j ourna l homepage: www.e lsev ie r .com/ locate /gene
Identification and characterization of starvation induced msdgc-1promoter involved in the c-di-GMP turnover☆
Binod K. Bharati, R.K. Swetha, Dipankar Chatterji ⁎Molecular Biophysics Unit, Indian Institute of Science, Bangalore, 560012, India
Abbreviations:ONPG, o-nitrophenyl-β-D-galactopyranocfu, colony formingunit; EDTA, Ethylenedinitrilotetraacetic afluoride; 7H9,Middlebrook-7H9; BRIT, Boardof Radiation anletionmutant ofM. smegmatis rel gene; DGCOE,MSMEG_219deletion mutant ofMSMEG_2196; DGCCO, DGCKO complem☆ We thank the Department of Biotechnology, Goverfinancial support and Indian Institute of Science, Bangalor⁎ Corresponding author. Tel.: +91 80 22932836; fax: +
C-di-GMP [Bis-(3′-5′)-cyclic-dimeric-guanosine monophosphate], a second messenger is involved in intracellu-lar communication in the bacterial species. As a result several multi-cellular behaviors in both Gram-positive andGram-negative bacteria are directly linked to the intracellular level of c-di-GMP. The cellular concentration of c-di-GMP is maintained by two opposing activities, diguanylate cyclase (DGC) and phosphodiesterase (PDE-A). InMycobacterium smegmatis, a single bifunctional protein MSDGC-1 is responsible for the cellular concentration ofc-di-GMP. A better understanding of the regulation of c-di-GMP at the genetic level is necessary to control thefunction of above two activities. In this work, we have characterized the promoter element present in msdgc-1along with the +1 transcription start site and identified the sigma factors that regulate the transcription ofmsdgc-1. Interestingly, msdgc-1 utilizes SigA during the initial phase of growth, whereas near the stationaryphase SigB containing RNA polymerase takes over the expression ofmsdgc-1. We report here that the promoteractivity of msdgc-1 increases during starvation or depletion of carbon source like glucose or glycerol. Whenmsdgc-1 is deleted, the numbers of viable cells are ~10 times higher in the stationary phase in comparison tothat of the wild type. We propose here that msdgc-1 is involved in the regulation of cell population density.
The bacterial second messenger c-di-GMP is used extensively inboth Gram-positive and Gram-negative organisms, and is involvedin intracellular communication, adaptation, biofilm formation, virulenceand long-term survival (Bharati et al., 2012; Brouillette et al., 2005;Karaolis et al., 2005; Paul et al., 2004). The cellular concentration ofc-di-GMP is maintained by the balance between diguanylate cyclase(DGC, synthesis) and phosphodiesterase (PDE, hydrolysis) activities(Christen et al., 2005; Paul et al., 2004; Tal et al., 1998). The character-istic activities of GGDEF and EAL domains are associated with theconserved signature motifs, GGDEF and EAL in the respective domains(Ausmees et al., 2001; Simm et al., 2004). Although there is an abun-dance of genes synthesizing GGDEF/EAL domain proteins in Gram-negative bacteria, in an organism like Gram positive Mycobacteriumsmegmatis there is only one functional copy of this gene present, thusmaking the system amenable for detailed molecular studies. We have
side;DMF, Dimethylformamide;cid; PMSF, Phenylmethylsulfonyld Isotope Technology; RelKO, de-6 over expressing strain; DGCKO,ented withMSMEG_2196.nment of India, New Delhi fore for the fellowship.91 80 23600535.
rji).
ights reserved.
extensively studied this protein and showed that the presence of allthe domains GAF, GGDEF and EAL in tandem arrangement is necessaryfor either of the activity (Bharati et al., 2012). Towards the global role ofc-di-GMP, it has been shown recently that Ms6479 (LtmA) specificallybindswith c-di-GMP and recognizes the promoters of 37 lipid transportand metabolism genes. Overexpression of Ms6479 in M. smegmatissignificantly reduces the permeability of the cell wall (Li and He, 2012).
The study of regulation and expression of the genes inmycobacteriain response to the harsh environmental condition is necessary to under-stand its survival strategy and growth inside the host. The expression ofspecific gene is carried out by amulti-subunit enzyme, RNA polymerasein complexwith gene's promoter and different sigma factors. It has beenreported earlier that there are 13 sigma factors in Mycobacteriumtuberculosis and their role in dormancy is not fully characterized (Coleet al., 1998; Manganelli et al., 1999, 2004). The principal sigma factorSigA is constitutively expressed and regulates the transcription ofnumerous housekeeping genes in M. tuberculosis (Manganelli et al.,1999; Wu et al., 2004). SigB is a principal-like sigma factor that is 62%homologous to SigA. It is induced under various stress conditions thatinclude exposure to sodium dodecyl sulfate (SDS), heat shock, coldshock, low aeration, and stationary phase (Manganelli et al., 1999).SigF shares 32% homology to SigB and is classified as a stress responsesigma factor capable of being induced by heat shock, mild cold shock,and nutrient starvation (Manganelli et al., 1999, 2004; Mukherjee andChatterji, 2005). Other sigma factor genes (SigC, SigD, SigE, SigG,SigH, SigI, SigJ, SigK, SigL, and SigM) are classified as extra-cytoplasmicsigma factors,which regulate cell envelope synthesis, secretory functions,
bkpm1000F GACGTGCCCGGCATCATCTAGAACGCCACCTCTCGCbkpm 500 F ACACCGGGATCTAGATCACCACGCTCGGTCTCGACGbkpm 500R ACTCGGCGACGAGCATGCTGGCGTGGGCGCGGTGGbkpm 200 F ACGACGGCGAACTCTAGAAACTCTCGGCGGGCCACGPSDBKF AGAAGAACTTCGTCGTGCGACTGTCCTCGPSDBKR TGCATATGGAAGTGATTCCTCCGGATATCGCMap2 GGAAGTGATTCCTCCGGATATCGBKF 129 TTCGCGCCACGGCGGCCGCTACGGAGCCGGBKF T129C TTCGCGCCACGCCCGCCGATACGGAGCCGGBKF T133G TTCGCGCCACGCCCGTCGAGACGGAGCCGG
100 B.K. Bharati et al. / Gene 528 (2013) 99–108
and periplasmic protein repair and degradation in mycobacteria (Coleet al., 1998; Lonetto et al., 1994; Raman et al., 2006).
As the gene for synthesizing GGDEF/EAL domain protein inM. smegmatis is present in a single copy, we thought it would be worth-while to study its regulation. It has been reported before that theconcentration of c-di-GMP inside the cell is regulated by riboswitch.The highly conserved RNA domains (GEMM) are located upstream ofthe DGC and PDE-A, and control expression of the genes in cellularprocesses (Sudarsan et al., 2008). In another study it was shown thatthe binding of c-di-GMP to a conserved secondary motif RXXD (I-site),which is separated by 5 amino acids from conserved GGDEF (A-site)allosterically inhibits the c-di-GMP synthesis in the PleD protein(Christen et al., 2006).
Therefore, it appears that the various sequence motifs aroundGGDEF/EAL domains may play a significant role in controlling thelevel of this all important secondmessenger c-di-GMP.We have under-taken the present work with an aim to characterize the upstreampromoter element for msdgc-1 gene, transcription start site, and sigmafactors involved in regulation. We have shown here that the msdgc-1promoter is starvation induced and different sigma factors regulatepromoter activity in growth phase dependent manner. In addition, theexogenous addition of glucose in the culture media in the stationaryor late stationary phase results in significant decrease in the promoteractivity. Such experiments likely would help us to follow the role ofdifferent sequence elements around the promoter region.
2. Materials and methods
2.1. Bacterial strains and culture conditions
M. smegmatis wild-type, msdgc-1 knockout (DGCKO), msdgc-1 overexpression (DGCOE), msdgc-1 complement (DGCCO), and rel knockout(RelKO) strains were used in this study (Bharati et al., 2012; Mathewet al., 2004). The mycobacterial-Escherichia coli shuttle vector pSD5b, apromoterless vectorwasused for the cloning thedifferent lengths of up-stream promoter region of the gene MSMEG_2196 (msdgc-1). Theelectroporated M. smegmatis containing different constructs in pSD5Bwere grown in Middlebrook 7H9 (7H9, Difco) broth supplementedwith varying concentration of glucose or glycerol with 0.05% Tween80 (v/v). The E. coli (DH5α) was transformed with different promoterconstructs and used for the expression of msdgc-1 using plate assay inLB-agar plate. The different antibiotics kanamycin (30 μg/ml) andhygromycin (30 μg/ml) were used as andwhen required. The plate cul-tureswere grown in 7H9 containing 1.5% agar supplementedwith 2 and0.02% glucose with appropriate antibiotics. All the plasmids, strains andoligonucleotides used in this study are listed in Tables 1 and 2. Restric-tion enzymes used for cloning were procured from New EnglandBiolabs. DyNAzyme EXT polymerase (NEB) was used for cloningpurpose; Phusion (Finnzymes) and KOD (Novagen) were used for sitedirected mutagenesis following the manufacturer's instructions. All
the clones generated were confirmed by sequencing (MWG, Bangalore,India).
2.2. Cloning of putative msdgc-1 promoter regions
The upstream regions ofmsdgc-1 gene, approximately 1100, 500 and200 bp upstream promoter fragments from translation start site (TSS)were PCR amplified using primers bkpm1000F/bkpm500R, bkpm500F/bkpm500R, and bkpm200F/bkpm500R and cloned upstream of lacZgene, in a promoterless pSD5b vector. The amplicons were digestedwith XbaI and SphI restriction enzymes and ligated into pSD5b vec-tor, predigested with the same set of enzymes (Jain et al., 1997). Theresulting recombinant plasmids, pSD1021, pSD561, and pSD237(Table 1) therefore had the lacZ reporter gene just downstream ofthemsdgc-1 promoter. The recombinants plasmidswere electroporatedin M. smegmatis mc2155 competent cells and screened on 7H9-agarplates containing kanamycin (30 μg/ml) supplementedwith 2% glucose(Snapper et al., 1990). The M. smegmatis strains containing differentpromoter fragments were grown in 7H9 broth supplemented with var-ious glucose concentrations and β-galactosidase activities (promoteractivities) were measured.
2.3. Activity assay of β-galactosidase in liquid culture
For the measurement of β-galactosidase activities in liquid cultures,the M. smegmatis strains containing pSD5b, pSD1021, pSD571, andpSD237 plasmids were grown in 7H9-broth supplemented with 2, 0.2and 0.02% glucose containing 0.05% Tween 80(v/v), kanamycin(30 μg/ml) and harvested at different points of time and absorbance at600 nm (A600) was also recorded. The β-galactosidase activity (lacZ ex-pression)wasmeasured usingONPGunder different glucose concentra-tion and activity was calculated in terms of Miller Unit (Miller, 1972).The harvested cultures (1 ml) were resuspended in1 ml of Z buffer(60 mM Na2HPO4, 40 mM NaH2PO4, 10 mM KCl, 1 mM MgSO4 and50 mM β-mercaptoethanol). The cells were permeabilized with 100 μlchloroform and 50 μl (0.1% SDS). The cultures were mixed by vortexingfor 10 s and incubated at 37 °C for 5 min. Freshly prepared 0.2 ml of
Reference
in Snapper et al. (1990)transformed with pMVDGC_2196 kanr Bharati et al. (2012)-1 gene inM. smegmatis Bharati et al. (2012)is complemented in DGCKO strain Bharati et al. (2012)G_2965 (rel)gene Mathew et al. (2004)containing promoterless lacZ gene Jain et al. (1997)ing 200 bp msdgc-1 upstream region This studying 500 bp msdgc-1 upstream region This studying 1100 bpmsdgc-1 upstream region This studying 1.6 kb rel upstream region Jain et al. (2005)am rel promoter cloned in pSD5b with HgrR and KanR This study
101B.K. Bharati et al. / Gene 528 (2013) 99–108
ONPG (o-nitrophenyl-β-D-galactopyranoside, 4 mg/ml, made in Zbuffer) was added and further incubated at 37 °C for 30 min ormore till sufficient yellow color was produced as a result of product(o-nitrophenol) formation. The reaction time (min) was noted andreaction was stopped using 0.5 ml of 1 M Na2CO3. After centrifuga-tion for 3 min at 10,000 r.p.m., the absorbance at 420 nm (A420)and 550 nm (A550) were measured using a microplate reader(Spectra Max 340PC384, Molecular devices), and activities werecalculated in Miller Units using the following expression:
where time is measured in min and volume in ml.A420 is the absorbance due to the formation of o-nitrophenol, A550
is the scatter from the cell debris, and A600 is the measurement ofcell population density. The promoter activities of different promoterconstructs were measured in triplicates using three different liquidcultures. M. smegmatis transformed with empty pSD5b was used asnegative control.
2.4. Activity assay of β-galactosidase with exogenous addition of glucose
M. smegmatis cells transformed with pSD5b, pSD237, pSD571, andpSD1021 vectors containing putative promoter regions of msdgc-1gene were grown in 7H9-broth media supplemented with 0.02, 0.2and 2% glucose containing 0.05% Tween 80(v/v) and kanamycin(30 μg/ml). The glucose or glycerol was added (2%) to the growing cul-tures exogenously as indicated. The cultureswere harvested at differentpoints of time and promoter activities were measured as describedabove.
2.5. Measurement of diguanylate cyclase and phosphodiesterase activitieswith exogenous addition of glucose
For the estimation of diguanylate cyclase and phosphodiesteraseactivities of MSDGC-1 in the presence of glucose, the protein MSDGC-1 and PleD were purified and assayed as described earlier (Bharatiet al., 2012). In brief, the purifiedMSDGC-1 (5 μM)proteinwas incubat-edwith varying concentration of glucose (0.02 and 2%) in reaction buffercontaining 50 mM Tris–Cl; pH 7.9, 500 mMNaCl, 10 mMMgCl2, 5 mMβ-mercaptoethanol, 0.1 mM GTP (cold) and [α-P32]GTP [0.01 mCi μl−1
(370 Bq μl−1); BRIT, Hyderabad] at 37 °C for 30 min in 10 μl reactionvolume. Reactions were stopped by placing them in boiling water for5 min followed by centrifugation at 12,000 r.p.m. for 20 min at 4 °C.The supernatants (1 μl) were spotted on polyethyleneimine-celluloseplates (PEI-cellulose, Merck) and developed against 1:1.5 (v/v)(NH4)2SO4 and 1.5 M KH2PO4; pH 3.6 and plates were exposed to aphosphor-imager screen. The PleD protein from Caulobacter crescentuswas used as a positive control. The intensities of the spots were deter-mined using the Multi Gauge V2.3 (Fujifilm) software from Sciencelab. The experiments were done in triplicates.
2.6. Measurement of mycobacterial growth using colony forming unit
The strains used in these studies were wild-type M. smegmatismc2155, msdgc-1 overexpression (DGCOE), msdgc-1 knockout (DGCKO),and msdgc-1 complemented (DGCCO). The description of these strains,and method for viable cell counts assay have been described earlier(Bharati et al., 2012). In brief, all the strains were grown in 7H9-brothmedia supplemented with 2 and 0.02% glucose containing 0.05% (v/v)Tween 80 with appropriate antibiotics. The growth profiles were moni-tored by measuring their optical density at 600 nm (data not shown)and colony forming unit assay (cfu/ml). For viable cells counting (cfu),bacterial cultures were declumped with 0.5 mm glass beads before plat-ing on 7H9-agar plates, as previously described (Primm et al., 2000).
The numbers of colony forming units were determined at regular timeintervals. The experiments were done in triplicates.
2.7. β-Galactosidase activity of msdgc-1 promoter in rel knockout strainand vice-versa
For the measurement of msdgc-1 promoter activity in rel knockoutstrain (RelKO), pSD237 was electroporated in rel knockout strain ofM. smegmatis (Mathew et al., 2004). Similarly for the measurement ofrel promoter activity in msdgc-1 knockout strain (DGCKO), the 300 bpupstream region of M. tuberculosis rel was cloned in pR3hyl vector. Thisvector was generated from pSD5b vector (kanr, hygr), electroporated inDGCKO strain, and screened on 7H9-agar hygromycin plates (30 μg/ml).The β-galactosidase activities of both the strains, RelKO-pSD237 andDGCKO-pR3hyl, were measured in liquid cultures supplemented with2% and 0.02% glucose, and compared with the wild-type M. smegmatiselectroporated with pSD237 and pVJP16. The pVJP16 contains the up-stream promoter fragment (~1.6 kb) of rel gene from M. tuberculosis inpSD5b (Jain et al., 2005).
2.8. Mapping of (+1) transcription start site
The primer extension method was used to identify the (+1) tran-scription start site of the MSMEG_2196 gene (Jain et al., 2005;Sambrook et al., 1989). M. smegmatis transformed with pSD237 wasgrown for 72 h in 7H9-broth supplemented with 2% and 0.02% glucoseand harvested. The total RNA was isolated using an RNeasy minikit(QIAGEN) following the manufacturer's instructions. A total of 10to 12 μg of RNA was used to prepare cDNA using a primer (MAP2)end labeled with [γ-32P]ATP (BRIT, Hyderabad, India), and RevertAidMoloney murine leukemia virus reverse transcriptase (Fermentas).Sequencing-grade TaqDNApolymerase and dideoxynucleoside triphos-phates were obtained from Promega. The primer was designed approx-imately 212 bp downstream of the translational start site. A sequencingladder was prepared by the dideoxy mediated chain terminationmethod using the pSD237 plasmid as a template and Fmol DNA cyclesequencing system (Promega) with an annealing temperature of50 °C. A 6% polyacrylamide gel containing 6 M urea was run to resolvethe sequencing ladder and cDNA using TBE buffer. The gel was driedand exposed overnight, and a picture was obtained using a phosphor-imager screen.
2.9. Identification and mutation in −10 regions of msdgc-1 promoter
After the identification of transcription start site (+1), putative−10regions was searched in the upstream of the msdgc-1 gene. Themycobacterial −10 regions are much similar to E. coli promoter,unlike −35 regions (Bashyam et al., 1996). Site directed mutagenesiswas carried out in the putative −10 region using mega primer methodwith pSD237 as a template. The 1st and 5th T have been mutated to Cand G respectively, and promoter induction assay were performed inthe liquid culture after electroporation of the mutated promoter con-structs in M. smegmatis and compared with pSD237 in 2 and 0.02%glucose. The mutations were confirmed by DNA sequencing at MWG,Bangalore.
2.10. Promoter-specific pull down assay for the identification of associatedsigma factors regulating the msdgc-1
For the identification of sigma factors that regulates the transcriptionofmsdgc-1 gene,we followed themethod already described (Chowdhuryet al., 2007). In brief, approximately 1100 bp upstream fragmentof msdgc-1 gene was PCR amplified using bkpm1000F/bkpm500Rprimers (Table 1). The amplicon was incubated at 37 °C for 5 minwith 20 μM biotin-11-dUTP (Fermentas), 100 μM deoxynucleosidetriphosphate, (Sigma), and 0.6 unit of Klenow fragment (Fermentas)
102 B.K. Bharati et al. / Gene 528 (2013) 99–108
in buffer A (10 mMTris–HCl, pH 7.4, 100 mMNaCl, 0.2 mMEDTA). Theunincorporated biotin-dUTP and deoxynucleoside triphosphates wereremoved by ethanol precipitation. The biotinylated msdgc-1 promoterfragment was resuspended in 25 μl of sterile water, and mixed with250 μl of streptavidin-agarose beads (Sigma) for 1 h at room tempera-ture with constant rotation. The biotinylation of DNA was measured byUV characteristics of the wash and eluted fractions. The biotinylation ofDNA was quantitated by characteristic UV absorbance at 260 nm, 200,240 and 289 nm for biotin and 280 nm for streptavidin. The ratio be-tween biotin and DNA was found to be nearly 1:1.
For the isolation of proteins (sigma factors), the wild-typeM. smegmatis was grown in 7H9-broth medium supplemented with2% glucose, and pelleted at 24, 48 and 72 h. The cells were suspendedin lysis buffer [50 mM Tris–HCl; pH 7.9, 2 mM EDTA; pH 8.0, 0.1 mMDTT, 300 mM NaCl, 5% glycerol, 1 mg/ml lysozyme, and 23 μg/mlPMSF]. The cells were lysed using French press and DNA bindingproteins were precipitated from crude lysate using polyethyleneimine(0.6%) at 4 °C. The proteins were extracted in TGE containing 1 MNaCl (40 mMTris–HCl, 20% glycerol and 0.5 M EDTA, pH 8.0), followedby the 50% ammonium sulfate precipitation. The pellet obtained in thisstep was dissolved in buffer B (20 mM Tris–HCl, pH 7.4, 5 mM MgCl2,100 mM potassium glutamate, 10% glycerol, 0.5 mM EDTA, and 0.1%Triton X-100) and mixed with 10 μl of promoter-biotin–streptavidin-agarose beads and kept for binding overnight at 4 °C with constant ro-tation. The beads were allowed to settle on ice for 10 min, the superna-tant was removed carefully, and the beads were washed three timeswith buffer B by centrifugation at 8000 r.p.m. for 2 min. Bound proteinswere then eluted with buffer C (20 mM Tris–HCl, pH 7.9 at 4 °C, 10%glycerol, 0.2 mM EDTA, and 0.1 mM dithiothreitol and 0.4 M NaCl).The eluted samples were subjected to SDS–PAGE followed by Westernblot analysis with M. tuberculosis sigma antibodies (obtained fromAstrazeneca, Bangalore).
3. Results
3.1. The MSDGC-1 promoter is starvation induced
Wehave identifiedMSDGC-1 protein asMSMEG_2196 locus (Bharatiet al., 2012) and in order to find out the minimum promoter lengthnecessary for promoter activity, the upstream fragments from +1translation start site up to 200, 500, and 1100 bp were separatelycloned in promoterless pSD5b vector and named as pSD237, pSD561,and pSD1021, respectively. The positive clones were screened withpSDBKF and pSDBKR primers using PCR. The β-galactosidase activitiesof pSD5b clones with different lengths of promoter were measuredin 2% and 0.02% glucose using plate assay and in liquid cultures. Theβ-galactosidase activities were measured for pSD1021, pSD561 andpSD237 constructs with various lengths of promoter fragments and itwas noticed that the promoter constructs with varying lengths of up-stream fragments show almost similar promoter activities, whenperformed in 7H9-plate containing X-gal supplemented with 2 and0.02% glucose (not shown). The promoter clones were also tested fortheir activities in E. coli andwe did not observe the blue color formationin the plate assay (not shown). This shows that msdgc-1 promoter isspecific only to M. smegmatis, and is not active in E. coli as reportedearlier for other mycobacterial promoters (Jain et al., 1997; Mulderet al., 1997).
The promoter clones pSD1021, pSD561 and pSD237 were assayedfor the β-galactosidase activities in the liquid cultures in 7H9-brothmedia supplemented with 2 and 0.02% glucose, as described in themethods section. The pSD5b vector alone was used as negative control.It can be seen from Figs. 1a and b that pSD1021, pSD561 and pSD237show almost similar promoter activities, which contain differentlengths of upstream sequences. The msdgc-1 promoter activities ofabove-mentioned constructs were highest at ~36 h followed by de-crease with time in 2% glucose (Fig. 1a). However, on the other hand,
the promoter activities increase with time continuously in 0.02%glucose, when monitored for 72 h (Fig. 1b).
We have shown previously that the level of MSDGC-1 product,c-di-GMP goes up by 7-fold in nutrient depleted condition (0.02%glucose) in M. smegmatis (Bharati et al., 2012). When we comparedthe promoter activities in 2 and 0.02% glucose condition, we observedsimilar promoter activities in low glucose. Thus, it appears that mini-mum 200 bp promoter length is sufficient for the promoter activity ofmsdgc-1 gene, and the promoter is starvation induced. It has beenreported before that level of c-di-GMP in eubacteria is regulated byriboswitch (Sudarsan et al., 2008). However, this is not likely the casein msdgc-1, as 1100, 500, and 200 bp containing upstream promoterfragments show the similar β-galactosidase activities, and also thebioinformatics analysis of upstream promoter regions using Riboswitchfinder program did not show the presence of conserved GEMM domainlike structure.
As pSD1021, pSd561, and pSD237 show similar promoter activitiesand pSD237 with 200 upstream promoter regions was selected forfurther studies. We have measured the promoter activity of pSD237 in2, 0.2 and 0.02% glucose for stationary and late stationary phase ofM. smegmatis, and found that promoter activity is inversely proportionalto glucose present in themedia (not shown). In the presence of low glu-cose in 7H9medium (0.2 or 0.02%) the promoter activity increaseswithtime. Upon the addition of glucose at any given point of time (indicatedwith an arrow) in pSD237 the promoter activity decreases significantlywith very little product formation (Figs. 1c and d). It appears that thepromoter activity of msdgc-1 gene is directly affected by the glucosepresent in the culture condition.
3.2. msdgc-1 promoter activity in glycerol
Themsdgc-1 promoter activitywas suppressed significantlywith theexogenous addition of glucose in the culture media. We wanted to testwhether themsdgc-1 promoter is specific to glucose. Thus, we replacedglucose with glycerol as a carbon source and tested the promoter activ-ities of pSD1021, pSd561, and pSD237 in 2 and 0.02% glycerol (Figs. 2aand b). We noticed the similar pattern of promoter activities as ob-served when glucose was used as a carbon source. As expected, theexogenous addition of glycerol (final 2%) at 84 h in the growing culturessupplemented with 0.2% glycerol shows the decrease in the promoteractivities (Figs. 2c and d). This experiment indicates that the msdgc-1promoter activity is independent of the carbon source. However, wedid not carried out any experiment under limiting condition of nitrogenor phosphorus.
3.3. Exogenous addition of glucose in the reaction condition does not affectthe DGC and PDE-A activities
As we have observed that exogenous addition of glucose affects thepromoter activities significantly, the DGC and PDE-A activities ofMSDGC-1 were measured in the presence of varying concentration ofglucose. The MSDGC-1 protein is a bifunctional protein (with GAF-GGDEF-EAL domains) that shows both the c-di-GMP synthesis andhydrolysis activities and the schematic representation is shown inFig. 3a. The MSDGC-1 and PleD proteins were purified (Fig. 3b), as de-scribed in the Materials and methods section. The purified MSDGC-1protein was incubated with 0.02 and 2% glucose, and further incubatedwith reaction buffer for 30 min and assayed for DGC and PDE-A activi-ties. This experimentwas performed to find the role of GAF in the detec-tion of glucose. It can be noticed from Figs. 3c and d that DGC and PDE-Aactivities are not altered as in the presence of glucose. This alsosuggests that the MSDGC-1 (or the GAF domain) is not involved inthe direct sensing of glucose in vitro. However, the exogenousaddition of glucose in the growing cultures does affect the promoteractivities of msdgc-1.
Fig. 1.β-Galactosidase activities of different lengths ofmsdgc-1 promoter in the liquid cultures ofM. smegmatis containing 2% (a) and 0.02% glucose (b). The exogenous addition of glucose(final 2%) decreases the promoter activity of msdgc-1 (pSD237) in the promoter construct with ~200 bp upstream region (c). Effect of exogenous addition of glucose in the growingcultures ofM. smegmatis containing different lengths ofmsdgc-1 promoters (d). The additions of glucose at 84 h in the growing cultures containing 0.2% glucose are shown with arrows(c and d).
103B.K. Bharati et al. / Gene 528 (2013) 99–108
3.4. β-Galactosidase activities of msdgc-1 promoter in rel knockout and relpromoter in msdgc-1 knockout strains of M. smegmatis
The in vivo cellular concentration of second messengers, ppGpp andc-di-GMP are maintained by rel and msdgc-1 genes, respectively. Wehave shown earlier that knockout of either of the gene severely affectsthe long term survival (Bharati et al., 2012; Mathew et al., 2004). Ithas been proposed earlier that quorum sensing and starvation arelinked, and regulate each other (Lazazzera, 2000). We wanted to seethe inter-dependence of c-di-GMP and ppGpp in the mycobacterialphysiology and thus this experiment was performed. Themsdgc-1 pro-moter construct, pSD237 was electroporated in rel knockout strain(RelKO), and rel promoter construct (pR3hyl, hygr) was electroporatedin msdgc-1 knockout (DGCKO) strain to generate RelKO-pSD237 andDGCKO-pR3hyl strains, respectively. The promoter activities of msdgc-1 and rel were measured and compared with wild-type backgroundsupplemented with 2 and 0.02% glucose. It can be noticed from theFig. 4a (2% glucose) that the promoter activities of msdgc-1 in RelKOand wild-type strains are similar. The promoter activities increase upto ~24 h and then decrease, while the rel promoter shows the consis-tent increase in wild-type (pVJP16) and DGCKO (DGCKO-pR3hyl)strains. On the other hand, during starvation (in 0.02% glucose) the pro-moter activity of msdgc-1 in RelKO strain is lower (~50%) than that ofwild-type (Fig. 4b). The rel promoter shows consistent increase in pro-moter activities in both wild-type and DGCKO strains. Thus, it appearsthat the promoter activity of msdgc-1 gene depends on rel but not viceversa, and if ppGpp is not there in the system (such as in RelKO strain),the c-di-GMP level will be less compared to that of wild-type.
As we have observed the difference in promoter activity ofmsdgc-1in 2 and 0.02% glucose, we monitored the growth of wild-type, DGCOE,DGCKO, and DGCCO in 7H9-broth supplemented with 2 and 0.02% glu-cose using colony forming units (cfu/ml) at different points of time(Figs. 5a and b). It can be noticed from Fig. 5b that in the case of 0.02%glucose the number of viable cells in the DGCKO is ~10 times higherthan that of wild type at ~72 h. However, such is not the case in 2% glu-cose containing medium. We observed a very high value for cfu/ml inhigh glucose containing media in all the cases. We have shown earlierthat long term survival was severely affected in the DGCKO strains,and after the entry into stationary phase the number of viable cellswas ~60% less than wild type. It appears that in the absence of c-di-GMP, cells are proliferating at a faster rate than that of the wild-typein 0.02% glucose, which is reflected in the cfu assay (Fig. 5b). However,this high proliferation rate of DGCKO strain will not be continuing forlong as the complete absence of nutrientswill limit the cell proliferation,and sharp decrease in the cfu was observed at a later stage of growth(~168 h). Further experiments are needed to prove the direct role ofc-di-GMP in mechanism of cell proliferation, but the observation madeover here suggests a possible role of c-di-GMP in the regulation of cellproliferation in M. smegmatis.
3.5. Mapping of transcription start site
The +1 transcription start site of msdgc-1 gene was mapped usingthe primer extension method. The M. smegmatis electroporated withpSD237, containing 200 bp upstream promoter fragment, was usedfor the isolation of total RNA. The isolated RNA was used for the
Fig. 2. β-Galactosidase activities of different lengths ofmsdgc-1 promoters in liquid cultures ofM. smegmatis containing 2% (a) and 0.02% glycerol (b). The exogenous addition of glycerol(final 2%) also decreases the promoter activity of msdgc-1 (like glucose) in the promoter construct with ~200 bp upstream region (c). Effect of exogenous addition of glycerol in thegrowing cultures of M. smegmatis containing different lengths of msdgc-1 promoters (d). The additions of glycerol at 84 h in the growing cultures containing 0.2% glycerol are shownwith arrows (c and d).
Fig. 3. Effect of exogenous addition of glucose on the DGC and PDE-A activities ofMSDGC-1. (a) Schematic representation of DGC and PDE-A activities ofMSDGC-1, (b) Protein purificationofMSDGC-1 and PleD. Lanes: 1—proteinmarker (kDa), 2 to 4—different elutions ofMSDGC-1, 5 to 7—different elutions of PleD. (c) DGC and PDE-A activities ofMSDGC-1 using radiometricTLC assay in the presence of glucose. Lanes: 1—Control (GTP), 2—MSDGC-1 (without glucose), 3—MSDGC-1 with 0.02% glucose, 4—MSDGC-1 with 2% glucose, and 5—PleD reactionproduct, (d) Comparative DGC and PDE-A activities of MSDGC-1 in the presence of varying concentration of glucose.
Fig. 4.β-Galactosidase activities ofmsdgc-1 promoter in rel knockout (RelKO-pSD237) andrel promoter in msdgc-1 knockout (DGCKO-pR3hyl) strains in 2% (a) and 0.02% glucose(b). It can be noticed here that the msdgc-1 promoter activities in RelKO strain is lower(~50%) than that of wild typeM. smegmatis in 0.02% glucose condition.
Fig. 5.Msdgc-1 knockout strain ofM. smegmatis grows ~10 times faster thanwild type strainin nutrient depleted condition. Measurement of viable cells counts in wild-type; msdgc-1overexpression (DGCOE);msdgc-1 knockout (DGCKO); andmsdgc-1 complemented strains(DGCCO) using colony forming unit assay (cfu/ml) in 2% (a) and 0.02% (b) glucose.
105B.K. Bharati et al. / Gene 528 (2013) 99–108
preparation of cDNA. The presence of one band of high intensity in thesequencing gel in lane P suggested the occurrence of one transcriptionstart site (Fig. 6a). The cDNAwas ~269nucleotides in length. The primerused here was vector back bone specific (pSD5b), and the transcriptionstart site was found to be “A” base. The mapped +1 transcription startsite was 57 bp upstream from the +1 translation start site (TSS).
3.6. Identification of−10 promoter regions of msdgc-1
After the identification of transcription start site (+1), upstreamsequence was searched for−10 region ofmsdgc-1 gene. The mycobac-terial promoters do not bear any homology with the TTGACA sequencein−35 regions as in E. coli promoters. Themultiple sequence alignmentof the upstream regions in different mycobacterial species did not yieldany conserved region. However, when we carried out the multiple se-quence alignment ofmsdgc-1 genewith the−10 sequences of the char-acterized promoter of mycobacteria, a probable −10 site TCGATA thatwas 14 bp upstream from the identified transcription start site becameapparent. A pictorial representation of the identified +1 transcriptionstart site, probable −10 regions have been shown in Fig. 6b. Further,site directed mutagenesis were carried out in the probable−10 region(TCGATA) using mega primer method with pSD237 as a template. The1st and 5th T were mutated to C and G, respectively (Table 3). We ob-served substantial reduction of promoter activity in mutants both in
high and in low glucose media, although complete inactivation ofpromoter activities were not noticed upon point mutation (Fig. 6c).
3.7. msdgc-1 promoter is recognized by Sig-A and Sig-B
The sigma factors are the components of RNA polymerase complexthat help in promoter recognition and binding of RNA polymerase tothe promoter for specific gene expression (Paget and Helmann, 2003).The specific gene expression is necessary for bacterial survival andadaptation in the adverse environmental condition such as hightemperature, exposure to chemicals, oxygen and nutrient depletion toname a few. The comparative genomic analysis of M. smegmatis showsthe presence of 26 potential sigma factors to facilitate the regulationof gene expression, and so far seven sigma factors have been character-ized experimentally (Waagmeester et al., 2005). These sigma factorscontribute to the specificity of transcription initiation at different pro-moters and regulate transcription (Helmann and Chamberlin, 1988;Ishihama, 1988; Lonetto et al., 1992; Manganelli et al., 2004).
We have attempted here to identify the contribution of sigma factorsin the regulation of msdgc-1 gene responsible for c-di-GMP turnover inM. smegmatis following the method as described earlier (Chowdhuryet al., 2007). The 1.1 kb upstream promoter region of msdgc-1 gene wasbiotinylated and immobilized on streptavidin coated agarose beads. Thepartially purified RNA polymerases from M. smegmatis culture grownat different stages of growth (24, 48, and 72 h) were incubated with
Fig. 6. Identification of transcription start site. (a) Transcription start site mapping ofmsdgc-1 gene using primer extension method. (b) The DNA sequence of 0.2 kb upstream ofmsdgc-1gene showing the transcription start site (+1), probable−10 regions and primer binding sites. The partialmsdgc-1 gene is shown in italics. (c) Measurement of β-galactosidase activitiesinM. smegmatis transformed with pSD237, pSDT129C, and pSDT133G in 0.02% glucose.
106 B.K. Bharati et al. / Gene 528 (2013) 99–108
promoter DNA-biotin–streptavidin complex and specific sigma factorswere identified by Western blot (Figs. 7a–f). It can be noticed fromFigs. 7a and b thatmsdgc-1 promoter is regulated by principal sigma fac-tor, SigA, in the log phase (~24 h) and early stationary phase (~48 h), butit is absent in the late stationary phase (~72 h, Fig. 7c). However, it is in-teresting to note here that the regulation ofmsdgc-1 switched over fromSigA to SigB, another principal like sigma factor, as shown in Figs. 7e and fat 48 and 72 h, while it was absent in early log phase of growth at 24 h(Fig. 7d). The SigA dependent regulation of msdgc-1 gene shows thatthe expression is specific to growth phase, and is important to maintainthe threshold level of c-di-GMP in the cell. When bacteria are understress or in late stationary phase, the regulation of msdgc-1 gene isgoverned by SigB to maintain the high level of c-di-GMP, which is neces-sary for the adaptation or survival in nutrient starved condition. It hasbeen shown earlier that transcription of SigB increases during the entryof mycobacteria in stationary phase, and regulates the expression ofthose genes, which are necessary for their survival and adaptation in sta-tionary phase (Hu and Coates, 1999).
4. Discussion
The stationary phase of mycobacteria is important with respect totheir survival under stress. Thus, characterization of genes which are
Table 3The −10 consensus sequence identified in msdgc-1 gene of M. smegmatis, and promoterconstructs with the mutations in the−10 regions.
−10 consensus sequence of M. smegmatis msdgc-1 gene
T C G A T A
Vector −10 consensus sequence with mutation
pSD237 T C G A T ApSDT129C C C G A T ApSDT133G T C G A G A
activated during stationary phase may lead to the understanding ofthe network that operates under stringent survival condition. In thisstudy we have explored the expression of msdgc-1 gene required formaintaining the c-di-GMP level and attempted to identify the transcrip-tional start site and promoter motifs.
Ourfirst observation in thismanuscript is important, that is the generesponsible for the synthesis and degradation of c-di-GMP is expressedpredominantly at the stationary phase. We reported before thatM. smegmatis cells devoid of msdgc-1 gene cannot survive for long andthese informations together point to the important role of c-di-GMP inmaintaining the viable cell density in the stationary phase. During thisworkwe also observed that in the absence ofmsdgc-1 gene, the numberof viable cells are ~10 times (at 72 h, in 0.02% glucose) higher than thatin wild-type M. smegmatis (Fig. 5b). This assay was performed byestimating the colony formation units. We believe from our data thatc-di-GMP is involved in regulating the cell population density in nutri-ent dependent manner. In the absence of c-di-GMP, the cellular densitywill be high and theywill eventually die in the absence of carbon source.On the other hand, high level of c-di-GMP controls cell proliferation andmaintains the optimal level of cell density which can sustain understress. We have observed that exogenous addition of glucose in theculture media during stationary phase (starved condition) decreasesthe promoter activity. After the addition of glucose and glycerol in themedia, the presence of sufficient nutrients is detected by the mycobac-terial cells and the promoter activity of msdgc-1 decreases significantlyto keep the c-di-GMP concentration low in order to facilitate the activecell proliferation.
Our hypothesis is also supported by a comparative measurement ofpromoter activities of msdgc-1 and rel (Figs. 4b and c). We observedhere that the promoter activity of rel is high in the stationary phase tomaintain the higher level of ppGpp inwild typeM. smegmatis. The bind-ing of ppGpp to the RNA polymerase down regulates the rRNA biosyn-thesis as a consequence of stringent response. Contrary to this, in theabsence of rel (RelKO), the level of ppGpp will be low inside the cell,
Fig. 7. a–f. Identification of sigma factors involved in the transcription ofmsdgc-1 gene using promoter specific pull down assay. Lanes: 1—PurifiedM. tuberculosis Sig A (a, b and c) or Sig B(d, e and f); 2—Flow through; 3—Wash I; 4—Wash II; 5—Wash III; and 6—Elution. The purifiedM. tuberculosis Sig-A and Sig-B proteins were used as positive controls.
107B.K. Bharati et al. / Gene 528 (2013) 99–108
and this will allow the synthesis of all the necessary components for cellproliferation even in the 0.02% glucose. To facilitate the cell proliferationin the RelKO strain in the 0.02% glucose, the c-di-GMP level should below, and we observed here that the promoter activity of msdgc-1 inRelKO strain is lower (~50%) than that of wild type M. smegmatis in0.02% glucose condition (Fig. 4c). We have reported earlier that thelevel of ppGpp and c-di-GMP increases in the stationary phase in thecarbon starved condition in wild-type M. smegmatis (Bharati et al.,2012; Ojha et al., 2000). Thus, high level of ppGpp and c-di-GMP isnecessary in the stationary phase to regulate the cell density.
Fig. 8. Low level of (p)ppGpp favors the low level of c-di-GMP for cell proliferation. Both the secondition (left panel) the hydrolysis activity will be high to maintain the low level of second mstarvation or in the stationary phase of growth (right panel) the synthesis activity will be highreduced the rate of cell proliferation.
Based on our studywe have generated amodel (Fig. 8) that supportsthe suggested link between ppGpp and c-di-GMP dependent signaling(Lazazzera, 2000). We hypothesized that c-di-GMP and (p)ppGppwork in a synergistic manner (Fig. 8) and levels of both the secondmessengers increase several folds in the carbon starved conditionduring the stationary phase of growth. During well-fed condition(left panel, 2% glucose), the hydrolysis activity is preferred to keep thelow levels of c-di-GMP and (p)ppGpp. The low level of c-di-GMP and(p)ppGpp is necessary to regulate basal level of gene expression andmaintain high rate of cell proliferation during log phase. Whereas,
cond messengers, c-di-GMP and (p)ppGpp work in a synergistic manner. During well-fedessengers in the log phase, thus to maintain the increased rate of cell proliferation. Duringto maintain the high level of (p)ppGpp and c-di-GMP, and will bind to various targets to
during starvation condition (right panel, 0.02% glucose) the synthesisactivity will dominate over hydrolysis activity to maintain the highlevels of c-di-GMP and (p)ppGpp inside the cell, and theywill eventual-ly reduced the rate of cell proliferation. It has also been shown previous-ly that low concentration of c-di-GMP does not alter the basal level ofcell proliferation. However, high c-di-GMP level arrests both basal andgrowth factor-stimulated proliferation of human colon cancer cellsin H508 cell lines (Karaolis et al., 2005). The cell cycle arrest hasalso been shown by another group, and they have observed that treat-ment of 50 μM c-di-GMP to Jurkat cell lines will stall the cell cycle atS-phase and finally decreased cell division (Steinberger et al., 1999).However, there is missing link between c-di-GMP and regulation ofcell proliferation, and further experimentation is necessary to provethis connection. It should be mentioned here that we have observedrecently, the presence ofmultiple rel genes inM. smegmatis. Thus the re-moval of primary rel gene does not ensure total absence of (p)ppGpp(Murdeshwar and Chatterji, 2012).
The last result worth mentioning here is the differential use ofsigma factors for the transcription of themsdgc-1 gene. There are 7 sig-ma factors in M. smegmatis among which SigA is known as principalsigma factor as deletion of this gene is not possible in M. smegmatisor M. tuberculosis (Cole et al., 1998; Manganelli et al., 1999, 2004;Waagmeester et al., 2005). SigB on theother hand, although very similarto SigA is dispensable. It is known as alternate sigma factor and playsa crucial role in maintaining the stationary phase in mycobacteria(Mukherjee and Chatterji, 2005). Here we observed that msdgc-1 pref-erentially uses SigA for transcription during the active growth phase.However, when the cells reach stationary phase of growth after 48 h,SigB dependent transcription resumes. This switch in RNA polymerasecomplex as a function of growth is unique and can be exploited forthe regulation of genes.
Conflict of interest statement
No conflict of interest.
Acknowledgments
This work was financially supported by the Department of Biotech-nology, Government of India, New Delhi. BKB acknowledges IndianInstitute of Science, Bangalore for fellowship. Author would also liketo record appreciation to Mariyam Abdullah and Sreeja Chellappan forthe help in few experiments.
References
Ausmees, N., Mayer, R., Weinhouse, H., Volman, G., Amikam, D., Benziman, M., Lindberg,M., 2001. Genetic data indicate that proteins containing the GGDEF domain possessdiguanylate cyclase activity. FEMS Microbiol. Lett. 204, 163–167.
Bashyam, M.D., Kaushal, D., Dasgupta, S.K., Tyagi, A.K., 1996. A study of mycobacterialtranscriptional apparatus: identification of novel features in promoter elements.J. Bacteriol. 178, 4847–4853.
Bharati, B.K., Sharma, I.M., Kasetty, S., Kumar, M., Mukherjee, R., Chatterji, D., 2012. A fulllength bifunctional protein involved in c-di-GMP turnover is required for long termsurvival under nutrient starvation in Mycobacterium smegmatis. Microbiology 158,1415–1427.
Brouillette, E., Hyodo, M., Hayakawa, Y., Karaolis, D.K., Malouin, F., 2005. 3′,5′-cyclicdiguanylic acid reduces the virulence of biofilm-forming Staphylococcus aureus strainsin amousemodel ofmastitis infection. Antimicrob. Agents Chemother. 49, 3109–3113.
Chowdhury, R.P., Gupta, S., Chatterji, D., 2007. Identification and characterization of thedpspromoter ofMycobacterium smegmatis: promoter recognition by stress-specific extra-cytoplasmic function sigma factors sigmaH and sigmaF. J. Bacteriol. 189, 8973–8981.
Christen, M., Christen, B., Folcher, M., Schauerte, A., Jenal, U., 2005. Identification andcharacterization of a cyclic di-GMP-specific phosphodiesterase and its allostericcontrol by GTP. J. Biol. Chem. 280, 30829–30837.
Christen, B., Christen, M., Paul, R., Schmid, F., Folcher, M., Jenoe, P., Meuwly, M., Jenal, U.,2006. Allosteric control of cyclic di-GMP signaling. J. Biol. Chem. 281, 32015–32024.
Cole, S.T., Brosch, R., Parkhill, J., Garnier, T., Churcher, C., Harris, D., Gordon, S.V., Eiglmeier,K., Gas, S., Barry III, C.E., Tekaia, F., Badcock, K., Basham, D., Brown, D., Chillingworth,
T., Connor, R., Davies, R., Devlin, K., Feltwell, T., Gentles, S., Hamlin, N., Holroyd, S.,Hornsby, T., Jagels, K., Krogh, A., McLean, J., Moule, S., Murphy, L., Oliver, K.,Osborne, J., Quail, M.A., Rajandream, M.A., Rogers, J., Rutter, S., Seeger, K., Skelton, J.,Squares, R., Squares, S., Sulston, J.E., Taylor, K., Whitehead, S., Barrell, B.G., 1998.Deciphering the biology of Mycobacterium tuberculosis from the complete genomesequence. Nature 393, 537–544.
Helmann, J.D., Chamberlin, M.J., 1988. Structure and function of bacterial sigma factors.Annu. Rev. Biochem. 57, 839–872.
Hu, Y., Coates, A.R., 1999. Transcription of two sigma 70 homologue genes, sigA and sigB,in stationary-phase Mycobacterium tuberculosis. J. Bacteriol. 181, 469–476.
Ishihama, A., 1988. Promoter selectivity of prokaryotic RNA polymerases. Trends Genet. 4,282–286.
Jain, S., Kaushal, D., DasGupta, S.K., Tyagi, A.K., 1997. Construction of shuttle vectors forgenetic manipulation and molecular analysis of mycobacteria. Gene 190, 37–44.
Jain, V., Sujatha, S., Ojha, A.K., Chatterji, D., 2005. Identification and characterization of relpromoter element of Mycobacterium tuberculosis. Gene 351, 149–157.
Karaolis, D.K., Cheng, K., Lipsky, M., Elnabawi, A., Catalano, J., Hyodo, M., Hayakawa, Y.,Raufman, J.P., 2005. 3′,5′-Cyclic diguanylic acid (c-di-GMP) inhibits basal and growthfactor-stimulated human colon cancer cell proliferation. Biochem. Biophys. Res.Commun. 329, 40–45.
Lazazzera, B.A., 2000. Quorum sensing and starvation: signals for entry into stationaryphase. Curr. Opin. Microbiol. 3, 177–182.
Li, W., He, Z.G., 2012. LtmA, a novel cyclic di-GMP-responsive activator, broadly regulatesthe expression of lipid transport and metabolism genes inMycobacterium smegmatis.Nucleic Acids Res. 40, 11292–11307.
Lonetto, M., Gribskov, M., Gross, C.A., 1992. The sigma 70 family: sequence conservationand evolutionary relationships. J. Bacteriol. 174, 3843–3849.
Lonetto, M.A., Brown, K.L., Rudd, K.E., Buttner, M.J., 1994. Analysis of the Streptomycescoelicolor sigE gene reveals the existence of a subfamily of eubacterial RNA polymer-ase sigma factors involved in the regulation of extracytoplasmic functions. Proc. Natl.Acad. Sci. U. S. A. 91, 7573–7577.
Manganelli, R., Dubnau, E., Tyagi, S., Kramer, F.R., Smith, I., 1999. Differential expression of10 sigma factor genes in Mycobacterium tuberculosis. Mol. Microbiol. 31, 715–724.
Manganelli, R., Provvedi, R., Rodrigue, S., Beaucher, J., Gaudreau, L., Smith, I., 2004. Sigma fac-tors and global gene regulation inMycobacterium tuberculosis. J. Bacteriol. 186, 895–902.
Mathew, R., Ojha, A.K., Karande, A., Chatterji, D., 2004. Deletion of the rel gene in Myco-bacterium smegmatis reduces its stationary phase survival without altering thecell-surface associated properties. Curr. Sci. 86, 149–153.
Miller, J.H., 1972. Experiments in Molecular Genetics. Cold Spring Harbor Press, ColdSpring Harbor, NY, USA.
Mukherjee, R., Chatterji, D., 2005. Evaluation of the role of sigma B in Mycobacteriumsmegmatis. Biochem. Biophys. Res. Commun. 338, 964–972.
Murdeshwar, M.S., Chatterji, D., 2012. MS_RHII-RSD, a dual-function RNase HII-(p)ppGppsynthetase from Mycobacterium smegmatis. J. Bacteriol. 194, 4003–4014.
Ojha, A.K., Mukherjee, T.K., Chatterji, D., 2000. High intracellular level of guanosinetetraphosphate in Mycobacterium smegmatis changes the morphology of the bacteri-um. Infect. Immun. 68, 4084–4091.
Paget, M.S., Helmann, J.D., 2003. The sigma70 family of sigma factors. Genome Biol. 4, 203.Paul, R., Weiser, S., Amiot, N.C., Chan, C., Schirmer, T., Giese, B., Jenal, U., 2004. Cell cycle-
dependent dynamic localization of a bacterial response regulator with a novel di-guanylate cyclase output domain. Genes Dev. 18, 715–727.
Primm, T.P., Andersen, S.J., Mizrahi, V., Avarbock, D., Rubin, H., Barry III, C.E., 2000. Thestringent response of Mycobacterium tuberculosis is required for long-term survival.J. Bacteriol. 182, 4889–4898.
Raman, S., Puyang, X., Cheng, T.Y., Young, D.C., Moody, D.B., Husson, R.N., 2006.Mycobacterium tuberculosis SigM positively regulates Esx secreted protein andnonribosomal peptide synthetase genes and down regulates virulence-associatedsurface lipid synthesis. J. Bacteriol. 188, 8460–8468.
Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning: A Laboratory Manual, 2nded. Cold Spring Harbor Laboratory Press, Cold SpringHarbor, New York.
Simm, R., Morr, M., Kader, A., Nimtz, M., Romling, U., 2004. GGDEF and EAL domainsinversely regulate cyclic di-GMP levels and transition from sessility to motility. Mol.Microbiol. 53, 1123–1134.
Steinberger, O., Lapidot, Z., Ben-Ishai, Z., Amikam, D., 1999. Elevated expression of the CD4receptor and cell cycle arrest are induced in Jurkat cells by treatment with the novelcyclic dinucleotide 3′,5′-cyclic diguanylic acid. FEBS Lett. 444, 125–129.
Sudarsan, N., Lee, E.R., Weinberg, Z., Moy, R.H., Kim, J.N., Link, K.H., Breaker, R.R., 2008.Riboswitches in eubacteria sense the second messenger cyclic di-GMP. Science 321,411–413.
Tal, R., Wong, H.C., Calhoon, R., Gelfand, D., Fear, A.L., Volman, G., Mayer, R., Ross, P.,Amikam, D., Weinhouse, H., Cohen, A., Sapir, S., Ohana, P., Benziman, M., 1998. Threecdg operons control cellular turnover of cyclic di-GMP in Acetobacter xylinum: geneticorganization and occurrence of conserved domains in isoenzymes. J. Bacteriol. 180,4416–4425.
Waagmeester, A., Thompson, J., Reyrat, J.M., 2005. Identifying sigma factors inMycobacteriumsmegmatis by comparative genomic analysis. Trends Microbiol. 13, 505–509.
Wu, S., Howard, S.T., Lakey, D.L., Kipnis, A., Samten, B., Safi, H., Gruppo, V.,Wizel, B., Shams, H.,Basaraba, R.J., Orme, I.M., Barnes, P.F., 2004. The principal sigma factor sigA mediatesenhanced growth ofMycobacterium tuberculosis in vivo. Mol. Microbiol. 51, 1551–1562.
