delivery of
one gene construct, using a 35S-GFP construct. A commercially available
GFP-containing vector, pCAMBIA 1302, was used for this purpose during this study.
This vector was chosen as it contained the same pCAMBIA 1302 backbone as the BiFC
vectors used by Bracha-Drori et al. (2004). This evaluation method confirmed the
low reproducibility of the gene delivery method (data not shown). To determine
whether the vector backbone had an impact on the frequency of transformation
events, another GFP construct, the pGreen-based 35S-GFP plasmid, was tested. The
use of this plasmid did not result in transformation events (data not shown). In
addition, agroinfiltration of Arabidopsis leaves and the subsequent 14-3-3 BiFC assays
did not generate reproducible results (Fig. 3-8 and data not shown). Taken together,
the results suggested that a) the nature of the Ti binary vector may influence the
performance of agroinfiltration of Arabidopsis leaves, b) to achieve high
transformation efficiency and high reproducibility of results would require elaborate
optimisation procedures to be performed.
Since two living organisms, plant and bacterium, participate in the process of
Agrobacterium-mediated transient assays, factors that affect the virulence of
Agrobacteria or the physiological condition of plants could have an impact on the
efficiency of agroinfiltration (Wroblewski et al., 2005). Using β-glucuronidase (GUS)
Chapter 3. Establishment of a BiFC assay system in planta 85
activity as a reporter, Wroblewski and co-workers (2005) examined several parameters
affecting transformation performance in these transient assays. The parameters
were evaluated such as the efficiency of several Agrobacterium strains, including the
strain GV3101 used in the present study, on four plant species: lettuce, tomato, N.
benthamiana and Arabidopsis (Col-0). Arabidopsis showed the least GUS activity
among the tested plant species, no matter which Agrobacterium strain was used
(Wroblewski et al., 2005). Additionally, transient GUS expression differed between
Arabidopsis ecotypes. A higher level of GUS expression was observed in the ecotype
WS than in Col-0 (Wroblewski et al., 2005). Wroblewski and co-workers (2005)
further investigated the effect of several viral silencing suppressors on inhibition of
PTGS to increase the level of transient expression in Arabidopsis. However, none of
the tested silencing suppressors, including p19, had a detectable effect on transient
GUS expression in Col-0. In the present study, attempts to fine-tune some of the
factors mentioned above to improve the outcome and reproducibility of transient
14-3-3 BiFC assay in Arabidopsis leaves (such as Arabidopsis ecotypes and p19) were
not successful (data not shown).
The suitability of Nicotiana leaf infiltration was investigated in parallel to the
study using Arabidopsis. The Nicotiana system showed higher transformation
efficiencies, stronger signals and could be optimised to demonstrate 14-3-3
dimerisation with great reproducibility. Combining the BiFC results obtained using
Nicotiana and Arabidopsis, the results presented here supported the findings of
Wroblewski et al. (2005) that the difference between plant types with respect to
transgene expression following agroinfiltration can be significant. Higher levels of
transgene expression following agroinfiltration of leaves were found for Nicotiana
than for two of the Arabidopsis ecotypes tested in the present study. Moreover, a
pGreen-based 35S-GFP construct was successfully introduced into Nicotiana leaves by
Chapter 3. Establishment of a BiFC assay system in planta 86
agroinfiltration but not into Arabidopsis leaves (data not shown). Furthermore,
when introducing a PTGS suppressor, p19, into the BiFC assay system, a strong
improvement of fluorescence, indicating improved or more stable transgene
expression was observed in Nicotiana leaves (Fig. 3-10), but not in Arabidopsis Col-0
(data not shown).
In summary, the Nicotiana-based BiFC assay system, as optimised in this study,
can serve as a robust, reliable and easy to perform assay system suitable for the
investigation of 14-3-3 protein interactions. As such, this system was employed in
further studies of 14-3-3 dimerisation and to determine the localisations of 14-3-3
dimers (Chapter 4).
Chapter 4. Visualisation of 14-3-3 dimerisation in living plant cells 87
Chapter 4
A Systematic Survey of
Subcellular Dimerisation of
Arabidopsis 14-3-3 Isoforms by
Bimolecular Fluorescence
Complementation
Chapter 4. Visualisation of 14-3-3 dimerisation in living plant cells 88
4.1. Introduction
4.1.1. Dimerisation of 14-3-3 proteins
14-3-3 proteins are highly conserved eukaryotic regulators coordinating a
variety of biological processes by physically interacting with phosphorylated target
proteins (Roberts, 2003). Native 14-3-3 proteins are always found as dimers (Aitken,
1996). In general these can be either homodimers or heterodimers.
Immunoprecipitation experiments followed by western blot analyses using 14-3-3
isoform specific antibodies indicated that different mammalian 14-3-3 isoforms show
differences in homo- or heterodimer formation. For example, the human 14-3-3
sigma isoform preferentially formed homodimers (Wilker et al., 2005), whilst the
epsilon isoform appeared to form exclusively heterodimers (Chaudhri et al., 2003).
The gamma isoform was able to homodimerise and to heterodimerise with the 14-3-3
isoforms beta, epsilon, zeta and eta (Chaudhri et al., 2003). A preference for
heterodimerisation was also reported for the two yeast 14-3-3 isoforms BMH1 and
BMH2 (Chaudhri et al., 2003). In plants, five recombinant Arabidopsis 14-3-3
isoforms (chi, psi, phi, omega and upsilon) were demonstrated to dimerise with each
other using yeast two hybrid assays or in vitro dimerisation assays combined with
native PAGE analyses (Wu et al., 1997b). In addition, recombinant Arabidopsis
14-3-3 psi and lambda were shown to form both homodimers and heterodimers in
vitro (Abarca et al., 1999). From these results, it appears that unlike those of
mammals or yeast, plant 14-3-3 isoforms do not show any preference for homo- or
heterodimer formation.
Structural and biochemical evidence suggest that the N-terminal domain of
14-3-3 monomers is required for dimerisation. X-ray crystal structure analysis of the
human 14-3-3 zeta isoform indicated that the N-terminal helix α1 of one monomer
interacts with helices α3 and α4 of the other monomer to form the dimerisation
Chapter 4. Visualisation of 14-3-3 dimerisation in living plant cells 89
interface (Liu et al., 1995). Further interaction studies performed on Arabidopsis
14-3-3 isoforms using in vitro dimerisation and yeast two hybrid assays showed that
the helices α1 to α4 are sufficient for dimerisation and that deletion of helix α4 leads
to dimerisation failure (Wu et al., 1997b; Abarca et al., 1999). Truncation studies of
the human 14-3-3 zeta isoform also demonstrated that an N-terminal truncated
mutant form was unable to dimerise but was still able to bind to its target protein
(Luo et al., 1995). In addition to verifying the role of the N-terminus in dimerisation,
Luo et al. (1995) also demonstrated that the C-terminal domain of 14-3-3 proteins
may contribute to binding of target proteins.
The dimeric structure of 14-3-3 proteins is related to their functions. A
monomeric form of the N-terminally truncated, human 14-3-3 zeta, although it can
bind to its target protein Raf-1, is unable to activate the target protein (Tzivion et al.,
1998). This strongly suggests that 14-3-3 dimerisation is important to at least part of
14-3-3 function. Additionally, it is widely proposed that 14-3-3 dimers act as
adaptors or scaffold proteins which bring two distinct target proteins together,
thereby requiring more than one target binding site (Tzivion et al., 2001; Roberts,
2003; Chevalier et al., 2009). Furthermore it appears that 14-3-3s, when binding to a
single target protein, do so by interacting with multiple binding sites within the target
protein. Both modes of action imply that 14-3-3 proteins must act as dimers. The
number of potential dimer combinations could also account for the large number of
experimentally verified and predicted target proteins if one assumes that 14-3-3
dimers have some kind of target specificity. Thus, it can be postulated that different
14-3-3 dimeric combinations may be related to different roles of 14-3-3s in cells.
So far, only a selection of Arabidopsis 14-3-3s has been tested for dimerisation
using in vitro approaches or yeast two hybrid analyses (Wu et al., 1997b; Abarca et al.,
1999). It remains elusive whether all members of the Arabidopsis 14-3-3 protein
Chapter 4. Visualisation of 14-3-3 dimerisation in living plant cells 90
family are able to freely dimerise with each other, especially in the native plant system.
Homodimerisation of a tobacco 14-3-3 isoform (T14-3c) using transient BiFC analysis
is the only direct evidence to date demonstrating 14-3-3 dimerisation in living plant
cells (Walter et al., 2004). Preferences for homo- and/or heterodimer formation of
14-3-3 proteins, as observed in animal systems, have not been investigated in plants
so far. This study will investigate whether Arabidopsis 14-3-3 isoforms have any
preference for dimer formation in vivo.
4.1.2. Subcellular localisation of 14-3-3 proteins in plants
In general, 14-3-3s are distributed widely throughout the cell and are usually
regarded as cytosolic proteins (Ferl et al., 2002; Alsterfjord et al., 2004). However, a
variety of studies in plants have demonstrated other intracellular distributions of
14-3-3 proteins. Immunohistochemical analyses showed that Arabidopsis 14-3-3
proteins are located in the nucleus (Bihn et al., 1997) and in chloroplasts (Sehnke et al.,
2000). Immunoblotting analyses using isoform specific antibodies confirmed this by
demonstrating the presence of the 14-3-3 isoforms epsilon, mu, nu and upsilon in
chloroplastic protein fractions (Sehnke et al., 2000). The same authors also
demonstrated the absence of 14-3-3 omega from chloroplastic fractions, thereby
showing isoform specific chloroplast localisation (Sehnke et al., 2000). In barley,
14-3-3 proteins were found in the matrix protein fraction of isolated mitochondria
using immunoblotting analyses (Bunney et al., 2001). Potential target proteins for
14-3-3 action in both, chloroplasts and mitochondria, are the organelle specific ATP
synthases (Bunney et al., 2001). In addition to immunological approaches, a number
of proteomics and GFP fusion studies revealed the diversity of subcellular localisation
of 14-3-3 proteins in Arabidopsis. The World Wide Web based SUBcellular protein
location database for Arabidopsis proteins (SUBA, http://www.suba.bcs.uwa.edu.au;
Heazlewood et al., 2007) summarises and compiles data from predicted and
Chapter 4. Visualisation of 14-3-3 dimerisation in living plant cells 91
experimentally documented subcellular localisations for most Arabidopsis proteins.
This database was used here to establish the current view of subcellular localisations
of Arabidopsis 14-3-3 isoforms (Section 4.2.1).
Of the Arabidopsis 14-3-3 protein family, five members (chi, psi, phi, omega and
upsilon) have been shown to dimerise with each other in vitro (Wu et al., 1997b). Of
those, only psi, phi and omega have similar subcellular locations as revealed using
14-3-3-GFP fusion protein approaches or proteomic analyses (Table 4-1). The lack of
data with regards to 14-3-3 dimer formation and subcellular localisation justifies a
systematic in planta study aimed at testing the current knowledge, which is based
largely on in vitro studies, and to extend analyses to a larger number of 14-3-3
isoforms. The advantage of such a systematic study would be its comprehensiveness.
A single experimental procedure with defined conditions would greatly contribute to
comparability of data, a weak point of the current literature. A systematic study of
14-3-3 dimer formation requires an assay system that allows for medium to high
throughput testing of interactions to cope with the large number of 14-3-3
combinations. Furthermore such a system should allow for the identification of
subcellular localisations without bias, which can result when performing fractionated
protein extraction. Finally, to be biologically meaningful, this assay system should
allow for in planta analysis, ideally in the organism from which the genes of interest
where isolated. BiFC analysis as described in Chapter 3 and by Walter and
co-workers (Walter et al., 2004) has the potential to fulfil all of the above-summarised
requirements.
The work presented in this chapter addresses the questions discussed above
with regards to formation and localisation of Arabidopsis 14-3-3 dimers. The
transient BiFC assay system, developed as described in Chapter 3, was employed in
Chapter 4. Visualisation of 14-3-3 dimerisation in living plant cells 92
combination with the 14-3-3 BiFC vector library (Section 3.2.4) to investigate these
questions. In detail, the aims of this work were:
(1) To establish whether Arabidopsis 14-3-3 isoforms can freely form dimers with each
other or whether preferences exist for some isoforms to form homo- or
heterodimers as was found in animals.
(2) To identify the subcellular localisations of all 14-3-3 dimer combinations tested
(3) To determine potential dimer preferences with regards to subcellular structures
which can then serve as the basis for functional analysis.
4.1.3. Interaction of 14-3-3s with target proteins
In addition to the above, studies into the interaction of a subset of 14-3-3s with
a target protein were used to complement the dimerisation and localisation studies
(described in Section 4.2.6). The target protein was chosen based on the outcome of
dimerisation and localisation studies presented in this chapter (Sections 4.2.2 to 4.2.4).
The focus was on potential interactions of 14-3-3s with nuclear target proteins.
The literature reports several potential roles for 14-3-3 proteins in the nucleus,
from interaction with transcription factor complexes to shuttling of proteins between
the nucleus and the cytosol (reviewed in Eckardt, 2001; Comparot et al., 2003;
Roberts, 2003; Dougherty and Morrison, 2004; Chevalier et al., 2009). Plant 14-3-3
proteins were identified in protein complexes that bind to the G-box elements found
in promoters of diverse plant genes, such as the alcohol dehydrogenase gene (Lu et al.,
1992), suggesting functional associations of 14-3-3s with transcription factors. A
large number of transcription factors in plants have been shown to interact with
14-3-3 proteins, including EmBP1/VIVIPAROUS1 (Schultz et al., 1998), TBP2 (TATA box
binding protein; Pan et al., 1999), TFIIB (transcription factor IIB; Pan et al., 1999),
ZMHOX1a/ZMHOX1b (Zea mays homeobox; Halbach et al., 2000), RSG (Repression of
Chapter 4. Visualisation of 14-3-3 dimerisation in living plant cells 93
Shoot Growth; Igarashi et al., 2001), HvABI5 (Hordeum vulgare ABA insensitive 5;
Schoonheim et al., 2007) and BZR1 (brassinazole resistant-1; Gampala et al., 2007).
Thus, potential roles for 14-3-3s in nuclear functions are well established.
A wider literature search showed at least twenty proteins are either shown or
predicted to interact with 14-3-3 proteins in the nucleus (Chang et al., 2009; Paul et al.,
2009). The nuclear 14-3-3 interactors include members of a small, plant-specific
family of histone deacetylase proteins in Arabidopsis, the histone deacetylase 2 (HD2)
family (Paul et al., 2009). In mammalian cells, histone deacetylases are found to
interact with 14-3-3 proteins, and such interactions sequester HDACs in the cytoplasm
(Grozinger and Schreiber, 2000; Wang et al., 2000). Similar cytoplasmic
sequestration was shown when 14-3-3 proteins bound plant nuclear proteins, such as
RSG and BZR1 (Igarashi et al., 2001; Gampala et al., 2007). To date, it is unclear if
such cytoplasmic sequestration by 14-3-3s also occurs as part of the regulation of the
plant-specific HD2s in vivo.
The Arabidopsis genome encodes 18 HDAC genes which can be categorised into
three types of HDACs: RPD3-like (also known as HD1), HD-tuin (also known as HDT
and HD2) and sirtuin (Hollender and Liu, 2008). The HD2 subfamily comprises 4
members: HD2A, HD2B, HD2C and HD2D (also known as HDT1, HDT2, HDT3 and HDT4,
respectively; Pandey et al., 2002; Hollender and Liu, 2008). The HD2 family is a
plant-specific class of HDACs, which is not found in animals or fungi (Pandey et al.,
2002; Hollender and Liu, 2008). Transcription patterns of all four HD2s share similar
profiles; all are highly expressed in inflorescence tissues but are under-expressed in
vegetative tissues, pollens, seeds and late-stage flowers (Zhou et al., 2004; Hollender
and Liu, 2008). GFP fusion approaches indicate that HD2A, HD2B and HD2C all
localise exclusively to the nucleolus (Lawrence et al., 2004; Zhou et al., 2004; Pendle
et al., 2005; Sridha and Wu, 2006). Functional analyses revealed that HD2A is
Chapter 4. Visualisation of 14-3-3 dimerisation in living plant cells 94
involved in reproductive development. Antisense HD2A transgenic plants exhibit a
phenotype of stunted siliques (Wu et al., 2000), whilst overexpression of GFP-HD2A
resulted in abnormal leaf morphology, flowers with shorter filaments, aborted seed
development, sterility and late flowering (Lawrence et al., 2004). HD2A and HD2B
act together in leaf polarity determination, possibly by controlling the levels or
distribution of two micro RNAs involved in abaxial/adaxial axis formation (Ueno et al.,
2007). In contrast, little is known about the biological function of HD2C and HD2D.
It is reported that HD2C is involved in abscisic acid and abiotic stress responses,
including drought and salinity (Sridha and Wu, 2006). Furthermore, HD2A, HD2B
and HD2C were identified in 14-3-3 protein complexes using an interactomic assay
(Paul et al., 2009). This report provided, for the first time, evidence for an
interaction of 14-3-3 proteins with HDACs, indicating that these plant-specific HDACs,
similar to their mammalian relatives, may be regulated by 14-3-3s. However, the
roles of 14-3-3 in regulating HD2s are still elusive. Recently, our lab was able to
demonstrate interaction of two 14-3-3 isoforms (chi and kappa) with HD2C using a
transient BIFC approach (M. van der Kwast, unpublished PhD thesis). Interaction was
observed in the nucleus and nucleolus but was absent from the cytoplasm.
Here HD2C (At5g03740) was used to test for interaction with a selection of
14-3-3 proteins to elucidate whether:
(1) 14-3-3s, other than the previously tested chi and kappa isoforms, are able to
interact with this HDAC, i.e. is there isoform specificity;
(2) the localisation preference of a 14-3-3 protein can impact on its ability to interact
with HD2C or if
(3) the preference of a 14-3-3 protein for nuclear or cytosolic localisation is
determined by the target protein, in this case HD2C.
Chapter 4. Visualisation of 14-3-3 dimerisation in living plant cells 95
4.2. Results
4.2.1. A database analysis of the subcellular localisation of Arabidopsis
14-3-3 proteins using the SUBcellular location database for
Arabidopsis proteins (SUBA)
A database analysis based on SUBA data was performed to establish a current
view of the subcellular localisations of Arabidopsis 14-3-3 isoforms before
commencing with 14-3-3 dimerisation assays using BiFC (Table 4-1). Such
localisation data could provide essential background knowledge for an informed
interpretation of 14-3-3 BiFC assays. The SUBA localisation data are based on in
silico predictions of protein localisation as well as on experimental approaches such as
proteomic studies and GFP-fusion approaches (Heazlewood et al., 2007).
Data retrived from the SUBA database indicated that all Arabidopsis 14-3-3
members localise to the cytosol by LOCtree or SubLoc predictions (Table 4-1).
Similarly, in addition to cytosolic localisation, eight 14-3-3 isoforms, chi, iota, kappa,
lambda, nu, pi, psi and upsilon, may also localise to the nucleus, based on the
predictors AmiGO or WoLF PSORT (Table 4-1). The same programs also predicted
that only 14-3-3 chi, epsilon and omega localise to the plasma membrane whilst
14-3-3 epsilon, mu and phi are predicted to localise to plastids as well. Two isoforms,
14-3-3 lambda and omicron, were predicted to be found in peroxisomes by PeroxiP
and WoLF PSORT, respectively (Table 4-1).
The SUBA data also indicated that proteomic data sets were available for ten of
the Arabidopsis 14-3-3 proteins whilst subcellular localisation data as identified by
fluorescent fusion protein approaches were available for six isoforms (Table 4-1).
None of the experimental datasets covered the localisation of the three 14-3-3
Chapter 4. Visualisation of 14-3-3 dimerisation in living plant cells 96
Table 4-1. Subcellular localisation of Arabidopsis 14-3-3 proteins using the
SubCellular Proteomic Database [SUBA; Heazlewood et al. (2007)].
The table summarises the search outcomes for the subcellular localisation of the Arabidopsis
14-3-3 protein family using predictor program and experimental datasets based on
proteomics and fluorescent protein experiments as available in the SUBA database.
14-3-3 isoform
Localisation Predicted by
program
References for proteomic
localisation data
References for fluorescent protein
localisation data
chi
cytosol nucleus plasma membrane plastid
[1], [2] [3] [4] -
- [10] [7], [8], [11], [15]
- - - -
epsilon cytosol plasma membrane plastid
[1], [2] [3] [4]
- [8] -
- - -
iota cytosol nucleus
[1], [2] [4]
- -
- -
kappa cytosol nucleus plastid
[2] [3] -
- [10] [11]
- [9] -
lambda
cytosol nucleus plasma membrane plastid peroxisome
[1], [2] [3], [4] - - [5]
- - [8] [11] [16]
[12] [9], [12] - - -
mu
cytosol nucleus plasma membrane plastid peroxisome
[1], [2] - - [3] -
- - [7] - [16]
[6], [16] [6] [16] - -
nu
cytosol nucleus plasma membrane plastid
[1], [2] [3], [4] - -
- - [7], [8], [13] [11]
- - - -
omega
cytosol nucleus plasma membrane cytoskeleton vacuole peroxisome
[1], [2] - [4] - - -
- - [8] - [14] [16]
[9] [9] - [9] - -
omicron cytosol peroxisome
[1], [2] [4]
- -
- -
phi
cytosol nucleus plasma membrane cytoskeleton plastid
[1], [2] - - - [4]
- - [8] - -
[9] [9] - [9] -
pi cytosol nucleus
[1], [2] [4]
- -
- -
psi
cytosol nucleus plasma membrane peroxisome
[1], [2] [4] - -
- - [7], [8] [16]
[16] - [16] -
upsilon cytosol nucleus plasma membrane
[1], [2] [3], [4] -
- - [7], [8]
- - -
“-“: No hit from the database search. References: [1] LOCtree [http://www.rostlab.org/services/LOCtree/; Nair and Rost (2005)]; [2] SubLoc [http://www.bioinfo.tsinghua.edu.cn/SubLoc/; Hua and Sun (2001)]; [3] AmiGO [http://amigo.geneontology.org/; Carbon et al. (2009)]; [4] WoLF PSORT [http://wolfpsort.org/; Horton et al. (2007)]; [5] PeroxiP [http://www.bioinfo.se/PeroxiP/; Emanuelsson et al. (2003)]; [6] Koroleva et al. (2005); [7] Marmagne et al. (2007); [8] Benschop et al. (2007); [9] Paul et al. (2005); [10] Bae et al. (2003); [11] Kleffmann et al. (2004); [12] Rienties et al. (2005); [13] Karlova et al. (2006); [14] Jaquinod et al. (2007); [15] Zybailov et al. (2008); [16] Reumann et al. (2009). Date of the database search: 13/5/2009.
Chapter 4. Visualisation of 14-3-3 dimerisation in living plant cells 97
isoforms, iota, omicron and pi. Experimental datasets based on proteomic studies
and GFP-fusion approaches are only partially in agreement with the predicted
subcellular localisations of 14-3-3 isoforms. For example, of the eight 14-3-3
isoforms predicted to localise to the nucleus (Table 4-1), only 14-3-3 chi and kappa
were experimentally identified in the nuclear proteome (Bae et al., 2003). Similarly,
although only two isoforms, lambda and omicron, were predicted to localise to
peroxisomes (Table 4-1), Reumann and co-workers demonstrated using a proteomics
approach that 14-3-3 lambda, mu, omega and psi localise to this organelle (Reumann
et al., 2009). Furthermore, 14-3-3 chi, kappa, lambda and nu were found in the
chloroplast proteome (Kleffmann et al., 2004; Zybailov et al., 2008) but none of these
four isoforms were predicted to localise to plastids (Table 4-1).
14-3-3 GFP fusion approaches are only available for six Arabidopsis 14-3-3
isoforms, kappa, lambda, mu, omega, phi and psi (Koroleva et al., 2005; Paul et al.,
2005; Rienties et al., 2005; Reumann et al., 2009; Table 4-1). These revealed that
even very similar 14-3-3 isoforms such as 14-3-3 kappa and lambda, which are 92%
identical at the amino acid level (Wu et al., 1997a), show differences in subcellular
localisation. In transgenic Arabidopsis plants, the 14-3-3 kappa-GFP fusion protein
was found predominantly in nuclei of trichomes and guard cells, whilst the
lambda-GFP protein localised to nuclei of trichomes but not to nuclei of guard cells
(Paul et al., 2005). In addition, the omega-GFP and phi-GFP fusion proteins were
evenly distributed between the cytosol and nuclei in the cells of trichomes and guard
cells (Paul et al., 2005).
A dependence of 14-3-3 localisation based on the experimental system is also
found for some 14-3-3s. For example, YFP-14-3-3 lambda fusion proteins were
found in the nuclei of transiently transformed cowpea protoplasts (Rienties et al.,
2005), which was consistent with the localisation of lambda-GFP observed in
Chapter 4. Visualisation of 14-3-3 dimerisation in living plant cells 98
Arabidopsis trichomes (Paul et al., 2005). However, in contrast to its location in
Arabidopsis trichomes (Paul et al., 2005), lambda also localised to the cytosol of
cowpea protoplasts (Rienties et al., 2005), indicating a clear dependence on the
experimental system and/or the cell type investigated. A dependence on the
experimental system became more obvious when data for 14-3-3 mu were analysed.
In transiently transformed Arabidopsis suspension cells, GFP-mu fusion proteins
localised to nuclei and the cytosol (Koroleva et al., 2005). In contrast, Reumann and
co-workers found 14-3-3 mu-YFP fusion proteins localised to the cytosol and/or the
plasma membrane, but it was absent from the nucleus of transiently transformed
tobacco epidermal cells (Reumann et al., 2009).
It can be concluded that the cytosol is a common location for 14-3-3 isoforms.
Thus, it can be expected that BiFC assays should reveal 14-3-3 dimerisation via
YFP-based fluorescence at least in the cytosol. Predicted and experimental datasets
indirectly suggest that certain 14-3-3 dimer combinations are found in some
organelles. As discussed above, a number of 14-3-3s localise to the nucleus as GFP
fusion proteins. However, several 14-3-3 isoforms (epsilon, iota, lambda, mu, nu,
omega, omicron, phi, pi, psi and upsilon) were not identified in the nucleus when
using proteomics approaches (Table 4-1). Of these, epsilon, mu, omega, omicron
and phi were not predicted to localise to the nucleus. Thus, according to the SUBA
dataset, it is unlikely that these isoforms will be found as part of a 14-3-3 dimer within
the nucleus. The BiFC analysis described in Chapter 3 will interrogate this and be
used to verify or to refute the information in available datasets. Furthermore, none
of the datasets predicted or showed localisation of 14-3-3 poteins in Golgi, ER or the
nucleoli. Therefore, the BiFC experiments conducted during this thesis paid special
attention to those organelles and subcellular localisations.
Chapter 4. Visualisation of 14-3-3 dimerisation in living plant cells 99
4.2.2. Arabidopsis 14-3-3 isoforms can form dimers with each other in
living plant cells
To perform the systematic survey of dimerisations among the ten Arabidopsis
14-3-3 isoforms, each of the possible fifty-five 14-3-3 dimer combinations was tested
individually by co-infiltrating a suspension mixture of Agrobacteria cells into Nicotiana
leaves. The Agrobacterium mixture contained three strains: a 14-3-3-YN strain, a
14-3-3-YC strain and a silencing suppressor-p19 carrying strain (Materials and
Methods, Section 2.4.5). For example, the combination of chi-YN and chi-YC strains
for co-infiltration was used to examine 14-3-3 chi homodimerisation (chi-chi); while
the combination of chi-YN and epsilon-YC was used to establish heterodimerisation
between the 14-3-3 chi and epsilon isoforms (chi-epsilon). BiFC fluorescence, due to
re-constitution of YFP upon 14-3-3 dimerisation, was detected for all examined 55
possible dimer combinations. The results indicated that all ten Arabidopsis 14-3-3
isoforms were able to dimerise with each other in vivo (Fig. 4-1). A representative
micrograph of the BiFC fluorescence for each 14-3-3 dimeric combination is shown in
Fig. 4-1. There was no obvious preferential dimerisation among the ten Arabidopsis
14-3-3 isoforms from the BiFC data.
The BiFC fluorescence not only demonstrated 14-3-3 dimerisations but also
indicated the subcellular locations of the dimers. Generally, the BiFC fluorescence
was observed in the cytosol and the nucleus. Further analyses of the 14-3-3 dimer
subcellular localisations are described later (Section 4.2.3).
The effect of YN and YC fusion configurations on 14-3-3 dimerisations and
localisation was also investigated. For example, did a dimer composed of
chi-YN/kappa-YC result in the same outcome as a dimer composed of kappa-YN/chi-YC.
In addition, no obvious differences for the two possible YN/YC configurations
chi epsilon iota kappa mu nu omega omicron phi psi
psi
phi
omicron
omega
nu
mu
kappa
iota
epsilon
chi
N
N
N
N
N
N
N
N
N
N
N
N
N
NN
N
N
N
N NN
N
N
N
N
N
N
N
N
NN
N N
NN
N
N
N
N
N
N
N
N
N
N
N
N
N
N
N
N
N
N
N
N
Fig. 4-1. Dimerisation of Arabidopsis 14-3-3 proteins using transient BiFC assays in N.benthamiana leaves.
Ten Arabidopsis 14-3-3 isoforms were tested for their ability to form homo- and heterodimersemploying transient BiFC assays in N. benthamiana leaf epidermal cells. The ability of each 14-3-3 protein to homodimerise and to form dimers with all other isoforms is shown by green YFPfluorescence. Dimers were identified in the nucleus and cytoplasm. The micrographs representone of several possible subcellular localisation patterns observed for individual 14-3-3 dimers(see also Section 4.2.3). The total number of cells examined for individual 14-3-3 dimer aresummarised in Table 4-2. N, nucleus. Scale bars = 50 μm.
Chapter 4. Visualisation of 14-3-3 dimerisation in living plant cells 100
Chapter 4. Visualisation of 14-3-3 dimerisation in living plant cells 101
were observed for the dimer combinations chi/omega, chi/mu, mu/epsilon, mu/iota
and mu/kappa (data not shown). Thus, it was assumed that dimers of the form
A-YN/B-YC and B-YN/A-YC were equivalent and the analysis was not extended to all
possible 14-3-3 dimer combinations.
4.2.3. Subcellular localisation of 14-3-3-BiFC dimeric complexes
4.2.3.1. Dual cytosolic/nuclear localisation of 14-3-3 dimers
The subcellular localisation for each 14-3-3 dimeric combination was
determined from the fluorescence micrographs. Fluorescence was detected in the
cytosol and in cytoplasmic strands within cells, indicating that all the dimers are
cytosolic under the experimental conditions used in this study (Fig. 4-1). Additionally,
BiFC fluorescence was detected in the nucleus of most of the cells showing
fluorescence (Fig. 4-1), indicating nuclear localisation of 14-3-3 dimers. All fifty-five
14-3-3 dimers showed a similar pattern of dual cytosolic and nuclear localisation.
However, the intensity of the fluorescence in the nucleus varied with the dimer
combination and sometimes also with the cell. For example, strong nuclear
fluorescence was often observed in cells expressing mu-psi heterodimers or kappa
homodimers (Fig. 4-1). In contrast, nuclear fluorescence was generally weak in cells
expressing psi-omega heterodimers or nu homodimers (Fig. 4-1).
A small structure (sometimes more than one), which showed no fluorescence
and was possibly the nucleolus, was found in the nucleus in all the cells analysed
across the 55 dimeric combinations tested. This suggests that 14-3-3 dimers
localised to the nucleus are absent from the nucleolus (Figs. 4-1, 3-12 B, 3-13 and data
not shown).
In some cases, fluorescence was also observed in a thin layer surrounding the
nucleus, as shown in the micrographs of epsilon-nu, nu-nu and psi-nu dimers (Fig. 4-1)
Chapter 4. Visualisation of 14-3-3 dimerisation in living plant cells 102
as well as an omega-nu dimer shown in Fig. 4-2 B, suggesting that some 14-3-3 dimers
localise to the nuclear envelope/ER.
The different localisation patterns observed for 14-3-3 dimers were used to
establish a classification of 14-3-3 dimer localisation (Section 4.2.3.3). Special
emphasis was placed on the intensity of the observed fluorescence in the nuclei.
This classification was then used to interrogate a larger number of cells for each of the
individual dimer combinations to investigate whether the observed patterns were
consistent and dimer specific (Section 4.2.4).
4.2.3.2. 14-3-3 dimers were absent from chloroplast stroma but may be
associated with chloroplastic membranes
Chloroplastic localisation was predicted for the epsilon, mu and psi isoforms and
a proteomics approach localised the 14-3-3s chi, kappa, lambda and nu to plastids
(see Section 4.2.1 for details and references). Additionally, 14-3-3 isoforms epsilon,
mu, nu and upsilon have been shown to localise to chloroplasts (Sehnke et al., 2000).
However, none of the 14-3-3 isoforms mentioned above contains a transit peptide.
In the transient BiFC assay in Nicotiana leaf epidermal cells, the nucleus was
usually surrounded by some chloroplasts (Figs. 4-1, 3-12 and 3-13). Thus, this assay
system was used to investigate if 14-3-3 isoforms (especially the predicted or reported
isoforms to be chloroplastic) can dimerise within the chloroplasts in the epidermal
cells.
As described in Section 3.2.7, BiFC fluorescence was not detectable within
chloroplasts for the 14-3-3 kappa homodimer (Figs. 3-12 C and 3-13 A-D) and
phi-omega heterodimer (Fig. 3-13 E-H). When the dimerisation assay was expanded
to other 14-3-3 isoforms, including those previously predicted/reported to be
chloroplastic (chi, epsilon, kappa, mu, nu and psi), none of the possible dimer
combinations demonstrated any visible BiFC fluorescence within chloroplasts (Fig. 4-1
Chapter 4. Visualisation of 14-3-3 dimerisation in living plant cells 103
and data not shown). Instead, BiFC fluorescence was clearly visible around
chloroplasts for a large number of dimer combinations (Figs. 4-1, 4-2 C, 3-12 and 3-13).
This may indicate an association of 14-3-3 dimers with the outside of chloroplasts or
localisation within the chloroplastic membranes or the chloroplastic intermembrane
space.
4.2.3.3. Variable nuclear localisation patterns of 14-3-3 dimers were
observed
Variable fluorescence intensities in the nucleus were observed not only across
different 14-3-3 dimeric combinations (Fig. 4-1) but also between different cells
expressing the same dimeric combination (Fig. 4-2). The differences were used to
classify nuclear localisation patterns of 14-3-3 dimers and to investigate whether the
observed patterns were dimer specific. To this end, the relative levels of nuclear to
cytoplasmic fluorescent signals were quantified for a large number of cells from
micrographs of each 14-3-3 dimerisation experiment using ImageJ software (Section
2.5.3.1). The ratios of nuclear to cytoplasmic BiFC fluorescence intensity (N/C) from
individual cells were used to define three nuclear localisation patterns. These were
as follows:
Nuclear Pattern 1: Cells were classified as showing Pattern 1 if the N/C ratio was
greater than 1.5, indicating prominently nuclear localisation of 14-3-3 dimers. This
matched the optical observation.
Nuclear Pattern 2: Cells were classified as showing Pattern 2 if the N/C ratio was
in between 0.7 to 1.5, indicating relative equal distribution of fluorescence between
the cytosol and the nucleus. Again, optical observations were used to support this.
Fig. 4-2. Variable distribution patterns of BiFC fluorescence by 14-3-3 dimerisation observedin transiently transformed Nicotiana epidermal cells.
Variable distribution patterns of BiFC fluorescence by 14-3-3 dimerisation were observedbetween and within dimer combinations as demonstrated here for the heterodimerisation of14-3-3 omega-YN and nu-YC fusion proteins in Nicotiana epidermal cells. Nuclear versuscytosolic fluorescence ratios (N/C ratios), obtained with image analysis, were used to classifythese patterns. A. Some cells had stronger fluorescence in the nucleus than in the cytosol (N/C> 1.5: Pattern 1). B. Other cells had apparently equal levels of fluorescence in the nucleus andcytosol (0.7 ≤ N/C ≤ 1.5: Pattern 2). C. A third category of cells showed stronger fluorescence inthe cytosol than in the nucleus (N/C < 0.7: Pattern 3). Bright field images of A, B and C areshown in D, E and F, respectively. Cyt, cytosol; Chl, chloroplast; N, nucleus; NE, nuclearenvelope. Scale bars = 50 μm.
A D
B
Pattern 2
Pattern 3
Pattern 1
C F
E
N
N
N
N/C=0.8
N/C=0.4
N/C=2.3
GFP filter Bright field
Cyt
Cyt
Cyt
NE
Chl
Chl
Chapter 4. Visualisation of 14-3-3 dimerisation in living plant cells 104
Chapter 4. Visualisation of 14-3-3 dimerisation in living plant cells 105
Nuclear Pattern 3: Cells were classified as showing Pattern 3 if the N/C ratio was
less than 0.7, representing weak fluorescence to almost absence of fluorescence from
the nucleus.
The classification scheme was applied to all cells photographed for each of the
fifty-five dimer combinations (Table 4-2). Using the heterodimerisation of 14-3-3
omega-nu (omega-YN/nu-YC) as an example, for which 25 cells were analysed, three
cells belonged to the Pattern 1, twelve cells were in the Pattern 2 category and ten
cells appeared in the Pattern 3 category (Table 4-2). Representative micrographs for
each of the patterns observed for the omega-nu dimer are shown in Fig. 4-2.
To provide an overall view of the nuclear localisation patterns for each 14-3-3
dimer, a scatterplot analysis was performed (Fig. 4-3). In total 581 cells (across 55
dimerisations) were analysed. Of these, 182 cells (31 %) were in the Pattern 1
category, 347 cells (60 %) in the Pattern 2 and 52 cells (9 %) were in the Pattern 3
category. Although the frequency of the three categories is dependent somewhat
on the number of cells analysed for each dimer, as some dimers appeared
preferentially in one over the other categories, the overall data indicated that the
most prominent pattern was Pattern 2, with almost twice as many cells found
exhibiting this pattern than in the next frequent category, Pattern 1, and over six times
more frequent than Pattern 3.
4.2.4. Some 14-3-3 dimers showed preferential subcellular localisations
The number of cells falling into one of the three N/C categories is summarised
for each of the fifty-five dimers in Table 4-2. Although for most dimers the number
of cells used to do the quantification analysis was far too low to be of statistical
significance, a trend suggesting preferential localisation patterns was observed for a
number of 14-3-3 dimers (Figs. 4-4 to 4-5).
Chapter 4. Visualisation of 14-3-3 dimerisation in living plant cells 106
Table 4-2. Quantitative analysis of the subcellular localisation of Arabidopsis 14-3-3
dimers as determined by image analysis of transient BiFC assays.
Nuclear localisation patterns were determined from epifluorescence images of all
possible dimer permutations of ten Arabidopsis 14-3-3 isoforms. The ratios of
nuclear to cytoplasmic (N/C) BiFC fluorescence intensities were estimated and used to
classify the cells into Pattern 1 (N/C ratio > 1.5), indicating prominently nuclear
localisation of 14-3-3 dimers, Pattern 2 (N/C ratio 0.7 to 1.5), indicating near equal
distribution between nucleus and cytosol and nuclear Pattern 3 (N/C ratio < 0.7),
representing weak or lack of nuclear fluorescence. The number of cells exhibiting
the three patterns (1, 2, and 3) and the total number of cells analysed (total) is given
for each 14-3-3 dimer. Homodimer combinations of 14-3-3s are highlighted in grey
for ease of navigation.
14-3-3 dimer
Localisation pattern
14-3-3 dimer
Localisation pattern
1 2 3 total 1 2 3 total
chi-chi 3 12 - 15 omicron-chi 5 5 - 10
chi-epsilon - 7 - 7 omicron-epsilon - 7 - 7
chi-kappa 5 8 - 13 omicron-iota 6 3 - 9
chi-nu - 5 3 8 omicron-kappa 5 2 - 7
chi-omega - 7 - 7 omicron-mu 4 4 - 8
epsilon-epsilon 3 6 - 9 omicron-nu - 12 - 12
epsilon-kappa 6 - - 6 omicron-omega 1 5 1 7
epsilon-nu 1 19 - 20 omicron-omicron 2 4 - 6
iota-chi - 3 - 3 phi-chi 1 6 - 7
iota-epsilon 1 9 - 10 phi-epsilon 3 5 - 8
iota-iota 1 11 - 12 phi-iota 1 11 - 12
iota-kappa - 6 - 6 phi-kappa 7 1 - 8
iota-nu 2 2 7 11 phi-mu 3 2 - 5
kappa-kappa 30 1 - 31 phi-nu - 9 2 11
kappa-nu 1 10 - 11 phi-omega - 6 - 6
mu-chi 3 7 - 10 phi-omicron 3 4 - 7
mu-epsilon 15 20 - 35 phi-phi 4 17 3 24
mu-iota 4 5 - 9 psi-chi 3 4 - 7
mu-kappa 14 - - 14 psi-epsilon 2 2 1 5
mu-mu 4 10 - 14 psi-iota 3 1 1 5
mu-nu - 6 - 6 psi-kappa 4 - - 4
nu-nu 2 12 19 33 psi-mu 8 1 - 9
omega-epsilon 2 3 - 5 psi-nu - 2 3 5
omega-iota - 5 - 5 psi-omega - 2 2 4
omega-kappa 2 4 6 psi-omicron 7 7 - 14
omega-mu 3 18 - 21 psi-phi 5 7 - 12
omega-nu 3 12 10 25 psi-psi - 4 - 4
omega-omega - 6 - 6
1: chi-chi 2: chi-epsilon 3: chi-kappa 4: chi-nu 5: chi-omega
6: epsilon-epsilon 7: epsilon-kappa 8: epsilon-nu 9: iota-chi 10: iota-epsilon
11: iota-iota 12: iota-kappa 13: iota-nu 14: kappa-kappa 15: kappa-nu
16: mu-chi 17: mu-epsilon 18: mu-iota 19: mu-kappa 20: mu-mu
21: mu-nu 22: nu-nu 23: omega-epsilon 24: omega-iota 25: omega-kappa
26: omega-mu 27: omega-nu 28: omega-omega 29: omicron-chi 30: omicron-epsilon
31: omicron-iota 32: omicron-kappa 33: omicron-mu 34: omicron-nu 35: omicron-omega
36: omicron-omicron 37: phi-chi 38: phi-epsilon 39: phi-iota 40: phi-kappa
41: phi-mu 42: phi-nu 43: phi-omega 44: phi-omicron 45: phi-phi
46: psi-chi 47: psi-epsilon 48: psi-iota 49: psi-kappa 50: psi-mu
51: psi-nu 52: psi-omega 53: psi-omicron 54: psi-phi 55:psi-psi
Fig. 4-3. Scatter plot analysis of localisation patterns of 14-3-3 dimers as determined bytransient BiFC assays and image analysis software.
Micrographs of cells expressing two 14-3-3 BiFC constructs were chosen for analysis offluorescence intensity using imageJ software (Section 2.5.3.1). The ratios of nuclear tocytosolic BiFC fluorescence intensity (N/C) obtained for individual cells were plotted for thecorresponding 14-3-3 dimer combinations. Each point, represented in the graph by diamonds,shows the N/C fluorescent ratio for a single cell. Values of the ratios above 1.5 represent cellsthat had a stronger fluorescence in the nucleus than in the cytosol (Pattern 1). The N/C ratiosbetween 1.5 and 0.7 correspond to cells in which the fluorescence intensity in the cytosol andnuclei appeared similar (Pattern 2). Values below 0.7 represented cells that had strongerfluorescence in the cytosol than in the nucleus (Pattern 3; see text for detail).
14-3-3 dimer combinations
Nu
cle
ar/
cyto
pla
sm
icsig
nal ra
tio
Pattern 1
Pattern 2
Pattern 3
Chapter 4. Visualisation of 14-3-3 dimerisation in living plant cells 107
Chapter 4. Visualisation of 14-3-3 dimerisation in living plant cells 108
To simplify the analysis, the fluorescence values were plotted to allow either
comparison of homodimers or of dimers with one common 14-3-3 protein (Figs. 4-4
and 4-5). When comparing the values of ten 14-3-3 homodimers, it appeared that
cells containing the dimers epsilon-epsilon, mu-mu, omicron-omicron, iota-iota,
chi-chi and kappa-kappa exhibited both Patterns 1 and 2; cells expressing the dimers
omega-omega and psi-psi exhibited only the Pattern 2 category; and cells containing
the dimers nu-nu and phi-phi displayed all three fluorescence patterns (Fig. 4-4).
Apparently, cells expressing the kappa homodimer exhibited a strong preference for
Pattern 1, with 30 of the 31 analysed cells having an N/C fluorescent ratio of more
than 1.5 (Fig. 4-4 and Table 4-2). In strong contrast, few cells containing the nu
homodimer showed Pattern 1 fluorescence, with less than 10% of the cells (2 out of
33) having an N/C fluorescence ratio of more than 1.5, and most of the cells having an
N/C ratio of less than 1 (Fig. 4-4 and Table 4-2). The majority of cells containing the
remaining 14-3-3 homodimers exhibited Pattern 2 (Fig. 4-4 and Table 4-2).
As for cells containing the 14-3-3 heterodimers, some exhibited the Pattern 1
only, such as those containing mu-kappa (14 cells out of 14) and epsilon-kappa (6 cells
out of 6), and others demonstrated Pattern 2, such as those expressing chi-epsilon (7
cells out of 7) and iota-kappa (6 cells out of 6; Table 4-2). Besides these, cells
expressing other heterodimer combinations displayed multiple patterns such as cells
expressing mu-epsilon, which showed both Patterns 1 and 2, with almost equal
distribution between the two (15 cells in Pattern 1 and 20 cells in Pattern 2; Table
4-2).
Only a few dimer combinations resulted in cells exhibiting Pattern 3 labelling
(weak labelling of the nucleus). None of these were solely found with Pattern 3
labelling (Table 4-2). For example, cells expressing nu homodimers demonstrated all
three patterns although with a bias towards Patterns 2 and 3 (Pattern 1: two cells,
Chapter 4. Visualisation of 14-3-3 dimerisation in living plant cells 109
Fig. 4-4. Subcellular localisation of 14-3-3 homodimers as determined by transient BiFC
assays and image analysis software.
A subset of the nuclear to cytosolic fluorescence ratios shown in Figure 4-3, focusing on
14-3-3 homodimers, are shown to demonstrate trends in the subcellular distributions of these
dimers. For details see Figure 4-3.
Pattern 2: twelve cells and Pattern 3: nineteen cells). Similarly, cells with the
omega-nu heterodimer exhibited all three patterns with an underrepresentation of
Pattern 1 (Pattern 1: three cells, Pattern 2: twelve cells and Pattern 3: ten cells, Table
4-2). Interestingly, six out of the eleven dimers containing the 14-3-3 nu isoform
resulted in cells displaying Pattern 3 (Table 4-2).
A trend towards preferential localisation patterns for the kappa- and nu-involved
14-3-3 dimers was apparent (Fig. 4-5). Of the ten kappa-involved dimers, cells
expressing six of them had a high propensity to be in Pattern 1; while those of the
remaining four (chi-kappa, iota-kappa, kappa-nu and omega-kappa) had preference to
be in Pattern 2 (Fig. 4-5). None of the cells with the ten kappa-involved dimers were
observed in Pattern 3 (Fig. 4-5 and Table 4-2). By contrast, cells expressing eight out
of the ten nu-related dimers were mainly in Pattern 2 and those with the remaining
Chapter 4. Visualisation of 14-3-3 dimerisation in living plant cells 110
Fig. 4-5. The impact of 14-3-3 isoforms kappa and nu on the subcellular localisation of
14-3-3 dimers.
A subset of the nuclear to cytosolic fluorescence ratios shown in Figure 4-3, focusing on
14-3-3 dimers containing 14-3-3 kappa or 14-3-3 nu, were shown to demonstrate the impact
of these 14-3-3 isoforms on the localisation of their homo- and heterodimers. For details
see Figure 4-3.
two dimers, iota-nu and nu-nu, were observed a high propensity to be in Pattern 3 (fig.
4-5 and Table 4-2). Although, these trends are somewhat influenced by the number
of cells surveyed for individual dimers, an overall tendency is apparent, whilst the
involvement of 14-3-3 kappa strongly promotes nuclear localisation of 14-3-3 dimers,
14-3-3 nu obstructs or reduces it (Fig. 4-5).
4.2.5. Discovery of a novel localisation pattern of 14-3-3 dimers
When analysing a larger number of cells for localisation patterns, a novel
distribution of 14-3-3 dimers was discovered. Fluorescence was observed in distinct,
punctuated areas within the cytoplasm, as shown in the selected images in Fig. 4-6.
This distinct 14-3-3 dimer labelling was different from the usually diffuse fluorescence
Fig. 4-6. Epifluorescence images demonstrating a novel, distinct cytoplasmic localisationpattern of 14-3-3 dimers in transiently transformed Nicotiana benthamiana leafepidermal cells.
Some Nicotiana epidermal leaf cells transiently expressing the indicated 14-3-3 BiFCconstructs showed a distinct cytoplasmic distribution pattern. This pattern was manifestedas punctuate, fluorescent bodies, which were observed at low frequency in transformedcells. This pattern was designated as Pattern 4 (see text for detail). Epifluorescence imageswere obtained using a fluorescence microscope equipped with a GFP filter, except for theiota-nu image (F) which was photographed using a FITC filter instead of the GFP filter. N,nucleus. Scale bars = 10 μm.
iota-chi chi-omega mu-epsilon
iota-nu omicron-iota omicron-omega
phi-nu omega-omega phi-phi
A B C
D E F
G H I
N
N
N
N
Chapter 4. Visualisation of 14-3-3 dimerisation in living plant cells 111
Chapter 4. Visualisation of 14-3-3 dimerisation in living plant cells 112
observed in the cytoplasm of most cells showing BiFC fluorescence (Fig. 4-1).
Although this novel pattern was observed for many 14-3-3 dimers, it was usually
underrepresented when compared to the frequency of the diffuse cytoplasmic
distribution. The approximate frequency of cells showing this novel pattern was
between 1% and 3.3% (data not shown).
The novel distribution pattern always occurred concurrently in cells showing
either nuclear Pattern 1 or 2, but never in cells with the Pattern 3 (data not shown).
For identification purposes, the novel cytoplasmic pattern is designated as Pattern 4
(Table 4-3). This pattern will be further analyzed in chapter 6.
The localisation patterns for all 14-3-3 dimeric combinations are summarised in
Table 4-3. From this it is apparent that the great majority of 14-3-3 dimers were
responsible for more than one localisation pattern. The novel Pattern 4 was
observed in cells containing 27 of the 55 analysed dimeric combinations, suggesting
the novel cytoplasmic localisation was possibly a general characteristic of 14-3-3
dimers and was not dimer-specific.
4.2.6. Investigation into the interaction of 14-3-3 proteins with the histone
deacetylase HD2C
The coding region of HD2C was cloned by Michael van der Kwast (unpublished
PhD thesis, Dr Martin’s laboratory, UWA) into the BiFC vectors described in Chapter 3.
The HD2C-YC construct was used to demonstrate interaction with 14-3-3 chi-YN and
kappa-YN in the nucleus and nucleolus using transient BiFC assays (Michael van der
Kwast, unpublished data).
This interaction study was extended to other 14-3-3 isoforms to test for
potential specificity of 14-3-3 isoforms towards the HD2C protein. The potential for
the preferential localisation of 14-3-3s to impact on their ability to interact with HD2C,
Chapter 4. Visualisation of 14-3-3 dimerisation in living plant cells 113
Table 4-3. Summary of subcellular distribution patterns of Arabidopsis
14-3-3 dimer combinations.
Arabidopsis 14-3-3 dimers were classified according to their distribution between the nucleus
and cytosol as described (Table 4-2) using nuclear to cytosolic (N/C) BiFC fluorescence
intensity ratios, which were correlated to observations made using a fluorescent microscope.
Nuclear Pattern 1 corresponded to prominently nuclear localisation, Pattern 2 corresponded
to equal distribution between nucleus and cytosol and Pattern 3 denotes mostly cytosolic
localisation. The table also shows 14-3-3 dimers appearing in a novel pattern (Pattern 4),
characterised by BiFC fluorescence appearing in distinct, punctuate fluorescent bodies
distributed throughout the cytosol. The Pattern 4, occurred with a very low frequency and
was only observed in combination with Patterns 1 and 2, never with the Pattern 3. With few
exceptions, 14-3-3 dimers appeared in more than one N/C pattern. Figures a to d show
typical epifluorescence images for each of the patterns and their corresponding N/C ratios.
Scale bars = 10 μm.
chi epsilon iota kappa mu nu omega omicron phi psi 14-3-3
1, 2 2 2, 4 1, 2 1, 2 2, 3 2, 4 1, 2 1, 2, 4 1, 2, 4 chi
1, 2 1, 2 4 1 1, 2, 4 1, 2, 4 1, 2 2 1, 2, 4 1, 2, 3 epsilon
1, 2 2 1, 2 1, 2, 3, 4 2 1, 2, 4 1, 2, 4 1, 2, 3, 4 iota
1, 2 1 1, 2, 4 1, 2 1, 2 1, 2 1, 4 kappa
1, 2, 4 2 1, 2, 4 1, 2 1, 2, 4 1, 2, 4 mu
1, 2, 3, 4 1, 2, 3, 4 2, 4 2, 3, 4 2, 3 nu
2, 4 1, 2, 3, 4 2 2, 3 omega
1, 2 1, 2 1, 2, 4 omicron
1, 2, 3, 4 1, 2, 4 phi
2 psi
or whether HD2C determines the localisation of 14-3-3 proteins by recruiting them
into the nucleus or nucleolus were also addressed.
Experiments of 14-3-3-HD2C interactions were performed as described for the
14-3-3 dimerisation studies by co-agroinfiltration of Nicotiana leaves using the 14-3-3
isoforms chi, epsilon, kappa, mu, nu, omega and omicron as YN constructs paired with
Chapter 4. Visualisation of 14-3-3 dimerisation in living plant cells 114
HD2C-YC (Sections 2.4.4 and 4.2.2). The kappa and nu isoforms were chosen, as they
appeared to represent the two extremes with respect to strong or weak nuclear
localisation when analysed as 14-3-3 dimers (Section 4.2.4; Figs. 4-4 and 4-5). In
parallel, 14-3-3 homodimers were used as controls to enable direct comparison of the
localisation patterns between the 14-3-3 dimers and the 14-3-3-HD2C complexes.
All seven 14-3-3 isoforms tested were able to interact with HD2C (Fig. 4-7 and
data not shown). Additionally all the 14-3-3 HD2C interactions were found in the
nuclei and the nucleoli but were absent from the cytosol and other cellular organelles.
The interactions observed were independent of the nuclear localisation pattern of the
tested 14-3-3 homodimers. For example, as shown before (Figs. 3-12 C and 4-4), the
kappa homodimer showed dual localisation with stronger fluorescence in the nucleus
than in the cytosol (Pattern 1) and no fluorescence in the nucleolus (Fig. 4-7 B).
However, the 14-3-3 kappa-HD2C complex resulted in fluorescence in the nuclei and
nucleoli (Fig. 4-7 A). The nu homodimer, as shown before (Figs. 4-1 and 4-4), mainly
localised to the cytosol and was with only weak fluorescence in the nucleus (Fig. 4-7
D). In contrast, the 14-3-3 nu-HD2C complex was absent from cytoplasm and
exhibited strong fluorescence in nuclei and nucleoli (Fig. 4-7 C). The signals obtained
for interaction in the nucleolus were much stronger than those observed in the
nucleus. The remaining five 14-3-3 isoforms tested (chi, epsilon, mu, omega and
omicron), which as homodimers showed dual localisation in nucleus and cytosol (Figs.
4-1 and 4-4, Table 4-2 and data not shown), localised exclusively to the nuclei and
nucleoli when interacting with HD2C as described for the interactions of HD2C with
kappa and nu (Fig. 4-7 and data not shown).
YNYC
chi epsilon kappa mu nu omega omicron
HD2C + + + + + + +
Fig. 4-7. Interactions of 14-3-3 isoforms with histone deacetylase 2C (HD2C).
Protein interactions between HD2C and 14-3-3 kappa or nu were analysed in transientlytransformed Nicotiana benthamiana epidermal leaf cells using BiFC assays and confocalscanning microscopy four days after agroinfiltration (A, C). Kappa and nu homodimerformations were investigated in parallel (B, D). Confocal images of BiFC signals obtained bysingle optical section are shown in A to D (YFP, left panel).A, C: BiFC fluorescence indicated that 14-3-3 kappa-HD2C and 14-3-3 nu-HD2C interactions tookplace in nuclei (N) and nucleoli (No). The nucleolar signals were so strong that the excitationlight intensity had to be reduced to reveal the nucleolar structure.B, D: Kappa homodimers localised to the cytosol (Cyt) and the nucleus (N) but were absentfrom the nucleolus whilst nu homodimers localised mostly to the cytosol.The merged images of YFP and bright field images (YFP/BF) are shown for comparison (A to D,right panel). Scale bars = 50 μm.E: Interaction of HD2C with other 14-3-3 isoforms was confirmed (+, data not shown). Thelocalisation patterns were identical to those shown in A and C.
E
YFP Merged (YFP/BF)
kappa-YN/kappa-YCB
nu-YN/nu-YCD
nu-YN/HD2C-YCC
N
N
No
Cyt
N
kappa-YN/HD2C-YCA
N
No
Cyt
No
Chapter 4. Visualisation of 14-3-3 dimerisation in living plant cells 115
Chapter 4. Visualisation of 14-3-3 dimerisation in living plant cells 116
4.3. Discussion
4.3.1. 14-3-3 isoforms can dimerise freely with each other in vivo
In this project, dimeric interactions between ten out of thirteen expressed
Arabidopsis 14-3-3 isoforms and their intracellular localisations were visualised in
living plant cells using a transient BiFC assay. It was clearly shown that under the
experimental conditions used, all tested 14-3-3 isoforms can dimerise freely with each
other in vivo, suggesting that there is no obvious preferential dimerisation among
14-3-3 isoforms. These results verified previous reports, which were based on small
numbers of isoforms tested in vitro (Wu et al., 1997b; Abarca et al., 1999). The work
presented here further demonstrated that this freedom of dimerisation also applies to
the in planta situation. Published work using Arabidopsis (Wu et al., 1997b; Abarca
et al., 1999) and the results from this study are in contrast to those of mammalian and
yeast work which showed some degree of preferential dimerisation (Chaudhri et al.,
2003; Wilker et al., 2005). Thus, 14-3-3s in Arabidopsis may differ from their
mammalian and yeast counterparts; however, it remains to be investigated whether
this is the case for 14-3-3 proteins from other plants.
4.3.2. Subcellular localisation of 14-3-3 dimers
Published localisation studies using GFP fusion approaches demonstrated that
Arabidopsis 14-3-3 kappa, lambda, mu, omega, phi, and psi isoforms localised to the
cytosol and the nuclei in living plant cells (Cutler et al., 2000; Koroleva et al., 2005;
Paul et al., 2005; Rienties et al., 2005; Reumann et al., 2009; Table 4-1). The present
study using transient BiFC assays in Nicotiana leaf cells further verified that these
14-3-3 isoforms (not included the lambda isoform) were able to form homodimers
and any combination of heterodimers in those cellular compartments (Figs. 4-1, 4-2
and data not shown). Surprisingly, neither the published GFP-fusion approaches nor
Chapter 4. Visualisation of 14-3-3 dimerisation in living plant cells 117
the transient BiFC assays presented in this work showed chloroplastic localisation of
14-3-3 proteins. This is contrary to previous reports that 14-3-3 proteins were
detectable in the chloroplasts (Sehnke et al., 2000). Sehnke and co-workers showed
the presence of Arabidopsis 14-3-3 isoforms epsilon, mu, nu and upsilon in both
cytoplasmic and chloroplastic protein fractions but omega isoform was not found in
the stroma extract (Sehnke et al., 2000). The discrepancies of 14-3-3 organellar
localisations might be due to from the use of different plant and/or experimental
systems. It may further be that 14-3-3s indeed localise to the chloroplasts but that
the amount is too low to be detectable in the BiFC assays shown here. Furthermore,
lack of a chloroplast import signal in 14-3-3s still leaves the question of how 14-3-3s
gain access to the chloroplasts. Finally, it cannot be excluded that the published
work showing chloroplast localisation only shows association of 14-3-3s with
chloroplasts, i.e. that 14-3-3s were found not ‘in’ but attached to chloroplasts. This
would be supported by the findings shown here where 14-3-3s are often found
surrounding chloroplasts.
A more detailed discussion regarding the obtained localisation data of 14-3-3
dimers is in the following paragraphs.
4.3.3. Do nuclear localisation patterns reflect function of 14-3-3 dimers?
Subcellular localisation studies indicated BiFC fluorescence due to 14-3-3
dimerisation was found in the cytosol and nuclei of transiently transformed Nicotiana
leaf epidermal cells (Figs. 4-1 and 4-2). The fluorescence intensity in the cytosol did
not change significantly from dimer to dimer but varied for the nuclei both between
dimers and within one dimer combination. Based on the fluorescence intensity in
nuclei, subcellular distributions of 14-3-3 dimers were classified into three patterns,
those with higher nuclear than cytosolic signal intensities, those with nearly equal
Chapter 4. Visualisation of 14-3-3 dimerisation in living plant cells 118
intensities and those were the cytosolic signal appeared stronger than the nuclear
signal (Section 4.2.3.3).
The BiFC fluorescence intensity could be an indicator of the accumulation level
of the 14-3-3-BiFC dimeric complexes within cells. The mechanism of 14-3-3 protein
translocations into nuclei is still not clear. Classical nuclear localisation signals (NLS)
were not identified in any of the Arabidopsis 14-3-3 isoforms using the PredictNLS
online program (http://cubic.bioc.columbia.edu/cgi/var/nair/resonline.pl; data not
shown). One proposed mechanism is that subcellular localisation of 14-3-3s is
driven by interactions with target proteins (Paul et al., 2005). This is supported by
the finding that disturbances of 14-3-3 and target protein interactions lead to
localisation pattern changes of nuclear 14-3-3 kappa- and lambda-GFP fusion proteins
out of the nucleus in tricome cells of transgenic Arabidopsis plants (Paul et al., 2005).
One point which has to be taken into account is that the interaction with client
proteins in the 14-3-3 BiFC assays presented here may be disturbed or changed, either
due to the fusion protein nature or their overexpression. This may change
localisation patterns of 14-3-3 dimers. To verify the hypothesis that nuclear
localisation of 14-3-3s is driven by client interactions, one would have to show
interaction of the dimer and simultaneously interaction with the client. Such
approaches may be useful in elucidating dimerisation and client interaction in a
cellular and subcellular context.
The transient BiFC assays indicated that all tested 14-3-3 isoforms were able to
form dimers with each other. However, this only indicates the potential of all 14-3-3s
to freely dimerise. It has to be taken into account that a strong, non-native
promoter was used and that all 14-3-3s were expressed in a non Arabidopsis
environment and in leave tissues. These conditions may not reflect the true nature
of the 14-3-3s and may give a somewhat distorted view. Ideally, the results would be
Chapter 4. Visualisation of 14-3-3 dimerisation in living plant cells 119
verified in Arabidopsis using native 14-3-3 promoters, which would allow for inclusion
of 14-3-3 expression profiles. A study aimed to verify such interactions in
Arabidopsis, although using the CaMV 35S promoter is presented in Chapter 5.
The transient BiFC assay in Nicotiana leaves indicates that Arabidiopsis 14-3-3
kappa isoform showed intense labelling in the nucleus as a homodimer and also when
present as a heterodimer in combination with most other 14-3-3 isoforms, except nu
and omega which commonly showed weaker nuclear BiFC signals in dimerisations
(Table 4-2 and Figs. 4-4 to 4-5). It also appears that kappa and nu can impose their
subcellular localisation preferences onto other 14-3-3s. For example, the psi isoform
shows Pattern 1 labelling when paired with kappa but demonstrates mainly Pattern 3
fluorescence when paired with nu (Fig. 4-5 and Table 4-2). The predominantly
nuclear labelling of 14-3-3 kappa is supported by a study that showed a similar
nuclear labelling pattern in tricome cells expressing 14-3-3 kappa-GFP fusion proteins
(Paul et al., 2005).
In contrast to the predominantly nuclear labelling pattern of 14-3-3
kappa-related dimers, the 14-3-3 nu isoform seemed to preferentially localise to the
cytosol, decreasing even the nuclear BiFC signal of kappa in a nu-kappa heterodimer
when compared to kappa homodimers. Furthermore, nu homodimers appeared to
be almost absent from the nucleus. Similarly, heterodimers of nu with omega and
iota appeared to be almost exclusively found in the cytosol (Fig. 4-5 and Table 4-2).
Different fluorescence intensity patterns between dimers and also for one dimer
combination of 14-3-3 dimers may reflect different cellular situations and
requirements. This is supported by findings showing that differential accumulation
of GFP-14-3-3 omega fusion proteins in nuclei of transgenic Arabidopsis hypocotyl
cells is responsive to the cell cycle state (Cutler et al., 2000). Commonly, the
GFP-omega fusion protein accumulated less in the nuclei, showing labelling similar to
Chapter 4. Visualisation of 14-3-3 dimerisation in living plant cells 120
the Pattern 3 described in the present study. However, the labelled fusion protein
accumulated to high levels in the nuclei just after completion of nuclear division,
appearing similar to Pattern 1 labelling in the present study. Shortly before
completion of cytokinesis, the fusion protein departed from nuclei (Cutler et al., 2000).
Although differential nuclear accumulation of 14-3-3 dimeric BiFC fluorescence was
detected in this study as well, it was unlikely due to the cell cycle regulation as
observed in Cutler et al. (2000) since the Nicotiana epidermal cells used here were
already highly differentiated. However, by analogy, the different patterns observed
for one dimer or pattern differences between dimers may reflect biological states of
so far unknown functions.
Interestingly, all the 14-3-3-BiFC dimeric complexes tested here displayed
fluorescence in the nucleoplasm but were absent from nucleoli. This contrasts with
an earlier study in which 14-3-3 kappa-GFP fusion proteins were reported to be
present in nucleoli (Paul et al., 2005). As there is no membrane barrier between the
nucleoplasm and nucleolus, the exclusion of 14-3-3 dimers from the latter is
intriguing.
4.3.4. Is the novel 14-3-3 localisation associated with the ER and with
wound induced cell death?
When investigating the subcellular localisation of 14-3-3-BiFC dimers in
epidermal cells, a distinct cytosolic pattern consisting of punctuate BiFC fluorescent
bodies (designated as Pattern 4) was observed very occasionally, suggesting that these
cytosolic structures do not reflect a common destination for 14-3-3 dimers. In
contrast this pattern may indicate special circumstances or cellular conditions. The
fading of the labelling also implies that 14-3-3 proteins might be responsive to an
event inducing this pattern. Furthermore, this pattern was observed for many
Chapter 4. Visualisation of 14-3-3 dimerisation in living plant cells 121
14-3-3 dimer combinations (Table 4-3) suggesting that the localisation response is not
isoform specific.
Observations of 14-3-3-BiFC fluorescence in epidermal peels indeed improved
the resolution and quality of the epifluorescence images and assisted greatly on
identification of subcellular distribution of the 14-3-3-BiFC dimeric complexes (Section
3.2.7). On the other hand, the procedure of epidermal peeling inflicts a degree of
mechanical stress onto the cells. Thus patterns observed for 14-3-3 dimers may
reflect cellular responses to wound effects. Several observations suggested that
wound-induced cell death was in progress in peeled epidermal cells. Firstly, there
was a dramatic decrease of the cell number showing fluorescence in the peels
compared to that in the original pre-peeled region in the intact leaves (Section 3.2.7).
Secondly, quick fading of BiFC fluorescence in epidermal peels when compared to
intact leaves may indicate cell death progression (data not shown). In contrast, BiFC
fluorescence could remain in leaf discs semi-immersed in water for 48 hours (data not
shown). Notably, the novel Pattern 4 fluorescence was mostly observed in peeled
epidermal samples but hardly detected in intact leaf samples, suggesting the pattern
would be a response to a factor associated with preparation of the peels (data not
shown).
The nature of this novel distribution pattern was further investigated in the
work presented in chapter 6.
4.3.5. Seven 14-3-3 isoforms can interact with histone deacetylase 2C
Interaction specificity of 14-3-3 isoforms with the target protein HD2C was
examined. The results indicated that all seven 14-3-3 isoforms tested were able to
interact with HD2C (Fig. 4-7), suggesting little specificity of 14-3-3 isoforms with
respect to the ability of binding to HD2C. In contrast, several in vitro binding assays
Chapter 4. Visualisation of 14-3-3 dimerisation in living plant cells 122
and application of the yeast two-hybrid system indicated binding specificities of
Arabidopsis 14-3-3 isoforms with some target proteins, such as nitrate reductase
(Bachmann et al., 1996b; Kanamaru et al., 1999), PM H+-ATPase (Rosenquist et al.,
2000; Alsterfjord et al., 2004) and phototropin 1 (Sullivan et al., 2009). This
introduces the question whether interaction specificities can be revealed using BiFC
assays. It may be that overexpression with or without mis-expression of the tested
proteins hinders such analysis. Furthermore, the stability of the formed YFP complex
may prevent specificity studies unless these specificities completely prevent binding
between the analysed proteins. Further investigations are needed to examine these
questions.
4.3.6. 14-3-3-HD2C interactions occurs in the nucleoplasm and nucleolus
All tested 14-3-3-HD2C interactions led to strong fluorescent signals in the
nucleus and even stronger labelling in the nucleolus. This was surprising as all dimer
combinations tested were absent from the nucleolus and some 14-3-3 homo- and
heterodimer combinations, namely those including 14-3-3 nu, did not preferentially
localise to the nucleus. It can be assumed that a relatively large amount of target
protein is available when expressing it under the control of the CaMV 35S promoter.
This amount may be sufficient to recruit 14-3-3 proteins to a specific location, namely
the nucleus and nucleolus, even if the 14-3-3 as a dimer shows less affinity for this
location. The absence of interaction between 14-3-3s and HD2C in the cytosol was
in contrast to experiments performed in mammalian systems where interactions of
14-3-3 proteins with HDACs were only found in the cytosol (Grozinger and Schreiber,
2000; Wang et al., 2000). This may point to a different regulation of the
plant-specific HD2 class of histone deacetylases when compared to the mammalian
and universal HDACs.
Chapter 4. Visualisation of 14-3-3 dimerisation in living plant cells 123
In previous studies, HD2C was identified in the nucleolar proteome (Pendle et al.,
2005). This is in agreement with the finding in this study. GFP fusion approaches
indicated that HD2C exclusively localises to the nucleolus but is not detectable in the
nucleoplasm and cytoplasm (Pendle et al., 2005; Sridha and Wu, 2006). This is only
in partial agreement with the current study in which HD2C interaction with 14-3-3s
was clearly found in the nucleus in addition to the nucleolus. Both studies agree on
absence of HD2C from the cytoplasm.
In 14-3-3-GFP fusion studies, dual localisation of 14-3-3s in the nucleus and
cytoplasm were reported for the isoforms kappa, lambda, mu, omega and phi but only
kappa was also detected in the nucleolus (Koroleva et al., 2005; Paul et al., 2005;
Rienties et al., 2005; Reumann et al., 2009 and summarised in Table 4-1). The
proteomic analysis of the Arabidopsis nucleolus which identifies HD2C as a nucleolar
protein does not identify any 14-3-3 proteins in the nucleolar proteome (Pendle et al.,
2005). Thus, the discovery that 14-3-3-HD2C interactions occur in the nucleolus as
demonstrated in this study, is a novel finding with respect to 14-3-3 localisation. This
brings up the question why 14-3-3 proteins are not found in the nucleolus when using
other approaches, including the 14-3-3 BiFC dimerisation assays performed in this
study (Section 4.2.3.1). One explanation may be the high expression levels achieved
using the CaMV 35S promoter to drive 14-3-3 and HD2C expression. These
expression levels possibly lead to high enough protein amounts to lead to
mis-localisation of binding partners. If this is the case, it may be that high HD2C
levels can recruit 14-3-3s to the nucleolus.
On the other hand, high amounts of 14-3-3s may recruit HD2C to the nucleus.
Why high 14-3-3 levels may not recruit HD2C to the cytoplasm may be explained with
a potential inability of the two proteins to interact in the cytosol. Interactions
between 14-3-3s and a target protein are often dependent on the phosphorylation of
Chapter 4. Visualisation of 14-3-3 dimerisation in living plant cells 124
the target. Thus, if interactions of 14-3-3s with HD2C are not possible in the
cytoplasm, it can be speculated that HD2C is non-phosphorylated before entering the
nucleus, i.e. after synthesis. This must be a short time period as HD2C-GFP fusions
were undetectable in the nucleoplasm (Pendle et al., 2005; Sridha and Wu, 2006).
When in the nucleus or nucleolus, HD2C, or at least some of the HD2C protein
molecules become phosphorylated and as a consequence, 14-3-3s can bind. It may
also be proposed that HD2C in the phosphorylated form is normally only present in
the nucleolus. This would be in agreement with the literature showing HD2C
localisation only in the nucleolar proteome and localisation of a HD2C-GFP fusion in
the nucleolus only (Pendle et al., 2005; Sridha and Wu, 2006). However, artificially
high amounts of 14-3-3s can be recruited to the phosphorylated, nucleolar HD2C.
Upon interaction, some of the 14-3-3-HD2C complex may move to the nucleus. This
would make the observed interaction of 14-3-3s with HD2C an experimental artefact.
Another explanation for the undetectable 14-3-3-HD2C interaction in the cytosol
would be that the HD2C does not localise to the cytosol or does so for a very short
period of time, i.e. it is translocated immediately to the nucleus when synthesised.
This is supported by the finding that HD2C-GFP fusion protein was also not detectable
in the cytosol (Pendle et al., 2005; Sridha and Wu, 2006). If as this case, there would
be no chance for cytosolic 14-3-3s to interact with HD2C in the cytoplasm.
More studies are clearly needed to answer the novel questions arising from this
work. These could include investigations into the impact of phosphorylation status
of HD2C on 14-3-3 binding. This could be achieved by generating a loss of
phosphorylation of HD2C mutant protein at potential 14-3-3 binding sites and then
testing for subcellular interaction of the HD2C mutant with 14-3-3 proteins using BiFC
assays.
Chapter 5. Analysis of 14-3-3 dimerisatons in transgenic Arabidopsis plants 125
Chapter 5
Analysis of 14-3-3 Dimerisation in
Transgenic Arabidopsis Plants
Chapter 5. Analysis of 14-3-3 dimerisatons in transgenic Arabidopsis plants 126
5.1. Introduction
5.1.1. Arabidopsis 14-3-3 isoforms freely dimerise with each other in a
heterologous plant system
As previously described (Section 4.1.1), only a limited number of plant 14-3-3
isoforms were shown to dimerise with each other by using mainly in vitro approaches
or the yeast two hybrid system (Wu et al., 1997b; Abarca et al., 1999). This study, by
focussing on in planta approaches has successfully demonstrated that ten of the
thirteen expressed Arabidopsis 14-3-3 isoforms can freely dimerise with each other
(Chapter 4). However, as these studies were performed in the heterologous plant
system Nicotiana benthamiana it remains unclear if similar results can be obtained in
the native plant system Arabidopsis thaliana. It cannot be excluded that the use of a
non-homologous system may impact on dimerisation results. Thus, it was decided
to verify a number of the interactions in Arabidopsis. Ideally Arabidopsis would have
been used to investigate all possible dimer combinations; however, previous studies
have shown that transient BiFC assays in Arabidopsis were not easy to perform and
lacked reliability (Chapter 3). Thus, the larger study was performed in Nicotiana as
described in Chapters 3 and 4, with follow-up studies using transgenic Arabidopsis as
described here.
Dimerisation of 14-3-3-YN and 14-3-3-YC fusion proteins in the native system
and in the presence of native 14-3-3s and their interacting proteins reflect, to a
degree, endogenous 14-3-3 behaviour. Dimerisation itself can be tested for in
analogy to the transient Nicotiana system using fluorescence microscopy.
Furthermore, tissue and developmental dependency of 14-3-3 dimer formation and
impact of endogenous or exogenous factors can be tested for using transgenic plants.
The outcomes of such analyses could provide more profound insights into the
Chapter 5. Analysis of 14-3-3 dimerisatons in transgenic Arabidopsis plants 127
function of 14-3-3 dimers than in vitro methods and studies performed in yeast and
non-homologous plant systems.
5.1.2. A literature review of 14-3-3 gene expression in Arabidopsis
All 14-3-3-split YFP constructs used in this study were expressed under the
control of the strong, widely active CaMV 35S promoter. Thus, foreseeable problems
with the evaluation of dimerisation results was the likelihood of different expression
patterns and higher expression levels of the introduced 14-3-3 BiFC transgenes
compared to endogenous 14-3-3s. Thus, endogenous 14-3-3 expression patterns
have to be taken into account when designing experiments and evaluating
dimerisation results.
To assist in this analysis, it was assumed that knowledge of endogenous 14-3-3
gene expression patterns in Arabidopsis would be helpful. Such knowledge could
help in identifying suitable 14-3-3-YN and 14-3-3-YC combinations for the genetic
generation of double transgenic plants and provide required background information
to evaluate dimerisation results.
Literature searches for the expression profiles of Arabidopsis 14-3-3 genes were
initially conducted. Alsterfjord and co-workers examined transcript abundance of
14-3-3 genes using Northern blot analysis and showed that 14-3-3 chi, lambda, mu
and epsilon are highly expressed in rosette leaves, followed by omega, phi, upsilon, nu
and kappa with lower but clearly detectable expression, and very low expression
levels of psi, omicron, iota and pi (Alsterfjord et al., 2004). In another report,
transcripts of chi, psi, lambda, kappa, mu, epsilon, omicron and pi were detected in
seven-day-old Arabidopsis seedlings (Cao et al. 2007). Furthermore, mu transcripts
were found in flowers, stems and leaves of mature plants (Kuromori and Yamamoto,
2000). Daugherty and co-workers monitored chi-promoter activity in transgenic
Chapter 5. Analysis of 14-3-3 dimerisatons in transgenic Arabidopsis plants 128
Arabidopsis plants using β-glucuronidase (GUS) as a reporter (Daugherty et al., 1996).
GUS activities were detected in flowers, roots, siliques, and imbibed seeds, suggesting
that the chi isoform was expressed in those tissues (Daugherty et al., 1996).
Rosenquist and co-workers reported that omicron was expressed in flowers, leaves
and roots of Arabidopsis plants, while iota was detectable exclusively in flowers and
expression of pi was not detectable in the tissues examined (Rosenquist et al., 2001).
It can be concluded from the literature that at least eight 14-3-3s are expressed in
seedlings (Cao et al. 2007), a minimum of nine in rosette leaves (Alsterfjord et al.,
2004) and that no less than four 14-3-3 genes are expressed in flowers (Daugherty et
al., 1996; Kuromori and Yamamoto, 2000; Rosenquist et al., 2001). Despite these
publications, the reported expression data of the Arabidopsis 14-3-3 family only cover
a limited number of tissues and in most cases are restricted to a small number of
these genes. To obtain a more complete picture, a comprehensive meta-profile
analysis based on publicly accessible microarray data was performed in this study
(Section 5.2.1).
Taken together, the aims of this chapter were:
(1) To analyse expression profiles of endogenous Arabidopsis 14-3-3 genes using
Genevestigator.
(2) To generate transgenic Arabidopsis plants harbouring 14-3-3-YN or -YC constructs
and to use those to generate double transgenic -YN/-YC plants by genetic crosses.
(3) To examine 14-3-3 dimerisation in double transgenic Arabidopsis plants in a whole
plant context.
Chapter 5. Analysis of 14-3-3 dimerisatons in transgenic Arabidopsis plants 129
5.2. Results
5.2.1. A large number of endogenous 14-3-3s are co-expressed in
Arabidopsis
Knowledge of endogenous 14-3-3 gene expression patterns in Arabidopsis
would assist this study in identifying suitable 14-3-3-YN and 14-3-3-YC combinations
for the genetic generation of double transgenic plants and providing background
information to evaluate 14-3-3 dimerisation results. To complement a literature
review of 14-3-3 gene expression in Arabidopsis (Section 5.1.2), a meta-profile
analysis of Arabidopsis 14-3-3 gene expression data was performed using
Genevestigator software (http://www.genevestigator.ethz.ch; Zimmermann et al.,
2004). Data sets from four thousand and seventy gene expression arrays
(Affymetrix® ATH1: 22k genechips) were used for this analysis. The “Anatomy tool”
and “Development tool” designed by Genevestigator were applied to analyse
expression profiles of eleven of the Arabidopsis 14-3-3 genes over tissues and
developmental stages. Genes encoding 14-3-3 isoforms chi (At4g09000) and phi
(At1g35160) were not included in this work of meta-profile analysis as the
oligonucleotides probe set used (probeset: 255079_s_at) was not specific enough to
differentiate between these two genes (Genevestigator). GRF14 (At1g22290) and
GRF15 (At2g10450) were not included in this analysis as they are considered to be
pseudogenes (Rosenquist et al., 2001; Chevalier et al., 2009).
A heat map of 14-3-3 expression profiles indicated that at least eight members,
omega, psi, upsilon, lambda, nu, kappa, mu and epsilon, were co-expressed in most of
the tissue categories (Fig. 5-1 A) and across different developmental stages (Fig. 5-1 B).
In contrast, omicron transcript was only found in tissues such as cotyledons, radicles,
adult rosette leaves, cauline leaves, lateral roots and the elongation zone of roots (Fig.
5-1 A). Furthermore, omicron expression was relatively low compared to that of
Chapter 5. Analysis of 14-3-3 dimerisatons in transgenic Arabidopsis plants 130
A B
Fig. 5-1. Tissue and development expression of Arabidopsis 14-3-3 genes –A Genevestigator heat map analysis.
The heat maps show tissue specific (A) and developmental (B) transcript abundance of elevenArabidopsis 14-3-3 genes. Data are based on the Affimetrix® ATH1:22k chip set and werecomputed using the meta-profile analysis tool of the online Genevestigator software(http://www.genevestigator.ethz.ch). Dark blue indicates higher and light blue lowerexpression levels. White indicates no detectable expression. For detailed descriptions of theanatomical ontology and of developmental stages, please refer to the Genevestigator website.The analysis shown above was verified in June 2009.
Chapter 5. Analysis of 14-3-3 dimerisatons in transgenic Arabidopsis plants 131
other 14-3-3 genes when analysed during developmental stages (Fig. 5-1 B). Still
further limited in tissue distribution were the expression of iota, which was detected
in pollen, and of pi only found expressed in the chalazal endosperm (Fig. 5-1 A), with
extremely low expression of these two genes in all developmental categories (Fig. 5-1
B).
From the meta-profile analysis and the literature study, it was concluded that a
large number of endogenous 14-3-3s are widely co-expressed in Arabidopsis with
relatively high expression levels.
5.2.2. Generation of transgenic Arabidopsis plants constitutively expressing
14-3-3-split YFP fusion proteins
The overall aim of the work presented in this chapter was the analysis of 14-3-3
dimerisation in the homologous plant system Arabidopsis. To do this, the first goal
was to generate a set of transgenic Arabidopsis plants each carrying either a
14-3-3-YN or a 14-3-3-YC construct by transforming wild-type (wt) plants (Col-0) using
the floral dip method (Section 2.4.5) with Agrobacteria carrying 14-3-3-split YFP
constructs. The constructs were chosen from the 14-3-3 library generated in the
work described in Chapter 3. The choice of clones was determined by their
availability during this project, the ability to match full-length with N-terminal deletion
mutant versions of 14-3-3s as these were to be used as negative controls, and the
expression patterns of 14-3-3 genes as determined from the literature and the above
described Genevestigator analysis.
For each transformation, 15,000 to 25,000 T1 seeds were screened for
resistance to either Basta or hygromycin, depending on the selection marker
contained on the transformed plasmid (Chapter 3). Wild-type plantlets were treated
in parallel with the selective agents to verify the expected sensitive phenotype.
Chapter 5. Analysis of 14-3-3 dimerisatons in transgenic Arabidopsis plants 132
Under both selective treatments, wt seedlings showed inhibited growth, lighter green
cotyledons and leaves, and died when kept under selective conditions. T1 seedlings
from transformed seed batches with wt-like phenotypes under selective conditions
were discarded as non-transgenic offspring (Fig. 5-2 and data not shown). Seedlings
with darker green cotyledons and leaves (under Basta selection; Fig. 5-2 B) or which
continued to grow (under hygromycin selection; Fig. 5-2 A) were selected as putative
transformants, transferred into individual pots with fresh compost mix and grown to
produce seeds. Presence of the transgene in the putative transformants was
confirmed by PCR analysis (Section 2.4.9) of genomic DNA from rosette leaves (data
not shown). Confirmed T1 plants were assigned individual line numbers (Table 5-1).
Fig. 5-2. Selection of transgenic Arabidopsis 14-3-3 BiFC seedlings.
Wild-type A. thaliana plants (Col-0) were transformed with 14-3-3-split YFP constructs using
the floral dip method. Two types of vectors were used, one conferring hygromycin and the
other Basta resistance (Chapter 3). T1 seeds were collected and germinated on either
hygromycin B (15 μg ml-1
) containing artificial media plates (A) or on soil for Basta (200 μM)
selection (B) as described (Section 2.4.7).
Seedlings were screened for resistance to the applied treatments 9 days (A) or 14 days (B)
after sowing. Hygromycin resistant seedlings grew beyond the germination stage; whilst the
growth of non-transformants was inhibited after germination (A). Seedlings resistant to Basta
stayed green and continued to grow after Basta application and were clearly distinguishable
from sensitive seedlings which appeared light to yellowish green and wilted (B). Arrows
indicate potential transformants.
Chapter 5. Analysis of 14-3-3 dimerisatons in transgenic Arabidopsis plants 133
Table 5-1. Summary of A. thaliana transformants carrying 14-3-3-split YFP
constructs.
Summarised are the result of Arabidopsis transformations with 14-3-3 BiFC constructs. Shown
are the names of the constructs used for transformation, the constructs, resistance by the
selectable plant transformation marker, names and numbers of isolated T1 plants, the ratios
of normal to aberrant phenotypes in the T1 generation and the names of plants with aberrant
phenotypes.
Construct
name 14-3-3-split YFP construct
Plant
selection*
Given name of
the T1 plants
Ratio of normal to
aberrant
phenotypes in the
T1 generation
Name of theT1
plants with aberrant
phenotypes
Ag3 pG nuX-229N-YN Basta Ag3-1 to 2 2/0 -
Ag4 pG nuX-229N-YC Basta Ag4-A1 toA2 2/0 -
Ag7 pG iotaXPCR-229N-YN Basta Ag7-1 1/0 -
Ag8 pG iotaXPCR-229N-YC Basta Ag8-1 to 4 4/0 -
Ag10 pG iota∆PCR-229N-YC Basta Ag10-1 to 6 6/0 -
Ag15 pG epsilonX-229N-YN Basta Ag15-1 1/0 -
Ag16 pG epsilonX-229N-YC Basta Ag16-1 1/0 -
Ag20 pG epsilon∆-179N-YC Hyg Ag20-1 0/1 20-1
Ag29 pG epsilon∆-229N-YN Basta Ag29-1 to 2 1/1 29-1
Ag22 pG omegaXPCR-229N-YC Basta Ag22-1 to 9 8/1 22-2
Ag23 pG omegaXPCR-179N-YN Hyg Ag23-1 to 8 8/0 -
Ag31 pG kappaXPCR-229N-YN Basta Ag31-1 to16 14/2 31-7, 31-16
Ag32 pG kappaXPCR-229N-YC Basta Ag32-1 to12 9/3 32-1, 32-9, 32-10
Ag33 pG kappa∆PCR-229N-YN Basta Ag33-1 to 2 2/0 -
Ag34 pG kappa∆PCR-229N-YC Basta Ag34-1 to 2 0/2 34-1, 34-2
Ag35 pG lambdaX-179N-YN Hyg B Ag35-1 to 4 4/0 -
Ag39 pG omicronXPCR-229N-YN Basta Ag39-1 to 11 9/2 39-3, 39-10
Ag40 pG omicronXPCR-229N-YC Basta Ag40-1 to11 9/2 40-2, 40-7
Ag50 pG muX-179NS-YC Hyg Ag50-1 1/0 -
Ag51 pG muX-179NS-YN Hyg Ag51-1 to 2 2/0 -
Ag60 pG mu∆-179NS-YN Hyg Ag60-1 to 2 1/1 60-2
Ag61 pG mu∆-179NS-YC Hyg Ag61-1 to 3 3/0 -
Ag53 pG phiX-179NS-YN Hyg Ag53-1 to 7 6/1 53-3
Ag54 pG phiX-179NS-YC Hyg Ag54-1 to 8 6/2 54-4, 54-8
Ag52 pG phi∆-179NS-YN Hyg Ag52-1 1/0 -
Ag55 pG psiX-179NS-YN Hyg Ag55-1 to 7 7/0 -
Ag56 pG psiX-179NS-YC Hyg Ag56-1 to 4 4/0 -
Ag59 pG psi∆-179NS-YC Hyg Ag59-1 1/0 -
Ag57 pG chiX-179NS-YN Hyg Ag57-1 1/0 -
Ag65 pG chiX-179NS-YC Hyg Ag65-1 1/0 -
subtotal 115 (normal) /18 (aberrant)
* Hyg, hygromycin B.
Chapter 5. Analysis of 14-3-3 dimerisatons in transgenic Arabidopsis plants 134
Thirty different BiFC constructs were successfully transformed into Arabidopsis,
including eleven full-length 14-3-3-YN constructs, ten full-length 14-3-3-YC constructs,
and additionally four 14-3-3∆-YN and five 14-3-3∆-YC constructs, which are
N-terminally truncated 14-3-3 mutant constructs (Table 5-1). A total of one hundred
and thirty-three independent T1 transgenic plants were obtained (Table 5-1). The
numbers of T1 plants isolated for the individual constructs ranged from one (e.g. for
pG iotaXPCR-229N-YN, Table 5-1) to sixteen (e.g. for pG kappaXPCR-229N-YN, Table
5-1) indicating that transgenic plants were obtained at a frequency of 0.005% - 0.1%;
well below published values of 0.5% - 3% for the floral-dip method (Clough and Bent,
1998). This was not further investigated as transgenic plants were obtained despite
these low frequencies.
5.2.3. Phenotypic changes were observed in some of the T1 transformants
Most of the T1 transgenic plants (115 out of 133) appeared similar to wild-type
plants (Table 5-1). The remaining eighteen T1 transformants showed aberrant
phenotypes, which may be related to the transgene itself, hinting at a biological
function, or caused by the insertion of the transgene into the genome which could
have an impact on function of the genes at the inserted loci. A differentiation
between possible causes was beyond the aims of this study. Hence, the observed
phenotypes, which are summarised in Table S1 (Appendix II), were solely used to
exclude transgenic plants with aberrant phenotypes from further analysis of 14-3-3
dimerisation.
5.2.4. Genetic analysis of T2 populations of 14-3-3-split YFP transformants
Timing and availability allowed for the genetic analyses of 16 out of the 133
obtained 14-3-3-split YFP transformants in the T2 generation (Table 5-2).
Chapter 5. Analysis of 14-3-3 dimerisatons in transgenic Arabidopsis plants 135
Table 5-2. Segregation of selectable markers in T2 progenies of sixteen
independent 14-3-3-split YFP transformants.
T2 populations of sixteen 14-3-3-split YFP carrying transgenic plants were tested for
resistance (R) and sensitivity (S) to selective agents (Basta or hygromycin; see also Table 5-1).
Segregation ratios were tested by χ2 test for fitness to possible segregation ratios. The null
hypothesis for χ2 tests was rejected at the 5 % level (P < 0.05). The expected ratios with the
highest probability of fitness were selected and are shown in the table. The χ2 test was not
applicable (n.a.) when any of the expected segregation frequency was less than 5 (Preacher,
2001).
Transformant
(genotype)
No. of T2
analysed
Resistant to
selection (R)
Sensitive to
selection (S) χ
2 test P-value
Ag3-1 (nu-YN) 16 9 7 1R:1S 0.62
Ag3-2 (nu-YN) 16 13 3 (3R:1S) n.a.
Ag4-A1 (nu-YC) 94 57 37 2R:1S 0.21
Ag4-A2 (nu-YC) 9 5 4 (1R:1S) n.a.
Ag15-1 (epsilon-YN) 22 17 5 3R:1S 0.81
Ag16-1 (epsilon-YC) 29 21 8 3R:1S 0.75
Ag29-2 (epsilon∆-YN) 23 13 10 1R:1S 0.53
Ag33-1 (kappa∆-YN) 22 14 8 2R:1S 0.76
Ag33-2 (kappa∆-YN) 20 16 4 3R:1S 0.61
Ag50-1 (mu-YC) 28 24 4 (11R:1S) n.a.
Ag51-1 (mu-YN) 23 23 0 All R -
Ag51-2 (mu-YN) 21 16 5 3R:1S 0.90
Ag52-1 (phi∆-YN) 21 21 0 All R -
Ag57-1 (chi-YN) 22 13 9 2R:1S 0.45
Ag59-1 (psi∆-YC) 10 10 0 All R -
Ag60-1 (mu∆-YN) 12 9 3 (3R:1S) n.a.
To gain an insight into the number of loci with a T-DNA insertion, segregation for
T-DNA linked hygromycin/Basta resistance was determined. The observed
segregation ratios were then statistically tested by chi-square (χ2) goodness-of-fit test
for fitness to different, theoretically expectable resistant to sensitive (R:S) segregation
ratios (Lu et al., 2004). The tested ratios included 1R:1S, 2R:1S, 3R:1S, 11R:1S and
15R:1S. The null hypothesis for the χ2 test was rejected at the less than 5% level
Chapter 5. Analysis of 14-3-3 dimerisatons in transgenic Arabidopsis plants 136
(P < 0.05). For each family analysed, the expected R:S ratio with the highest P-value
was selected and is listed in Table 5-2 to indicate the most likely segregation ratio
suggested by the observed frequencies. It should be noted that the use of the χ2
tests is inappropriate if any expected frequency is below 1 or if more than 20% of the
expected frequencies are less than 5 (Preacher, 2001).
Analysis of resistance to Basta for 16 Ag3-1 and 23 Ag29-2 T2 siblings revealed
segregation ratios of 9R:7S and 13R:10S. Both ratios fitted best a 1R:1S segregation
ratio with P=0.62 (Ag3-1) and P=0.53 (Ag29-2; Table 5-2) which is likely an indication
for insertion of a T-DNA at a single locus that led to gametophytic lethality in either
male or female gametes (Howden et al., 1998; Lu et al., 2004).
Four transformants, Ag15-1 (17R: 5S), Ag16-1 (21R:8S), Ag33-2 (16R: 4S) and
Ag51-2 (16R: 5S), appeared as a single locus T-DNA insertion lines that resulted in a
typical Mendelian segregation of 3R:1S ratio in the T2 populations.
Three transgenic lines, Ag4-A1, Ag33-1 and Ag57-1, exhibited a 2R:1S
segregation ratio indicating the potential of single locus inheritance with non-viable
homozygote plants (Lu et al., 2004).
The T2 seedlings of Ag51-1 (n=23), Ag52-1 (n=21) and Ag59-1 (n=10) examined
were all resistant to hygromycin, suggesting that there were at least two independent
T-DNA loci in the genome of these transformants.
The remaining transformants, Ag3-2, Ag4-A2, Ag50-1 and Ag60-1 had
segregation ratios for which the T2 populations were too small for an appropriate χ2
goodness-of-fit test (Table 5-2; n.a.) as more than 20% of the expected frequencies
were less than 5 (Preacher, 2001). Further genetic and molecular analyses are
needed to elucidate or confirm the number of T-DNA loci in the transgenic genomes.
Chapter 5. Analysis of 14-3-3 dimerisatons in transgenic Arabidopsis plants 137
5.2.5. Generation of “double” transgenic 14-3-3-YN and 14-3-3-YC
Arabidopsis plants for BiFC analysis of 14-3-3 dimerisation in a whole
plant context
The use of Nicotiana for transient BiFC analysis of Arabidopsis proteins has
proven to be a useful way of examining 14-3-3 dimerisation (Chapter 4). One
disadvantage with such an approach is the fact that the analysis was not done in the
native plant system. Additionally, transient BiFC analysis in Nicotiana was limited to
leaf tissue and was not extendable to a whole plant. In order to scrutinise the data
obtained in the transient analysis and to allow for whole plant dimerisation studies, it
was decided to perform BiFC investigations, limited to a few 14-3-3 dimer
combinations, in stable transformed Arabidopsis plants. To this end, a series of
transgenic Arabidopsis plants was generated harbouring one 14-3-3 BiFC construct
each (Section 5.2.2). Microarray data analysis (Section 5.2.1) and the published
literature (Section 5.1.2) indicated that a large number of 14-3-3 genes are widely
expressed, including chi, epsilon and mu. Taking microarray data and availability of
transformants into account, four double transgenic lines containing both a 14-3-3-YN
and a 14-3-3-YC construct were generated by crossing single transgenic T1 plants. T1
plants were usually used here to save time. Although T1 plants are heterozygous for
the transgenes, the dominance of the transgenes allowed for easy selection of double
transgenic offspring plants by testing for a combination of hygromycin and Basta
resistance (if applicable) and by monitoring for expected BiFC signals.
In detail, the maternal Ag50-1 plant (mu-YC, hygR; Table 5-1) was crossed with
the paternal Ag57-1 plant (chi-YN, hygR; Table 5-1) to generate offspring containing
both mu-YC and chi-YN transgenes (Table 5-3). Similarly, crosses of Ag15-1 x Ag50-1
were conducted to generate epsilon-YN/mu-YC plants (Table 5-3). Double transgenic
mu-YN/mu-YC plants were obtained by crossing of Ag50-1 x Ag51-1 and vice versa
Chapter 5. Analysis of 14-3-3 dimerisatons in transgenic Arabidopsis plants 138
Table 5-3. Generation of double transgenic 14-3-3-split YFP Arabidopsis
plants by genetic crosses.
Double transgenic Arabidopsis plants carrying the indicated 14-3-3-BiFC constructs were
generated by genetic crosses of single 14-3-3 YN and 14-3-3 YC parents. F1 seeds obtained
were germinated on MS media with the indicated selective conditions (refer to Table 5-1).
Seedlings resistant to the selection(s) were examined for BiFC fluorescence indicative of
14-3-3 dimerisation using fluorescent microscopy.
Cross (♀ x ♂)
F1 genotype
(note: both alleles are
heterozygous, unless
otherwise stated)
Plant selectionc
dNo. of F1
seeds
planted
F1 seedlings
resistant to
selection(s)
F1
seedlings
sensitive to
selection(s)
Resistant F1
seedlings
with BiFC
fluorescence
Ag15-1 x Ag50-1 epsilon-YN/mu-YC Basta and Hyg 33 4 29 4
Ag50-1 x Ag57-1 mu-YC/chi-YN Hyg 16 10 6 2
aAg50-1 x Ag51-1 mu-YC/mu-YN Hyg
a84 9 3 2
aAg51-1 x Ag50-1 mu-YN/mu-YC Hyg 40 34 6 2
Ag60-1-1b x
Ag61-1 mu∆-YN/mu∆-YC Hyg 20 20 0 0
a The genetic cross of Ag50-1 x Ag51-1 generated mostly shrunken seeds (72 out of 84), which did not germinate; while
the reciprocal cross (Ag51-1 x Ag50-1) produced normal seeds. b The maternal plant Ag60-1-1 used for the crosses with Ag61-1 pollen was a T2 line. A follow-up genotypic examination
on the F1 populations Ag60-1-1b x Ag61-1 suggested the maternal plant Ag60-1-1 was a transgenic homozygote
plant (see text). c Hyg, hygromycin B.
d No., number.
(Table 5-3). The crosses of Ag60-1-1 (a T2 plant) with Ag61-1 (a T1 plant) were done
to generate mu∆-YN/mu∆-YC plants, which served as a negative control for mu-mu
homodimerisation (Table 5-3).
5.2.5.1. Selection of BiFC expressing, double transgenic Arabidopsis plants
F1 seeds obtained from the genetic crosses were germinated on MS media with
appropriate selection to test seedlings for segregation of resistance versus sensitivity
to the plant selection (Table 5-3). Resistant seedlings were analysed for presence of
both transgenes by monitoring YFP fluorescence, which was indicative of 14-3-3
dimerisation (Table 5-3). Of the 33 epsilon-YN/mu-YC (Ag15-1 x Ag50-1) F1 seedlings
obtained, four were resistant to Basta and hygromycin and showed BiFC fluorescence
(Table 5-3). In analogy, two seedlings showed BiFC fluorescence in the offspring of
Chapter 5. Analysis of 14-3-3 dimerisatons in transgenic Arabidopsis plants 139
the mu-YC and chi-YN cross (Ag50-1 x Ag57-1, Table 5-3). The cross of Ag50-1 x
Ag51-1 produced mostly shrunken F1 seeds (72 seeds out of 84), which did not
germinate (data not shown). The remaining 12 seeds germinated, with two hygR
seedlings showing BiFC fluorescence, indicating formation of mu-YC/mu-YN dimers
(Table 5-3). The reciprocal cross of Ag51-1 x Ag50-1 was performed as well and it
produced normal seeds. Of the 40 Ag51-1 x Ag50-1 F1 seedlings, 34 were resistant
to hygromycin but only two showed BiFC fluorescence (Table 5-3).
Generation of mu∆-YN/mu∆-YC plants was achieved by crossing the maternal T2
plant Ag60-1-1 (mu∆-YN, hygR) with the T1 plant Ag61-1 (mu∆-YC, hygR). Twenty F1
seedlings tested were hygromycin resistance. Twelve of the F1 seedlings, randomly
selected to test for the presence of transgenes by PCR genotyping, contained the
mu∆-YN transgene with seven of those also containing the mu∆-YC transgene. This
suggested that the maternal plant Ag60-1-1 was homozygous and that the paternal
plant Ag61-1 was heterozygous, with a single locus for the transgene (mu∆-YC). As
expected, the seven F1 progeny containing both mu∆-YN and mu∆-YC transgenes did
not show BiFC fluorescence (Table 5-3 and data not shown).
5.2.5.2. Distribution of 14-3-3 dimers in double transgenic Arabidopsis
plants as observed by BiFC
An overview of the tissue distribution pattern of BiFC fluorescence in a young
chi-YN/mu-YC F1 seedling (Ag50-1 x Ag57-1, line 2) is shown in Figure 5-3 A to D.
Fluorescence intensity was strong in the root tip (Fig. 5-3 D), decreased in the
adjacent proximal zone (Fig. 5-3 D) and was strong again in the stele of the mature
root zone (Fig. 5-3 C). Fluorescence was also detectable in the hypocotyl and
cotyledons (Fig. 5-3 A, B). The distribution of BiFC fluorescence in epsilon-YN/mu-YC
and mu-YN/mu-YC seedlings resembled that of the seedling shown in Figure 5-3 (data
not shown). F1 seedlings exhibiting BiFC fluorescence were transferred to soil
Fig. 5-3. Localisation of a 14-3-3 mu-YC/14-3-3 chi-YN heterodimer as detected by BiFCanalysis of a genetically obtained double transgenic Arabidopsis F1 seedling.
Double transgenic 14-3-3 BiFC seedlings carrying two 14-3-3 BiFC constructs were obtained bygenetic crosses of single transgenic seedlings carrying 14-3-3 BiFC monomers. F1 seedlings wereexamined for BiFC fluorescence as an indicator of 14-3-3 dimerisation, using conventionalfluorescence microscopy. Shown is a seven day-old F1 seedling (Ag50-1 x Ag57-1 BiFC line 2,Table 5-3) carrying a 14-3-3 mu-YC and a 14-3-3 chi-YN constructs (mu-YC/chi-YN).Fluorescence indicating dimerisation of the two 14-3-3 constructs was observed throughout theseedling: cotyledons (A), hypocotyl and the junction of hypocotyl and root (B), root (C) and roottip (D). Strong fluorescence was observed in the root cap and the root stele with weak or nofluorescence in the adjacent proximal zone (D). Left panel: epfluorescence images (GFP filter).Middle panel: overlay of left and right panels. Right panel: bright field images. Scale bars =0.5 mm.
GFP filter Bright field
B
C
D
A mu-YC/chi-YN
Merged
Chapter 5. Analysis of 14-3-3 dimerisatons in transgenic Arabidopsis plants 140
Chapter 5. Analysis of 14-3-3 dimerisatons in transgenic Arabidopsis plants 141
and allowed to set seeds. The F2 progeny was used for a genetic analysis, a detailed
tissue specific dimerisation analysis and to monitor the subcellular distribution of
14-3-3 dimers in different tissues.
5.2.5.3. Genetic analysis of F2 offspring of double transgenic BiFC
Arabidopsis plants
F2 plants were derived by allowing the F1 plants shown in Table 5-4 to self
fertilise. The F2 seedlings were tested for hygromycin resistance and for BiFC
fluorescence. Out of 22 tested seedlings of Ag15-1 x Ag50-1 BiFC line1
(epsilonYN/mu-YC), 17 were resistant to hygromycin and 13 were BiFC positive (Table
5-4). The 17R:5S ratio (dominant hygromycin resistance) fitted a typical Mendelian
3R:1S segregation ratio with P=0.81 when tested using the chi-square goodness-of-fit
test (Section 5.2.4), suggesting that a single mu-YC allele (linked to hygromycin
resistance) was inherited from the Ag50-1 plant. BiFC fluorescence requires one
allele of each of the parents to be transmitted. The ratio of BiFC positive (13 BiFC+)
to BiFC negative (9 BiFC-) seedlings fitted an expected BiFC segregation ratio of 9
BiFC+:7 BiFC- with P=0.79, suggesting a single allele of the epsilon-YC transgene (linked
to Basta resistance) in the double transgenic parental plant.
In analogy, the observed hygromycin resistance ratio of 74R:6S in the offspring
of Ag51-1 x Ag50-1 BiFC line1 (mu-YN/mu-YC) fitted a 15R:1S ratio (P=0.64),
suggesting that the parental line contained two independent transgene alleles linked
to hygromycin resistance, one each from Ag51-1 and Ag50-1. This was further
supported by the observed BiFC segregation ratio (43 BiFC+:37 BiFC-; Table 5-4) which
fitted an expected 9 BiFC+:7 BiFC- ratio with P=0.65.
Chapter 5. Analysis of 14-3-3 dimerisatons in transgenic Arabidopsis plants 142
Table 5-4. Segregation of BiFC fluorescence in the F2 generation derived
from three independent double transgenic 14-3-3-split YFP Arabidopsis
lines.
The table shows segregation of hygromycin resistance and BiFC fluorescence (14-3-3
dimerisation) in the F2 progeny of double transgenic 14-3-3-split YFP plants. The F2 progeny
containing epsilon-YN/mu-YC were produced from one of the four BiFC-presenting lines
(Table 5-3) from the cross of Ag15-1 x Ag50-1. In analogy, the BiFC line 1 of Ag51-1 x Ag50-1
and the BiFC line 2 of Ag50-1 x Ag57-1 were used to generate F2 populations displaying BiFC
fluorescence of mu-YN/mu-YC and mu-YC/chi-YN dimerisation, respectively.
Transformant with BiFC Genotype Total *no. of F2
seeds planted
Resistant to
hygromycin
F2 Seedlings
with BiFC
BiFC line 1 of Ag15-1 x Ag50-1 epsilon-YN/mu-YC 22 17 13
BiFC line 1 of Ag51-1 x Ag50-1 mu-YN/mu-YC 80 74 43
BiFC line 2 of Ag50-1 x Ag57-1 mu-YC/chi-YN 116 107 53
* No., number.
In contrast, the segregation of hygromycin resistance to sensitivity of 11R:1S
(P=0.82) of the offspring of Ag50-1 x Ag57-1 BiFC line2 (mu-YC/chi-YN) indicated an
untypical Mendelian segregation of hygromycin resistance, suggesting two
independent T-DNA alleles at different, non-linked loci in the parental genome, with
one of the insertions leading to non-viable resistant homozygote offspring (Lu et al.,
2004). This was consistent with the conclusion drawn from a similar analysis
performed for the F2 generation of one of the parental lines, Ag57-1, with a 2R:1S
segregation ratio (Table 5-2). Segregation of BiFC fluorescence (53 BiFC+:63 BiFC-)
fitting a 1:1 ratio (P=0.35) rather than a 9 BiFC+:7 BiFC- ratio (P=0.02) further
supported this assumption (Table 5-4).
Chapter 5. Analysis of 14-3-3 dimerisatons in transgenic Arabidopsis plants 143
5.2.6. Distribution of 14-3-3 BiFC dimers in double transgenic Arabidopsis
plants
F2 plants in which fluorescence was detected were used to investigate the
subcellular localisation of the three 14-3-3 dimers in roots, cotyledon guard cells, and
epidermal cells of rosette leaves.
5.2.6.1. Distribution of 14-3-3 dimers in roots of transgenic seedlings
Five to nine day-old BiFC+ F2 seedlings were analysed for subcellular localisation
of 14-3-3 dimers in root tissues using confocal laser scanning microscopy (CLSM).
14-3-3 BiFC constructs were under the expression control of the CaMV 35S promoter.
Assuming that transcriptional regulation of the CaMV 35S promoter is independent of
the transgene itself, one can attribute differences in the distribution of the expressed
proteins to post-transcriptional and post-translational regulation, or to the impact of
the cellular environment on the ability of the proteins to interact. Comparing 14-3-3
dimerisation with expression of a control protein such as GFP, also under the control
of the CaMV 35S promoter, potentially shows promoter independent regulatory
events. Thus, obtained 14-3-3 dimerisation patterns were compared to fluorescence
observed due to CaMV 35S-GFP expression in control plants.
CLSM revealed strong GFP fluorescence in all zones, including meristematic and
elongation zones, of primary root tips of 35S-GFP seedlings (Fig. 5-4 B-D). GFP
fluorescence analysis thus demonstrated activity of the CaMV 35S promoter in all root
tip cells.
In contrast to GFP, strong BiFC fluorescence of mu-YC/chi-YN dimer complexes
was detected in the lateral and the columella root cap (Fig. 5-4 E-G). Very low levels
of fluorescence were observed in the meristematic and elongation zone of roots.
Fig. 5-4. Distribution of mu-YC/chi-YN and mu-YN/mu-YC dimeric complexes in root tips ofdouble transgenic Arabidopsis seedlings.
(A) Schematic illustration of root apical tissues delineating root cap (RC), meristematic (M) andelongation zone (EZ). Adapted from Marchant et. al., (1999) with permission from NaturePublishing Group, copyright© 1999.Confocal images of longitudinal section through the root tip of five to nine day-old transgenicArabidopsis seedlings expressing GFP (B-D), mu-YC/chi-YN fusion proteins (E-G; progeny ofAg50-1 x Ag57-1 BiFC line 2, Table 5-4) and mu-YN/mu-YC fusion proteins (H-J; progeny ofAg51-1 x Ag50-1 BiFC line 1, Table 5-4). GFP and 14-3-3-YN/YC expression was driven byCaMV35S promoters. BiFC fluorescence showed strong accumulation of 14-3-3 dimericcomplexes in the lateral and columella root cap. In contrast to GFP, 14-3-3 dimers were notobserved in meristematic and elongation zones of roots. Left panel (B, E and H): GFP or YFPfluorescence; right panel (D, G and J): the same root areas under bright field; middle panel (C, Fand I): overlay of left and right panels. Scale bars = 50 μm.
GFP
mu-YC/chi-YN
mu-YN/mu-YC
B
E
H
GFP/YFP Bright fieldMerged
A
C D
F G
I J
Chapter 5. Analysis of 14-3-3 dimerisatons in transgenic Arabidopsis plants 144
Chapter 5. Analysis of 14-3-3 dimerisatons in transgenic Arabidopsis plants 145
Similar 14-3-3 BiFC distribution patterns were also observed for mu-YN/mu-YC (Fig.
5-4 H-J) and epsilon-YN/mu-YC (data not shown) seedlings. Thus the differences in
GFP and BiFC fluorescence patterns suggested regulation events post transcription
initiation. For example, cellular conditions, e.g. native 14-3-3 binding competitors,
may interfere with efficient 14-3-3 dimerisation in cells or that post-transcriptional or
post-translational events prevent formation of the fusion proteins therefore showing
low level BiFC fluorescence.
Longitudinal optical sections imaged with CLSM were used to investigate the
distribution of epsilon-YN/mu-YC, mu-YC/chi-YN or mu-YN/mu-YC dimers or of GFP
fluorescence in epidermal/cortex cells of mature roots (Fig. 5-5). GFP fluorescence
was strong in the nuclei and cytoplasms of such cells (Fig. 5-5 A). Fluorescence of
epsilon-YN/mu-YC was clearly visible in the cytoplasm and nuclei, albeit fluorescence
in nuclei appeared weaker than in GFP plants (Fig. 5-5 D). Fluorescence in root cells
of mu-YC/chi-YN and mu-YN/mu-YC expressing plants was strong in the cytoplasm
with inconclusive results for nuclei of mu-YC/chi-YN plants and absent from nuclei of
mu-YN/mu-YC plants (Fig. 5-5 G and J).
5.2.6.2. Subcellular distribution of 14-3-3 dimers in cotyledon guard cells
In cotyledon guard cells, GFP fluorescence indicated that the GFP localised to
the nuclei and the cytoplasm but fluorescence was weak or absent from chloroplasts,
which appeared as red fluorescent structures when testing for chlorophyll
autofluorescence (Fig. 5-6 A and B). This was consistent with observations for GFP
localisation in root cells (Fig. 5-5 A). BiFC fluorescence of the 14-3-3
epsilon-YN/mu-YC dimeric complexes was detectable in the nuclei and the cytoplasm
with slightly lower intense in the nucleus (Fig 5-6 D), thus resembling Pattern 2 as
defined in transient expression experiments (Chapter 4). Fluorescence of the
Fig. 5-5. Subcellular localisation of 14-3-3-BiFC dimers in root cells of double transgenicArabidopsis seedlings.
Shown are confocal images of virtual longitudinal sections through a primary root of five totwelve day-old transgenic seedlings: (A-C) GFP, (D-F) epsilon-YN/mu-YC dimer (progeny ofAg15-1 x Ag50-1 BiFC line 1, Table 5-4), (G-I) mu-YC/chi-YN dimer (progeny of Ag50-1 x Ag57-1BiFC line 2, Table 5-4) and (J-L) mu-YN/mu-YC dimer (progeny of Ag51-1 x Ag50-1 BiFC line 1,Table 5-4). GFP expression was found in the cytoplasm and nuclei (A). All three 14-3-3 dimerswere found in the cytoplasm. Nuclear localisation was found for epsilon-YN/mu-YC, wasinconclusive for mu-YC/chi-YN and not found for mu-YN/mu-YC. Left panel: GFP (A) or YFPfluorescence (D, G and J); right panel (C, F, I and L), the same root areas under bright field;middle panel (B, E, H and K): overlay of left and right panels. Scale bars = 50 μm.
GFP/YFP Merged Bright field
A
GFP
G
mu-YC/chi-YN
D
epsilon-YN/mu-YC
J
mu-YN/mu-YC
N
B C
E F
H I
K L
Chapter 5. Analysis of 14-3-3 dimerisatons in transgenic Arabidopsis plants 146
Fig. 5-6. Subcellular localisation of 14-3-3-BiFC dimers in cotyledon guard cells of doubletransgenic Arabidopsis seedlings.
Shown are confocal images of single optical sections through cotyledon guard cells of nine totwelve day-old transgenic seedlings expressing GFP or two 14-3-3 BiFC constructs (A, D and G),merged images of GFP/YFP confocal images with red chlorophyll autofluorescence (Chl) (B, Eand H) and bright field images of the respective guard cells (C, F and I). Scale bars = 10 μm.(A-C) GFP fluorescence was detected in nuclei and in the cytoplasm of guard cells and wasweak or absent from chloroplasts.(D-F) YFP fluorescence, indicating the presence of epsilon-YN/mu-YC heterodimers in guardcells, was observed in the nuclei and cytoplasm but was undetectable or extremely low inchloroplasts.(G-I) YFP fluorescence, indicating the presence of mu-YN/mu-YC homodimers in guard cells,was strong in the cytoplasm, and very weak or absent from nuclei and chloroplasts.
D
GFP/YFP Bright fieldMerged with Chl
epsilon-YN/mu-YC
A
GFP
G
mu-YN/mu-YC
N
N
N
Chl
Chl
Chl
B C
E F
H I
Chapter 5. Analysis of 14-3-3 dimerisatons in transgenic Arabidopsis plants 147
Chapter 5. Analysis of 14-3-3 dimerisatons in transgenic Arabidopsis plants 148
mu-YN/mu-YC homodimer was clearly detectable in the cytoplasm but either absent
or only detectable at very low levels in nuclei (Fig. 5-6 G). Thus, the mu/mu
homodimer appeared in Pattern 3 as defined earlier (Chapter 4). The observations
made for the two 14-3-3 dimers in cotyledon guard cells matched those in root cells
of the same plants (Figs. 5-5 and 5-6).
It was reported that some 14-3-3 proteins, including epsilon and mu, localise to
chloroplasts (Sehnke et al., 2000). In the experiments performed here, fluorescence
was very week or absent from chloroplasts of guard cells for both the
epsilon-YN/mu-YC heterodimer and the mu-YN/mu-YC homodimer (Fig. 5-6 D-E and
G-H). Lack of BiFC fluorescence of 14-3-3 dimers in chloroplasts was consistent with
the observations made in transiently transformed Nicotiana leaves (Chapter 4).
Instead, fluorescence was clearly detectable surrounding the chloroplasts (Fig. 5-6 E
and H).
5.2.6.3. Subcellular distribution of 14-3-3 dimers in epidermal cells of
rosette leaves
The positive GFP control showed fluorescence in both the cytoplasm and the
nuclei of epidermal cells of rosette leaves of transgenic plants, with strong intensity in
the nuclei (Fig. 5-7 A-C).
Distribution of mu-YC/chi-YN, epsilon-YN/mu-YC and mu-YN/mu-YC dimerisation
was analysed in rosette leaves of transgenic Arabidopsis plants as well. As shown in
Fig. 5-7, both the mu-YC/chi-YN and epsilon-YN/mu-YC heterodimers were detectable
by BiFC fluorescence in the nuclei and cytosol (Fig. 5-7 D-F and G-I, respectively). In
contrast, mu homodimers (mu-YN/mu-YC) were detectable in the cytoplasm but not
in nuclei of the epidermal cells (Fig. 5-7 J-L). None of the three 14-3-3 dimers
Fig. 5-7. Subcellular localisation of 14-3-3-BiFC dimers in abaxial epidermal cells of rosetteleaves of double transgenic Arabidopsis seedlings.
Shown are confocal images of single optical sections through abaxial epidermal cells of rosetteleaves of nine to twelve day-old transgenic seedlings expressing GFP or two 14-3-3 BiFCconstructs (A, D, G and J), merged images of GFP/YFP confocal images with chlorophyllautofluorescence (B, E, H and K) and bright field images of the respective epidermal cells (C, F, Iand L). Scale bars = 50 μm.(A-C) GFP fluorescence was detected in nuclei (arrowheads) and in the cytoplasm of epidermalcells and was weak or absent from chloroplasts.(D-I) YFP fluorescence, indicating the presence of epsilon-YN/mu-YC (D-F) or mu-YC/chi-YN (G-I)heterodimers in epidermal cells, was observed in the nuclei (arrowheads) and cytoplasm butwas weak or absent from chloroplasts.(J-L) YFP fluorescence, indicating the presence of mu-YN/mu-YC homodimers in epidermal cells,was strong in the cytoplasm, but very weak or absent from nuclei and chloroplasts.
A
D
G
J
GFP/YFP Bright fieldMerged with Chl
GFP
mu-YC/chi-YN
epsilon-YN/mu-YC
mu-YN/mu-YC
B C
E F
H I
K L
Chapter 5. Analysis of 14-3-3 dimerisatons in transgenic Arabidopsis plants 149
Chapter 5. Analysis of 14-3-3 dimerisatons in transgenic Arabidopsis plants 150
appeared to localise to chloroplasts, which was consistent with the observations
made using guard cells (Fig. 5-6).
5.2.6.4. Distribution of 14-3-3 epsilon-YN/mu-YC dimer in flower tissues
The meta-profile analysis by Genevestigator indicating that 14-3-3 mu and
epsilon are expressed in flowers (Fig. 5-1) led to the decision to examine BiFC
fluorescence of 14-3-3 epsilon-YN/mu-YC dimers in flowers using conventional
fluorescence microscopy (Fig. 5-8). Analysis of negative control plants containing
only one 14-3-3 BiFC construct (14-3-3 phi-YC), which is unable to reconstitute a
functional YFP indicated strong autofluorescence in anthers (Fig. 5-8 B). Thus
anthers were excluded from observations described here.
Apart from anthers, fluorescence in the sepals, petals, stigma and in stamen
filaments confirmed that epsilon and mu, when co-expressed in flowers, are able to
dimerise with each other (Fig. 5-8 A). In sepals, petals and the stamen filaments,
fluorescence was prominent in the vascular tissues (Fig. 5-8 A, arrowheads).
5.3. Discussion
5.3.1. BiFC fluorescence in transgenic plants may reflect endogenous 14-3-3
dimerisations
Three sets of double transgenic 14-3-3 BiFC Arabidopsis plants,
epsilon-YN/mu-YC, mu-YC/chi-YN and mu-YN/mu-YC, were generated during this study.
It was foreseeable that the 14-3-3 BiFC constructs, driven by constitutive CaMV 35S
promoter, must be constitutively and ubiquitously expressed in the transgenic
Arabidopsis plants. On the other hand, Genevestigator microarray data (Fig. 5-1) and
reported transcript analyses (Section 5.1.2) indicated that a minimum of eight 14-3-3
isoforms (including epsilon and mu) are constitutively and ubiquitously expressed
Chapter 5. Analysis of 14-3-3 dimerisatons in transgenic Arabidopsis plants 151
Fig. 5-8. Distribution of epsilon-YN/mu-YC heterodimers in floral tissues of a doubletransgenic Arabidopsis plant.
This figure shows images obtained by conventional fluorescence microscopy through the GFPfilter set (left panel), the FITC filter set (middle panel) and bright field (right panel) of a doubletransgenic 14-3-3 epsilon-YN/mu-YC (Ag15-1 x Ag50-1, A) and a non-dimer forming, singletransgenic phi-YC control plant (Ag54-8, B). Fluorescence of 14-3-3 epsilon-YN/mu-YC wasdetected in most of the floral organs, including sepals (S), petals (P), stigma (St), carpel (C), andstamen filaments (F). Strong signals were observed in the vascular tissue of sepals, petals andstamen filaments (arrowheads). When these fluorescent signals were compared to the phi-YCcontrol plant (B), it became obvious that fluorescence in anthers (An) is, at least partially, dueto autofluorescence under the applied microscopic condition. Note, the white dotted linesshown in the left two panels outline partial margins of petals and sepals. Scale bars = 0.5 mm.
GFP filter Bright fieldFITC filter
A
B
epsilon-YN/mu-YC
phi-YC
St
An
P
S
C
F
C
S
PAn
F
St
Chapter 5. Analysis of 14-3-3 dimerisatons in transgenic Arabidopsis plants 152
and hence in most cell types will be co-expressed in a wt plant (Fig. 5-1). This leads
to the hypothesis that a number of native 14-3-3s, including the chi, epsilon and mu
analysed here, can be concurrently found across organs, tissues and cells. Thus,
combining 14-3-3 BiFC constructs under the regulatory control of the CaMV35S
promoter, although not identical to endogenous regulation, should not provide an
artificial situation with respect to protein expression and appeared suitable for an
initial dimerisation analysis. However, differences in expression levels between
native promoter and CaMV 35S promoter regulated expression of 14-3-3s as well as
addition of 14-3-3 expression on top of the native expression must be taken into
account when interpreting data. The BiFC fluorescence detected in the three sets of
double transgenic plants may be very close to the native situation for the three
respective 14-3-3 dimerisations: the heterodimers epsilon-mu and chi-mu and the mu
homodimer. Future experiments could be performed replacing the CaMV promoter
with endogenous 14-3-3 promoters and transformation of 14-3-3 knock-out lines to
ensure even closer resemblance to the native situation.
5.3.2. Visualising 14-3-3 dimerisations in a whole plant context
BiFC fluorescence was ubiquitously detectable in the three sets of double
transgenic 14-3-3 BiFC Arabidopsis plants (Figs. 5-3 to 5-8 and data not shown),
reflecting the fact that the three 14-3-3 dimerisations are able to occur across tissues.
Intriguingly, strong fluorescent signals of all the three 14-3-3 dimeric combinations
were observed in most of the root with the exception of the meristematic and
elongation zones of primary roots of seedlings (Fig. 5-4 and data not shown). In
these zones fluorescence was very weak or absent, possibly indicating a lack or low
concentrations of the 14-3-3-BiFC dimer molecules (Fig. 5-4).
Chapter 5. Analysis of 14-3-3 dimerisatons in transgenic Arabidopsis plants 153
BiFC fluorescence was compared to fluorescence due to a GFP construct
(pCAMBIA1302) expressed under the control of the CaMV 35S promoter. This
construct was clearly expressed in the meristematic and elongation zones of primary
roots as indicated by strong GFP fluorescence (Fig. 5-4 B-D). It was assumed that
expression patterns of the driven genes should be identical. However, when the
nucleotide sequences of 35S promoters used for the 14-3-3 BiFC constructs and the
GFP control were compared, it was found that they share ca. 600 bp identical
nucleotide sequences but that the promoter used in BiFC constructs was
approximately 200 bp longer (data not shown). It is unclear at this stage whether
region missing in the GFP linked 35S promoter contains repressive elements
preventing expression of 14-3-3 constructs in the meristematic and elongation zones
of roots. If this is not the case, then any difference in fluorescence distribution
between GFP and 14-3-3 BiFC in such zones may be not due to transcription level of
transgene expression but may indicate functional or biological impacts of cells on
14-3-3-BiFC dimer formation. The lack or low fluorescence may indicate that the
investigated 14-3-3s fail to dimerise in these areas or that post-transcriptional or
post-translational events prevent formation of the fusion proteins.
Expression of the 14-3-3- split YFP fusion proteins in such zones could be
verified by immunohistochemical analysis or by performing a western blot analysis on
proteins extracted from these zones using antibodies specific to the peptide tags
included in the fusion proteins. If protein expression could be confirmed, it would
be worthwhile investigating whether the 14-3-3 fusion proteins bind to target proteins
that modify the 14-3-3s or that prevent reconstitution of the split YFP fusion proteins
or even hinder 14-3-3 dimerisation. Protein pull-down assays have the potential to
demonstrate if the 14-3-3 fusion proteins bind to any target proteins in the tissue that
did not show BiFC fluorescence. A prevention of dimerisation in those root cells is
Chapter 5. Analysis of 14-3-3 dimerisatons in transgenic Arabidopsis plants 154
further supported as in all other tissues, fluorescence patterns of GFP and 14-3-3-BiFC
dimers appeared identical although their expressions were under the control of the
two 35S promoter variants.
Strong BiFC signals were detected in root caps and root steles for the three
dimer combinations tested (Figs. 5-3 and 5-4). This hinted that 14-3-3s play a role in
these tissues. Again, as the BiFC accumulation profiles of 14-3-3 dimers in these
tissues may only reflect the 35S promoter activity, further work should be performed
to verify this by replacing the 35S promoter with endogenous 14-3-3 promoters for
the BiFC analysis of 14-3-3 dimerisations.
5.3.3. Subcellular distribution of 14-3-3 dimer was somewhat
dimer-dependent in some tissues
On the subcellular level, localisation of 14-3-3 dimers appeared to be somewhat
dimer-dependent (Figs. 5-5 to 5-7). In epidermal cells of rosette leaves, the
epsilonYN/mu-YC dimer, as well as the mu-YC/chi-YN dimer, was found in both the
nucleus and cytoplasm (Fig. 5-7). In contrast, the mu-YN/mu-YC dimer localised
restrictedly to the cytoplasm, although nuclear staining such as DAPI stainingis
needed to confirm the nuclear position. Similar distributional differences for the
three 14-3-3 dimers were also observed in the seedling root cells and cotyledon guard
cells (Figs. 5-5 and 5-6, and data not shown). The distributional differences
suggested that the mu homodimer might play a role different from the heterodimers
epsilon-mu or chi-mu in these cells. One explanation for this is such dimers may
bind to different target proteins with different subcellular localisation as 14-3-3
localisation is postulated to be driven by client interactions (Paul et al., 2005).
Intriguingly, previous work has demonstrated Arabidopsis HD2C is able to interact
with several 14-3-3 isoforms, including chi, epsilon and mu, in the transiently
Chapter 5. Analysis of 14-3-3 dimerisatons in transgenic Arabidopsis plants 155
transformed Nicotiana leaves (Fig. 4-7). The HD2C-14-3-3 interactions localised
exclusively to the nucleus and prominently to the nucleolus (Fig. 4-7), demonstrating
the ability of HD2C to recruit 14-3-3 dimers, including the mu homodimer, into the
nucleus. Hence the absence of mu homodimeric BiFC from the nucleus of leaf
epidermal cells in transgenic Arabidopsis plants is contradictory to a possible
consequence of nuclear recruitment of 14-3-3 dimers by target proteins, at least by
endogenous HD2C, and therefore needs to be further investigated.
In contrast to the distributional differences detected in Arabidopsis leaf cells (Fig.
5-7), the three 14-3-3 dimers displayed similar localisation patterns in transiently
transformed Nicotiana leaf cells. In Nicotiana, the three 14-3-3 dimers all appeared
in nuclear localisation Patterns 1 or 2 (Figs. 4-1 and 4-5, Tables 4-2), i.e. stronger
fluorescence intensity in the nucleus than in the cytosol (Pattern 1) or similar intensity
in the nucleus and in the cytosol (Pattern 2). In leaf epidermal cells of stably
transformed Arabidopsis plants, however, nuclear BiFC signals were detected for both
the epsilon-mu and chi-mu dimers but not for the mu homodimer (Fig. 5-7).
Additionally, the fluorescent signals for both epsilon-mu and chi-mu dimers were
stronger in the cytosol than in the nuclei when observed by eye, thus neither
resembling Patterns 1 or 2 but instead Pattern 3 as previously defined in the Nicotiana
system (Chapter 4). From the results presented in this chapter, the outcomes of BiFC
performance of a given 14-3-3 dimer in the transient Nicotiana system were not
completely consistent with those from the Arabidopsis system. This supports a
common notion that functional analysis of a protein of interest in a heterologous
system should be eventually verified in the homologous system.
Chapter 6. Cell death induced aggregation and ER association of 14-3-3 dimers 156
Chapter 6
Cell Death Induced Aggregation
and ER Association of 14-3-3
Dimers
Chapter 6. Cell death induced aggregation and ER association of 14-3-3 dimers 157
6.1. Introduction
When analysing the intracellular distribution of 14-3-3 dimers in epidermal cells
of transiently transformed Nicotiana leaves, a novel pattern was discovered during
this project (Pattern 4, chapter 4). This pattern, distinguished by small fluorescent
bodies, was detected for a number of 14-3-3 combinations but only observed
occasionally (Chapter 4, Table 4-3). The size and shape of these fluorescent bodies
were taken as an indication of organelle localisation of 14-3-3 dimers but may also
indicate aggregates of 14-3-3 proteins into protein bodies. As outlined in Section
1.6.2 (Chapter 1), 14-3-3 proteins were previously identified in chloroplasts (May and
Soll, 2000; Sehnke et al., 2000; Bunney et al., 2001) and mitochondria (Bunney et al.,
2001). Additionally, the Arabidopsis 14-3-3 isoforms lambda, mu, omega and psi
were identified in the proteome of peroxisomes (Table 4-1; Reumann et al., 2009).
Observations during this project could not confirm the presence of 14-3-3 dimers in
chloroplasts (Sections 3.2.7 and 4.2.3.2). This leaves mitochondria, peroxisomes, ER
or the Golgi as putative subcellular localisation of 14-3-3 dimers giving rise to the
novel distribution pattern.
The first aim of the work presented in this chapter was to determine if the novel
distribution pattern of 14-3-3 fluorescent bodies could be correlated with one of
these organelles (Section 6.2.1).
The fluorescent bodies observed upon 14-3-3 dimerisation appeared in cells
after performing epidermal peels and were rarely detected in intact leaf samples.
This suggested that a factor associated with the preparation of the peels, i.e.
wounding and possible cell death could induce this novel pattern. In animals,
14-3-3s are known as regulators of apoptosis (Fu et al., 2000; van Hemert et al., 2001;
Rosenquist, 2003). As in animals, regulated cell death is an essential process
occurring during plant development and when plants face stresses (reviewed in
Chapter 6. Cell death induced aggregation and ER association of 14-3-3 dimers 158
Pennell and Lamb, 1997; Beers and McDowell, 2001; Jones, 2001; Lam, 2004). The
lack of plant homologues of animal apoptotic proteins suggests that plants may
employ a different regulatory mechanism for cell death than animals. It is well
established that transcription of plant 14-3-3 genes can be induced by some plant
pathogens and stress conditions (Roberts and Bowles, 1999; Lapointe et al., 2001;
Chen et al., 2006). However, an involvement of 14-3-3s in plant cell death is still not
clear (Rosenquist, 2003).
Two of the well-characterised examples of plant cell death are the development
of xylem elements and the hypersensitive response to pathogen attack (Lam, 2004).
Reactive oxygen species, such as hydrogen peroxide (H2O2), and stress hormones,
such as methyl jasmonate (MeJA), act as key signal molecules and/or effectors of the
cell death process (Beers and McDowell, 2001; Overmyer et al., 2003). Both
substrates were extensively used to trigger cell death in plant protoplast/cell culture
systems (Desikan et al., 1998; McCabe and Leaver, 2000; Houot et al., 2001; Paul and
Russell, 2001; Zhang and Xing, 2008).
The second aim of the work presented here was to investigate whether pattern
4 can also be induced in Arabidopsis thaliana and if cell death inducing conditions
other than wound induction can trigger this pattern. Double transgenic Arabidopsis
plants expressing two 14-3-3 BiFC constructs (Chapter 5) were used for these
investigations. Mesophyll protoplasts isolated from these Arabidopsis plants were
treated with exogenously applied H2O2 or MeJA and analysed for 14-3-3 dimer
patterns.
Thus, aims of the work presented in this chapter were:
(1) to determine if the novel distribution pattern of 14-3-3 fluorescent bodies were
correlated with intracellular organelles.
Chapter 6. Cell death induced aggregation and ER association of 14-3-3 dimers 159
(2) To investigate whether the novel pattern of 14-3-3 dimers can also be induced by
cell death inducing conditions in Arabidopsis thaliana.
6.2. Results
6.2.1. Co-localisation of 14-3-3 dimers with fluorescent ER and Golgi
markers
Organelle-specific fluorescence dyes, such as MitoTracker® Red CMXRos
(Molecular Probes, Invitrogen) and ER-Tracker™ Blue-White DPX (Molecular Probes,
Invitrogen) were used to investigate if the fluorescent 14-3-3 BiFC bodies co-localise
with these organelles in epidermal peels of transiently transformed Nicotiana leaves.
Epidermal cells were examined for Pattern 4 by conventional fluorescence microscopy
(Section 2.5.1) and then stained with MitoTracker or ER-Tracker as per manufacturer’s
instruction. Dye concentrations up to the maximum recommended concentration (1
μM) for live cell staining were used, with staining times of up to one hour. However,
in all experiments, staining of individual organelles was unsuccessful and this
approach was consequently aborted (data not shown).
A second approach made use of co-expression of fluorescent proteins fused to
organelle targeting signals, which directed the fluorescent protein into specific
organelles. Co-localisation of BiFC fluorescence with that of the labelled protein
markers would indicate that 14-3-3 dimers were associated with a particular
organelle.
A peroxisomal targeted mRFP (Pracharoenwattana et al., 2005) and
mitochondrial, ER or Golgi targeted mCherry constructs (Nelson et al., 2007) were
chosen for the co-localisation analysis and allowed differentiation between the red
fluorescence of the organelle targeted markers and the yellow-green fluorescence of
14-3-3-BiFC complexes (Materials and Methods, Section 2.1.2.4). The organelle
Chapter 6. Cell death induced aggregation and ER association of 14-3-3 dimers 160
marker genes were expressed under the control of a double 35S promoter
(Pracharoenwattana et al., 2005; Nelson et al., 2007) .
To allow for delivery into plant cells, plasmids containing the organelle marker
proteins were individually transformed into the same Agrobacterium strain (GV3101)
used for delivering 14-3-3-BiFC constructs into Nicotiana leaf cells (Section 2.3.4).
For co-localisation experiments, four Agrobacteria strains were co-injected into
Nicotiana leaves, one containing the organelle marker protein gene, one for each of
the two (YN and YC) 14-3-3 BiFC constructs and a fourth strain harbouring the p19
plasmid (Section 2.4.4). To identify the subcellular localisation observed as Pattern 4,
this work focussed on the 14-3-3 mu-epsilon heterodimer (mu-YN/epsilon-YC)
because Pattern 4 was more frequently observed with this dimer than with any of the
other 14-3-3 combinations (data not shown). Initially Nicotiana leaves were
infiltrated with a suspension mixture containing the four Agrobacterium strains in a
1:1:1:1 volume ratio. This resulted in very strong red fluorescence from the
expressed mCherry- or mRFP-tagged markers, impeding detection of BiFC
fluorescence caused by 14-3-3 dimerisation (data not shown). This may have been
due to higher marker protein expression as these were under the control of a double
35S promoter whilst 14-3-3 BiFC constructs were under the control of a single 35S
promoter. To overcome this problem, the amount of the marker-carrying
Agrobacterium strain in infiltration mixes was reduced 90% (i.e. to an 1:1:1:0.1
volume ratio). This led to the desired effect of lower marker expression and easier
detection of BiFC fluorescence, but also lowered the number of marker protein
expressing cells, a disadvantage which was accepted as co-localisation could be
investigated by observing a greater cell number.
To improve image resolution and to achieve easier comparison of organelle
marker and 14-3-3 dimer localisation, epifluorescence images were deconvolved using
Chapter 6. Cell death induced aggregation and ER association of 14-3-3 dimers 161
Huygens Essential software (version 3.4, Scientific Volume Imaging B.V., The
Netherlands; http://www.svi.nl/). For comparison, the original and deconvolved
images are shown (Figs. 6-1, 6-3 and 6-4).
As described before (Chapter 4), the frequency of cells with Pattern 4 was very
low, between 1% and 3.3% cells. The low number of cells expressing the organelle
markers and the low frequency of Pattern 4 cells led, in most cases, to small numbers
of cells expressing the two together. Thus, the following results are based on small
numbers of cells, which needs to be taken into account when interpreting results.
a) Fluorescent bodies of mu-epsilon dimer were absent from
mitochondria
Only a small number of cells showed fluorescence of the mitochondrial marker
protein and 14-3-3 BiFC, and most demonstrated the 14-3-3 pattern previously
characterised as Pattern 2, i.e. 14-3-3 BiFC complex mediated fluorescence was found
evenly distributed between the cytosol and the nucleus (Chapter 4). In all cells
expressing the mitochondrial marker (transit peptide of ScCOX4 fused to mCherry;
Nelson et al., 2007), mitochondria appeared as small, red fluorescent bodies (Fig. 6-1
C and F), which localised to small, dark areas observed using the GFP filter set (Fig 6-1
A and D, position of dark areas indicated by arrowheads). BiFC fluorescence
indicating localisation of 14-3-3 mu-epsilon dimers was observed in the cytosol and in
a small number of cells with Pattern 4 in small vesicular structures (Fig. 6-1 A and D).
14-3-3 mediated BiFC fluorescence never co-localised with labelled mitochondria (Fig.
6-1 B and E). The different localisations of mCherry and BiFC labels were already
visible in non-deconvolved images (Fig. 6-1 B) but became much clearer after
deconvolution (Fig. 6-1 E). The results clearly demonstrated that 14-3-3 mu-epsilon
heterodimers were absent from mitochondria and that the punctate 14-3-3 BiFC
fluorescence described as Pattern 4 was in a different subcellular location.
Chapter 6. Cell death induced aggregation and ER association of 14-3-3 dimers 162
Fig. 6-1. Co-localisation analysis of 14-3-3 mu-epsilon heterodimeric BiFC complexes and amCherry-tagged mitochondrial marker in Nicotiana leaf epidermal cells.
N. benthamiana leaves were transiently co-transformed with an Agrobacterium mix containingbacteria harboring either 14-3-3 epsilon-YC, 14-3-3 mu-YN, p19 or an mCherry taggedmitochondrial marker gene. Figures A-C: four days after injection, leaves were analysed usingconventional fluorescence microscopy for expression and localisation of reconstituted YFP bydimerisation of mu-YN and epsilon-YC (A, green fluorescence) and the mitochondrial marker (C,red fluorescence). An overlay of A and C is shown in B. Figures D-F: the original epifluorescenceimages were deconvolved using Huygens Essential software to exclude out-of-focus information(Section 2.5.3). Using an RFP filter set, mitochondria were visible as small, red labeled, round tooval organelles which appeared as dark shadows under a GFP filter (arrowheads). In eachmicrograph, an area containing mitochondria and 14-3-3 dimers is shown enlarged (1.5x) forbetter resolution. The figures clearly showed that 14-3-3 BiFC dimers did not co-localise withmitochondria. Scale bars =10 μm.
GFP filter RFP filterMerged
Original
Deconvolved
A B C
D E F
Chapter 6. Cell death induced aggregation and ER association of 14-3-3 dimers 163
b) Co-localisation analysis of fluorescent bodies of mu-epsilon dimer
and peroxisomes was inconclusive
Using the RFP-tagged peroxisomal marker (mRFP-PTS1; Pracharoenwattana et
al., 2005), peroxisomes were clearly visualised as round structures of similar size
(about 1.5 μm in diameter), widely distributed in transformed epidermal cells (Fig. 6-2
C). None of the cells investigated concurrently showed labelled peroxisomes and
BiFC fluorescent bodies in Pattern 4 of the mu-epsilon dimer. Instead, co-expressing
cells demonstrated Pattern 2 (Fig. 6-2 A). In such cells the peroxisomal marker and
14-3-3 dimers were not co-localised (Fig. 6-2 B). Thus, the results of investigating
14-3-3 dimers and labelled peroxisomes for co-localisation remained inconclusive.
Fig. 6-2. Co-localisation analysis of 14-3-3 mu-epsilon-BiFC complexes and a peroxisomal
mRFP marker in Nicotiana leaf epidermal cells.
Nicotiana leaves were transiently transformed with an Agrobacterium mix, as described in the
legend to Fig. 6-1, except a peroxisomal marker gene (mRFP-PTS1) replaced the mitochondrial
marker gene. Fluorescence in the transformed leaf epidermal cells was analysed four days
after injection as described (Fig. 6-1). Shown are images obtained for reconstituted YFP by
dimerisation of mu-YN and epsilon-YC (A, green fluorescence) and the peroxisomal marker (C,
red fluorescence). Overlay of GFP and RFP images (GFP/RFP) is shown in B and the merged
image of RFP and bright field (BF) is shown in C (RFP/BF). In the cell with a BiFC Pattern 2 (A),
14-3-3 mu-epsilon dimer did not co-localise with the peroxisome marker. None of the cells
investigated concurrently showed labelled peroxisomes and BiFC punctate bodies (Pattern 4)
of the mu-epsilon dimer. N, nucleus. Scale bars = 50 μm.
Chapter 6. Cell death induced aggregation and ER association of 14-3-3 dimers 164
c) Fluorescent bodies of mu-epsilon dimer sometimes co-localise
with Golgi bodies
The expressed mCherry-Golgi marker (GmMan1-mCherry; Nelson et al., 2007)
localised to a large number of small, nearly round structures in transformed epidermal
cells (Fig. 6-3 C, F, I and L). As described for mitochondrial and peroxisomal marker
experiments, most of the cells showing concurrent BiFC fluorescence and red marker
protein fluorescence did not show the 14-3-3 Pattern 4, but instead 14-3-3 Pattern 2
(Fig. 6-3 A). In cells that did show 14-3-3 Pattern 4 and fluorescence of the Golgi
marker protein (Fig. 6-3 H and K), punctate BiFC fluorescence and red Golgi marker
fluorescence only partially co-localised (Fig. 6-3 K, overlap of fluorescence is indicated
by arrowheads).
d) Fluorescent bodies of mu-epsilon dimer co-localised partially
with ER-derivative structures
The ER can appear in at least two distinguishable conformations, reticular,
network like structures and vesicular structures. The reticular ER architecture was
easily detectable in epidermal cells of leaf discs from non-peeled Nicotiana leaves
transiently transformed with the ER-mCherry marker (signal peptide of
AtWAK2-mCherry-HDEL; Nelson et al., 2007; Fig. 6-4 C and F and Fig. 6-5). Within
such cells, BiFC fluorescence of 14-3-3 dimers localised within or associated with the
reticular structure as indicated by weak fluorescence (Fig. 6-4 A and B). Much
stronger BiFC fluorescence was observed in ’nodes‘ of the mCherry-labelled ER
network architecture (Fig. 6-4 B and E).
Fig. 6-3. Co-localisation analysis of 14-3-3 mu-epsilon heterodimeric BiFC complexes and amCherry-tagged Golgi marker in Nicotiana leaf epidermal cells.
Nicotiana leaves were transiently transformed with an Agrobacterium mix as described in thelegend to Fig. 6-1, except that a Golgi marker gene (GmMan1-mCherry) replaced themitochondrial marker gene. Fluorescence in the transformed leaf epidermal cells was analysed4 days after injection as described (Fig. 6-1). Shown are images obtained for reconstituted YFPby dimerisation of mu-YN and epsilon-YC (A and G, green fluorescence) and the Golgi marker (Cand I, red fluorescence). B shows the overlay of A and C and H shows the overlay of G and I.Figures D to F and J to L are deconvolved images of A to C and G to I, respectively. In cells withthe BiFC Pattern 2 (A to F), 14-3-3 mu-epsilon dimer did not co-localise with the Golgi marker.In contrast, the BiFC punctate bodies (Pattern 4) appeared to co-localise with some but not allstructures labelled by the Golgi marker (G to L, arrowheads). N, nucleus. Scale bars = 10 μm.
A
Original
Deconvolved
Original
Deconvolved
B C
D E F
G H I
J K L
N
Chapter 6. Cell death induced aggregation and ER association of 14-3-3 dimers 165
Chapter 6. Cell death induced aggregation and ER association of 14-3-3 dimers 166
Fig. 6-4. Co-localisation analysis of 14-3-3 mu-epsilon heterodimeric BiFC complexes and amCherry-tagged ER marker in Nicotiana leaf epidermal cells.
Nicotiana leaves were transiently transformed with an Agrobacterium mix, as described in thelegend to Fig. 6-1, except that an ER marker gene (signal peptide of AtWAK2-mCherry-HDEL)replaced the mitochondrial marker gene. Fluorescence in the transformed leaf epidermal cellswas analysed 4 days after injection as described (Fig. 6-1). Shown are images obtained forreconstituted YFP by dimerisation of mu-YN and epsilon-YC (A and G, green fluorescence) andthe ER marker (C and I, red fluorescence) in intact epidermal leaf discs (A to F) and in peeledepidermal cells (G to L). Overlays of A and C and G and I are shown in B and H, respectively.Figures D to F and J to L are deconvolved images of A to C and G to I, respectively. In epidermalcells of leaf discs, the ER-marker labeled a reticular architecture (C and F). 14-3-3 BiFCfluorescence was detected in discrete spots along this network (B and E, arrowheads). In peeledepidermal cells, BiFC fluorescence and mCherry fluorescence were closely associated.Unlabeled dark spots in G and J matched the ER marker labeled vesicular structures (compare Gand J with I and L), which were connected by a BiFC labeled network structure (H and K). Insetsin G-L (top, right): magnification (1.5x zoom) of the selected regions shown in G and J. Scalebars= 10 μm.
GFP filter RFP filterMerged
G
Original
Deconvolved
H I
K LJ
Original
Deconvolved
B CA
E FD
Chapter 6. Cell death induced aggregation and ER association of 14-3-3 dimers 167
Better resolution of the ER network architecture was achieved by making a
composite image from a series of optical sections obtained by CLSM (Fig. 6-5 B). The
cell co-expressed the 14-3-3 mu-epsilon BiFC constructs in a network-like distribution
(Fig. 6-5 A). The identical localisation of 14-3-3 BiFC fluorescence and ER-mCherry
marker confirmed that 14-3-3 mu-epsilon dimers co-localised with the ER (Fig. 6-5 C).
In peeled epidermal cells, the ER-mCherry marker appeared in vesicle-like
structures (Fig. 6-4 I and L), and it was difficult to determine whether the ER marker
also labelled an ER network structure (Fig. 6-4 I). However, the absence of a
network-like structure in the deconvolved images suggested that the ER had
disintegrated into vesicular structures (Fig. 6-4 L). In Fig. 6-4 J-L BiFC fluorescence of
the 14-3-3 mu-epsilon dimer was clustered or associated with the red
fluorescence-labelled ER vesicular structures (Fig. 6-4 H and K).
In conclusion, the results of these analyses indicated that the 14-3-3 mu-epsilon
dimer did co-localise or associate with the ER. Some association was also observed
with the Golgi apparatus, but was completely absent from mitochondria. Small
vesicular structures appearing in leaf epidermal peels were shown to be of ER origin.
The ER derived vesicles were closely associated with 14-3-3 BiFC fluorescence as
observed in 14-3-3 Pattern 4.
6.2.2. Chemical cell death inducers and wounding trigger changes of
subcellular localisation of 14-3-3 dimers in transgenic Arabidopsis
The analysis of 14-3-3 dimerisation Pattern 4 in transiently transformed
Nicotiana cells was useful in revealing co-localisation of 14-3-3s with the ER.
However, as the 14-3-3 proteins are from Arabidopsis, Nicotiana is a heterologous
plant system. To investigate whether ER localisation can be observed in the
homologous Arabidopsis system, and to test conditions leading to cell death as
Chapter 6. Cell death induced aggregation and ER association of 14-3-3 dimers 168
Fig. 6-5. Confocal image analysis of 14-3-3 mu-YN/epsilon-YC BiFC complexes and the ERmarker in transiently transformed Nicotiana leaf cells.
Confocal images were captured from cells co-transformed with 14-3-3 mu-YN/epsilon-YC BiFCconstructs and the ER targeting mCherry marker as described for Fig. 6-4.(A) A projection image of the YFP channel showed BiFC fluorescence indicative of 14-3-3 mu-epsilon dimerisation in the cytoplasm, the nucleus (N) and the ER.(B) A projection image of the mCherry channel showed the mCherry-labelled ER reticularstructure.(C) An overlay image of (A) and (B) demonstrated co-localisation of the BiFC and mCherryfluorescence, suggesting the 14-3-3 mu-epsilon dimer is associated with the ER.(D) A bright field image of the same field of view.Scale bars = 50 μm.
A B
C D
N
Chapter 6. Cell death induced aggregation and ER association of 14-3-3 dimers 169
possible inducers of Pattern 4, double transgenic Arabidopsis plants expressing two
14-3-3 BiFC constructs (Chapter 5) were used. These were the same double
transgenic plants previously used to study 14-3-3 dimerisation in Arabidopsis, namely
epsilon-YN/mu-YC, chi-YN/mu-YC and mu-YN/mu-YC (Table 5-6).
6.2.2.1. The subcellular distribution of 14-3-3 dimers changes in response to
wounding in cotyledon epidermal cells
Cotyledons of 12-day-old mu-YN/mu-YC transgenic seedlings were wounded by
squeezing the tissue with tweezers. Homodimerisation of 14-3-3 mu was observed,
using CLSM by monitoring BiFC fluorescence in cells at the wounded sites one hour
after the treatment. As controls, cotyledons of non-wounded 14-3-3 BiFC plants
(negative controls) and wounded cotyledons of CaMV 35S-GFP plants (fluorescence
control) were analysed in the same way.
In non-wounded cells, fluorescence of mu-YN/mu-YC BiFC dimers was found
throughout the cytoplasm (Fig. 6-6 A). In wounded cells, fluorescence of 14-3-3 mu
BiFC complexes was visible in a larger area surrounding the vacuole, possibly
indicating that the vacuole had shrunken and that the cytosol took up more of the
cellular space (Fig. 6-6 B). Accumulation of 14-3-3 mu dimers was clearly visible in
the form of small round bodies distributed throughout the cytosol and sometimes
associated with a network-like structure, possibly cytoplasmic strands (Fig. 6-6 B,
arrowheads). The small bodies were similar in appearance to the bodies and the
ER-associated pattern observed in transient BiFC assays of peeled epidermal
Nicotiana cells (Figs. 4-6, 6-4 and 6-5).
As with 14-3-3 BiFC fluorescence, GFP fluorescence was observed in the cytosol
of non-wounded cells (Fig. 6-6 C). In addition, GFP fluorescence was observed in
nuclei. Upon wounding, vacuolar shrinkage was reflected by an extended area
Chapter 6. Cell death induced aggregation and ER association of 14-3-3 dimers 170
Fig. 6-6. The subcellular distribution of 14-3-3-BiFC dimers changed upon wounding incotyledons of transgenic Arabidopsis seedlings.
Twelve-day-old cotyledons of transgenic Arabidopsis seedlings expressing 14-3-3 mu-YN/mu-YC(A and B) or GFP (C and D) were kept intact (A and C) or wounded by squeezing the tissues withtweezers tips (B and D) followed by confocal microscopy analysis one hour after treatments.Continuous, homogenous distribution of BiFC fluorescence was detected in the cytosol of non-wounded cells (A). In the wounded cells, the BiFC fluorescence of 14-3-3 mu homodimers wasvisible in a larger area surrounding the vacuole possibly indicating that the vacuole (V) hadshrunken and that the cytosol took up more of the cellular space (B). Accumulation of the 14-3-3 mu dimers was also clearly visible in form of small round bodies (arrowheads) distributedthroughout the cytosol and sometimes associated with a network-like structure, possiblycytoplasmic strands (B). GFP fluorescence was observed in both the cytosol and the nuclei ofnon-wounded cells (C). Upon wounding, vacuolar shrinkage was observable by an extendedarea showing GFP fluorescence (D). In contrast to 14-3-3 BiFC plants, wounding did not causethe formation of small fluorescent bodies in GFP plants. N, nucleus. Scale bars = 50 μm.
NN
C D
A B
Non-wounded Wounded
V
Chapter 6. Cell death induced aggregation and ER association of 14-3-3 dimers 171
showing GFP fluorescence (Fig. 6-6 D). In contrast to 14-3-3 BiFC plants, wounding
did not cause the formation of small fluorescent bodies in GFP plants. The results
suggested that the observed wound-induced aggregations of BiFC fluorescence in
cells was 14-3-3 specific under the conditions of the experiment.
6.2.2.2. Subcellular distribution of 14-3-3 dimers in mesophyll protoplasts
derived from double transgenic Arabidopsis plants
To test whether the observed subcellular localisation Pattern 4 of 14-3-3 dimers
is associated with cell death and can be induced, a protoplast system was employed.
This has the advantage that all cells will be equally exposed to the treatment (McCabe
and Leaver, 2000), which is not guaranteed in a tissue context.
Protoplasts were isolated from rosette leaves of three transgenic 14-3-3 BiFC
lines, epsilon-YN/mu-YC, chi-YN/mu-YC and mu-YN/mu-YC (Section 2.4.3). Before
commencing with treatments, a CLSM analysis was performed to identify the
localisation of 14-3-3 BiFC dimers in protoplasts of the three transgenic lines.
BiFC fluorescence, indicative of 14-3-3 dimerisation, was found in the cytosol and
nucleus of protoplasts expressing epsilon-YN/mu-YC or mu-YC/chi-YN dimers but was
absent from chloroplasts in both (Fig. 6-7 A-D). The dual localisation of these two
14-3-3 heterodimers in both the nucleus and cytosol was in agreement with earlier
observations of the two dimers in rosette leaf epidermal cells of transgenic
Arabidopsis plants (Fig 5-7 D-F and G-I). However, a higher level of nuclear
accumulations of the two dimers were observed in mesophyll protoplasts (Fig. 6-7 A-D)
than those in leaf epidermal cells (Fig. 5-7 D-I).
Fluorescence of the mu-YN/mu-YC homodimer was also observed in the cytosol
and in the nuclei of mesophyll protoplasts (Fig. 6-7 E-F). This observation differed
from those made for this dimer in leaves in that nuclear localisation was not detected
Chapter 6. Cell death induced aggregation and ER association of 14-3-3 dimers 172
Fig. 6-7. Subcellular localisation of 14-3-3 dimers as detected by BiFC fluorescence in rosetteleaf protoplasts derived from transgenic Arabidopsis plants.
Mesophyll protoplasts were obtained from rosette leaves of transgenic Arabidopsis plantsexpressing the following 14-3-3 BiFC dimer constructs: epsilon-YN/mu-YC (A-B), mu-YC/chi-YN(C-D) and mu-YN/mu-YC (E-F). A, C and E show single optical sections and B, D and F showprojection images of several serial optical sections. The panels from left to right show: YFPfluorescence (YFP), chlorophyll autofluorescence (Chl), merged images of YFP and Chl (YFP/Chl)and the overlay of YFP/Chl and a bright field image (YFP/Chl/BF).Dual localisation of BiFC fluorescence in both cytosol and the nucleus (N) was observed for allthe three 14-3-3 dimeric combinations. In contrast, BiFC fluorescence was not observed inchloroplasts for either epsilon-YN/mu-YC (A-B) or chi-YN/mu-YC (C-D), but was detected inchloroplasts for mu-YN/mu-YC dimer (E-F). Scale bars = 10 μm.
N
E
F
YFP YFP/ChlChl YFP/Chl/BF
N
N
C
D
mu-YN/mu-YC
N
N
A
B
N
mu-YC/chi-YN
epsilon-YN/mu-YC
Chapter 6. Cell death induced aggregation and ER association of 14-3-3 dimers 173
in Arabidopsis leaf epidermal cells (Fig. 5-7 J-L). On the other hand, this dimer was
shown to localise to nuclei when analysed in transiently transformed Nicotiana leaves
(Chapter 4). In addition to nuclear and cytosolic localisation, this dimer was also
detectable in chloroplasts (Fig. 6-7 E-F). Again, this was in contrast to previous
observations made using leaves of transgenic Arabidopsis plants (Fig. 5-7 J-L) and
transiently transformed Nicotiana leaves (Sectioin 4.2.3.2), where this dimer appeared
absent from chloroplasts. Overall, with the exception of chloroplastic localisation of
the mu homodimer, localisation of 14-3-3 dimers in protoplasts agreed well with
localisation observed in leaves of transgenic Arabidopsis plants and transiently
transformed Nicotiana leaves.
6.2.2.3. Hydrogen peroxide treatment induces the novel subcellular
localisation of 14-3-3 dimers
Hydrogen peroxide was shown in a number of experiments to induce plant cell
death (Desikan et al., 1998; McCabe and Leaver, 2000; Houot et al., 2001; Paul and
Russell, 2001). Hence, H2O2 was used in the pilot study of testing the impact of
induced cell death on the distribution of 14-3-3 dimers (Section 2.4.10.1).
Treatment of GFP-expressing and 14-3-3 dimeric BiFC presenting protoplasts
with H2O2 for 24 h caused a dramatic loss of fluorescence in almost all protoplasts and
disintegration of cellular integrity regardless of the H2O2 concentration used (data not
shown). In contrast, most GFP-expressing and 14-3-3-BiFC protoplasts from the
non-H2O2-treated control (mock treatment) remained fluorescent and structurally
intact after 24 h incubation (data not shown). When incubated in the presence of
0.2 mM H2O2 for 12 h, a significant number of GFP-expressing and 14-3-3 protoplasts
had lost fluorescence and cellular integrity (data not shown); however, a sufficient
number remained intact for analysis. Protoplasts expressing 14-3-3
epsilon-YN/mu-YC BiFC dimers showed the formation of small, round, fluorescent
Chapter 6. Cell death induced aggregation and ER association of 14-3-3 dimers 174
structures (Fig. 6-8) resembling those previously observed for 14-3-3 BiFC Pattern 4 in
transiently transformed Nicotiana epidermal peels (Figs. 4-6, 6-1, 6-3 and 6-4). In
contrast, no significant change of fluorescence patterns was observed in the
protoplasts expressing either chi-YN/mu-YC mu-YN/mu-YC or GFP when treated with
H2O2 (Fig. 6-8 and data not shown).
6.2.2.4. Methyl jasmonate treatment induces the novel subcellular
localisation of 14-3-3 dimers
The plant hormone MeJA is another widely used inducer of plant cell death
(Asai et al., 2000; Repka et al., 2004; Zhang and Xing, 2008). It was decided to test if
the novel distribution pattern of aggregates of 14-3-3 dimers was inducible by
exogenous MeJA.
Most 14-3-3 dimeric BiFC presenting protoplasts did not display significant
changes in the subcellular distribution of fluorescence when treated with MeJA (Fig.
6-9 and data not shown). The exception was a small number (ca. 1%) of
epsilon-YN/mu-YC protoplasts treated with 50 μM MeJA which displayed fluorescent
bodies (Fig. 6-9) similar to those observed as Pattern 4 (Fig. 4-6) and in hydrogen
peroxide treatments (Fig. 6-8 and data not shown). Such bodies did not appear in
mock-treated controls for the epsilon-YN/mu-YC protoplasts nor in the GFP controls
or in the chi-YN/mu-YC protoplasts (Fig. 6-9).
Effects of exogenous MeJA on subcellular localisation of the 14-3-3-BiFC dimers
were further examined in excised leaves. No significant changes on 14-3-3 BiFC or
GFP fluorescence distribution were detected in excised rosette leaves from
six-to-seven-week-old transgenic plants expressing either epsilon-YN/mu-YC,
c h i - Y N / m u - Y C , m u - Y N / m u - Y C , m u Δ - Y N/ m u Δ - Y C o r G F P c o n s t r u c t s
Chapter 6. Cell death induced aggregation and ER association of 14-3-3 dimers 175
Fig. 6-8. Changes of epsilon-YN/mu-YC BiFC complex localisation were induced by H2O2
treatment in mesophyll protoplasts of transgenic Arabidopsis plants.
Mesophyll protoplasts were obtained from rosette leaves of transgenic Arabidopsis plantsexpressing a GFP construct (top row) or the epsilon-YN/mu-YC BiFC dimer (bottom row).Protoplasts shown in the left two columns were subjected to mock treatment (no H2O2).Protoplasts shown in the two right columns were treated with 0.2 mM H2O2 for 12 hours priorto analysis by conventional fluorescence microscopy. Distribution of GFP fluorescence wasunaffected by H2O2 treatment when compared to mock treated protoplasts. In contrast, BiFCfluorescence of epsilon-YN/mu-YC dimers aggregated into punctate bodies (arrowhead) afterthe H2O2 treatment. Scale bars = 50 μm.
Control (0 mM H2O2)
GFP
epsilon-YN/mu-YC
0.2 mM H2O2
GFP filter GFP filterBright field Bright field
GFP
epsilon-YN/mu-YC
Chapter 6. Cell death induced aggregation and ER association of 14-3-3 dimers 176
Control 50 μM MeJA
Fig. 6-9. Changes of epsilon-YN/mu-YC BiFC complex localisation were induced in a smallnumber of mesophyll protoplasts of transgenic Arabidopsis plants by MeJA treatment.
Mesophyll protoplasts were obtained from rosette leaves of transgenic Arabidopsis plantsexpressing a GFP construct (top row), the chi-YN/mu-YC BiFC dimer (second row) or the epsilon-YN/mu-YC BiFC dimer (bottom two rows). Protoplasts shown in the left two columns weresubjected to mock treatment (0.1% ethanol). Protoplasts shown in the two right columns weretreated with 50 μM MeJA in 0.1% ethanol for 24 hours prior to analysis by conventionalfluorescent microscopy. Columns two and four show bright field images or bright field imagescombined with fluorescent images (column 4, row three). No apparent changes in subcellulardistribution were detected for GFP or the chi-YN/mu-YC BiFC dimer after MeJA treatment whencompared to mock treatments. In contrast, MeJA treatment caused aggregation of epsilon-YN/mu-YC BiFC complexes into punctate bodies (arrowheads) in a small number of protoplasts,two of which are shown here. This aggregation pattern was not observed in mock treatedprotoplasts (controls). The punctate bodies resembled the pattern 4 observed for 14-3-3 dimersafter wounding in Nicotiana and Arabidopsis leaves (Chapter 4 and Fig. 6-6 B, respectively).Note, the MeJA treated protoplast shown in row three possibly displays shrinkage of the cytosol.Scale bars = 50 μm, unless otherwise indicated.
GFP
mu-YC/chi-YN
epsilon-YN/mu-YC
25 μm
25 μm
25 μm
25 μm
GFP filter
GFP filter
Bright field
Bright field
epsilon-YN/mu-YC
epsilon-YN/mu-YC
mu-YC/chi-YN
GFP
Chapter 6. Cell death induced aggregation and ER association of 14-3-3 dimers 177
treated with 50 μM MeJA for 38 h (Fig. 6-10). Fluorescence was absent from the
muΔ-YN/muΔ-YC negative dimerisation control (Fig. 6-10).
Methyl jasmonate inhibits root growth (Staswick et al., 1992). As 14-3-3 BiFC
plants are 14-3-3 overexpressors, testing MeJA on growth of such seedlings would
show: (1) if 14-3-3 plays a role in MeJA induced root growth inhibition and (2) if MeJA
has any impact on 14-3-3 dimer formation and localisation in newly grown root and
leaf tissues.
Ten day-old transgenic seedlings expressing GFP or BiFC fluorescence were
transferred from hygromycin selection MS plates to 0 μM or 50 μM MeJA containing
MS plates and allowed to grow for four more days. Absolute root growth during this
period was measured. As shown in Fig. 6-11, root growth inhibition by MeJA was
very similar in double transgenic 14-3-3 seedlings to that in the GFP control. This
suggested that overexpression of the tested 14-3-3-BiFC fusion proteins has no
impact on MeJA signalling with respect to root growth inhibition. Additionally, BiFC
fluorescence pattern was examined in the first pair of leaves and in root tips of
primary roots at the end of treatments. No significant changes were observed in
terms of 14-3-3 dimer formation and subcellular localisation between MeJA treated
and untreated seedlings within the newly grown tissues (Fig. 6-11).
Taken together, an altered distribution pattern of 14-3-3 dimers was detected in
cells after wounding and H2O2 treatment and to a lesser extent in MeJA treated
protoplasts. The observed pattern changes resembled those described for
epidermal peels from Nicotiana leaves. These results further suggested that the
novel 14-3-3 dimerisation Pattern 4 occurred in response to cell death inducing
conditions.
Chapter 6. Cell death induced aggregation and ER association of 14-3-3 dimers 178
Control 50 μM MeJA
GFP filter Bright field GFP filter Bright field
GFP
chi-YN/mu-YC
epsilon-YN/mu-YC
mu-YN/mu-YC
muΔ-YN/muΔ-YC
Fig. 6-10. MeJA did not impact on subcellular 14-3-3 BiFC dimer distribution in intactepidermal cells of transgenic Arabidopsis rosette leaves.
Rosette leaves were excised from six-to-seven-week-old transgenic Arabidopsis plantsexpressing the indicated constructs and were subjected to mock treatment (0.1% ethanol) or50 μM MeJA in 0.1% ethanol. Effects of MeJA on the distribution of GFP or 14-3-3 BiFCfluorescence were compared to mock treatments 38 hours post treatment by conventionalfluorescent microscopy. No changes in distribution were detected. Scale bar= 50 μm.
Chapter 6. Cell death induced aggregation and ER association of 14-3-3 dimers 179
Fig. 6-11. MeJA inhibited root growth, but did not affect either dimer formation ordistribution pattern of 14-3-3 dimers in newly grown leaf and root tissues.
Ten-day-old transgenic Arabidopsis seedlings expressing the indicated constructs weretransferred from hygromycin selection plates to 0 μM or 50 μM MeJA containing plates andallowed to grow for four days. Absolute root growth during this period was measured and theepifluorescence images were obtained from newly grown tissues (first pair of leaves or primaryroot tips) at the end of treatment. Root growth values are the means ± SD from 7 to 9seedlings as indicated. No significant changes were observed in terms of 14-3-3 dimerformation and tissue/cellular distribution between MeJA treated and untreated seedlingswithin the newly grown tissues. Scale bars for leaf and root samples are 10 μm and 100 μm,respectively.
0
10
20
30
Ctrl MeJA
mm mu-YN/mu-YC (n=7)
roo
t gr
ow
th
0
10
20
30
Ctrl MeJA
mm mu-YC/chi-YN (n=8)
roo
t gr
ow
th
0
10
20
30
Ctrl MeJA
mm epsilon-YN/mu-YC (n=9)
roo
t gr
ow
th0
10
20
30
Ctrl MeJA
mm GFP (n=8)
Ctrl MeJA
roo
t gr
ow
th
10 μm
100 μm
leaf
root
Chapter 6. Cell death induced aggregation and ER association of 14-3-3 dimers 180
6.3. Discussion
6.3.1. The potential association with the ER upon cell death induction and
wounding suggest a role of 14-3-3s in ER mediated apoptosis
During identification of subcellular localisation of 14-3-3 dimerisations using
BiFC assay, a novel distribution pattern of 14-3-3 dimers, characterised as small,
punctate, cytoplasmic bodies (designated as Pattern 4), was observed in the cells of
epidermal peels of transiently transformed Nicotiana leaves (Chapter 4).
Co-expression of an ER targeting fluorescent protein marker with 14-3-3
mu-YN/epsilon-YC BiFC constructs indicated that the 14-3-3 mu-epsilon dimer
co-localised to ER reticular network (Fig. 6-5) and ER-derived structures (Fig. 6-4 A-F)
in epidermal cells of transiently transformed Nicotiana leaves. Sometimes, after
wounding caused by epidermal peeling, aggregation of this dimer was observed in
association with the Golgi apparatus (Fig. 6-3 G-L) and with very bright fluorescence in
punctate areas of the ER (Fig. 6-4 G-L). These preliminary observations have been
supported by more recent work in the Martin lab, which has shown that the network
structure with 14-3-3 BiFC fluorescence is an early event and that punctate bodies
appear at later stages after wounding or herbicide treatments (R. Li, unpublished
results).
The punctate areas in which 14-3-3 dimers localised to or associated with the ER
may be ER export sites/exit sites (ERES). The ERES are the start of transport vesicles
leaving the ER known as coatomer protein complex II (COPII) vesicles (Hanton et al.,
2005; Watson and Stephens, 2005; Budnik and Stephens, 2009). 14-3-3 regulation
on export of membrane proteins from ER has been studied in depth in yeast and
mammalian systems (Nufer and Hauri, 2003; Mrowiec and Schwappach, 2006;
Shikano et al., 2006). A proposed model for mammalian 14-3-3 regulated trafficking
of membrane protein targets suggests that binding to 14-3-3 reduces ER retention,
Chapter 6. Cell death induced aggregation and ER association of 14-3-3 dimers 181
therefore promoting forward transport of membrane proteins to the plasma
membrane (Nufer and Hauri, 2003; Shikano et al., 2006). However, it is not known if
14-3-3s regulate protein export from the ER in plants.
Aggregation of 14-3-3 dimer into punctuate bodies was also observed for the
mu homodimer at wounded sites of cotyledons (Fig. 6-6) and for the epsilon-mu
heterodimer in H2O2- and less frequently in MeJA-treated mesophyll protoplasts (Figs.
6-8 and 6-9) of transgenic Arabidopsis 14-3-3 BiFC plants. The results strongly
support an idea that the morphological change of 14-3-3 dimer distribution was
responsive to cell death inducing treatments.
With respect to cell death induction, it is interesting to note that Cutler and
co-workers reported the accumulation of a GFP-Nitrilase 1 (GFP-Nit1) fusion protein in
Arabidopsis cells in response to mechanical wounding (Cutler and Somerville, 2005).
Plant nitrilases are reported to be involved in processes of cyanide detoxification, in
the catabolism of cyanogenic glycosides and glycosinolates, and in biosynthesis of the
plant growth hormone indole-3-acetic acid (Piotrowski, 2008). The appearance of
wound-induced vesiculation of GFP-Nit1 resembles strongly the accumulation of
14-3-3 dimers in punctate bodies observed in this study. In the co-localisation
analysis for 14-3-3 dimers and an ER marker presented here (Section 6.2.1), the
morphology of the ER marker and 14-3-3 dimers in epidermal peel cells was often
observed in vesicular structures. By contrast in intact leaves, it commonly presented
as a reticulated network of ER (Figs. 6-4 and 6-5).
The aggregation of GFP-Nit1 occurs rapidly from initially dispersed cytosolic
distribution upon wounding and cell death inductive treatments (Cutler and
Somerville, 2005). Thus, not just the final appearance of GFP-Nit1 aggregates but
also the timing upon wounding leading to such aggregates resembles strongly the
observations made for 14-3-3 dimers. The aggregation of GFP-Nit1 was proposed to
Chapter 6. Cell death induced aggregation and ER association of 14-3-3 dimers 182
be an early marker of cell death at wound sites (Cutler and Somerville, 2005). More
interestingly still, a 14-3-3 interactome study has shown that Nit1 is a potential 14-3-3
target protein (Paul et al., 2009). Ongoing work in the Martin lab has demonstrated
interaction of several 14-3-3 isoforms with Nit1 in the cytosol and that the Nit1-14-3-3
complex aggregates into vesicular structures after wounding (M. van der Kwast and R.
Li, unpublished results). This suggests regulation of Nit1 by 14-3-3 proteins. It
further promotes the notion that 14-3-3s are somewhat involved in responses to cell
death triggers in plant cells. Whether such involvement is regulatory, i.e. impacts on
the progression of cell death events, or is simply a regulation of enzymes involved in
scavenging cellular components, e.g. recycling of nitrogen and detoxification of
cyanide compounds as performed by nitrilase, is unclear.
Chapter 7. General discussion 183
Chapter 7
General Discussion
Chapter 7. General discussion 184
7.1. Conclusion and discussion
7.1.1. Analysis of 14-3-3 isoform specificity using bimolecular fluorescence
complementation
Using the BiFC assay systems developed in the present study, dimerisation of
Arabidopsis 14-3-3 isoforms and binding of 14-3-3 proteins to the target protein
histone deacetylase 2C (HD2C) were investigated and visualised in living plant cells.
The work performed here showed that BiFC assays can be successfully performed in
transiently transformed Arabidopsis mesophyll protoplasts (Fig. 3-9),
Agrobacterium-infiltrated Nicotiana leaves (Fig. 3-10 to 3-13 and Chapter 4) and in
stably transformed Arabidopsis plants (Chapter 5).
The question whether the large number of 14-3-3 isoforms in multicellular
organisms reflects functional specificity (Rosenquist et al., 2000) was addressed in this
project by investigating: (1) if 14-3-3 proteins are selective for each other during dimer
formation and (2) if 14-3-3 isoform specificity exists in the interaction with the target
protein HD2C. In addition, the question was asked whether or not individual dimer
combinations have specific subcellular localisations, which could be an indicator of
functional specificity.
7.1.1.1. Isoform specificity in 14-3-3 dimerisation
Selectivity of a 14-3-3 isoform for another isoform during dimer formation could
be one of the mechanisms which contribute to 14-3-3 specificity (Aitken, 2002). To
test this hypothesis, ten Arabidopsis 14-3-3 isoforms were systematically examined for
their ability to dimerise with each other using transient BiFC assays in Nicotiana leaves
(Chapter 4). The results indicated that all ten 14-3-3 isoforms can freely dimerise
with each other (Chapter 4), suggesting little selectivity of Arabidopsis 14-3-3s during
dimer formation. This is in agreement with a number of previous studies
Chapter 7. General discussion 185
demonstrating for example that six Arabidopsis 14-3-3 isoforms can dimerise freely
with each other when using in vitro dimerisation assays or yeast two-hybrid studies
(Wu et al., 1997b; Abarca et al., 1999). The results of the present study also agree
with a recently published study showing that Arabidopsis 14-3-3 omega is able to
associate with ten Arabidopsis 14-3-3 isoforms in tandem affinity purification
experiments (Chang et al., 2009). Such results imply that formation of 14-3-3 dimers
contributes little to functional specificity of Arabidopsis 14-3-3 proteins. However,
this is in contrast to observations made in mammalian and yeast systems (Chaudhri et
al., 2003; Wilker et al., 2005). For example, the mammalian sigma isoform shows
selectivity, appearing to only form homodimers (Wilker et al., 2005). The
discrepancy to the results obtained here simply may be due to plant 14-3-3s behaving
differently to mammalian and yeast isoforms during dimer formation.
7.1.1.2. Isoform specificity with respect to 14-3-3 isoform-target interaction
Specificity of 14-3-3 proteins could be expressed by selectivity in the interaction
with target proteins (Rosenquist et al., 2000; Aitken, 2002). Differential binding
affinity between 14-3-3 isoforms and target proteins/peptides was shown using in
vitro binding assays and yeast two-hybrid analyses (Bachmann et al., 1996b;
Kanamaru et al., 1999; Rosenquist et al., 2000; Sullivan et al., 2009). In the present
study, interactions of seven Arabidopsis 14-3-3 isoforms with HD2C were investigated
for isoform specificity using transient BiFC analysis. All seven 14-3-3 isoforms tested
were able to interact with HD2C, implying a lack of isoform specificity. Similar results
have been obtained in our lab when testing for interaction of 14-3-3s with other
target proteins (R. Li, M. van der Kwast and T. Martin, unpublished results). One
possible explanation for the apparent lack of specificity may be that CaMV 35S
promoter-mediated high expression levels of 14-3-3 and target protein negatively
impact on selectivity. It is also possible that highly conserved ligand-binding
Chapter 7. General discussion 186
domains of 14-3-3 proteins cause low intrinsic differences in their ability to bind to
some ligands but may be sufficient for selectivity towards other ligands (Aitken et al.,
2002). The latter argument is supported by findings that 14-3-3 proteins show
specificity in the interaction with target proteins. For example, a large scale yeast
two-hybrid analysis testing five barley 14-3-3 isoforms for interaction with 132
potential 14-3-3 target proteins from barley indicated that some targets showed high
affinity with all five 14-3-3 isoforms while others interacted only with subsets of
14-3-3 isofomrs (Schoonheim et al., 2007a).
The internal conditions of the test system employed may also have impacted on
the selectivity of 14-3-3 isoforms towards a target protein. An example of this is the
ability of 14-3-3s to interact with the PM H+-ATPase (Alsterfjord et al., 2004).
Despite of the fact that twelve Arabidopsis 14-3-3 isoforms were able to bind to the
H+-ATPase in vitro, only a subset of the isoforms were found to associate with the
H+-ATPase in vivo (Alsterfjord et al., 2004). However, when a fusicoccin treatment
was applied to change the internal conditions, only 14-3-3 phi and upsilon isoforms,
which were not detected in the plasma membrane fraction under normal conditions,
were found to interact with the H+-ATPase (Alsterfjord et al., 2004). Thus,
interaction specificity of 14-3-3 isoforms may be target protein- or stimuli-dependent
and needs to be verified empirically case by case.
7.1.1.3. Differential subcellular distribution of 14-3-3 dimers may
contribute to specificity
In transient BiFC assays all 14-3-3 dimers were found in the cytoplasm and most
were also present in the nucleus of Nicotiana leave cells. Whilst the fluorescence
intensity for one dimer and between dimers in the cytoplasm of individual cells was
relatively constant, the nuclear fluorescence intensity varied. This was used to
classify cells expressing 14-3-3 dimers according to the nuclear to cytoplasmic BiFC
Chapter 7. General discussion 187
fluorescence ratios with three main patterns identified: Pattern 1 where
fluorescence in the nucleus was at least 1.5 times stronger than in the cytoplasm,
Pattern 2 where the ratio of fluorescence was between 1.5 and 0.7, and Pattern 3
with nuclear fluorescence far lower (ratio smaller than 0.7) than in the cytoplasm.
Most dimers appeared in more than one of these patterns, with one of the patterns
being pre-dominant. For example, dimers consisting of the kappa isoform and any
of the 14-3-3 isoforms epsilon, kappa, mu, omicron, phi and psi, were mostly
detected in Pattern 1. However, when kappa was paired with either iota, chi, nu or
omega, the dimers appeared preferentially in Pattern 2. In contrast to kappa
containing dimers, 14-3-3 nu-related dimers were usually observed in Pattern 2 or 3.
One interpretation of this is that preferential localisation may reflect a major role of
14-3-3 kappa in the regulation of nuclear target proteins while 14-3-3 nu may be
involved largely in the regulation of cytoplasmic target proteins.
When examining subcellular distribution of epsilon-YN/mu-YC, mu-YC/chi-YN
and mu-YN/mu-YC in transgenic Arabidopsis plants, dimer-dependent localisation
patterns were observed in some tissues. For example, the epsilon-YN/mu-YC
heterodimer was found in the nuclei of rosette leaf epidermal cells, root cells and
cotyledon guard cells whilst the mu-YN/mu-YC homodimer was not detectable in
nuclei of these three cell types (Figs. 5-5 to 5-7). This supported the hypothesis that
nuclear localisation is at least in part dimer-dependent.
A discrepancy between experiments performed in Nicotiana and Arabidopsis
was observed for mu homodimers, which may point to cell type, plant or
experimental system specific differences. For example, in contrast to the mu
homodimer, which was found in leaf cell nuclei during transient Nicotiana
experiments (Fig. 4-1), it was absent from nuclei of Arabidopsis rosette leaf cells (Fig.
5-7, J-L).
Chapter 7. General discussion 188
In summary, although this study found no evidence for specificity of 14-3-3
monomers for other monomers, during dimer formation, a level of specificity was
observed when subcellular localisation of 14-3-3 dimers was examined. This
specificity appeared not to be solely dependent on the dimer but may be strongly
influenced by cellular conditions. Thus, the physiological history of the cell and its
state at the time of experimentation may have a stronger impact on mediating
specificity of 14-3-3 dimers than the actual 14-3-3 protein itself.
7.1.2. Advantages and limitations of bimolecular fluorescence
complementation for the analysis of 14-3-3 interactions
Advantages and disadvantages of BiFC approaches have been discussed in the
literature (Walter et al., 2004; Kerppola, 2006; Ohad et al., 2007; Citovsky et al., 2008;
Kerppola, 2008; Lalonde et al., 2008). Briefly, the advantages of the BiFC assay are:
(1) It is an easy assay to perform that does not require sophisticated equipment for
the analysis of protein-protein interactions in vivo. (2) It allows live cell imaging of
interacting protein complexes, which prevents potential artefacts associated with cell
lysis or fixation. In addition, the subcellular localisation of such complexes can be
determined. (3) The assay is sensitive and capable of trapping weak or transient
interactions by the stable reconstitution of YFP complexes. (4) It has the potential to
detect the effects of stimuli on protein interactions.
The current study supports the reported advantages of BiFC assays. For
example, the dimerisations between 14-3-3 isoforms and the interactions of 14-3-3
isoforms with a target protein HD2C were easy to detect and identification of
subcellular localisations was achieved in living plant cells (Chapter 4).
On the other hand, limitations of BiFC assay may include: (1) The differences in
protein expression levels under a set of given experimental conditions probably
Chapter 7. General discussion 189
influence which binding partners can be identified (Kerppola, 2006). This can be
partially overcome by using strong promoters, although gene copy number still
impacts on expression. (2) There is a time delay between injection and formation of
the BiFC complex due to the need for transcription, translation and potential
pot-translational modifications to take place, in addition to time required for the
fluorophore to mature (Hu et al., 2002; Ohad et al., 2007). Thus, proteins with high
turnover rates or with large differences in stability might not be amenable to BiFC
studies (Bhat et al., 2006). (3) The formation of BiFC complexes is irreversible, at
least in vitro (Hu et al., 2002; Magliery et al., 2005). This characteristic might lead to
artificial interactions and hence false positive results, especially when overexpressing
such fusion proteins (Bhat et al., 2006; Lalonde et al., 2008). On the other hand the
tendency of the fluorescent protein fragments to associate is often reduced when
they are fused to proteins that do not associate with each other (Kerppola, 2008).
Thus, false positive interaction can be circumvented by performing appropriate
negative controls, for example using mutated proteins that are unable to interact.
The applicability of this for 14-3-3s was described in the literature (Walter et al., 2004;
Kerppola, 2008) and also in this thesis. Alternatively, the use of moderate promoters
for the expression of the respective fusion proteins will reduce such artefacts (Walter
et al., 2004; Bhat et al., 2006). (4) Steric accessibility of the split YFP parts in the
respective fusion proteins for reconstitution is an issue for the formation of BiFC
complexes (Lalonde et al., 2008). Thus, multiple fusion orientations should be tested
in case of negative outcomes (Morsy et al., 2008).
Most of the described limitations of BiFC assays did not impact on this study as
all investigated interactions occurred and were detectable whilst negative controls
with truncated, non-dimerising 14-3-3 mutants showed no interactions (Chapter 3).
However, some other potentially limiting factors need to be considered. Firstly, the
Chapter 7. General discussion 190
infiltration of Nicotiana leaves with a mixture of distinct Agrobacterium strains (YN, YC
and p19) restricted the use of the assay to qualitative examination of 14-3-3
interactions. This is due to the unpredictability of how the individual constructs will
be transferred and expressed in individual cells. Western blot analysis can only give
an averaged picture of protein expression in a tissue and does not show the
cell-to-cell differences. In theory, interactions can be analysed quantitatively by
directly comparing BiFC fluorescence intensity. This may be best achieved by
construction of a vector containing both, the YN and the YC fusion construct, thereby
reducing variability in transformations of two constructs. On the other hand, such
large vectors would be harder to handle and also greatly reduce the flexibility of the
approach, i.e. the combinatorial aspect, unless an increase in labour time for
generating more constructs is not an issue. Alternatively, adding an additional
reporter gene such as luciferase into the BiFC vectors would allow correction for
transformation differences, and may be an easier alternative to the above.
Secondly, it is unclear if the affinity of two interaction partners corresponds to
the degree of cellular fluorescence (Bhat et al., 2006). Thus observed BiFC
fluorescence of different 14-3-3 interactions cannot be directly used as an indicator
for the interaction preference between distinct 14-3-3 dimeric combinations or
different 14-3-3 isoform-target interactions. Although the intensity of BiFC
fluorescence per se is quantifiable (Walter et al., 2004; Gampala et al., 2007), it
requires an internal control to compare the intensity between cells. The multicolour
BiFC analysis, which allows simultaneous visualisation of multiple protein complexes
in the same cell (Hu and Kerppola, 2003; Kerppola, 2008), has the potential to address
competition between two or more 14-3-3 proteins for a target protein which may be
another 14-3-3 or a target protein. However, the multicolour BiFC analysis is still a
challenging technique as it requires precise quantification of the amount of
Chapter 7. General discussion 191
fluorescent protein complexes with often overlapping excitation and/or emission
spectra and big differences in fluorescence energy output hindering visualisation and
signal comparision.
Last but not least, it may not be possible to resolve the full function of 14-3-3
proteins, especially in terms of dissociation of the protein complexes, using the BiFC
assays because the formation of BiFC complexes is irreversible (Hu et al., 2002;
Magliery et al., 2005). On the other hand, it is speculated that the dynamics of BiFC
complex formation is maintained or can be modified by the cellular protein folding
and degradation machinery, allowing at least the stability versus degradation of BiFC
complexes to be investigated (Walter et al., 2004). Furthermore, intracellular
relocalisation, such as those observed in this project in response to wounding and cell
death (Chapter 4 and 6), is possible with this system.
7.1.3. Interpretation of the BiFC outcomes of 14-3-3 interactions in cells
This study showed the ability of the introduced 14-3-3-split YFP fusion proteins
to bind to their interacting counterparts in the developed BiFC assay systems. Thus,
it can be speculated that an introduced 14-3-3 fusion protein is also able to interact
with endogenous 14-3-3 interacting proteins, including native 14-3-3 isoforms and
their target proteins. From a different point of view, the introduced 14-3-3s are in
direct competition with endogenous 14-3-3s for dimerisation and interaction with
targets.
In the transient BiFC assay of Nicotiana leaves, it can be expected that the
amounts of expressed 14-3-3-split YFP fusion molecules may be much higher than
those of the endogenous 14-3-3 interacting proteins, owing to induction of the
transgene expression by the co-expression of silencing suppressor protein p19. Thus,
intrinsic competition may be low and the BiFC signals would largely reflect the two
Chapter 7. General discussion 192
interacting proteins been tested. This may also explain the contradictory BiFC
distribution patterns that showed all the examined 14-3-3 dimerisations were absent
from the nucleolus whilst 14-3-3-HD2C interactions accumulated to high levels in the
nucleolus (Fig. 4-7). The absence of 14-3-3 dimers from nucleoli in dimerisation
experiments may be a mere artefact based on the lack of a similarly highly expressed
target protein. Once a target protein is available in high numbers, it may provide the
driving force, bringing 14-3-3s into the nucleolus. Complementing dimerisation
studies with localisation studies using single 14-3-3 isoforms fused to GFP or another
marker protein may help avoid mis- or over-interpretation of dimerisation data. This
approach may be limited to some isoforms as it was reported that out of six isoforms,
only kappa localised to the nucleolus when using a GFP fusion protein approach
(Koroleva et al., 2005; Paul et al., 2005; Rienties et al., 2005; Reumann et al., 2009;
Table 4-1).
In contrast, for the transgenic Arabidopsis plants used with the BiFC assay, the
expression level of transgenes could be different from plant to plant due to the
balance between the effects of transgene-driven promoter and the intrinsic gene
expression regulatory mechanisms such as post transcriptional gene silencing
(Wroblewski et al., 2005). Besides, a reservoir of endogenous 14-3-3 interacting
proteins may act as competitors for, or may disrupt the formation of, recombinant
fluorescent BiFC complexes in cells (MacKintosh, 2004). Thus, if there are any
preferential dimerisations between 14-3-3 isoforms or isoform-specific interactions of
14-3-3 with target proteins, it would have a negative impact on formation of the
tested 14-3-3 BiFC complexes in a particular cellular compartment in the native
system. This may explain why the mu-YN/mu-YC dimer (found in the nuclei in the
Nicotiana system) was not detectable in the nucleus of leaf epidermal cells and
cotyledon guard cells in the transgenic Arabidopsis plants but the mu-YC/chi-YN and
Chapter 7. General discussion 193
epsilon-YN/mu-YC heterodimers were (Figs. 5-6 and 5-7). Hence it would be
important to know the protein levels of the transgenic 14-3-3-split YFP over-expressed
related to the endogenous 14-3-3 isoforms. For this, proper tools, such as 14-3-3
isoform-specific antibodies, are needed.
7.2. Future perspectives
Despite hundreds of 14-3-3 target proteins having been predicted, their
interaction with 14-3-3s in vivo or in the native organism is still speculative (Oecking
and Jaspert, 2009). As was shown elsewhere (Walter et al., 2004; Gampala et al.,
2007; Jaspert et al., 2009; Purwestri et al., 2009), BiFC is a suitable method to provide
in vivo or in planta evidence for such interactions. Isoform specificity of 14-3-3
proteins was not observed in the present study, neither in the dimerisation
experiments nor in the interaction studies with HD2C. It is possible that isoforms
omitted here would reveal specificity when tested for dimerisation or HD2C
interaction, and these should be tested.
To ensure that the observed interactions with HD2C are not due to non-specific
binding, negative controls such as N-terminally truncated 14-3-3s could be used. A
further control would be to use a HD2C mutant in which the 14-3-3 binding site was
mutated. The first set of experiments was conducted in the Martin lab and no
interaction was detected (M. van der Kwast and T. Martin, unpublished data). With
respect to the second approach, deletion experiments were used to show that the
potential 14-3-3 binding site is located in the N-terminal region of the HD2C (M. van
der Kwast and T. Martin, unpublished data).
If the 14-3-3 BiFC dimeric complex is still able to interact with target proteins, i.e.
the YFP components do not prevent such interaction, transgenic plants could be used
along with pull-down assays in combination with two-dimensional gel electrophoresis
Chapter 7. General discussion 194
and gas chromatography/mass spectrometry (GC/MS) or MS alone to identify target
proteins binding to the 14-3-3-split YFP fusion proteins. The library of transgenic
Arabidopsis plants carrying one or two 14-3-3 BiFC constructs can be used as
biological starting material to generate such 14-3-3 interactomic profiles for different
tissues or different development stages. Similar strategies of using antibodies to
pull-down 14-3-3 associated protein complexes have been successfully performed
(Chang et al., 2009; Paul et al., 2009). The association of -YN and -YC constructs with
two different tags may be suitable to identify target proteins interacting with the
dimer only but not with single 14-3-3s or one of the 14-3-3 BiFC constructs and an
endogenous 14-3-3 protein. This, in principle, allows for a proteomics approach
directed towards the identification of dimer specific binding partners.
Alternatively, an approach that can isolate intact protein complexes, such as
blue-native gel electrophoresis (Kanczewska et al., 2005; Wittig et al., 2006) could be
used as the first step in the identification of components of 14-3-3-interacting protein
complex.
Changes in cellular distribution of 14-3-3 BiFC fluorescence can occur in
response to certain cellular events as was demonstrated in this work when studying
14-3-3 dimer distribution in response to cell death-related stimuli (Chapter 4 and 6).
This has since led to the discovery that 14-3-3-Nit1 interactions were commonly in the
cytoplasm, but aggregation of the 14-3-3-Nit1 BiFC complex into vesicular structures
was induced by wounding and herbicide treatments (R. Li, M. van der Kwast and T.
Martin, unpublished results). Future studies could also include examining the links
between 14-3-3 interactions with other target proteins, changes in subcellular
distribution, and the biological role of 14-3-3s or their target proteins.
In conclusion, BiFC assays adapted in this thesis were successfully used to
investigate the in vivo interactions and subcellular localisations of 14-3-3 proteins in
Chapter 7. General discussion 195
dimerisation studies and with a target protein. It was found that this technique has
great potential to investigate 14-3-3-target complex formation and translocation in
living cells. The present study also led to investigations in the potential roles of
14-3-3 proteins in regulation of nitrilase and HD2C. Further studies in these
directions will provide novel insights into the complex roles of 14-3-3 proteins.
References 196
References
Abarca, D., Madueno, F., Martinez-Zapater, J.M., and Salinas, J. (1999). Dimerization
of Arabidopsis 14-3-3 proteins: Structural requirements within the N-terminal
domain and effect of calcium. FEBS Lett. 462, 377-382.
Aitken, A. (1996). 14-3-3 and its possible role in co-ordinating multiple signalling
pathways. Trends Cell Biol. 6, 341-347.
Aitken, A. (2002). Functional specificity in 14-3-3 isoform interactions through dimer
formation and phosphorylation. Chromosome location of mammalian isoforms
and variants. Plant Mol. Biol. 50, 993-1010.
Aitken, A., Baxter, H., Dubois, T., Clokie, S., Mackie, S., Mitchell, K., Peden, A., and
Zemlickova, E. (2002). Specificity of 14-3-3 isoform dimer interactions and
phosphorylation. Biochem. Soc. Trans. 30, 351-360.
Alsterfjord, M., Sehnke, P.C., Arkell, A., Larsson, H., Svennelid, F., Rosenquist, M.,
Ferl, R.J., Sommarin, M., and Larsson, C. (2004). Plasma membrane H+-ATPase
and 14-3-3 isoforms of Arabidopsis leaves: Evidence for isoform specificity in
the 14-3-3/H+-ATPase interaction. Plant Cell Physiol. 45, 1202-1210.
Aparicio, F., Thomas, C.L., Lederer, C., Niu, Y., Wang, D., and Maule, A.J. (2005). Virus
induction of heat shock protein 70 reflects a general response to protein
accumulation in the plant cytosol. Plant Physiol. 138, 529-536.
Asai, T., Stone, J.M., Heard, J.E., Kovtun, Y., Yorgey, P., Sheen, J., and Ausubel, F.M.
(2000). Fumonisin B1-induced cell death in Arabidopsis protoplasts requires
jasmonate-, ethylene-, and salicylate-dependent signaling pathways. Plant Cell
12, 1823-1836.
Athwal, G.S., and Huber, S.C. (2002). Divalent cations and polyamines bind to loop 8
of 14-3-3 proteins, modulating their interaction with phosphorylated nitrate
reductase. Plant J. 29, 119-129.
Athwal, G.S., Huber, J.L., and Huber, S.C. (1998a). Biological significance of divalent
metal ion binding to 14-3-3 proteins in relationship to nitrate reductase
inactivation. Plant Cell Physiol. 39, 1065-1072.
Athwal, G.S., Huber, J.L., and Huber, S.C. (1998b). Phosphorylated nitrate reductase
and 14-3-3 proteins. Site of interaction, effects of ions, and evidence for an
AMP-binding site on 14-3-3 proteins. Plant Physiol. 118, 1041-1048.
Athwal, G.S., Lombardo, C.R., Huber, J.L., Masters, S.C., Fu, H., and Huber, S.C. (2000).
Modulation of 14-3-3 protein interactions with target polypeptides by physical
and metabolic effectors. Plant Cell Physiol. 41, 523-533.
Bachmann, M., Huber, J.L., Liao, P.-C., Gage, D.A., and Huber, S.C. (1996a). The
inhibitor protein of phosphorylated nitrate reductase from spinach (Spinacia
oleracea) leaves is a 14-3-3 protein. FEBS Lett. 387, 127-131.
References 197
Bachmann, M., Huber, J.L., Athwal, G.S., Wu, K., Ferl, R.J., and Huber, S.C. (1996b).
14-3-3 proteins associate with the regulatory phosphorylation site of spinach
leaf nitrate reductase in an isoform-specific manner and reduce
dephosphorylation of Ser-543 by endogenous protein phosphatases. FEBS Lett.
398, 26-30.
Bae, M.S., Cho, E.J., Choi, E.-Y., and Park, O.K. (2003). Analysis of the Arabidopsis
nuclear proteome and its response to cold stress. Plant J. 36, 652-663.
Baunsgaard, L., Fuglsang, A.T., Jahn, T., Korthout, H.A.A.J., de Boer, A.H., and
Palmgren, M.G. (1998). The 14-3-3 proteins associate with the plant plasma
membrane H+-ATPase to generate fusicoccin binding complex and a fusicoccin
responsive system. Plant J. 13, 661-671.
Beers, E.P., and McDowell, J.M. (2001). Regulation and execution of programmed cell
death in response to pathogens, stress and developmental cues. Curr. Opin.
Plant Biol. 4, 561-567.
Benschop, J.J., Mohammed, S., O'Flaherty, M., Heck, A.J.R., Slijper, M., and Menke,
F.L.H. (2007). Quantitative phosphoproteomics of early elicitor signaling in
Arabidopsis. Mol. Cell. Proteomics 6, 1198-1214.
Bhat, R.A., Lahaye, T., and Panstruga, R. (2006). The visible touch: in planta
visualization of protein-protein interactions by fluorophore-based methods.
Plant Methods 2, 12.
Bihn, E.A., Paul, A.-L., Wang, S.W., Erdos, G.W., and Ferl, R.J. (1997). Localization of
14-3-3 proteins in the nuclei of arabidopsis and maize. Plant J. 12, 1439-1445.
Bracha-Drori, K., Shichrur, K., Katz, A., Oliva, M., Angelovici, R., Yalovsky, S., and
Ohad, N. (2004). Detection of protein-protein interactions in plants using
bimolecular fluorescence complementation. Plant J. 40, 419-427.
Brandt, J., Thordal-Christensen, H., Vad, K., Gregersen, P.L., and Collinge, D.B. (1992).
A pathogen-induced gene of barley encodes a protein showing high similarity
to a protein kinase regulator. Plant J. 2, 815-820.
Braselmann, S., and McCormick, F. (1995). Bcr and Raf form a complex in vivo via
14-3-3 proteins. EMBO J. 14, 4839-4848.
Bridges, D., and Moorhead, G.B.G. (2005). 14-3-3 proteins: a number of functions for
a numbered protein. Sci. STKE 2005, re10.
Budnik, A., and Stephens, D.J. (2009). ER exit sites - Localization and control of COPII
vesicle formation. FEBS Lett. 583, 3796-3803.
Bunney, T.D., van Walraven, H.S., and de Boer, A.H. (2001). 14-3-3 Protein is a
regulator of the mitochondrial and chloroplast ATP synthase. Proc. Natl. Acad.
Sci. USA 98, 4249-4254.
Bunney, T.D., van den Wijngaard, P.W.J., and de Boer, A.H. (2002). 14-3-3 Protein
regulation of proton pumps and ion channels. Plant Mol. Biol. 50, 1041-1051.
References 198
Bustos, D.M., and Iglesias, A.A. (2003). Phosphorylated non-phosphorylating
glyceraldehyde-3-phosphate dehydrogenase from heterotrophic cells of wheat
interacts with 14-3-3 proteins. Plant Physiol. 133, 2081-2088.
Campbell, W.H. (1999). NITRATE REDUCTASE STRUCTURE, FUNCTION AND
REGULATION: bridging the gap between biochemistry and physiology. Annu.
Rev. Plant Physiol. Plant Mol. Biol. 50, 277-303.
Cao, A., Jain, A., Baldwin, J., and Raghothama, K. (2007). Phosphate differentially
regulates 14-3-3 family members and GRF9 plays a role in Pi-starvation
induced responses. Planta 226, 1219-1230.
Carbon, S., Ireland, A., Mungall, C.J., Shu, S., Marshall, B., Lewis, S., the Ami, G.O.H.,
and the Web Presence Working, G. (2009). AmiGO: online access to ontology
and annotation data. Bioinformatics 25, 288-289.
Chang, I.-F., Curran, A., Woolsey, R., Quilici, D., Cushman, J.C., Mittler, R., Harmon, A.,
and Harper, J.F. (2009). Proteomic profiling of tandem affinity purified 14-3-3
protein complexes in Arabidopsis thaliana. Proteomics 9, 2967-2985.
Chaudhri, M., Scarabel, M., and Aitken, A. (2003). Mammalian and yeast 14-3-3
isoforms form distinct patterns of dimers in vivo. Biochem. Biophys. Res.
Commun. 300, 679-685.
Chen, F., Li, Q., Sun, L., and He, Z. (2006). The rice 14-3-3 gene family and its
involvement in responses to biotic and abiotic stress. DNA Res 13, 53-63.
Chevalier, D., Morris, E.R., and Walker, J.C. (2009). 14-3-3 and FHA domains mediate
phosphoprotein interactions. Annu. Rev. Plant Biol. 60, 67-91.
Chung, H.-J., Sehnke, P.C., and Ferl, R.J. (1999). The 14-3-3 proteins: cellular
regulators of plant metabolism. Trends Plant Sci. 4, 367-371.
Citovsky, V., Gafni, Y., and Tzfira, T. (2008). Localizing protein-protein interactions by
bimolecular fluorescence complementation in planta. Methods 45, 196-206.
Clough, S.J., and Bent, A.F. (1998). Floral dip: a simplified method for
Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. 16,
735-743.
Cohen, P. (2002). The origins of protein phosphorylation. Nat. Cell Biol. 4, E127-E130.
Comparot, S., Lingiah, G., and Martin, T. (2003). Function and specificity of 14-3-3
proteins in the regulation of carbohydrate and nitrogen metabolism. J. Exp. Bot.
54, 595-604.
Cutler, S., and Somerville, C. (2005). Imaging plant cell death: GFP-Nit1 aggregation
marks an early step of wound and herbicide induced cell death. BMC Plant Biol.
5, 4.
Cutler, S.R., Ehrhardt, D.W., Griffitts, J.S., and Somerville, C.R. (2000). Random
GFP::cDNA fusions enable visualization of subcellular structures in cells of
Arabidopsis at a high frequency. Proc. Natl. Acad. Sci. USA 97, 3718-3723.
References 199
Daugherty, C.J., Rooney, M.F., Miller, P.W., and Ferl, R.J. (1996). Molecular
organization and tissue-specific expression of an Arabidopsis 14-3-3 gene.
Plant Cell 8, 1239-1248.
de Boer, B. (1997). Fusicoccin - a key to multiple 14-3-3 locks? Trends Plant Sci. 2,
60-66.
de Vetten, N.C., Lu, G., and Ferl, R.J. (1992). A maize protein associated with the
G-box binding complex has homology to brain regulatory proteins. Plant Cell 4,
1295-1307.
Desikan, R., Reynolds, A., Hancock, J.T., and Neill, S.J. (1998). Harpin and hydrogen
peroxide both initiate programmed cell death but have differential effects on
defence gene expression in Arabidopsis suspension cultures. Biochem. J. 330,
115-120.
Desprez, T., Juraniec, M., Crowell, E.F., Jouy, H., Pochylova, Z., Parcy, F., Höfte, H.,
Gonneau, M., and Vernhettes, S. (2007). Organization of cellulose synthase
complexes involved in primary cell wall synthesis in Arabidopsis thaliana. Proc.
Natl. Acad. Sci. USA 104, 15572-15577.
Dougherty, M.K., and Morrison, D.K. (2004). Unlocking the code of 14-3-3. J. Cell Sci.
117, 1875-1884.
Douglas, P., Moorhead, G., Hong, Y., Morrice, N., and MacKintosh, C. (1998).
Purification of a nitrate reductase kinase from Spinacea oleracea leaves, and
its identification as a calmodulin-domain protein kinase. Planta 206, 435-442.
Eckardt, N.A. (2001). Transcription factors dial 14-3-3 for nuclear shuttle. Plant Cell 13,
2385-2389.
Emanuelsson, O., Elofsson, A., von Heijne, G., and Cristobal, S. (2003). In silico
prediction of the peroxisomal proteome in fungi, plants and animals. J. Mol.
Biol. 330, 443-456.
Ferl, R.J. (2004). 14-3-3 proteins: Regulation of signal-induced events. Physiol. Plant.
120, 173-178.
Ferl, R.J., Manak, M.S., and Reyes, M.F. (2002). The 14-3-3s. Genome Biol. 3,
reviews3010.
Finnemann, J., and Schjoerring, J.K. (2000). Post-translational regulation of cytosolic
glutamine synthetase by reversible phosphorylation and 14-3-3 protein
interaction. Plant J. 24, 171-181.
Fu, H., Subramanian, R.R., and Masters, S.C. (2000). 14-3-3 proteins: structure,
function, and regulation. Annu. Rev. Pharmacol. Toxicol. 40, 617-647.
Gampala, S.S., Kim, T.-W., He, J.-X., Tang, W., Deng, Z., Bai, M.-Y., Guan, S., Lalonde,
S., Sun, Y., Gendron, J.M., Chen, H., Shibagaki, N., Ferl, R.J., Ehrhardt, D.,
Chong, K., Burlingame, A.L., and Wang, Z.-Y. (2007). An essential role for
14-3-3 proteins in brassinosteroid signal transduction in Arabidopsis. Dev. Cell
13, 177-189.
References 200
Gardino, A.K., Smerdon, S.J., and Yaffe, M.B. (2006). Structural determinants of
14-3-3 binding specificities and regulation of subcellular localization of
14-3-3-ligand complexes: A comparison of the X-ray crystal structures of all
human 14-3-3 isoforms. Semin. Cancer Biol. 16, 173-182.
Gawel, N.J., and Jarret, R.L. (1991). A modified CTAB DNA extraction procedure for
Musa and Ipomoea. Plant Mol. Biol. Report. 9, 262-266.
Genoud, T., and Métraux, J.-P. (1999). Crosstalk in plant cell signaling: structure and
function of the genetic network. Trends Plant Sci. 4, 503-507.
Gomord, V., Denmat, L.-A., Fitchette-Lainé, A.-C., Satiat-Jeunemaitre, B., Hawes, C.,
and Faye, L. (1997). The C-terminal HDEL sequence is sufficient for retention of
secretory proteins in the endoplasmic reticulum (ER) but promotes vacuolar
targeting of proteins that escape the ER. Plant J. 11, 313-325.
Grefen, C., Stadele, K., Ruzicka, K., Obrdlik, P., Harter, K., and Horak, J. (2008).
Subcellular localization and in vivo interactions of the Arabidopsis thaliana
ethylene receptor family members. Mol Plant 1, 308-320.
Grozinger, C.M., and Schreiber, S.L. (2000). Regulation of histone deacetylase 4 and 5
and transcriptional activity by 14-3-3-dependent cellular localization. Proc.
Natl. Acad. Sci. USA 97, 7835-7840.
Höfgen, R., and Willmitzer, L. (1988). Storage of competent cells for Agrobacterium
transformation. Nucl. Acids Res. 16, 9877.
Hamilton, A., Voinnet, O., Chappell, L., and Baulcombe, D. (2002). Two classes of
short interfering RNA in RNA silencing. EMBO J. 21, 4671-4679.
Hanahan, D. (1985). Techniques for transformation of E. coli. In DNA Cloning: a
practical approach, D.M. Glover, ed (London, UK: IRL Press Ltd.
Hanton, S.L., Bortolotti, L.E., Renna, L., Stefano, G., and Brandizzi, F. (2005). Crossing
the divide - transport between the endoplasmic reticulum and Golgi apparatus
in plants. Traffic 6, 267-277.
Harrison, S.J., Mott, E.K., Parsley, K., Aspinall, S., Gray, J.C., and Cottage, A. (2006). A
rapid and robust method of identifying transformed Arabidopsis thaliana
seedlings following floral dip transformation. Plant Methods 2, 19.
He, Z.-H., Cheeseman, I., He, D., and Kohorn, B. (1999). A cluster of five cell
wall-associated receptor kinase genes, Wak1–5, are expressed in specific
organs of Arabidopsis. Plant Mol. Biol. 39, 1189-1196.
Heazlewood, J.L., Verboom, R.E., Tonti-Filippini, J., Small, I., and Millar, A.H. (2007).
SUBA: the Arabidopsis subcellular database. Nucl. Acids Res. 35, D213-D218.
Helenius, E., Boije, M., Niklander-Teeri, V., Palva, E., and Teeri, T. (2000). Gene
delivery into intact plants using the HeliosTM gene gun. Plant Mol. Biol. Report.
18, 287-288.
Hellens, R., Mullineaux, P., and Klee, H. (2000a). A guide to Agrobacterium binary Ti
vectors. Trends Plant Sci. 5, 446-451.
References 201
Hellens, R.P., Edwards, E.A., Leyland, N.R., Bean, S., and Mullineaux, P.M. (2000b).
pGreen: a versatile and flexible binary Ti vector for Agrobacterium-mediated
plant transformation. Plant Mol. Biol. 42, 819-832.
Hellens, R.P., Allan, A.C., Friel, E.N., Bolitho, K., Grafton, K., Templeton, M.D.,
Karunairetnam, S., Gleave, A.P., and Laing, W.A. (2005). Transient expression
vectors for functional genomics, quantification of promoter activity and RNA
silencing in plants. Plant Methods 1, 13.
Hirsch, S., Aitken, A., Bertsch, U., and Soll, J.g. (1992). A plant homologue to
mammalian brain 14-3-3 protein and protein kinase C inhibitor. FEBS Lett. 296,
222-224.
Hoff, B., and Kück, U. (2005). Use of bimolecular fluorescence complementation to
demonstrate transcription factor interaction in nuclei of living cells from the
filamentous fungus Acremonium chrysogenum. Curr. Genet. 47, 132-138.
Hollender, C., and Liu, Z. (2008). Histone deacetylase genes in Arabidopsis
development. J. Integr. Plant Biol. 50, 875-885.
Horton, P., Park, K.-J., Obayashi, T., Fujita, N., Harada, H., Adams-Collier, C.J., and
Nakai, K. (2007). WoLF PSORT: protein localization predictor. Nucl. Acids Res.
35, W585-587.
Houot, V., Etienne, P., Petitot, A.-S., Barbier, S., Blein, J.-P., and Suty, L. (2001).
Hydrogen peroxide induces programmed cell death features in cultured
tobacco BY-2 cells, in a dose-dependent manner. J. Exp. Bot. 52, 1721-1730.
Howden, R., Park, S.K., Moore, J.M., Orme, J., Grossniklaus, U., and Twell, D. (1998).
Selection of T-DNA-tagged male and female gametophytic mutants by
segregation distortion in Arabidopsis. Genetics 149, 621-631.
Hu, C.-D., and Kerppola, T.K. (2003). Simultaneous visualization of multiple protein
interactions in living cells using multicolor fluorescence complementation
analysis. Nat. Biotechnol. 21, 539-545.
Hu, C.-D., Chinenov, Y., and Kerppola, T.K. (2002). Visualization of interactions among
bZIP and Rel family proteins in living cells using bimolecular fluorescence
complementation. Mol. Cell 9, 789-798.
Hua, S., and Sun, Z. (2001). Support vector machine approach for protein subcellular
localization prediction. Bioinformatics 17, 721-728.
Huang, C.-N., Cornejo, M.J., Bush, D.S., and Jones, R.L. (1986). Estimating viability of
plant protoplasts using double and single staining. Protoplasma 135, 80-87.
Huang, H.C., and Chen, C.C. (1988). Genome Multiplication in Cultured Protoplasts of
Two Nicotiana Species. J. Hered. 79, 28-32.
Huber, S.C., Bachmann, M., and Huber, J.L. (1996). Post-translational regulation of
nitrate reductase activity: a role for Ca2+ and 14-3-3 proteins. Trends Plant Sci.
1, 432-438.
References 202
Huber, S.C., MacKintosh, C., and Kaiser, W.M. (2002). Metabolic enzymes as targets
for 14-3-3 proteins. Plant Mol. Biol. 50, 1053-1063.
Ichimura, T., Isobe, T., Okuyama, T., Yamauchi, T., and Fujisawa, H. (1987). Brain
14-3-3 protein is an activator protein that activates tryptophan
5-monooxygenase and tyrosine 3-monooxygenase in the presence of
Ca2+,calmodulin-dependent protein kinase II. FEBS Lett. 219, 79-82.
Igarashi, D., Ishida, S., Fukazawa, J., and Takahashi, Y. (2001). 14-3-3 Proteins
regulate intracellular localization of the bZIP transcriptional activator RSG.
Plant Cell 13, 2483-2497.
Jach, G., Pesch, M., Richter, K., Frings, S., and Uhrig, J.F. (2006). An improved mRFP1
adds red to bimolecular fluorescence complementation. Nat.Methods 3,
597-600.
Jahn, T., Fuglsang, A.T., Olsson, A., Bruntrup, I.M., Collinge, D.B., Volkmann, D.,
Sommarin, M., Palmgren, M.G., and Larsson, C. (1997). The 14-3-3 protein
interacts directly with the C-terminal region of the plant plasma membrane
H+-ATPase. Plant Cell 9, 1805-1814.
Jaquinod, M., Villiers, F., Kieffer-Jaquinod, S., Hugouvieux, V., Bruley, C., Garin, J.,
and Bourguignon, J. (2007). A proteomics dissection of Arabidopsis thaliana
vacuoles isolated from cell culture. Mol. Cell. Proteomics 6, 394-412.
Jaspert, N., and Oecking, C. (2002). Regulatory 14-3-3 proteins bind the atypical motif
within the C terminus of the plant plasma membrane H+-ATPase via their
typical amphipathic groove. Planta 216, 136-139.
Jaspert, N., Weckermann, K., Piotrowski, M., and Oecking, C. (2009). Enolase, a
cross-link between glycolysis and stress response. In 20th International
Conference on Arabidopsis Research (Edinburgh, Scotland, United Kingdom).
Jones, A.M. (2001). Programmed cell death in development and defense. Plant
Physiol. 125, 94-97.
Jones, D.H., Ley, S., and Aitken, A. (1995). Isoforms of 14-3-3 protein can form homo-
and heterodimers in vivo and in vitro: implications for function as adapter
proteins. FEBS Lett. 368, 55-58.
Köhler, R.H., Zipfel, W.R., Webb, W.W., and Hanson, M.R. (1997). The green
fluorescent protein as a marker to visualize plant mitochondria in vivo. Plant J.
11, 613-621.
Kanamaru, K., Wang, R., Su, W., and Crawford, N.M. (1999). Ser-534 in the hinge 1
region of Arabidopsis nitrate reductase is conditionally required for binding of
14-3-3 proteins and in vitro inhibition. J. Biol. Chem. 274, 4160-4165.
Kanczewska, J., Marco, S., Vandermeeren, C., Maudoux, O., Rigaud, J.-L., and Boutry,
M. (2005). Activation of the plant plasma membrane H+-ATPase by
phosphorylation and binding of 14-3-3 proteins converts a dimer into a
hexamer. Proc. Natl. Acad. Sci. USA 102, 11675-11680.
References 203
Karlova, R., Boeren, S., Russinova, E., Aker, J., Vervoort, J., and de Vries, S. (2006).
The Arabidopsis SOMATIC EMBRYOGENESIS RECEPTOR-LIKE KINASE1 protein
complex includes BRASSINOSTEROID-INSENSITIVE1. Plant Cell 18, 626-638.
Kerppola, T.K. (2006). Visualization of molecular interactions by fluorescence
complementation. Nat. Rev. Mol. Cell Biol. 7, 449-456.
Kerppola, T.K. (2008). Bimolecular fluorescence complementation (BiFC) analysis as a
probe of protein interactions in living cells. Annu. Rev. Biophys. 37, 465-487.
Kleffmann, T., Russenberger, D., von Zychlinski, A., Christopher, W., Sjölander, K.,
Gruissem, W., and Baginsky, S. (2004). The Arabidopsis thaliana chloroplast
proteome reveals pathway abundance and novel protein functions. Curr. Biol.
14, 354-362.
Koncz, C., and Schell, J. (1986). The promoter of TL-DNA gene 5 controls the
tissue-specific expression of chimaeric genes carried by a novel type of
Agrobacterium binary vector. Mol. Gen. Genet. 204, 383-396.
Koroleva, O.A., Tomlinson, M.L., Leader, D., Shaw, P., and Doonan, J.H. (2005).
High-throughput protein localization in Arabidopsis using
Agrobacterium-mediated transient expression of GFP-ORF fusions. Plant J. 41,
162-174.
Kovtun, Y., Chiu, W.-L., Tena, G., and Sheen, J. (2000). Functional analysis of oxidative
stress-activated mitogen-activated protein kinase cascade in plants. Proc. Natl.
Acad. Sci. USA 97, 2940-2945.
Kubista, M., Aakerman, B., and Norden, B. (1987). Characterization of interaction
between DNA and 4',6-diamidino-2-phenylindole by optical spectroscopy.
Biochemistry 26, 4545-4553.
Kulma, A., Villadsen, D., Campbell, D.G., Meek, S.E.M., Harthill, J.E., Nielsen, T.H.,
and MacKintosh, C. (2004). Phosphorylation and 14-3-3 binding of Arabidopsis
6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase. Plant J. 37, 654-667.
Kuromori, T., and Yamamoto, M. (2000). Members of the Arabidopsis 14-3-3 gene
family trans-complement two types of defects in fission yeast. Plant Sci. 158,
155-161.
Laemmli, U.K. (1970). Cleavage of Structural Proteins during the Assembly of the
Head of Bacteriophage T4. Nature 227, 680-685.
Lalonde, S., Ehrhardt, D.W., Loque, D., Chen, J., Rhee, S.Y., and Frommer, W.B. (2008).
Molecular and cellular approaches for the detection of protein-protein
interactions: latest techniques and current limitations. Plant J. 53, 610-635.
Lam, E. (2004). Controlled cell death, plant survival and development. Nat. Rev. Mol.
Cell Biol. 5, 305-315.
Lapointe, G., Luckevich, M.D., Cloutier, M., and Seguin, A. (2001). 14-3-3 gene family
in hybrid poplar and its involvement in tree defence against pathogens. J. Exp.
Bot. 52, 1331-1338.
References 204
Lawrence, R.J., Earley, K., Pontes, O., Silva, M., Chen, Z.J., Neves, N., Viegas, W., and
Pikaard, C.S. (2004). A concerted DNA methylation/histone methylation switch
regulates rRNA gene dosage control and nucleolar dominance. Mol. Cell 13,
599-609.
Lillo, C., Lea, U.S., Leydecker, M.T., and Meyer, C. (2003). Mutation of the regulatory
phosphorylation site of tobacco nitrate reductase results in constitutive
activation of the enzyme in vivo and nitrite accumulation. Plant J. 35, 566-573.
Lillo, C., Meyer, C., Lea, U.S., Provan, F., and Oltedal, S. (2004). Mechanism and
importance of post-translational regulation of nitrate reductase. J. Exp. Bot. 55,
1275-1282.
Liu, D., Bienkowska, J., Petosa, C., Collier, R.J., Fu, H., and Liddington, R. (1995).
Crystal structure of the zeta isoform of the 14-3-3 protein. Nature 376,
191-194.
Logemann, E., Birkenbihl, R.P., Ü lker, B., and Somssich, I.E. (2006). An improved
method for preparing Agrobacterium cells that simplifies the Arabidopsis
transformation protocol. Plant Methods 2, 16.
Lu, G., Sehnke, P.C., and Ferl, R.J. (1994). Phosphorylation and calcium binding
properties of an Arabidopsis GF14 brain protein homolog. Plant Cell 6,
501-510.
Lu, G., DeLisle, A.J., de Vetten, N.C., and Ferl, R.J. (1992). Brain proteins in plants: an
Arabidopsis homolog to neurotransmitter pathway activators is part of a DNA
binding complex. Proc. Natl. Acad. Sci. USA 89, 11490-11494.
Lu, Z.-X., Laroche, A., and Huang, H.C. (2004). Segregation patterns for integration
and expression of Coniothyrium minitans xylanase gene in Arabidopsis thaliana
transformants. Bot. Bull. Acad. Sin. (Taipei) 45, 23-31.
Luo, Z.-j., Zhang, X.-f., Rapp, U., and Avruch, J. (1995). Identification of the 14.3.3 ζ
domains important for self-association and Raf binding. J. Biol. Chem. 270,
23681-23687.
MacKintosh, C. (2004). Dynamic interactions between 14-3-3 proteins and
phosphoproteins regulate diverse cellular processes. Biochem. J. 381, 329-342.
Mackintosh, C., Douglas, P., and Lillo, C. (1995). Identification of a protein that
inhibits the phosphorylated form of nitrate reductase from spinach (Spinacia
oleracea) leaves. Plant Physiol. 107, 451-457.
Magliery, T.J., Wilson, C.G.M., Pan, W., Mishler, D., Ghosh, I., Hamilton, A.D., and
Regan, L. (2005). Detecting protein-protein interactions with a green
fluorescent protein fragment reassembly trap: scope and mechanism. J. Am.
Chem. Soc. 127, 146-157.
Marchant, A., Kargul, J., May, S.T., Muller, P., Delbarre, A., Perrot-Rechenmann, C.,
and Bennett, M.J. (1999). AUX1 regulates root gravitropism in Arabidopsis by
facilitating auxin uptake within root apical tissues. EMBO J. 18, 2066-2073.
References 205
Marmagne, A., Ferro, M., Meinnel, T., Bruley, C., Kuhn, L., Garin, J., Barbier-Brygoo,
H., and Ephritikhine, G. (2007). A high content in lipid-modified peripheral
proteins and integral receptor kinases features in the Arabidopsis plasma
membrane proteome. Mol. Cell. Proteomics 6, 1980-1996.
Maudoux, O., Batoko, H., Oecking, C., Gevaert, K., Vandekerckhove, J., Boutry, M.,
and Morsomme, P. (2000). A plant plasma membrane H+-ATPase expressed in
yeast is activated by phosphorylation at its penultimate residue and binding of
14-3-3 regulatory proteins in the absence of fusicoccin. J. Biol. Chem. 275,
17762-17770.
May, T., and Soll, J. (2000). 14-3-3 proteins form a guidance complex with chloroplast
precursor proteins in plants. Plant Cell 12, 53-64.
McCabe, P.F., and Leaver, C.J. (2000). Programmed cell death in cell cultures. Plant
Mol. Biol. 44, 359-368.
Mhawech, P. (2005). 14-3-3 proteins - an update. Cell Res. 15, 228-236.
Minet, M., Dufour, M.-E., and Lacroute, F. (1992). Complementation of
Saccharomyces cerevisiae auxotrophic mutants by Arabidopsis thaliana cDNAs.
Plant J. 2, 417-422.
Moore, B.W., and Perez, V.J. (1967). Specific acidic proteins of the nervous system. In
Physiological and Biochemical Aspects of Nervous Integration, F. Carlton, ed
(Prentice Hall), pp. 343-359.
Moorhead, G., Douglas, P., Morrice, N., Scarabel, M., Aitken, A., and Mackintosh, C.
(1996). Phosphorylated nitrate reductase from spinach leaves is inhibited by
14-3-3 proteins and activated by fusicoccin. Curr. Biol. 6, 1104-1113.
Moorhead, G., Douglas, P., Cotelle, V., Harthill, J., Morrice, N., Meek, S., Deiting, U.,
Stitt, M., Scarabel, M., Aitken, A., and MacKintosh, C. (1999).
Phosphorylation-dependent interactions between enzymes of plant
metabolism and 14-3-3 proteins. Plant J. 18, 1-12.
Morsy, M., Gouthu, S., Orchard, S., Thorneycroft, D., Harper, J.F., Mittler, R., and
Cushman, J.C. (2008). Charting plant interactomes: possibilities and challenges.
Trends Plant Sci. 13, 183-191.
Mrowiec, T., and Schwappach, B. (2006). 14-3-3 proteins in membrane protein
transport. Biol. Chem. 387, 1227-1236.
Nair, R., and Rost, B. (2005). Mimicking Cellular Sorting Improves Prediction of
Subcellular Localization. J. Mol. Biol. 348, 85-100.
Nelson, B.K., Cai, X., and Nebenführ, A. (2007). A multicolored set of in vivo organelle
markers for co-localization studies in Arabidopsis and other plants. Plant J. 51,
1126-1136.
Nufer, O., and Hauri, H.-P. (2003). ER export: Call 14-3-3. Curr. Biol. 13, R391-R393.
References 206
Oecking, C., and Hagemann, K. (1999). Association of 14-3-3 proteins with the
C-terminal autoinhibitory domain of the plant plasma-membrane H+-ATPase
generates a fusicoccin-binding complex. Planta 207, 480-482.
Oecking, C., and Jaspert, N. (2009). Plant 14-3-3 proteins catch up with their
mammalian orthologs. Curr. Opin. Plant Biol. 12, 760-765.
Oecking, C., Eckerskorn, C., and Weiler, E.W. (1994). The fusicoccin receptor of plants
is a member of the 14-3-3 superfamily of eukaryotic regulatory proteins. FEBS
Lett. 352, 163-166.
Oecking, C., Piotrowski, M., Hagemeier, J., and Hagemann, K. (1997). Topology and
target interaction of the fusicoccin-binding 14-3-3 homologs of Commelina
communis. Plant J. 12, 441-453.
Ohad, N., Shichrur, K., and Yalovsky, S. (2007). The analysis of protein-protein
interactions in plants by bimolecular fluorescence complementation. Plant
Physiolology 145, 1090-1099.
Olsson, A., Svennelid, F., Ek, B., Sommarin, M., and Larsson, C. (1998). A
phosphothreonine residue at the C-terminal end of the plasma membrane
H+-ATPase is protected by fusicoccin-induced 14-3-3 binding. Plant Physiol. 118,
551-555.
Ottmann, C., Marco, S., Jaspert, N., Marcon, C., Schauer, N., Weyand, M.,
Vandermeeren, C., Duby, G., Boutry, M., Wittinghofer, A., Rigaud, J.-L., and
Oecking, C. (2007). Structure of a 14-3-3 coordinated hexamer of the plant
plasma membrane H+-ATPase by combining X-ray crystallography and electron
cryomicroscopy. Mol. Cell 25, 427-440.
Overmyer, K., Brosche, M., and Kangasjarvi, J. (2003). Reactive oxygen species and
hormonal control of cell death. Trends Plant Sci. 8, 335-342.
Palmgren, M.G. (2001). PLANT PLASMA MEMBRANE H+-ATPases: powerhouses for
nutrient uptake. Annu. Rev. Plant Physiol. Plant Mol. Biol. 52, 817-845.
Pan, S., Sehnke, P.C., Ferl, R.J., and Gurley, W.B. (1999). Specific interactions with TBP
and TFIIB in vitro suggest that 14-3-3 proteins may participate in the regulation
of transcription when part of a DNA binding complex. Plant Cell 11, 1591-1602.
Pandey, R., Muller, A., Napoli, C.A., Selinger, D.A., Pikaard, C.S., Richards, E.J.,
Bender, J., Mount, D.W., and Jorgensen, R.A. (2002). Analysis of histone
acetyltransferase and histone deacetylase families of Arabidopsis thaliana
suggests functional diversification of chromatin modification among
multicellular eukaryotes. Nucl. Acids Res. 30, 5036-5055.
Paul, A.-L., Sehnke, P.C., and Ferl, R.J. (2005). Isoform-specific subcellular localization
among 14-3-3 proteins in Arabidopsis seems to be driven by client interactions.
Mol. Biol. Cell 16, 1735-1743.
Paul, A.-L., Liu, L., McClung, S., Laughner, B., Chen, S., and Ferl, R.J. (2009).
Comparative interactomics: Analysis of Arabidopsis 14-3-3 complexes reveals
References 207
highly conserved 14-3-3 interactions between humans and plants. J. Proteome
Res. 8, 1913-1924.
Paul, C.B., and Russell, L.J. (2001). Cell death of barley aleurone protoplasts is
mediated by reactive oxygen species. Plant J. 25, 19-29.
Pendle, A.F., Clark, G.P., Boon, R., Lewandowska, D., Lam, Y.W., Andersen, J., Mann,
M., Lamond, A.I., Brown, J.W.S., and Shaw, P.J. (2005). Proteomic analysis of
the Arabidopsis nucleolus suggests novel nucleolar functions. Mol. Biol. Cell 16,
260-269.
Pennell, R.I., and Lamb, C. (1997). Programmed cell death in plants. Plant Cell 9,
1157-1168.
Piotrowski, M. (2008). Primary or secondary? Versatile nitrilases in plant metabolism.
Phytochemistry 69, 2655-2667.
Pracharoenwattana, I., Cornah, J.E., and Smith, S.M. (2005). Arabidopsis peroxisomal
citrate synthase is required for fatty acid respiration and seed germination.
Plant Cell 17, 2037-2048.
Preacher, K.J. (2001). Calculation for the chi-square test: an interactive calculation
tool for chi-square tests of goodness of fit and independence [Computer
software]. Available from http://www.quantpsy.org.
Purwestri, Y.A., Ogaki, Y., Tamaki, S., Tsuji, H., and Shimamoto, K. (2009). The 14-3-3
protein GF14c acts as a negative regulator of flowering in rice by interacting
with the florigen Hd3a. Plant Cell Physiol. 50, 429-438.
Repka, V., Fischerová, I., and Šilhárová, K. (2004). Methyl jasmonate is a potent
elicitor of multiple defense responses in grapevine leaves and cell-suspension
cultures. Biologia Plantarum 48, 273-283.
Reumann, S., Quan, S., Aung, K., Yang, P., Manandhar-Shrestha, K., Holbrook, D.,
Linka, N., Switzenberg, R., Wilkerson, C.G., Weber, A.P.M., Olsen, L.J., and Hu,
J. (2009). In-depth proteome analysis of Arabidopsis leaf peroxisomes
combined with in vivo subcellular targeting verification indicates novel
metabolic and regulatory functions of peroxisomes. Plant Physiol. 150,
125-143.
Riedel, J., Tischner, R., and Mack, G. (2001). The chloroplastic glutamine synthetase
(GS-2) of tobacco is phosphorylated and associated with 14-3-3 proteins inside
the chloroplast. Planta 213, 396-401.
Rienties, I.M., Vink, J., Borst, J.W., Russinova, E., and de Vries, S.C. (2005). The
Arabidopsis SERK1 protein interacts with the AAA-ATPase AtCDC48, the 14-3-3
protein GF14λ and the PP2C phosphatase KAPP. Planta 221, 394-405.
Rittinger, K., Budman, J., Xu, J., Volinia, S., Cantley, L.C., Smerdon, S.J., Gamblin, S.J.,
and Yaffe, M.B. (1999). Structural analysis of 14-3-3 phosphopeptide
complexes identifies a dual role for the nuclear export signal of 14-3-3 in ligand
binding. Mol. Cell 4, 153-166.
References 208
Roberts, M.R. (2003). 14-3-3 Proteins find new partners in plant cell signalling. Trends
Plant Sci. 8, 218-223.
Roberts, M.R., and Bowles, D.J. (1999). Fusicoccin, 14-3-3 proteins, and defense
responses in tomato plants. Plant Physiol. 119, 1243-1250.
Romeis, T., Ludwig, A.A., Martin, R., and Jones, J.D.G. (2001). Calcium-dependent
protein kinases play an essential role in a plant defence response. EMBO J. 20,
5556-5567.
Rosenquist, M. (2003). 14-3-3 proteins in apoptosis. Brazilian Journal of Medical &
Biological Research 36, 403-408.
Rosenquist, M., Alsterfjord, M., Larsson, C., and Sommarin, M. (2001). Data mining
the Arabidopsis genome reveals fifteen 14-3-3 genes. Expression is
demonstrated for two out of five novel genes. Plant Physiol. 127, 142-149.
Rosenquist, M., Sehnke, P., Ferl, R.J., Sommarin, M., and Larsson, C. (2000).
Evolution of the 14-3-3 protein family: Does the large number of isoforms in
multicellular organisms reflect functional specificity? J. Mol. Evol. 51, 446-458.
Saint-Jore-Dupas, C., Nebenfuhr, A., Boulaflous, A., Follet-Gueye, M.-L., Plasson, C.,
Hawes, C., Driouich, A., Faye, L., and Gomord, V. (2006). Plant N-glycan
processing enzymes employ different targeting mechanisms for their spatial
arrangement along the secretory pathway. Plant Cell 18, 3182-3200.
Sambrook, J., Fritsch, E.F., and Maniatis, T. (1989). Molecular Cloning: A Laboratory
Manual. (New York: Cold Spring Harbor Laboratory Press).
Schütze, K., Harter, K., and Chaban, C. (2009). Bimolecular Fluorescence
Complementation (BiFC) to study protein-protein interactions in living plant
cells. In Plant Signal Transduction, T. Pfannschmidt, ed (Humana Press), pp.
189-202.
Schoonheim, P.J., Veiga, H., da Costa Pereira, D., Friso, G., van Wijk, K.J., and de Boer,
A.H. (2007a). A comprehensive analysis of the 14-3-3 interactome in barley
leaves using a complementary proteomics and two-hybrid approach. Plant
Physiol. 143, 670-683.
Schoonheim, P.J., Sinnige, M.P., Casaretto, J.A., Veiga, H., Bunney, T.D., Quatrano,
R.S., and de Boer, A.H. (2007b). 14-3-3 adaptor proteins are intermediates in
ABA signal transduction during barley seed germination. Plant J. 49, 289-301.
Schultz, T.F., Medina, J., Hill, A., and Quatrano, R.S. (1998). 14-3-3 proteins are part
of an abscisic acid-VIVIPAROUS1 (VP1) response complex in the Em promoter
and interact with VP1 and EmBP1. Plant Cell 10, 837-847.
Sehnke, P.C., and Ferl, R.J. (2000). Plant 14-3-3s: omnipotent metabolic
phosphopartners? Sci. STKE 2000, pe1-.
Sehnke, P.C., Henry, R., Cline, K., and Ferl, R.J. (2000). Interaction of a plant 14-3-3
protein with the signal peptide of a thylakoid-targeted chloroplast precursor
References 209
protein and the presence of 14-3-3 isoforms in the chloroplast stroma. Plant
Physiol. 122, 235-241.
Sehnke, P.C., Chung, H.-J., Wu, K., and Ferl, R.J. (2001). Regulation of starch
accumulation by granule-associated plant 14-3-3 proteins. Proc. Natl. Acad. Sci.
USA 98, 765-770.
Sehnke, P.C., Laughner, B., Cardasis, H., Powell, D., and Ferl, R.J. (2006). Exposed loop
domains of complexed 14-3-3 proteins contribute to structural diversity and
functional specificity. Plant Physiol. 140, 647-660.
Shaner, N.C., Campbell, R.E., Steinbach, P.A., Giepmans, B.N.G., Palmer, A.E., and
Tsien, R.Y. (2004). Improved monomeric red, orange and yellow fluorescent
proteins derived from Discosoma sp. red fluorescent protein. Nat. Biotechnol.
22, 1567-1572.
Sheen, J. (2001). Signal transduction in maize and Arabidopsis mesophyll protoplasts.
Plant Physiol. 127, 1466-1475.
Shen, W., Clark, A.C., and Huber, S.C. (2003). The C-terminal tail of Arabidopsis
14-3-3ω functions as an autoinhibitor and may contain a tenth α-helix. Plant J.
34, 473-484.
Shikano, S., Coblitz, B., Wu, M., and Li, M. (2006). 14-3-3 proteins: regulation of
endoplasmic reticulum localization and surface expression of membrane
proteins. Trends Cell Biol. 16, 370-375.
Sinnige, M.P., Roobeek, I., Bunney, T.D., Visser, A.J.W.G., Mol, J.N.M., and de Boer,
A.H. (2005). Single amino acid variation in barley 14-3-3 proteins leads to
functional isoform specificity in the regulation of nitrate reductase. Plant J. 44,
1001-1009.
Sridha, S., and Wu, K. (2006). Identification of AtHD2C as a novel regulator of abscisic
acid responses in Arabidopsis. Plant J. 46, 124-133.
Staswick, P.E., Su, W., and Howell, S.H. (1992). Methyl jasmonate inhibition of root
growth and induction of a leaf protein are decreased in an Arabidopsis
thaliana mutant. Proc. Natl. Acad. Sci. USA 89, 6837-6840.
Su, W., Huber, S.C., and Crawford, N.M. (1996). Identification in vitro of a
post-translational regulatory site in the hinge 1 region of Arabidopsis nitrate
reductase. Plant Cell 8, 519-527.
Sugden, C., Donaghy, P.G., Halford, N.G., and Hardie, D.G. (1999). Two SNF1-related
protein kinases from spinach leaf phosphorylate and inactivate
3-hydroxy-3-methylglutaryl-coenzyme A reductase, nitrate reductase, and
sucrose phosphate synthase in vitro. Plant Physiol. 120, 257-274.
Sullivan, S., Thomson, C.E., Kaiserli, E., and Christie, J.M. (2009). Interaction
specificity of Arabidopsis 14-3-3 proteins with phototropin receptor kinases.
FEBS Lett. 583, 2187-2193.
References 210
Svennelid, F., Olsson, A., Piotrowski, M., Rosenquist, M., Ottman, C., Larsson, C.,
Oecking, C., and Sommarin, M. (1999). Phosphorylation of Thr-948 at the C
terminus of the plasma membrane H+-ATPase creates a binding site for the
regulatory 14-3-3 protein. Plant Cell 11, 2379-2392.
Taylor, N.J., and Fauquet, C.M. (2002). Microparticle bombardment as a tool in plant
science and agricultural biotechnology. DNA Cell Biol. 21, 963-977.
Toroser, D., Athwal, G.S., and Huber, S.C. (1998). Site-specific regulatory interaction
between spinach leaf sucrose-phosphate synthase and 14-3-3 proteins. FEBS
Lett. 435, 110-114.
Tzivion, G., Luo, Z., and Avruch, J. (1998). A dimeric 14-3-3 protein is an essential
cofactor for Raf kinase activity. Nature 394, 88-92.
Tzivion, G., Shen, Y.H., and Zhu, J. (2001). 14-3-3 proteins; bringing new definitions to
scaffolding. Oncogene 20, 6331-6338.
Ueki, S., Lacroix, B., Krichevsky, A., Lazarowitz, S.G., and Citovsky, V. (2008).
Functional transient genetic transformation of Arabidopsis leaves by biolistic
bombardment. Nat. Protocols 4, 71-77.
Ueno, Y., Ishikawa, T., Watanabe, K., Terakura, S., Iwakawa, H., Okada, K., Machida,
C., and Machida, Y. (2007). Histone deacetylases and ASYMMETRIC LEAVES2
are involved in the establishment of polarity in leaves of Arabidopsis. Plant Cell
19, 445-457.
Vain, P., Afolabi, A.S., Worland, B., and Snape, J.W. (2003). Transgene behaviour in
populations of rice plants transformed using a new dual binary vector system:
pGreen/pSoup. Theor. Appl. Genet. 107, 210-217.
van Hemert, M.J., Steensma, H.Y., and Heusden, G.P.H.v. (2001). 14-3-3 proteins: key
regulators of cell division, signalling and apoptosis. BioEssays 23, 936-946.
van Heusden, G.P.H., van der Zanden, A.L., Ferl, R.J., and Steensma, H.Y. (1996). Four
Arabidopsis thaliana 14-3-3 protein isoforms can complement the lethal yeast
bmh1 bmh2 double disruption. FEBS Lett. 391, 252-256.
Voinnet, O., Rivas, S., Mestre, P., and Baulcombe, D. (2003). An enhanced transient
expression system in plants based on suppression of gene silencing by the p19
protein of tomato bushy stunt virus. Plant J. 33, 949-956.
Würtele, M., Jelich-Ottmann, C., Wittinghofer, A., and Oecking, C. (2003). Structural
view of a fungal toxin acting on a 14-3-3 regulatory complex. EMBO J. 22,
987-994.
Waadt, R., Schmidt, L.K., Lohse, M., Hashimoto, K., Bock, R., and Kudla, J. (2008).
Multicolor bimolecular fluorescence complementation (mcBiFC) reveals
simultaneous formation of alternative CBL/CIPK complexes in planta. Plant J.
56, 505-516.
Walter, M., Chaban, C., Schütze, K., Batistic, O., Weckermann, K., Näke, C., Blazevic,
D., Grefen, C., Schumacher, K., Oecking, C., Harter, K., and Kudla, J. (2004).
References 211
Visualization of protein interactions in living plant cells using bimolecular
fluorescence complementation. Plant J. 40, 428-438.
Wang, A.H., Kruhlak, M.J., Wu, J., Bertos, N.R., Vezmar, M., Posner, B.I., Bazett-Jones,
D.P., and Yang, X.-J. (2000). Regulation of histone deacetylase 4 by binding of
14-3-3 proteins. Mol. Cell. Biol. 20, 6904-6912.
Wang, H., Qi, M., and Cutler, A.J. (1993). A simple method of preparing plant samples
for PCR. Nucl. Acids Res. 21, 4153-4154.
Watson, P., and Stephens, D.J. (2005). ER-to-Golgi transport: Form and formation of
vesicular and tubular carriers. Biochim. Biophys. Acta 1744, 304-315.
Weigel, D., and Glazebrook, J. (2002). Arabidopsis: a laboratory manual. (New York:
Cold Spring Harbor Laboratory Press).
Wilker, E.W., Grant, R.A., Artim, S.C., and Yaffe, M.B. (2005). A structural basis for
14-3-3σ functional specificity. J. Biol. Chem. 280, 18891-18898.
Witte, C.-P., Noël, L., Gielbert, J., Parker, J., and Romeis, T. (2004). Rapid one-step
protein purification from plant material using the eight-amino acid StrepII
epitope. Plant Mol. Biol. 55, 135-147.
Wittig, I., Braun, H.-P., and Schagger, H. (2006). Blue native PAGE. Nat. Protocols 1,
418-428.
Wroblewski, T., Tomczak, A., and Michelmore, R. (2005). Optimization of
Agrobacterium-mediated transient assays of gene expression in lettuce,
tomato and Arabidopsis. Plant Biotechnol. J. 3, 259-273.
Wu, K., Rooney, M.F., and Ferl, R.J. (1997a). The Arabidopsis 14-3-3 multigene family.
Plant Physiol. 114, 1421-1431.
Wu, K., Lu, G., Sehnke, P., and Ferl, R.J. (1997b). The heterologous interactions among
plant 14-3-3 proteins and identification of regions that are important for
dimerization. Arch. Biochem. Biophys. 339, 2-8.
Wu, K., Tian, L., Malik, K., Brown, D., and Miki, B. (2000). Functional analysis of HD2
histone deacetylase homologues in Arabidopsis thaliana. Plant J. 22, 19-27.
Xiao, B., Smerdon, S.J., Jones, D.H., Dodson, G.G., Soneji, Y., Aitken, A., and Gamblin,
S.J. (1995). Structure of a 14-3-3 protein and implications for coordination of
multiple signalling pathways. Nature 376, 188-191.
Xu, W.F., and Shi, W.M. (2006). Expression profiling of the 14-3-3 gene family in
response to salt stress and potassium and iron deficiencies in young tomato
(Solanum lycopersicum) roots: analysis by real-time RT-PCR. Ann Bot 98,
965-974.
Yaffe, M.B. (2002). How do 14-3-3 proteins work? Gatekeeper phosphorylation and
the molecular anvil hypothesis. FEBS Lett. 513, 53-57.
Yaffe, M.B., Rittinger, K., Volinia, S., Caron, P.R., Aitken, A., Leffers, H., Gamblin, S.J.,
Smerdon, S.J., and Cantley, L.C. (1997). The structural basis for
14-3-3:phosphopeptide binding specificity. Cell 91, 961-971.
References 212
Yang, Y., Costa, A., Leonhardt, N., Siegel, R., and Schroeder, J. (2008). Isolation of a
strong Arabidopsis guard cell promoter and its potential as a research tool.
Plant Methods 4, 6.
Yao, Y., Du, Y., Jiang, L., and Liu, J.-Y. (2007). Molecular analysis and expression
patterns of the 14-3-3 gene family from Oryza Sativa. J. Biochem. Mol. Biol. 40,
349-357.
Yoo, S.-D., Cho, Y.-H., and Sheen, J. (2007). Arabidopsis mesophyll protoplasts: a
versatile cell system for transient gene expression analysis. Nat. Protocols 2,
1565-1572.
Zhang, L., and Xing, D. (2008). Methyl jasmonate induces production of reactive
oxygen species and alterations in mitochondrial dynamics that precede
photosynthetic dysfunction and subsequent cell death. Plant Cell Physiol. 49,
1092-1111.
Zhong, S., Lin, Z., Fray, R., and Grierson, D. (2008). Improved plant transformation
vectors for fluorescent protein tagging. Transgenic Res. 17, 985-989.
Zhou, C., Labbe, H., Sridha, S., Wang, L., Tian, L., Latoszek-Green, M., Yang, Z., Brown,
D., Miki, B., and Wu, K. (2004). Expression and function of HD2-type histone
deacetylases in Arabidopsis development. Plant J. 38, 715-724.
Zimmermann, P., Hirsch-Hoffmann, M., Hennig, L., and Gruissem, W. (2004).
GENEVESTIGATOR. Arabidopsis microarray database and analysis toolbox.
Plant Physiol. 136, 2621 - 2632.
Zybailov, B., Rutschow, H., Friso, G., Rudella, A., Emanuelsson, O., Sun, Q., and van
Wijk, K.J. (2008). Sorting signals, N-terminal modifications and abundance of
the chloroplast proteome. PLoS ONE 3, e1994.
Appendices 213
Appendices
Appendix I: Media and Solutoins 214
Appendix I: Media and solutions
Solutions for plasmid minipreps (Sambrook et al., 1989)
Miniprep Solution I: 50 mM glucose, 10 mM EDTA, 25 mM Tris-HCl pH 8.0. Sterilise by
autoclaving.
Miniprep Solution II: 0.2 M NaOH, 1% SDS (freshly prepared).
Miniprep Solution III: 3 M sodium acetate, pH 4.7. Sterilise by autoclaving.
100% ethanol.
Sterile MQ H2O: autoclaved Milli-Q water.
Agarose gel electrophoresis
Agarose (Bioline).
1 x TAE running buffer (40 mM Tris-acetate, 1 mM EDTA). For convenience, make 50 x
TAE as a stock solution.
50x TAE (1L):
242 g Tris base
57.1 ml glacial acetic acid
100 ml 0.5 M EDTA (pH 8.0)
Orange G loading dye, 10x: 10 mM Tris-HCl, pH 8.0, 50 mM EDTA, 0.5% Orange G
(Sigma), 50% glycerol.
Ethidium bromide (1% solution, Applichem).
DNA ladder: Hyperladder I (Bioline).
Polymerase Chain Reaction (PCR)
BIOTAQ® DNA polymerase (Bioline).
10x NH4 Reaction Buffer (Bioline): 160 mM (NH4)2SO4, 670 mM Tris-HCl (pH8.8 at
25°C), 0.1% Tween-20.
MgCl2 stock solution (Bioline): 50 mM MgCl2.
Appendix I: Media and Solutoins 215
dNTP mix (10 mM total): prepared from 100 mM stock solution of dATP, dCTP, dGTP
and dTTP (Bioline) by combining 2.5 mM of each.
Accuzyme® polymerase (Bioline).
10x AccuBuffer (Bioline): 600 mM Tris-HCl (pH8.3 at 25°C), 60 mM (NH4)2SO4, 100 mM
KCl, 20 mM MgSO4.
Chill-out 14® Liquid wax (MJ Research Inc.).
BigDye® DNA sequencing reaction
BigDye® Terminator v3.1 reaction mix [Applied Biosystems; purchased an aliquot from
Lotterywest Biomedical Facility: Genomics (LSBFG), Perth, Australia].
2.5x BigDye® sequencing buffer (Applied Biosystems, provided by LSBFG).
3 M sodium acetate, pH 4.6-4.7.
Preparation of competent E. coli cells
LB medium (1L): 10 g bacteriological tryptone, bacteriological yeast extract, 5 g NaCl,
pH 7.5.
LB plate: LB medium containing 15 g/L of bacteriological agar, autoclave sterilised.
LB medium containing 20 mM MgSO4.
TFB 1: 30 mM potassium acetate, 10 mM CaCl2, 50 mM MnCl2, 100 mM RbCl, 15%
glycerol. Adjust pH to 5.8 with 1 M acetic acid. 0.22 μm filter-sterilised.
TFB 2: 75 mM CaCl2, 10 mM RbCl, 15% glycerol, 10 mM MOPS or PIPES. Adjust pH to
6.5 with 1M KOH. 0.22 μm filter-sterilised.
Isolation of Arabidopsis thaliana mesophyll protoplasts
Protoplasting solution: 1% Cellulase (onozuka R-10; Duchefa Biochemie, Netherlands),
0.2% Macerozyme (Duchefa Biochemie), 0.4 M sucrose, 20 mM KCl, 10 mM CaCl2, 20
mM MES-KOH, pH 5.7; 0.45 μm filtered.
W5 solution: 154 mM NaCl, 125 mM CaCl2, 5 mM KCl, 2 mM MES-KOH, pH 5.7.
Appendix I: Media and Solutoins 216
PS-1: A very gentle shaking motion (30 rpm) during the cell wall digestion process
helped in releasing protoplasts.
PS-2: a 75 μm nylon mesh was recommended to the use of sieving out undigested leaf
debris from the protoplasts by Yoo et al. (2007).
PEG-mediated transfection of A. thaliana mesophyll protoplasts
MaMg solution: 0.4 M mannitol, 15 mM MgCl2, 5 mM MES-KOH, pH 5.7
PEG-calcium solution: 40% (w/v) PEG 3350 (Sigma), 0.2 M mannitol, 100 mM CaCl2
PS: PEG4000 (Fluka, cat. no. 81240) was reported to perform an optimal protoplast
transfection efficiency (Yoo, et al. 2007)
Infiltration of Nicotiana benthamiana leaves
Acetosyringone (3, 5-Dimethoxy-4-hydroxy-acetophenone, Fluka, cat. No. 38766):
prepare 200 mM stock solution in DMSO.
Infiltration buffer: 10 mM MgCl2, 200 μM acetosyringone, 10 mM MES-KOH, pH 5.6.
Generation of transgenic Arabidopsis using floral dip transformation
5% sucrose (prepare freshly before use).
Silwet L-77 (Lehle Seeds, Cat# VIS-01).
Arabidopsis seed sterilisation
Anti-bacterial tablets (Milton): containing 50% sodium dichloroisocyanurate.
Seed sterilisation solution: resolve 0.0625 g of the ground up anti-bacterial tablet
powder in 1 ml deionised water, then add a drop of 1% Tween-20 and 9 ml of 95%
ethanol.
Screening Arabidopsis transformants
Basta® (200 g/L glufosinate ammonium, Hoechst, Australia).
Hygromycin B (100 mg/ml in H2O, A. G. Scientific Inc., USA).
Appendix I: Media and Solutoins 217
1/2 MS medium plates: Murashige and Skoog (MS) basal salt mixture (Sigma, cat. No.
M5524) 2.15 g/L, 0.5% sucrose, 2 mM MES, pH 5.7, 0.8% agar.
PCR genotyping- a fast method
0.5 N NaOH
100 mM Tris, pH 8.0
Plant genomic DNA isolation -the CTAB method
Chloroform: Isoamyl alcohol (24:1, v/v)
CTAB extraction buffer:
1.4 M NaCl
100 mM Tris-HCl, pH 8.0
20 mM EDTA
2% (w/v) Ethyltrimethylammonium Bromide (CTAB)
1% (w/v) polycinylpyrollidine (PVP-40)
Heat the solution to dissolve and then autoclave.
Add β-Mercaptoethanol to 0.2% (v/v) before use.
RNase A solution (4 mg/ml, Invitrogen)
100% Isopropanol
Appendix II: Supplementary figures and tables 218
Appendix II: Supplementary figures and tables
Fig. S1. Strong background fluorescence adjacent to wound sites hindered evaluation of
BiFC experiments in infiltrated Arabidopsis leaves.
Epifluorescence and bright field images were captured from the same batch of agroinfiltrated
Arabidopsis leaves shown in Fig. 3-8. Strong background fluorescence was observed in the
cells surrounding the wounded leaf tissues. Scale bars = 50 μm.
Appendix II: Supplementary figures and tables 219
Table S1. Phenotypic variations of 14-3-3-split YFP carrying T1
transformants.
This table summarises aberrant phenotypes observed in eighteen 14-3-3-split YFP carrying T1
transformants. Observed phenotypes were grouped into ten categories for easier
comparisons between transformants.
Genotype T1 plant
Phenotypes
aberr
ant
leaf
morp
holo
gy
incre
ased
nu
mber
of ro
sett
e le
aves
serr
ate
d c
au
line leaves
aeria
l ro
sett
es o
n e
arly n
od
e
dela
y o
f flow
erin
g
(flo
ral bu
ds e
merg
ed >
10 w
after
sow
ing)
str
ong a
pic
al do
min
ance
(only
on
e p
rim
ary
ste
m)
inte
nsifie
d inflore
scence
bra
nches
short
ene
d s
tam
en f
ilam
ents
and
bro
wn
ish/im
ma
ture
anth
ers
short
ene
d s
iliq
ues o
r stu
nte
d s
iliqu
es
shru
nken s
ee
ds (
seed a
bort
ion)
epsilon∆-YN Ag29-1 x x x
epsilon∆-YC Ag20-1 x x x x
kappa-YN Ag31-7 x x x
Ag31-16 x x x x
kappa-YC
Ag32-1 x x
Ag32-9 x
Ag32-10 x
kappa∆-YC Ag34-1 x
Ag34-2 x x x x x
omega-YC Ag22-2 x x
omicron-YN Ag39-3 x x x x
Ag39-10 x x
omicron-YC Ag40-2 x
Ag40-7 x x
mu∆-YN Ag60-2 x x x
phi-YN Ag53-3 x x x
phi-YC Ag54-4 x x
Ag54-8 x