+ All Categories
Home > Documents > Lac Operon Gene Regulation in action. What is gene regulation Expressing a gene –Making the...

Lac Operon Gene Regulation in action. What is gene regulation Expressing a gene –Making the...

Date post: 18-Dec-2015
Category:
Upload: collin-lyons
View: 214 times
Download: 0 times
Share this document with a friend
Popular Tags:
27
Lac Operon Gene Regulation in action
Transcript
Page 1: Lac Operon Gene Regulation in action. What is gene regulation Expressing a gene –Making the protein for the gene Only making a protein when needed The.

Lac Operon

Gene Regulation in action

Page 2: Lac Operon Gene Regulation in action. What is gene regulation Expressing a gene –Making the protein for the gene Only making a protein when needed The.

What is gene regulation

• Expressing a gene– Making the protein for the gene

• Only making a protein when needed

• The process for determining when transcription occurs– or what factors determine that

Page 3: Lac Operon Gene Regulation in action. What is gene regulation Expressing a gene –Making the protein for the gene Only making a protein when needed The.

Introns and Exons

• Eukaryotic DNA differs from prokaryotic DNA it that the coding sequences along the gene are interspersed with noncoding sequences

• The coding sequences are called

• EXONS

• The non coding sequences are called

• INTRONS

Page 4: Lac Operon Gene Regulation in action. What is gene regulation Expressing a gene –Making the protein for the gene Only making a protein when needed The.
Page 5: Lac Operon Gene Regulation in action. What is gene regulation Expressing a gene –Making the protein for the gene Only making a protein when needed The.

Lac Operon

• Found in E. Coli– Bacteria– Prokaryote

• Determines the balance between enzyme and substrate

• What really happens when we make protein?- requirements– Amino acids, transcription, translation- don’t

forget ATP

Page 6: Lac Operon Gene Regulation in action. What is gene regulation Expressing a gene –Making the protein for the gene Only making a protein when needed The.

Lac Operon

• Waste of energy?– You bet!

• How do we make sure we can make proteins only when we need them– How do we get lights only when we need

them – How do we get electricity in this thing

Page 7: Lac Operon Gene Regulation in action. What is gene regulation Expressing a gene –Making the protein for the gene Only making a protein when needed The.

Lac Operon

• Reminder about bacteria– Bacteria- 1 chromosome– Bacteria- one strand– DNA is circular

Page 8: Lac Operon Gene Regulation in action. What is gene regulation Expressing a gene –Making the protein for the gene Only making a protein when needed The.

Lac Operon

• Many of our old buddies are still around– DNA– RNA– Factors– Helicase

- Polymerase

Page 10: Lac Operon Gene Regulation in action. What is gene regulation Expressing a gene –Making the protein for the gene Only making a protein when needed The.

New Terms

• Promoter region– Place upstream important for binding in

DNA

• Controller/operator regions– Where Operon binds in

• Lactose– the sugar

Page 11: Lac Operon Gene Regulation in action. What is gene regulation Expressing a gene –Making the protein for the gene Only making a protein when needed The.

Enzymes

• Permease– Protein allow items into the cell

• Beta-galactosidase– Breaks down glucose

• Transacetylase- ?

Page 12: Lac Operon Gene Regulation in action. What is gene regulation Expressing a gene –Making the protein for the gene Only making a protein when needed The.

Look at the DNALook at the DNA

Promoter Promoter RegionRegion

Operator Operator SequenceSequence

Coding Coding RegionRegion

Terminator Terminator SequenceSequence

DNA DNA SequenceSequence

Page 13: Lac Operon Gene Regulation in action. What is gene regulation Expressing a gene –Making the protein for the gene Only making a protein when needed The.

Promoter Promoter RegionRegion

Operator Operator SequenceSequence

Coding Coding RegionRegion

Terminator Terminator SequenceSequence

Lac Operon in actionLac Operon in action

ATATATATATATATATATATATATAGGGGGCCGGGGCGGGGGATATCGCATACAGG

TATATATATATATATATATATATATCCCCCGGCCCCGCCCCCCTATAGCGTATGTCC

Page 14: Lac Operon Gene Regulation in action. What is gene regulation Expressing a gene –Making the protein for the gene Only making a protein when needed The.

Promoter Promoter RegionRegion

Operator Operator SequenceSequence

Coding Coding RegionRegion

Terminator Terminator SequenceSequence

Lac Operon in actionLac Operon in action

If there is no lactose present, the inhibitor is bound to the operator (Operon) sequence.

ATATATATATATATATATATATATAGGGGGCCGGGGCGGGGGATATCGCATACAGG

TATATATATATATATATATATATATCCCCCGGCCCCGCCCCCCTATAGCGTATGTCC

Page 15: Lac Operon Gene Regulation in action. What is gene regulation Expressing a gene –Making the protein for the gene Only making a protein when needed The.

Promoter Promoter RegionRegion

Operator Operator SequenceSequence

Coding Coding RegionRegion

Terminator Terminator SequenceSequence

Lac Operon in actionLac Operon in action

If there is no lactose present, the inhibitor is bound to the operator (Operon) sequence.

No space for polymerase to reach where it needs to.

ATATATATATATATATATATATATAGGGGGCCGGGGCGGGGGATATCGCATACAGG

TATATATATATATATATATATATATCCCCCGGCCCCGCCCCCCTATAGCGTATGTCC

InhibitorInhibitor

Page 16: Lac Operon Gene Regulation in action. What is gene regulation Expressing a gene –Making the protein for the gene Only making a protein when needed The.

Promoter Promoter RegionRegion

Operator Operator SequenceSequence

Coding Coding RegionRegion

Terminator Terminator SequenceSequence

Lac Operon in actionLac Operon in action

If there is no lactose present, the inhibitor is bound to the operator (Operon) sequence.

No space for polymerase to reach where it needs to.

ATATATATATATATATATATATATAGGGGGCCGGGGCGGGGGATATCGCATACAGG

TATATATATATATATATATATATATCCCCCGGCCCCGCCCCCCTATAGCGTATGTCC

InhibitorInhibitorRNA RNA POLPOL

Page 17: Lac Operon Gene Regulation in action. What is gene regulation Expressing a gene –Making the protein for the gene Only making a protein when needed The.

Promoter Promoter RegionRegion

Operator Operator SequenceSequence

Coding Coding RegionRegion

Terminator Terminator SequenceSequence

Lac Operon in actionLac Operon in action

No space for polymerase to reach where it needs to.

Lactose solution added

ATATATATATATATATATATATATAGGGGGCCGGGGCGGGGGATATCGCATACAGG

TATATATATATATATATATATATATCCCCCGGCCCCGCCCCCCTATAGCGTATGTCC

InhibitorInhibitorRNA RNA POLPOL

Page 18: Lac Operon Gene Regulation in action. What is gene regulation Expressing a gene –Making the protein for the gene Only making a protein when needed The.

What’s Lactose again?

Page 19: Lac Operon Gene Regulation in action. What is gene regulation Expressing a gene –Making the protein for the gene Only making a protein when needed The.

Promoter Promoter RegionRegion

Operator Operator SequenceSequence

Coding Coding RegionRegion

Terminator Terminator SequenceSequence

Lac Operon in actionLac Operon in action

Lactose solution added

Lactose binds to the inhibitor

ATATATATATATATATATATATATAGGGGGCCGGGGCGGGGGATATCGCATACAGG

TATATATATATATATATATATATATCCCCCGGCCCCGCCCCCCTATAGCGTATGTCC

InhibitorInhibitorRNA RNA POLPOL

Page 20: Lac Operon Gene Regulation in action. What is gene regulation Expressing a gene –Making the protein for the gene Only making a protein when needed The.

Promoter Promoter RegionRegion

Operator Operator SequenceSequence

Coding Coding RegionRegion

Terminator Terminator SequenceSequence

Lac Operon in actionLac Operon in action

Lactose binds to the inhibitor

Lactose causes inhibitor no longer bind to the operator sequence

ATATATATATATATATATATATATAGGGGGCCGGGGCGGGGGATATCGCATACAGG

TATATATATATATATATATATATATCCCCCGGCCCCGCCCCCCTATAGCGTATGTCC

RNA RNA POLPOL

InhibitorInhibitor

Page 21: Lac Operon Gene Regulation in action. What is gene regulation Expressing a gene –Making the protein for the gene Only making a protein when needed The.

Promoter Promoter RegionRegion

Operator Operator SequenceSequence

Coding Coding RegionRegion

Terminator Terminator SequenceSequence

Lac Operon in actionLac Operon in action

Lactose causes inhibitor no longer bind to the operator sequence

RNA Polymerase can now transcribe

ATATATATATATATATATATATATAGGGGGCCGGGGCGGGGGATATCGCATACAGG

TATATATATATATATATATATATATCCCCCGGCCCCGCCCCCCTATAGCGTATGTCC

RNA RNA POLPOL

InhibitorInhibitor

Page 22: Lac Operon Gene Regulation in action. What is gene regulation Expressing a gene –Making the protein for the gene Only making a protein when needed The.

Promoter Promoter RegionRegion

Operator Operator SequenceSequence

Coding Coding RegionRegion

Terminator Terminator SequenceSequence

Lac Operon in actionLac Operon in action

Lactose causes inhibitor no longer bind to the operator sequence

RNA Polymerase can now transcribe

ATATATATATATATATATATATATAGGGGGCCGGGGCGGGGGATATCGCATACAGG

TATATATATATATATATATATATATCCCCCGGCCCCGCCCCCCTATAGCGTATGTCC

RNA RNA POLPOL

CCCCCGCCCCCGCCCCCUAUCCCCCGCCCCCGCCCCCUAURNA

Page 23: Lac Operon Gene Regulation in action. What is gene regulation Expressing a gene –Making the protein for the gene Only making a protein when needed The.

Three mRNA “recipes” are made

• Permease– Protein allow items into the cell

• Beta-galactosidase– Breaks down glucose

• Transacetylase

• They also get translated!

Page 24: Lac Operon Gene Regulation in action. What is gene regulation Expressing a gene –Making the protein for the gene Only making a protein when needed The.

Promoter Promoter RegionRegion

Operator Operator SequenceSequence

Coding Coding RegionRegion

Terminator Terminator SequenceSequence

Lac Operon in actionLac Operon in action

Transcription continues to occur until lactose levels get low in the solution

ATATATATATATATATATATATATAGGGGGCCGGGGCGGGGGATATCGCATACAGG

TATATATATATATATATATATATATCCCCCGGCCCCGCCCCCCTATAGCGTATGTCC

RNA RNA POLPOL

CCCCCGCCCCCGCCCCCUAUCCCCCGCCCCCGCCCCCUAURNA

Page 25: Lac Operon Gene Regulation in action. What is gene regulation Expressing a gene –Making the protein for the gene Only making a protein when needed The.

Promoter Promoter RegionRegion

Operator Operator SequenceSequence

Coding Coding RegionRegion

Terminator Terminator SequenceSequence

Lac Operon in actionLac Operon in action

Transcription continues to occur until lactose levels get low in the solution

Then the inhibitor binds back into the operator sequence

ATATATATATATATATATATATATAGGGGGCCGGGGCGGGGGATATCGCATACAGG

TATATATATATATATATATATATATCCCCCGGCCCCGCCCCCCTATAGCGTATGTCC

RNA RNA POLPOL

InhibitorInhibitor

Page 26: Lac Operon Gene Regulation in action. What is gene regulation Expressing a gene –Making the protein for the gene Only making a protein when needed The.

The End

Page 27: Lac Operon Gene Regulation in action. What is gene regulation Expressing a gene –Making the protein for the gene Only making a protein when needed The.

DNA


Recommended