Introductio1 Final Sid - Copy 1 (1)

8/11/2019 Introductio1 Final Sid - Copy 1 (1)

1/44

1

Chapter 1

INTRODUCTION

Non alcoholic fatty liver disease (NAFLD) is a reversible condition where

liver cells become hoarded with large vacuoles of triglyceride fat by the process

called steatosis (Brunt, 2010). It is rapidly becoming a worldwide public health

problem. It comprises a broad range of liver damage, involving asymptomatic

steatosis with high or normal aminotransferases to steatorrhea with swelling,

ballooning degeneration and cellular fibrosis (Nonalcoholic Steatohepatitis,

NASH) to cirrhosis (Barshop and Loomba et al.,2009). On the basis of different

causative factors it is categorized as Alchoholic Fatty Liver Disease (NAFLD) and

Non Alchoholic Fatty Liver Disease (NAFLD). So it does not follow a simple

Mendelian pattern of inheritance but it involves multiple genes, environmental

factors, age effects, and their interaction (Thomas, 2004). Prevalence of NAFLD

reaches 15%-20% in general population.

Series of hepatic pathologies are associated with NAFLD which include

relatively benign steatosis that may, under the influence of multiple triggering

factors, progress to the more severe condition of non-alcoholic steatohepatitis

(NASH), characterized by accumulation of fats, necro-inflammation, and

eventually fibrosis (Brunt, 2010). Throughout the world specially including United

States fatty liver disease is more common and now 2030% of the general

population in North America and similar countries affected by NAFLD (Angulo,
http://www.frontiersin.org/Cellular_and_Infection_Microbiology/10.3389/fcimb.2012.00132/full#B5http://www.frontiersin.org/Cellular_and_Infection_Microbiology/10.3389/fcimb.2012.00132/full#B5http://www.frontiersin.org/Cellular_and_Infection_Microbiology/10.3389/fcimb.2012.00132/full#B5http://www.frontiersin.org/Cellular_and_Infection_Microbiology/10.3389/fcimb.2012.00132/full#B5


2/44

2

2007) and it is also estimated that NAFLD is 20%-30 % more prevalent in western

countries (William, 2006).

In the beginning it was thought that women is more affected by NAFLD as

compared to men but this belief lacks realistic support (Fan et al., 2005).The study

on the prevalence of NAFLD showed that 26527 Asian subjects getting medical

health checkups having 31% prevalence in men and 16% in women (Chen et al.,

2004). So majority of men were patients of NAFLD showed by clinicopathological

summaries of patients from India (Sorrentino et al., 2004). An elevated

aminotransferase level in Male gender was also related to histological NASH,

hepatic fibrosis and overall mortality. Only a few studies propose that female

patients along with metabolic syndrome is an autonomous risk factor for NASH,

NAFLD and fibrosis.

Children of age 2 9 years having the most common liver abnormality

called NAFLD. It is indicated that 1 of every 10 children have macrovesicular

hepatic steatosis are important consequences for the long-term health of children

and young adults. The effects of risk factors after recognition should be taken in to

consideration in the development of protocols designed to screen at-risk children

and adolescents.

Environment also plays a major role in the etiology of NAFLD, especially

in genetically susceptible populations. In recent years, alteration of lifestyle and

dietary habits dramatically increases incidence of NAFLD (Fan et al., 2005.


3/44

3

Relationship between age and the prevalence of NAFLD shows that older

(NAFLD) patients have a higher probability of disease development or mortality

(Ong et al.,2010). In older age there is an increase chance of raising some related

problems such as severe hepatic fibrosis, hepatocellular carcinoma and type II

diabetes mellitus (Ascha et al.,2010). An increase in ALT activity as well as with

hepatic steatosis in individuals with mysterious liver enzyme elevations was

associated with younger age. In contrast to these findings, Hui and colleagues note

no significant differences in age between individuals with progressive NAFLD and

those who do not progress.In fact, older age is an independent factor for important

hepatic steatosis showed by a study of potential living liver donors. (Loria et al.,

2005). Cryptogenic cirrhosis, is more frequent in older diabetic patients with

present or past obesity by Caldwell in 1999.

In addition to other factors composition of the intestinal microflora, clearly

in part considerations of diet are important factor in fatty liver disease (Solga and

Diehl, 2003). In contrast to environmental risk factors, a number of genes have also

been identified associated with fatty liver. The prevalence of NAFLD is not clear

for ethnic differences. Some correlated risk factors of NAFLD, such as the extent

of visceral adiposity, are similar across ethnic groups reported by Wagenknecht

and colleagues. On the other hand, In Hispanics age, triglycerides (TG) are only

associated with NAFLD, and level of serum adiponectin is only associated with

NAFLD in African Americans.NAFLD is caused by Important, but unidentified,

genetic or environmental factors. The genetic variant Patatin-like phospholipase

domain containing protein-3 (PNPLA) and glucokinase regulatory protein (GCR)


4/44

4

single nucleotide polymorphism (SNPs) in pediatric population were responsible

for up to 39% of the liver fat, published in the March issue of Hepatology, a journal

of the American Association for Disease.

Peroxisome proloferator-activated receptor Gamma (PPAR) gene is one of

the main reason of NAFLD. It plays a key role in regulating the synthesis, storage,

and export of hepatic triglycerides and consequently the level of NAFLD. This

gene is responsible to encode a member of the peroxisome proliferator activated

receptor (PPAR) subfamily of nuclear receptor. DNA binding and transcriptional

activity reduces in vitro, was associated with the C/G polymorphism(rs1801282), a

Pro-Ala exchange that results in the replacement of proline with alanin at codon 12,

and the G cariers showed significant improvement in insulin sensitivity (Deeb et

al., 1998). There are strong effects of PPAR on various diseases including

osteoporosis, atherosclerosis, inflammation, carcinogenesis, type-2 diabetes

mellitus, insulin resistance and obesity (Chen and yue, 2008 and 2010).

Unpretentious mutilation of transcriptional activity due to decrease in

binding affinity of DNA was linked with decreased activity of PPAR in adipose

tissue, and decreased diabetes and insulin resistance was associated with

Polymorphisms (Pro12Ala SNP of PPAR2), reported in Caucasians (Tonjes et al.,

2006). Some reports show that growth of cancer cells are also caused by

polymorphism of Pro12Ala (Michalik et al.,2004). Mutation in codon 12 of exon

B of the PPAR gene which code Adipocyte specific (PPAR-2 isoform) define by

amino terminal residue decreases the chance of insulin resistance with allele


5/44

5

frequency 0.03-0.12 in some population. is caused by mutation in codon 12 of exon

B of the PPAR gene. (Schmidt et al.,1998). In Asian ultrasonographically proved

fatty liver patients show strong association of PPARwith clinical and biochemical

parameters (Bhatt et al.2013).

Due to alteration in dietary habits Fatty liver disease (NAFLD) is now

becoming an increasing threat to Pakistani population. However, screaning of

genotype of Fatty liver population with associated markers and its genetic

occurrence among Pakistani population are scarce. Therefore, the projected activity

was planned to screen genetic susceptibility of local Pakistani origin population

towards PPARwith following objectives;

i. PCR genotyping of PPARgene polymorphism

ii. Association of identified polymorphic form with fatty liver disease


6/44

6

Chapter 2

REVIEW OF LITERATURE

Fatty liver disease is considering as a metabolic syndrome. This metabolic

syndrome is strongly associated with the development of diabetes mellitus and an

increased risk of cardiovascular disease. Metabolic syndrome is a state which is

characterized by a group of symptoms together with insulin resistance, abdominal

obesity, dyslipedimia, elevated level of blood pressure and a proinflammatory state.

So it increases morbidity and mortality in respect of cardiovascular disease

(Reaven, 2001 and Grundy et al., 2004). Fatty Liver Disease comprises a broad

range of liver damage, ranging from asymptomatic steatosis with elevated or

normal aminotransferases to liver inflammation, and pericellular fibrosis

(Nonalcoholic Steatohepatitis, NASH) to cirrhosis (Barshop and Loomba et al.,

2009).

Significant increase in the chance of developing end-stage of liver is caused

by progressive increase of NAFLD to non-alcoholic steatohepatitis

(Neuschwander-Tetri and Caldwell, 2003). Due to its complex metabolic condition

the exact cause of NAFLD is not known, although both lifestyle environmental

genetic factors play an important pathogenic part in NAFLD (Angulo, 2002).

Dimitrova-Shumkovska et al., 2010 demonstrated that development and

progression of NAFLD is due to oxidative stress which is a result of bulk

production of reactive oxidant species (ROS) under over nutrition. (Csiszar et al.,


7/44

7

2009). However Smoking is also related with NAFLD so it is known to be an

increase risk of developing persistent low-grade inflammation (Pirkola et al.,

2010), which later play an essential role in the development of NAFLD (Byrne,

2010). There are some potential synergistic factors which are oxidative stress and

inflammatory response of inborn immunity acting in concert in the development of

NAFLD are oxidative stress and inflammatory response of innate immunity

(Byrne, 2010). Evidence provided by many epidemiological studies showed that

the development and progression of NAFLD is caused by interactions between

genetic and non-genetic risk determinants (Day, 2006).

In addition to well-known environmental risk variables, disease

susceptibility genes and associated single nucleotide polymorphisms have been

identified which offer an important tool for the diagnosis of individuals at risk.

It is estimated that among several candidate genes, PPAR gene polymorphisms

have been identified and explored for disease association, in various groups around

the world.

Peroxisome Proliferators Activated Receptor Gamma (PPAR)

Peroxisome Proliferators Activated Receptor Gamma (PPAR) plays a

important role in regulating the production, storage, and export of hepatic

triglycerides and as a result the degree of NAFLD. And it is also known in

regulation of fatty acid storage and glucose metabolism.Location of PPARgene is

on chromosome 3, which is linked to the development of NAFLD. Transcription


8/44

8

factor PPAR-2 is involve in regulation oftranscription and translation of frequent

target genes, which have been involved in adipocyte differentiation, lipid and

metabolism, and atherosclerosis ( Stumvoll and Haring, 2002).Wherever it is also

known that PPAR is the key regulator in the control of genes which involved in

lipogenic pathways of adipocytes, promoting the uptake of Fatty Acids(FAs) and

the differentiation of the adipocyte, with the subcequent increase in the cellular

content of TAGs (Tri acylglycerides) and decrease in the FA delivery to the liver

(Lazar, 2005). This receptor is highly expressed in fat deposit tissue and Lower in

skeletal muscle, spleen, heart and liver. Also evident in placenta, lung and ovary

(Mukherjee et al.,1997). PPARinvolved in the activation of genes that stimulate

lipid uptake and adipogenesis by fat cells and it is experimentally proved when

PPAR was knockout from mice, it fails to generate adipose tissue when fed a

high-fat diet (Jones, 2005) thus proving that PPARplays an essential role in fat

metabolism and present in different tissues for metabolism.

Tissue Specific Distribution and Cellular Functions of PPARGene

Target genes of PPAR are involved in many functions including , lipid

storage, adipocyte differentiation, glucose metabolism and include lipoprotein

lipase, CD36, adipocyte FA binding protein aP2, FA transport protein, acyl-coA

synthetase, phosphoenolpyruvate carboxykinase, aquaporin 7, and citrate carrier

(Stienstra et al., 2007 ; Dubuquoy et al., 2002; Damiano et al., 2012 ). PPAR

interact with chemicals which cause propagation of peroxisomes and these

organelles are responsible for the oxidation of fatty acids.
http://en.wikipedia.org/wiki/Adipogenesishttp://en.wikipedia.org/wiki/Adipogenesis


9/44

9

Two proteins are produced by PPAR gene, PPAR 1 and the nearly

adipose-specific PPAR2. PPAR2 has 28 additional N-terminal amino acids and

these amino acids present a 5- to 6-fold increase in transcription-stimulating

activity of the ligand-independent activation function-1 domain (Tontonoz et al.,

1994; Fajas et al.,1997). In adipose tissue this gene is highly expressed where it is

an important regulator of the transcriptional chain reaction underlying adipocyte

differentiation, as established in vitro by gain-of-function (Tontonoz et al., 1994

and Kletzien et al.,1992) and loss-of-function experiments (Ren et al.,and Muller

et al.,2002).

Another key role of PPAR is the entraining of adipose tissue lipid

metabolism to nutritional state. Its expression is highest after meal, and its

activation leads to up regulation of genes that mediate FA uptake and trapping

(Schoonjans et al.,1996). When PPARis expressed in, macrophages, muscles and

adipocytes where it regulates glucose metabolism. development, lipid homeostasis.

PPAR may also involve in bootless cycling in adipocytes between

triglyceride (TG) esterification and de-esterification (Guan et al.,2002). However,

the upregulation of glycerol kinase in human adipocytes is regulated by PPAR

was not replicated by a second study, which furthermore failed to find any

physiological confirmation of such glycerol cycling in human adipose tissue in

vivo (Tan et al.,2003).

An important feature of steatotic liver is increased expression of PPARand


10/44

10

several studies shows its fundamental in steatosis development by mechanisms

involving activation of lipogenic genes and de novo lipogenesis. Adipose cells In

humans are much more abundant of PPAR ; yet reasonable levels of PPAR

mRNA can also be found in other organs including skeletal muscle, colon, lung,

and placenta but when we compare them we see that little amount of PPAR is

also expressed in liver and heart in contrast to adipose tissue, however, under

certain disease conditions, these tissues can express significant amounts of PPAR

that have an important impact on metabolic homeostasis and tissue function

(Wang, 2010).

Cytogenetic Location and Gene Map ofPPAR

PPARgene consist of 9 exons and have size more than 100 kb. 8 exons

are involved in coding PPAR1and 7 exons in PPAR2 and PPAR1 uses exons

A1 and A2, whereasPPAR2 uses exon B; both use exons 1 through 6. Location

base pair of this gene is start at 12329349 and ends at 12475855 bp. The

cytogenetic location of gene is 3p25.2Fajas et al. (1997).The protein encoded by

this gene is the regulator of adipocyte differentiation called PPAR.

Polymorphism Associated With PPARGene

By multivariate analysis it is seen that NAFLD was associated with these

two polymorphisms (Bhatt et al.,2013).Two types of polymorphism are there in

PPARgene. Out of which one is Pro12Ala polymorphism which is significantly

associated with higher serum TG, waist-hip ratio and alkaline phosphatase whereas

the C161T polymorphism with increased TG and total cholesterol. The C/G
http://www.omim.org/geneMap/3/52?start=-3&limit=10&highlight=52http://www.omim.org/entry/601487#reference31http://www.omim.org/entry/601487#reference31http://www.omim.org/entry/601487#reference31http://www.omim.org/entry/601487#reference31http://www.omim.org/geneMap/3/52?start=-3&limit=10&highlight=52


11/44

11

polymorphism (rs1801282), in which Pro-to-Ala exchange take place is the results

of substitution of proline with alanine at codon 12, which in turn related with

reductions in both transcriptional activity and DNA binding in vitro, and the G

carriers showed significant improvement in insulin sensitivity (Deeb et al.,1998).

It has been demonstrated that other variant locus of PPAR gene are associated

with NAFLD in Chinese (Hui et al.,2008).

Recent studies have also indicated that insulin sensitivity improved by

Ala12 allele- which may involve enhanced suppression of lipid oxidation, which

permits more proficient glucose disposal (Thamer et al., 2002). Some studies

showed thatpolymorphism in PPARmay influence body mass index (BMI).and

BMI reflects the amount of fat, lean mass, and body build and it is also seen that

genetic variations in PPARinfluence the carotid intimal medial thickness (CIMT)

which is a measure of atherosclerosis that is independently associated with

traditional atherosclerotic cardiovascular disease risk factors and coronary

atherosclerotic burden. 35 to 45% of the variability in multivariable-adjusted CIMT

is explained by genetic factors. Age is another factor responsible for fatty liver.

The Ageing Liver

Decline in liver function, hepatic blood flow (by 33%) and hepatic volume

(up to 25%), occurs between the ages of 20 and 70 (Frith, 2009), the reason of

reduction of liver volume and hepatic blood flow in the elderly is unknown, but it

tends to alter the pharmacokinetic profiles of drugs that undergo mandatory hepatic

oxidation (Schmucker, 1998). Furthermore, reductions in bile acid synthesis with

resultant change to bile acid secretion and bile flow. It is also seen that decline in


12/44

12

hepatic metabolism of LDL (Low Density Lipoprotein) cholesterol is also related

to age which leading to elevated serum cholesterol. Therefore, there combined

effects of changes in bile acid secretion and cholesterol metabolism possibly

contribute to increased serum cholesterol levels and an increased frequency of

gallstones formation.

A more important cause of NAFLD may come from dysregulation or

failure of peripheral adipose tissue storage sites leading to store excess energy as

TG, to abnormal lipid partitioning to the liver and other nonphysiological storage

sites like muscles (Larter et al.,2010 ). The ageing liver does appear to be more

susceptible to the effects of drugs and other toxins, having diminished regenerative

capacity to recover from insults, as evident by an increase in morbidity and

mortality in hepatic resections in experimental studies in patients greater than 60

years old (Mentha, 1992).

Anyhow, there are some pathways which provide an incomplete

explanation that why insulin resistance and premetabolic syndrome is strongly

associated with steatosis. Insulin involves in the activation of several nuclear

transcription factors that control a remaining process (in the case of sterol

regulatory element binding proteins (SREBP) 1 and 2) and glucose (in the case of

carbohydrate-responsive sterol regulatory element binding protein (ChREBP) 1)

(Musso, 2010, Larter et al.,2010, Shiota, 2009) . Both SREBP1 and ChREBP are

involve in activation of Fatty acid synthase (FAS) (activate biosynthesis of long

chain fatty acids) and regulation of cholesterol biosynthesis.


13/44

13


14/44

14

Chapter 3

MATERIALS AND METHODS

The present study was approved from Ethics Committee for the use of

human subjects, PMAS-AAUR. Blood sampling of human subjects was done on a

case control study design. Both fatty liver patients and healthy controls were aware

of study participation.

3.1: CRITERIA FOR SAMPLE COLLECTION OF NAFLD CASES

Sample collection for NAFLD patients was conducted in the OPDs of

various hospitals in Rawalpindi/Islamabad whereas controls were sampled from

ethnically matched general population. The definition of fatty liver disease

(NAFLD) requires that:-

a) There is evidence of hepatic steatosis, either by imaging or by histology.

There are no causes for secondary hepatic fat accumulation such as

significant alcohol consumption, use of steatogenic medication or

hereditary disorders.

b) In the majority of patients, NAFLD is associated with metabolic risk factors

such as obesity, diabetes mellitus, and dyslipidemia. NAFLD is

histologically further categorized into nonalcoholic fatty liver (NAFL) and

nonalcoholic steatohepatitis (NASH). NAFL is defined as the presence of

hepatic steatosis with no evidence of hepatocellular injury in the form of


15/44

15

ballooning of the hepatocytes. NASH is defined as the presence of hepatic

steatosis and inflammation with hepatocyte injury (ballooning) with or

without fibrosis.

c)

High serum triglyceride levels and low serum HDL levels are very common

in patients with NAFLD. The prevalence of NAFLD in individuals with

dyslipidemia attending lipid clinics was estimated to be 50% (Chalasani et

al., 2012).

d)

Samples were collected on basis of above requirements of NAFLD defined

by liver ultrasound and Questionnaire based with written informed consent.

3.2: SAMPLE COLLECTION FOR RESEARCH PURPOSE

Sample size was about 219 subjects, 106 patients studied in comparison

with 113 controls. Blood sampling was done at the OPDs of various hospitals in

Rawalpindi/Islamabad. About 4-5ml venous blood samples was collected using

disposable multiple sampling needles in two vacutainers for biochemical analysis.

The EDTA coated (BD Vacutainer) genomic DNA extraction with blood

sample a questionnaire was also filled by subject regarding all necessary

information for research purpose. (Appendix). These blood samples were kept on

ice at 4C for further analysis. And all syringed incinerated carefully for public

health concern.


16/44

16

3.3: BIOCHEMICAL TESTING

After collecting Samples proceed for the biochemical analysis for

distinction of cases and controls subjects. We requested PIMS and NIH labs for

biochemical tests of our subjects. In biochemical tests ALT (SGPT) and lipid

profile was included. To perform this test gel coated Vacutainers were centrifuged

at 3500 rpm for 15 minutes to separate serum from whole blood. From EDTA

vacutainers plasma were also separated from whole blood. By the serum and

plasma on spectrophotometer Microlab 300 (Merck) according to the standard

protocol all above analysis were performed.

3.4: DNA ISOLATION FROM WHOLE BLOOD

For Genomic DNA whole blood was used as a source of Genomic DNA using

extraction method recommended by sambrook (Sambrook and Russel, 2001).

Following are the steps of DNA extraction method:

RBC lysis buffer (750l) was mixed with 750l blood in eppendrof and

incubated for ten minutes at room temperature.

The tubes were centrifuged at 13,000 rpm for two minutes to form a pallet

of WBCs. This step was repeated till complete lysis of RBCs and discared

the supernatant and resupspended the nuclear pallet.

The tubes were overturned on a blotting paper.

Nuclear lysis buffer (400l) was added along with 60-70l of ten percent

Sodium Dodecyl Sulphate (SDS) and 10l of Proteinase K (Bio Ron) for

protein digestion.


17/44

17

The tubes were kept in incubator at 37C for overnight.

After this 250l of phenol and 250l TE Buffer were added and mixed

them.

Then tubes were centrifuged for 10 min at 13000 rpm.

Collected the upper aqueous phase in new eppendrof and added equal

quantity of Chloroform/Isoamylalcohol (24/l).

Then tubes were centrifuged for 10 min at 13000 rpm and again collected

upper aqueous phase in new eppendrof.

To the collected aqueous phase 70l of 3M Na-acetate and equal volume of

Isopropanol were added.

Inverted the tubes gently to precipitate DNA.

Then centrifuged for 10 min at 13000 rpm.

Removed the solvent phase without disturbing the DNA pallet.

350l of 70% ethanol were added in a tube containing palleted DNA then

centrifuged at 13000 rpm for 10 min.

Ethanol was removed and DNA pallet was dried by kept in incubator.

Then DNA was dissolved in 90l of DNA dissolving solution (TE Buffer).

Small aliquots of extracted DNAs were stored at 20C.

3.5: AGAROSE GEL ELECTROPHORESIS

Agarose based isolated genomic DNA stocks was checked for purity using

0.8 - 1% w/v agarose (1gm of agarose in 100ml of 0.5 x TBE buffer), whereas PCR

products was run on 2% agarose gel. Gels were stained with ethidium bromide

(5g/100ml will be used after boiling in microwave oven) and DNA was analyzed


18/44

18

by placing the gel on uv-transilluminator (Sambrook et al., 2001). Known

molecular weight DNA markers were also run on gels along with sample DNAs to

estimate size. 2% agarose was run for PCR Amplified product along with known

molecular weight markers. Gel pictures were taken and saved by gel

documentation system for record keeping.

3.6: DNA QUANTIFICATION

Isolated genomic DNA was also quantified by using nanodrop (avans

Cudrop). Quantification was done by taking absorbance at 260nm, 280 and 230 nm

wavelengths. Ratios of 260/280 and 260/230 was used to check the protein and

alcoholic impurities. DNA was quantified in ng/ul.

3.7: PCR PRIMER DESIGN

Sequence of PPAR gene SNP rs1801282 were retrieved from NCBI

dbSNP database. Primers were designed by using online web source Primer3

program. Insert dp SNP sequence (Appendix III) and selected of SNP flanking

primers, the primers designed by software were of following sequence:

Upstream Primer: 5 CCAATTCAAGCCCAGTCCTTTC 3

Downstream Primer: 3CAGTGAAGGAATCGCTTTCCG 5

The above given primers were used in each separate vial. Tm or Melting

temperatures of primers were calculated using online Tm calculator by Applied


19/44

19

Biosystems, Life Technologies for estimation of PCR annealing temperatures.

Methods or annealing temperature.

3.7.1: Primer Re-suspension and Dilution

The forward and reverse primers were suspended in nano-pure water

(GIBCO) based on primers concentrations provided by the manufacturer to get a

final dilution of 100M primer stocks. The working 10M primer stocks were

prepared by further dilution of main stocks. All stocks were kept at -20C.

3.8: OPTIMIZATION OF PCR AMPLIFICATION CONDITIONS FOR

PPAR SNP

Genotyping was done based on PCR-RFLP method. Genomic DNA was

first amplified using polymerase chain reaction (PCR) based on designed primers.

PCR conditions were optimized like; PCR cycle times and temperatures, annealing

temperature, Mg+2 concentration and dNTPs concentration based on laboratory

conditions. The PCR products were run on 2% Agarose gel and visualized by gel

doc system after ethidium bromide staining and results were recorded and saved.

For PCR amplification, 7l reaction mixtures were prepared. The PCR cycling

conditions,reported in literature by (Su et al., 2008) were followed initially but a

number of parameters were changed for optimum amplification of the required

SNP region. The SNP rs1801282 (244bp) fragment of PPARgene was amplified

by Polymerase chain reaction (0.2xE Thermal cycler).


20/44

20

Initial denaturation at 94C (7 min)

Denaturation at 94C (30 sec)

Annealing at 58C (45sec) (36 cycles)

Extension at 72C (45sec)

Final Extension 72C (10 min)

Hold at 4C

Final extension takes place at 72C for 7 min. The PCR products (244bp)

were loaded on 2% agarose gel wells along with 100 bp ladder (Thermo Scientific)

at 120Volts 30 min to confirm the amplification of desired fragments of rs1801282

SNP (figure 2).


21/44

21

Figure 2: Amplified PCR product of PPARseparated on 1%

agarose gel

M 1 2 3 4


22/44

22

3.9: RESTRICTION FRAGMENT LENGTH POLYMORPHISM

For digestion of amplified PCR products sequence specific restriction

enzyme were used called restriction fragment length polymorphism (RFLP) to

identify the variation in homologous DNA sequence. Resulting digested fragments

were isolated by Agarose gel electrophoresis according to their sizes. Based on size

of fragment a finger prints were generated.

3.10: Digestion of PCR Amplified PPAR Gene rs1801282 SNP

The PCR amplified PPAR Gene rs2854116 SNP products (244bp) were

digested with Bsh (BstU1) 10U/L (Thermo Scientific) restriction enzyme at 37C

for 16 hours. Standardized conditions already reported in literature were used (Su

et al., 2008). The BstU1 recognition site is as follows;

5C G C G3

3G C GC5

A L restriction digestion reaction mixture was used (Table 2). Digestion

products were run on 3% Agarose gel electrophoresis along with 50bp ladder at 80

/ 100V for an hour. BstU1 produce cuts at specific site 5 C G C G 3,

digested PCR-RFLP products were loaded on 3% Agarose gel.

The 244bp fragment of gene rs1801282 SNP may have C to G substitution,

where site of BstU1 is located, while the fragment containing G allele remains


23/44

23

undigested heterozygous for AG. Enzyme will cut once before G and produces two

bands of size 223bp and 21bp respectively. Homozygous for C allele will remain

uncut and produce one band of 244bp on gel. Homozygous for G allele will

produce two bands of size 223bp and 21bp on gel. The result analysis of present

study was shows in 106 NAFLD patients, 103were homozygous for CC, 3 were

homozygous for GG whereas in 113 healthy controls, 112 were homozygous for

CC, 1 was homozygous for GG (Figure 3)

3.11: MAINTANANCE OF DATA RECORDS

Data was saved including all the anthropometric data and genotype data.

The data sheet contained information regarding name of patient, age, gender,

weight in kilogram (Kg), height in inches, circumference of waist (WC),

circumference of hip (HP), biochemical tests and the area of Pakistan to which

patient belonged.

3.12: GENOTTYPE/ALLELE FREQUENCY

PPAR rs1801282 genotyping was carried out by directly counting bands

From gels (homozygous/heterozygous) to establish the polymorphism profile by

Comparing the number of individuals in each group. Restriction digestion results

indicate genotype distribution among case and control groups. Hardy Weinberg

equation as described by Miller and Hardy was used for calculation of

genotype/allele frequencies (Su et al., 2008).


24/44

24

Figure 3: PCR-RFLP based Amplification ofPPARSNP rs1801282

PCR-RFLP products of rs1801282 were run along 50bp ladder in lane M. In above

gel Fatty Liver patients samples were run in wells. In well number 2, 4 shows

homozygous G/G genotype while well numbers 1, 3, 5, 6, 7, 8, 9, 10, 11 shows

homozygous C/C.

M 1 2 3 4 5 6 7 8 9 10 11


25/44

25

3.13: STATISTICAL ANALYSIS

Genotype/allele frequencies were estimated by allele counting and

comparing observed genotype frequencies to the expected frequencies. Deviations

from HardyWeinberg equilibrium were calculated through Chi-square goodness-

of-fit test. The descriptive statistics of means with 95% coefficient interval was

calculated to summarize the collected data. One-way Analysis of Variance

(ANOVA) was conducted for the comparison of risk parameters and disease

associations with genotype were calculated by using logistic regression. A

significance level of 0.05 was be used in all statistical analyses. The data analysis

was carried out using SPSS version 16.0 software (SPSS Inc., Chicago, IL, USA).


26/44

26

TABLE 1: PCR Reaction Mixture for Amplification of SNP rs1801282

PCR Reagents Stock Conc. Working Conc. Volume used

PCR Master Mix 5x - 1l

GIBCO Water - - 1l

Primer Forward 100M 10M 1l

Primer Reversed 100M 10M 1l

25mM MgCl2 0.25l

PCR Enhancer 0.25l

Genomic DNA 50ng/l 50ng 2l

Total PCR

Reaction Mixture

- - 7 l


27/44

27

Table 2: Reaction Mixture for Restriction Digestion of SNP rs1801282 PCR-

Amplified product

Reagents Volume Used (l)

PCR Amplified Product 5 l

GIBCO Water 0.5 l

10X buffer for Enzyme 0.5 l

BseGI (BtsCI) Enzyme 1 l

Total Reaction Mixture 7 l


28/44

28

RESULTS AND DISCUSSION

In present study, 200 blood samples were collected from fatty liver patients

and healthy individuals. Samples were genotyped for PPAR associated SNPs;

rs1801282 (C/G). PCR-RFLPbased genotyping study was conducted on 223

samples to find out the association of PPAR SNPs rs1801282 with NAFLD risk

factors such as ultrasound proved fatty liver. In the present study of 217 samples,

106 were cases were analyzed in comparison with 113 controls.

ASSOCIATION STUDIES OF NAFLD RISK FACTORS IN SELECTED

POPULATIONS

According to NAFLD definition following risk parameters were studied in

our population; Age, height, weight, waist circumference, hip circumference, ALT,

cholesterol, HDL, LDL and TG. One way ANOVA was applied to calculate

descriptive state on all risk factor with comparison among cases and controls to

find their association in different Age groups in both males and females with

PPAR SNPs rs1801282. Also genotyping results were analyzed in association

with all risk factors with 5% significance level to estimate the association of SNPs

rs1801282 with NAFLD risk factors in comparison among case control population.

NAFLD Risk Factors Analysis in among Case Control Population


29/44

29

Comparison of all variables (Age, Height, Weight, Weight Circumference

(WC), Height Circumference (HC), ALT, TG, cholesterol, HDL, and LDL) among

cases and controls expressed as MeansSD. The data presented in Table 4.1 shows

that W, WC, HC, ALT, CHOL and HDL are the parameters which are significantly

different among cases and controls. In cases the values of all the risk parameters

(weight 74.8715.889, WC 111.72016.342, HC112.40015.346, ALT

84.22275.8218, Cholesterol 220.49126.428 and HDL 139.95104.645) are

higher than the values in control weight(61.3819.772, WC78.80025.3189, HC

80.25027.5070, ALT 19.11317.2946, Cholesterol 165.7246.814 and HDL

36.4119.016). The descriptive in table shows that risk factors are highly prevalent

in cases than in control (0.05).

In this data we shows that there is no significant difference of Age, Height,

LDL and TG among cases and control and >0.05 with an earlier reported study

(Chuang et al.,2012) which shows that Age, Height, LDL are non significant risk

for NAFLD. According to another literature (Mattias Ekstedt., 2008) shows a

similar results that TG is non significant factor of NAFLD.


30/44

30

Table: 4.1. Anthropometric and biochemical parameters in fatty liver Cases and

Controls Expressed in Mean and Standard Deviation

Variables

Controls NAFLD Cases

p value

Mean SD Mean SD

Age (Years) 35.9316.17 38.2512.59 0.213

Height (ft) 6.5114.04 5.280.31 0.658

Weight (Kg) 61.3819.77 74.8715.89 0.001

WC (cm) 78.8025.32 111.7216.34


31/44

31

Gender Based Frequency

By comparison of risk phenotypes between cases and controls of both male

and female population we assume that frequency of ALT and HDL in male patients

(59.09% and 50.8%) is higher than control (40.9% and 49.1%), whereas

TG(45.61%), CHOL(30.3%), LDL(9.52%) have low frequency in cases ( Table 3).

By comparing this data with female patients it is showing that HDL frequency

(84.5%) is higher in female patients but not ALT, whereas all other variables are

low

Table 2: Association of Risk Phenotypes with Disease

Risk Phenotypes Odds p- values

Age 0.76(0.460-1.241) 0.268

Male

Female

2.36(0.258-0.692)

Ref(1)

0.001

Cholesterol 5.80(2.314-14.512) 0.0001


32/44

32

HDL 0.06(0.019-0.165) 0.0001

TG 2.31(0.956-5.565) 0.063

ALT 48.8(21.247-112.05) 0.0001

Table 3: Gender Based Frequency Table

Male Female


33/44

33

Variable Control% Case% Control% Case%

ALT 45 (40.9%) 65 (59.09%) 64 (68.8%) 29 (31.1%)

TG 31 (54.3%) 26 (45.61%) 39 (44.7%0 31 (44.2%)

Cholesterol 39 (69.6%) 17 (30.3%) 54 (76.05%) 17 (23.9%)

HDL 28 (49.1%) 29 (50.8%) 11 (15.49%) 60 (84.5%)

LDL 38 (90.4%) 04 (9.52%) 59 (90.7%) 06 (9.23%)

GENOTYPIC ASSOCIATION WITH NAFLD AND CONRTROL

Association analysis of genotyping with the disease showed that the subject

having G/G genotype is at 2.89 odds more risk of getting fatty liver disease as

compared to CC genotype, but statistically results are not significant ( >0.005).


34/44

34

Table 4: GENOTYPING GENOTYPE FREQUENCIES

GENOTYPING genotype frequencies (n=217)

All subjects Control Case

Genotype Count Proportion Count Proportion Count Proportion


35/44

35

C/C 212 0.98 104 0.99 108 0.97

G/G 4 0.02 1 0.01 3 0.03

NA 1 --- 0 --- 1

Table 5: ALLELE FREQUENCY

GENOTYPING allele frequencies (n=216)

All subjects Control Case

Allele Count Proportion Count Proportion Count Proportion

C 424 0.98 208 0.99 216 0.97

G 8 0.02 2 0.01 6 0.03

Table 6:

GENOTYPING exact test for Hardy-Weinberg equilibrium (n=216)

CC CG GG C G P-value

All subjects 212 0 4 424 8


36/44

36

respons=1 108 0 3 216 6


37/44

37

Throughout the world specially including United States it is the

most common liver disease and now 2030% of the general population in

North America and similar countries affected by NAFLD. A number of

genes are found to be associated with fatty liver disease but resently

discover that PPAR is now considered candidate gene for Fatty Liver

Disease. peroxisome proliferator activated receptor gamma (PPAR) gene

encodes a member of the Peroxisome proliferator activated receptor

(PPAR) subfamily of nuclear receptors. Gene functions are affected by

several environmental factors such as dietary habits and composition of

intestinal microflora. The receptor PPAR binds chemicals that induce

proliferation of peroxisomes, organelles which contribute to the oxidation

of fatty acids. Several polymorphisms in PPAR have been identified in

various ethnic groups around the world. Some of them have shown strong

association with insulin resistance, obesity, Diabetes mellitus, and

metabolic syndrome. Thus PPAR is proposed an important candidate gene

for the diagnosis of various metabolic complications. Present study is

designed to identify PPAR gene risk variant in local NAFLD patients

under following objectives; PCR based genotyping of PPAR gene

polymorphism in selected population and association of identified

polymorphic forms with fatty liver. Blood samples of NAFLD diagnosed


38/44

38

patients will be conducted from OPDs of local hospitals for genomic DNA

extraction. PCR based genetic typing of selected PPAR SNP will be

performed. The genotypic data will be statistically analyzed to find disease

association. The expected outcomes of this study include identification of

PPAR genetic variants in selected Pakistani population and their

association with fatty liver specific environmental factors.

LITERATURE CITED

Angulo, p. 2007. Obesity and Nonalcoholic Fatty Liver Disease. Nutr Rev, 65:857-

863.

Brunt, E. M. and D. G. Tiniakos. 2010. Histopathology of nonalcoholic fatty liver

disease. World J.Gastroenterol., 16(42): 52865296.


39/44

39

Caldwel, S. H., D. H. Oelsner , J. C. Iezzoni, E. E. Hespenheide, E. H. Battle, C. J.

Driscoll. 1999. Cryptogenic cirrhosis: clinical characterization and risk

factors for underlying disease. Hepatology., 29: 664669.

Chen, Z. W., L.Y. Chen, H.L. Dai, J.L. Chen, L.Z. Fang. 2008. Relationship

between alanine aminotransferase levels and metabolic syndrome in

nonalcoholic fatty liver disease. J Zhejiang Univ Sci B., 9: 616622.

Damiano, F., G.V. Gnoni, L. Siculella. 2012. Citrate carrier promoter is target of

peroxisome proliferator-activated receptor alpha and gamma in hepatocytes

and adipocytes. Int. J. Biochem. Cell Biol., 44(4): 659668.

Day, C. P., E. Henderson, A. D. Burt and J. L. Newton.2006. Non-alcoholic fatty

liver disease in older people. Gerontology., 55: 607613.

Dubuquoy, L., S. Dharancy, S. Nutten, S. Pettersson, J.Auwerx, P. Desreumaux.

2002. Role of peroxisome proliferator-activated receptor and retinoid X

receptor heterodimer in hepatogastroenterological diseases. The Lancet.,

360(9343): 14101418.

Erickson, S. K. 2009. Nonalcoholic fatty liver disease. J. Lipid. Res., 50(suppl):

412- 416.

Evans, R. M., G. D. Barish, Y. X. Wang. 2008. PPARs and the complex journey to

obesity.Nature Med. 10: 355-361.sss

Fajas, L., D. Auboeuf, E. Raspe, K. Schoonjans, A. M. Lefebvre, R. Saladin, J.

Najib, M. Laville, J.-C. Fruchart, S. Deeb, A. Vidal-Puig, J. Flier, M.R.


40/44

40

Briggs, B. Staels, H. Vidal, J. Auwerx. 1997. The organization, promoter

analysis, and expression of the human PPAR-gamma gene. J. Biol. Chem.,

272: 18779-18789.

Fajas, L., D. Auboeuf, E. Rasp, K. Schoonjans, A. M. Lefebvre, R. Saladin, J.

Najib, M. Laville, J.C. Fruchart, S. Deeb, A. Vidal-Puig, J. Flier, M.R.

Briggs, B. Staels, H. Vidal, J. Auwerx. 1997. The organization, promoter

analysis, and expression of the human PPARgamma gene. J Biol Chem.,

272(30): 18779-187789.

Fan, J. G., J. Zhu and XJ. Li. 2005. Prevalence of and risk factors for fatty liver in a

general population of Shanghai, China. J. Hepatol., 43: 508514.

Fan, J. G., J. Zhu, X. J. Li, L. Chen, S. Lu, L. Li, F. Dai, F. Li, S. Y. Chen. 2005.

Fatty liver and the metabolic syndrome among Shanghai adults. J.

Gastroenterol Hepatol., 20(12): 18251832.

Frith, J., D. Jones and J. L. Newton. 2009. Chronic liver disease in an ageing

population. Age and Ageing., 38(1): 1118.

Jones, J. R., C. Barrick, K. A. Kim, J. Lindner, B. Blondeau, Y. Fujimoto, M.

Shiota , R.A. Kesterson, B.B. Kahn, M.A. Magnuson. 2005. Deletion of

PPAR in adipose tissues of mice protects against high fat diet-induced

obesity and insulin resistance. Proc. Natl. Acad. Sci. U.S.A., 102(17):

620712.

Khuram, M., S. Abdul, M.M. Arshad, H. Khaar, Z. Hasan. 2004. Characteristic

features of NAFLD patients. Rawal Med J., 29: 82.
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC556131http://www.ncbi.nlm.nih.gov/pmc/articles/PMC556131http://www.ncbi.nlm.nih.gov/pmc/articles/PMC556131http://www.ncbi.nlm.nih.gov/pmc/articles/PMC556131http://www.ncbi.nlm.nih.gov/pmc/articles/PMC556131http://www.ncbi.nlm.nih.gov/pmc/articles/PMC556131http://www.ncbi.nlm.nih.gov/pmc/articles/PMC556131


41/44

41

Kletzien, R. F., S. D. Clarke, R. G. Ulrich. 1992. Enhancement of adipocyte

differentiation by an insulin-sensitizing agent.Mol. Pharmacol., 41: 393

398.

Kuk, J. L., T. J. Saunders, L. E. Davidson and R. Ross. 2009. Age-related changes

in total and regional fat distribution. Ageing Research Reviews., 8(4): 339

348.

Lazar, M. A. 2005. PPAR, 10 years later. Biochimie., 87(1): 913.

Loria, P., A. Lonardo, S. Lombardini. 2005. Gallstone disease in non-alcoholic

fatty liver: prevalence and associated factors. J. GastroenterolHepatol., 20:

11761184.

Madan, K., Y. Batra, S.P. Gupta., B. Chander, K.D Rajan, M.S. Tewatia et al.

2006. Nonalcoholic fatty liver disease may not be a severe disease at

presentation among Asian Indians. World J. Gasteroenterol., 12: 3400

3405.

Mauro, K., C. Crdova, R. Jac de Oliveira, M. Gomes de Oliveira Karnikowski, O. de

Toldo Nbrega. 2007. Non-alcoholic fatty liver disease and metabolic syndrome

in Brazilian middle-aged and older adults. Med. J., 125(6).

Mentha, G., O. Huber, J. Robert, C. Klopfenstein, R. Egeli, and A. Rohner. 1992.

Elective hepatic resection in the elderly. Bri. J. Surg., 79(6): 557559.

Mueller, E. S. Drori, A. Aiyer, J. Yie, P. Sarraf, H. Chen, S. Hauser, E. D. Rosen,

K. Ge, R.G. Roeder, B. M Spiegelman. 2002. Genetic analysis of


42/44

42

adipogenesis through peroxisome proliferator-activated receptor gamma

isoforms. J. Biol. Chem., 277: 4192541930.

Mukherjee, R., L. Jow, G. E. Croston, J. R. Paterniti. 1997. Identification,

Characterization, and Tissue Distribution of Human Peroxisome

Proliferator Activated Receptor (PPAR) Isoforms PPARgamma2 Varsus

PPARgamma1 and Activation wuth Retinoid X Receptor Agonist and

Antagonists. J. Biol Chem., 272: 8071-8076.

Musso, G.,R.Gambino, F. De Michieli, M. Durazzo, G. Pagano, and M. Cassader.

2008. Adiponectin gene polymorphisms modulate acute adiponectin

response to dietary fat: possible pathogenetic role in NASH. Hepatol. 47:

11671177.

Ong, J. P., A. Pitts and Z. M. Younossi. 2008. Increased overall mortality and liver-

related mortality in non-alcoholic fatty liver disease. J. Hepatol., 49: 608

612.

Paola., D. and L. Valenti. 2012. Peroxisome Proliferator-Activated Receptor Genetic

Polymorphisms and Nonalcoholic Fatty Liver Disease: Any Role in Disease

Susceptibility? Int. Med., 2013.

Qari, F. A., A. Al Ghamdi. 2005. Fatty liver in overweight and obese patients in

Western part of Saudi Arabia: a study of sonological prevalence. Pak J Med

Sci., 21: 1437.

Ren, D., T. N. Collingwood, E. J. Rebar, A. P. Wolffe, H. S. Camp. 2002.

PPARgamma knockdown by engineered transcription factors: exogenous
http://www.hindawi.com/50197450/http://www.hindawi.com/60832424/http://www.hindawi.com/60832424/http://www.hindawi.com/50197450/


43/44

43

PPARgamma2 but not PPARgamma1 reactivates adipogenesis. Genes

Dev., 16: 2732.

Schmucker, D. L. 1998. Aging and the liver: an update. J. Gerontol. Series., 53(5):

315320.

Solga, S. F.and A. M. Diehl. 2003. Non-alcoholic fatty liver disease: lumen-liver

interactions and possible role for probiotics.J. Hepatol., 38: 681687.

Sorrentino. P., G. Tarantino and P. Conca. 2004. Silent non-alcoholic fatty liver

disease-a clinical-histological study. J. Hepatol., 41: 751757.

Stienstra, R., C. Duva, M. Muller, S. Kersten. 2007. PPARs, obesity, and

inflammation. PPAR Research. 2007: 95964-95974.

Tan, G. D. C. Debard,C. Tiraby,S. M. Humphreys,K. N.Frayn,D. Langin,H.

Vidal, F. Karpe. 2003. A futile cycle induced by thiazolidinediones in

human adipose tissue? Nat. Med., 9: 811812.

Tonjes, A. M. Scholz, M. Loeffle, M. Stumvoll. 2006. Association of Pro12Ala

polymorphism in peroxisome proliferator-activated receptor gamma with

Pre-diabetic phenotypes: meta-analysis of 57 studies on nondiabetic

individuals.Diabetes Care., 29(11): 2489-2497.

Tontonoz, P. E. Hu and B. M. Spiegelman.1994. Stimulation of adipogenesis in

fibroblasts by PPAR gamma 2, a lipid-activated transcription factor. Cell.,

79: 11471156.
http://www.ncbi.nlm.nih.gov/pubmed?term=Debard%20C%5BAuthor%5D&cauthor=true&cauthor_uid=12835685http://www.ncbi.nlm.nih.gov/pubmed?term=Tiraby%20C%5BAuthor%5D&cauthor=true&cauthor_uid=12835685http://www.ncbi.nlm.nih.gov/pubmed?term=Humphreys%20SM%5BAuthor%5D&cauthor=true&cauthor_uid=12835685http://www.ncbi.nlm.nih.gov/pubmed?term=Frayn%20KN%5BAuthor%5D&cauthor=true&cauthor_uid=12835685http://www.ncbi.nlm.nih.gov/pubmed?term=Langin%20D%5BAuthor%5D&cauthor=true&cauthor_uid=12835685http://www.ncbi.nlm.nih.gov/pubmed?term=Vidal%20H%5BAuthor%5D&cauthor=true&cauthor_uid=12835685http://www.ncbi.nlm.nih.gov/pubmed?term=Karpe%20F%5BAuthor%5D&cauthor=true&cauthor_uid=12835685http://www.ncbi.nlm.nih.gov/pubmed?term=Karpe%20F%5BAuthor%5D&cauthor=true&cauthor_uid=12835685http://www.ncbi.nlm.nih.gov/pubmed?term=Vidal%20H%5BAuthor%5D&cauthor=true&cauthor_uid=12835685http://www.ncbi.nlm.nih.gov/pubmed?term=Langin%20D%5BAuthor%5D&cauthor=true&cauthor_uid=12835685http://www.ncbi.nlm.nih.gov/pubmed?term=Frayn%20KN%5BAuthor%5D&cauthor=true&cauthor_uid=12835685http://www.ncbi.nlm.nih.gov/pubmed?term=Humphreys%20SM%5BAuthor%5D&cauthor=true&cauthor_uid=12835685http://www.ncbi.nlm.nih.gov/pubmed?term=Tiraby%20C%5BAuthor%5D&cauthor=true&cauthor_uid=12835685http://www.ncbi.nlm.nih.gov/pubmed?term=Debard%20C%5BAuthor%5D&cauthor=true&cauthor_uid=12835685


44/44

Tontonoz, P. E. Hu., R. A. Graves, A. I. Budavari, B. M. Spiegelman. 1994.

mPPAR gamma 2: tissue-specific regulator of an adipocyte enhancer.

Genes Dev., 8: 12241234.

Wang, Y. X. 2010. PPARs: diverse regulators in energy metabolism and metabolic

diseases. Cell Research.20(2): 124137.

Williams, C. D., J. Stengel, M. I. Asike, D. M. Torres, J. Shaw, M. Contreras, C. L.

Landt, S. sA. Harrison. 2011. Prevalence of nonalcoholic fatty liver disease

and nonalcoholic steatohepatitis among a largely middle-aged population

utilizing ultrasound and liver biopsy: a prospective study. Gastroenterol.,

140: 124131.

Date post:	03-Jun-2018
Category:	Documents
Upload:	christian-carroll
View:	214 times
Download:	0 times

Introductio1 Final Sid - Copy 1 (1)

Documents