Date post: | 06-Jul-2018 |
Category: |
Documents |
Upload: | insan-fitriyani |
View: | 232 times |
Download: | 0 times |
of 17
8/17/2019 Microarray Analysis Identifies Differentially
1/17Copyright @ 2009 by IGCS and ESGO. Unauthorized reproduction of this article is prohibited.
Microarray Analysis Identifies DifferentiallyExpressed Genes Induced by Human Papillomavirus
Type 18 E6 Silencing RNA
Wei Min, PhD,* Ma Wen-li, MD, PhD,* Sun Zhao-hui, PhD,Þ Li Ling, PhD,* Zhang Bao, PhD,*
and Zheng Wen-ling, MD, PhDþ
Abstract: The oncoprotein E6 of high-risk human papillomavirus (HPV) types promotes
cell proliferation and contributes to carcinogenesis of HPV-positive cervical cancer cells. In
this study, we used small interfering RNA (siRNA) technology to silence the E6 gene in
HPV-18 Y transformed human cervical cell line HeLa and determined the effects of E6 gene
knockdown on the cell by using microarray-based gene expression profiling coupled
with gene functional classification with bioinformatics methods. Silencing RNA prepared by
siRNA expression cassettes against HPV-18 E6 gene could significantly inhibit E6 gene
expression and induce HeLa cells to apoptosis. The microarray analysis identified 359
differentially expressed genes containing 307 up-regulated and 52 down-regulated genes. We
analyzed the gene functions andcellular pathways in detail, including cell cycle Y related genes,
CCNG1 and p21; apoptosis-related genes, CASP4, CASP6 , IGFBP3, and DFFA; ubiquitin
proteolysis pathway Y related genes, UBE3A and UBE2C ; keratinocyte differentiation Y
related genes, KRT4, KRT6E , and KRT18; and antioncogenes, RECK and VEL . In addition,
it can be concluded that cellular apoptosis induced by HPV-18 E6 siRNA mainly depends on
the P53 and ubiquitin proteolysis pathway to regulate gene expression, consequently
inhibiting cell proliferation and promoting cell apoptosis. Meanwhile, activation of
antioncogene and upper regulation of immunization-related genes signified the degression
of the malignant extent of tumor cells after E6 inhibition. Our approach, which combines the
use of siRNA-mediated gene silencing, microarray screening, and functional classificationof differential genes, can be used in functional genomics study to elucidate the role of E6
oncogene in the carcinogenesis of HPV-18 and provide some possible targets for clinical
treatment and drug development of cervical cancer.
Key Words: siRNA, Microarray, HPV, E6
( Int J Gynecol Cancer 2009;19: 547 Y 563)
Cervical cancer is one of the most common malignancies and the second leading cause of cancer mortality in women world-wide. Nearly 400,000 cases were diagnosed annually worldwide,80% of which occurred in developing countries.1 During the past 20 years, the links between genital human papillomavirus (HPV)
infections and cervical cancer have been identified.
2
It is now agreed
universally that HPV causes virtually all cervical cancers.3 To date,more than 85 different HPV types have been identified, and amongthem, more than 20 high-risk HPV (HR-HPV) types have an estab-lished risk to develop into squamous cell carcinoma.4 Among theseHR-HPV types, HPV-16 and HPV-18 are found in 60% to 70% of
invasive cervical carcinomas, with the HPV-31, HPV-58, and HPV-52 types causing the remaining cases.5,6 Some studies have reported that patients infected with HPV-18 had worse prognoses and higher rates of disease recurrence than patients infected with HPV-16.7 Y 13
A possible difference might as well be caused by adenocarcinomas,which are more frequently associated with HPV-18, that might havea worse prognosis.
The transforming activity of tumor-associated HR-HPVtypes, such as HPV-16 and HPV-18, is dependent on the functionsof the viral E6 and E7 oncogenes, and continuous E6/E7 expressionis required for the maintenance of the transformed phenotype of HPV-positive cervical cancer cells.14 E6 protein binds a number of cellular proteins including the E6-associated protein (E6AP), a protein ligase of the ubiquitin proteolysis pathway. E6 complexed
ORIGINAL ARTICLE
International Journal of Gynecological Cancer & Volume 19, Number 4, May 2009 547
*Institute of Molecular Biology, Southern Medical University; †Department of Clinical Laboratory, Guangzhou Liuhuaqiao Hospital; and ‡SouthernChina Genomics Research Center, Guangzhou, People’s Republic of China.Address correspondence and reprint requests to Ma Wen-li, Institute of
Molecular Biology, Southern Medical University, Guangzhou 510515,People’s Republic of China. E-mail: [email protected].
This work was supported by the Natural Science Foundation of GuangdongProvince, China (grant No. D07300239), and the Medical ScientificResearch Foundation of Guangdong Province, China (grant
No.WSTJJ20071201360103197802270749).Copyright * 2009 by IGCS and ESGOISSN: 1048-891XDOI: 10.1111/IGC.0b013e3181a44c68
8/17/2019 Microarray Analysis Identifies Differentially
2/17Copyright @ 2009 by IGCS and ESGO. Unauthorized reproduction of this article is prohibited.
with E6AP targets the P53 tumor suppressor protein for proteasomedegradation, resulting in genetic instability and progression toward malignancy.15 In contrast, HPV E7 is known to bind the transcrip-tional repressor hypophosphorylated retinoblastoma protein, caus-ing increased levels of active E2F transcription factors.16 This resultsin increased expression of genes involved in cell cycle progression
and DNA synthesis.Studies have demonstrated that the expression of HPV E6
protein is indispensable for tumor development and maintenanceof malignant phenotypes. Thus, E6 oncogene is an ideal target of gene-specific therapy for cervical cancer. Previous studies havedemonstrated that the attempts of targeting E6/E7 by therapeuticnucleic acids including antisense RNA and oligonucleotides re-sulted in a several-fold inhibition of proliferation in cervical cancer cell lines,17 Y 19 and now, combination of the small interfering RNA(siRNA) and microarray technologies can provide a powerful toolto analyze comprehensively viral pathogenicity-related genes.
Expression profile microarray technology should provide auseful experimental strategy to define cellular target genes for HPV-induced cell transformation by identifying transcriptionally altered genes upon silencing of endogenous E6 expression in HPV-positive
cancer cells. Combining microarray with bioinformatics technologyto analyze the gene expression patterns of various tumors is an im- portant method in functional genomic studies. It surpasses the solegene research pattern obviously and may illuminate the gene expres-sion and regulation network of tumor cells in the whole.
The present work used siRNA technology to silence E6 genein HPV-18 Y transformed human cervical cell line HeLa and deter-mined the effection of E6 gene knockdown on the cell by usingmicroarray-based gene expression profiling coupled with gene func-tional classification with bioinformatics methods.
MATERIALS AND METHODS
Silencing RNA Expression Cassettes
Constructed by Polymerase Chain ReactionSilencing RNAs targeting HPV-18 E6 gene were designed and synthesized according to the manufacturer’s instruction of LineSilence Complete RNAi Kit (Allele Biotechnology). The tar-get sequence for HPV-18 E6 was nucleotide site 340-358 (5¶-GACATTATTCAGACTCTGT-3¶). In addition, the negative controlmessenger-silencing RNA (m-siRNA) has the same base composi-tion but confused sequences of targeting E6 siRNA. Both siRNAsequences were screened against the human genome by using a basiclocal alignment search tool homology search to avoid unintentionalsilencing of host cell genes. Polymerase chain reactions (PCRs)were performed using a plasmid containing the human U6 promoter as template. The upstream primer (5¶U6 universal primer) is comple-mentary to 29 nucleotides (nt) at the 5 ¶ end of the U6 promoter. Thedownstream primer (3¶U6 universal primer) contains a U6 termina-
tor, a sense or antisense siRNA sequence, and a complementary se-quence to the last 20 nt of the U6 promoter. The sequences of thedownstream primers of E6 siRNA and m-siRNA were synthesized (Invitrogen Corp, Carlsbad, Calif ) as follows:Antisense prime of E6 siRNA,5¶-caaaaactgtaaa AAGACATTATTCAGACTCTGT ggtgtttcgtcctttcca
caaga-3¶;sense prime of E6 siRNA,5¶-caaaaactgtaaa AAACAGAGTCTGAATAATGTC ggtgtttcgtcctttcca
caaga-3¶;Antisense prime of m-siRNA,5¶-caaaaactgtaaa AAGACTTGTATCACTAACTTC ggtgtttcgtcctttcca
caaga-3¶;Sense prime of m-siRNA,
5¶-caaaaactgtaaa AAGAAGTTAGTGATACAAGTC ggtgtttcgtcctttccacaaga-3¶.The PCR reactions were carried out in a final reaction volume
of 50 KL; it contained template DNA (1 ng/ KL), 1 KL; 10 PCR buffer, 5 KL; 4 deoxyribonucleotide triphosphates, 1 KL; Taq poly-merase (Gibco), 1 unit; upstream primer (20 Kmol/L), 1.2 KL;
downstream primer (20 Kmol/L), 1.2 KL; and double distilled water,37.5 KL. Forty cycles of PCR amplification (2 steps) were per-formed as follows: Denature at 94-C for 30 seconds and annealand extend at 72-C for 1 minute 30 seconds. The amplified DNAfragments were fractionated by agarose 1.5% gel electrophoresisand visualized by ethidium bromide staining.
Cell CultureHuman papillomavirus 18 Y positive HeLa cervical carcinoma
cells were cultured in Roswell Park Memorial Institute 1640 me-dium (Invitrogen Corp) supplemented with 10% fetal bovineserum (Invitrogen Corp) and incubated at 37-C with 5% CO2. Themedium was changed once every 2 days, and the cells were trans-ferred into 24-well plates at a density of 3 103 cells per well 1 day before transfection.
Transfection of CellsOne day before transfection, HeLa cells were transferred into
24-well plates at a density of 3 104 cells in 400 KL of RoswellPark Memorial Institute 1640 growth medium without antibiotics per well. We used Lipofectamine 2000 (Invitrogen Corp) as trans-fection reagent according to the protocols as follows: (1) 0.5 Kg of DNA (PCR product) was mixed thoroughly with 50 KL of serum-and antibiotic-free medium incubated for 5 minutes at room tem- perature. (2) Lipofectamine 2000 was mixed gently before use and diluted at 0.5 KL in 50 KL of serum- and antibiotic-free medium.The mixture was mixed gently and incubated for 15 minutes at room temperature. (3) After the 15-minute incubation, the diluted PCR products and the diluted Lipofectamine 2000 (total volume,
approximately 100 KL) were combined. It was mixed gently and in-cubated for 15 minutes at room temperature to allow complexes toform. (4) The mixture of transfection was added into the well drop by drop. We set up some control groups including normal HeLacells as the blank control group and cells added with a nonspecificsiRNA sequence (m-siRNA) as the negative control group. Threewells were performed repeatedly per group. The cells were lysed after 24 hours to isolate total RNA.
Morphological Analysis in HeLa Cells After Transfection of siRNA
At 48 and 72 hours after transfections, the morphologicalchanges of 3 groups including normal HeLa cells, cells inter-fered with E6 siRNA, and m-siRNA were observed under optical
microscopy.
Apoptosis Analysis by Hypoploidy AnalysisFirst, HeLa cells (1 106) after transfection were harvested
and washed twice using 0.01 mmol/L phosphate-buffered saline(PBS). Then, the cells were fixed using 4 mL of cold 70% ethanolat 4-C for a minimum of 4 hours and then washed twice withPBS. Next, the cells were resuspended in 500 KL of PBS, stained by adding 200 KL of propidium iodide (50 Kg/mL; Sigma) alongwith 20 KL of RNase (1 mg/mL, Sigma) in a 37-C water bath for 15 Y 20 min. Finally, the apoptosis cells were determined by Eliteflow cytometry (Beckman-Coulter Inc) and analyzed using Start VERITY Mod LT software.
Min et al International Journal of Gynecological Cancer & Volume 19, Number 4, May 2009
548 * 2009 IGCS and ESGO
8/17/2019 Microarray Analysis Identifies Differentially
3/17Copyright @ 2009 by IGCS and ESGO. Unauthorized reproduction of this article is prohibited.
Cell Viability Assay Cell viability was measured using the 3-(4,5-dimethylthiazol-
2-yl)-2, 5-diphenyltetrazolium bromide (MTT) assay as described previously.20 A total of 2 104 cells per well were plated in a 96-well plate. After 24 hours of plating, the untreated cells and thecells transfected with E6 siRNA or negative control m-siRNA were
incubated with 10 KL of MTT (10 mg/mL) at 37-C. As a tetrazo-lium salt, MTT can be converted by living cells into blue formazancrystals. The medium was removed from the wells 4 hours after MTT addition, 200 KL of dimethyl sulfoxide was added to dissolvethe farmazan crystals, and then the absorbance ( A) values weremeasured in an automatic microplate reader (MicroQuant; Bio-Tek Instruments, Inc) at the wavelength of 570 nm. Each assay was performed in triplicate.
Semiquantitative Real-Time PCR Analysis of E6 Messenger RNA Expression
Relative quantitative multiplex real-time PCR (RT-PCR)was performed using the housekeeping gene glyceraldehyde-3- phosphate dehydrogenase (GAPDH ) internal control as follows.Total RNA was extracted using the Trizol reagent (Invitrogen) ac-cording to manufacturer’s instructions. For RT-PCR, 2 Kg of deoxy-ribonuclease I (DNase I) Y treated total RNAwas used as the templatefor single-stranded complementary DNA (cDNA) synthesis reac-tions using oligo(deoxythymidine) primer and reverse transcriptase(Gibco) for 60 minutes at 42-C. Multiplex PCR reactions were per-formed using Taq polymerase (Takara Co, Japan) with primers for both the GAPDH internal control and E6 gene. To avoid satura-tion or plateau effects, the linear range of amplification efficiencyfor each gene studied was determined by comparing the amplifi-cation products from identical reactions removed from the ther-mal cycle every other cycle. The number of cycles that yielded anamplification-efficiency in the middle of this linear range was used in subsequent reactions. The primers for amplification of E6 wereforward 5¶-CAACACGGCGACCCTACA-3¶ and reverse 5¶-GGATTCAACGGTTTCTGG-3¶ with an annealing temperature of 58-C,
yielding an amplicon of 330 base pairs (bp). In addition, GAPDH messenger RNA (mRNA) was amplified using the forward primer 5¶-CAACGGATTTGGTCGTATT-3¶ and the reverse 5¶-CACAGTCTTCTGGGTGGC-3 ¶, yielding an amplicon of 550 bp. The PCR prod-ucts were fractionated by agarose 1.5% gel electrophoresis and vi-sualized by ethidium bromide staining.
Oligonucleotide Array Hybridizationand Data Analysis
Fluorescent-labeled single-stranded complementary RNA(cRNA) samples were prepared for hybridization as follows. TotalRNA was extracted from cells interfered with E6 siRNA and cellswith nonspecific siRNA after 24 hours using the Trizol reagent (Invitrogen) and purified on RNeasy columns (Qiagen, Inc, Valen-
cia, Calif). The integrity and high quality of RNA samples wereconfirmed by using agarose electrophoresis and the lab-on-a-chipsystem (Agilent Technologies Inc, Santa Clara, Calif ). Fluorescent cRNA samples were synthesized using Agilent Low RNA Input Fluorescent Linear Amplification Kit using 50 to 500 ng of totalRNA as starting material. A primer that contains poly(deoxythymi-dine) and a T7 polymerase promoter, was annealed to the poly A +RNA. Reverse transcriptase was added to the reaction to synthesizethe first and second strands of cDNA. At this point, double-stranded cDNA had been synthesized. Next, cRNA was synthesized usingT7 RNA polymerase, which simultaneously incorporated cyanine3 Y or cyanine 5 Y labeled cytosine triphosphate (CTP). The cRNA of the E6 siRNA group was labeled with Cy3 and m-siRNA with Cy5.Labeled cRNA samples were cleaned using the RNeasy Mini kit
(Qiagen) and eluted with 30 KL of diethyl pyrocarbonate Y treated water. Labeled cRNA samples were fragmented to a mean size of 100 to 200 bases by incubating at 60-C for 30 minutes in 25fragmentation buffer contained in the Agilent Human 1A OligoMicroarray Kit (Agilent Technologies Inc).
The array hybridization, washing, and scanning procedures
were performed according to the Agilent protocol using labeled cRNA on Agilent Human 1A Oligo Microarray containing morethan 20,000 60-mer probes corresponding to more than 18,000human genes and expressed sequence tags. In addition, the Agilent G2565BA dual-laser microarray scanner scanned the oligo array.Two independent duplicates were performed.
Spot quantitation, normalization, and application of a platform-specific error model were performed using Agilent’s Fea-ture Extractor software. This allows for the calculation of meanratios between expression levels of each gene in the analyzed sam- ple pair, SD, and P values for each experiment.
Quantitative RT-PCRQuantitative RT-PCR applying SYBR Green dye was used to
validate the differential expression of 4 genes found by microarray
and E6 gene inhibition. The total RNA from the cells that inter-fered with E6 siRNA and m-siRNA 24 hours after transfection wasanalyzed in the RT-PCR. Total RNA samples were treated withRNAse-free DNase treatment and removal reagents (Ambion, Tex).Reactions were performed in quadruplicate on the Cycle Real-TimePCR System (BioRad). We used a 2-step RT-PCR method to am- plify target genes and internal control gene (GAPDH ) from HeLacells of both the siRNA transfection and the control groups. Single-stranded cDNAs as standard substances were synthesized from500 ng of total RNA of HeLa cells using a reverse transcription sys-tem. The cDNA samples were serially diluted (1, 1:10, 1:100, and 1:1000) and subjected to SYBR Green fluorescent quantitationPCR amplification with SYBR Premix Ex Taq with forward and reverse primers specific to the target genes or GAPDH . Then thestandard curves of the target genes and GAPDH were achieved ac-cording to the cycle threshold values of each amplification curves.The relative expression levels of 4 genes including CCNG1, CD KN1A, and IFBP3 were testified with RT-PCR under the follow-ing conditions: Denaturation at 94-C for 10 seconds followed by 45 PCR cycles (denaturation at 94-C for 5 seconds and primersannealing and extension at 60-C for 20 seconds). The gene-specific primer pairs and product sizes were listed in Table 1, showing that all primers had the same melting temperature.
Gene Function AnalysisWe analyzed the gene functions and cellular pathways of
some differentially expressed genes in detail, including cell cycle Y related genes, CCNG1 and p21; apoptosis-related genes, CASP4,CASP6 , IGFBP3, and DFFA; ubiquitin proteolysis pathway Y related genes, UBE3A and UBE2C ; keratinocyte differentiation Y related genes, KRT4, KRT6E , and KRT18; and antioncogene, RECK and VEL.
RESULTS
Morphological Changes in HeLa Cells After Transfection of siRNA
We first determined if the transient transfection of E6 siRNAcould induce the morphological changes in HeLa cells by phasecontrast microscope. As shown in Figure 1, visible morphologicalchanges were prominent at 48 hours after the original transfectionincluding cell swelling and rounding and cytoplasmic vacuole ap- pearance. By 72 hours after transfection, there were striking mor- phological differences between the E6 siRNA Y treated cells and the
International Journal of Gynecological Cancer & Volume 19, Number 4, May 2009 Microarray Analysis Identifies Genes
* 2009 IGCS and ESGO 549
8/17/2019 Microarray Analysis Identifies Differentially
4/17Copyright @ 2009 by IGCS and ESGO. Unauthorized reproduction of this article is prohibited.
control cells. The cytoplasmic shrinkage and condensation of nu-clear chromatin were observed in the E6 siRNA Y treated cells. In
addition, DNA fragmentation apoptosis assay detected DNA strand breaks in cells after 48 hours in the E6 siRNA group, whereas thecontrol group had no the same change (data not shown).
E6 siRNA Causes Low Viability of HeLa CellsTo examine if the suppression of E6 and m-siRNA would
affect cell viability, MTT assay were carried out on hours 0, 12, 24,48, and 72 after transfection using an equal number of HeLa cells.Figure 2 showed that inhibition of E6 expression by E6 siRNAdecreased the viability of HeLa cell compared with that in thecontrol and the m-siRNA groups ( P G 0.01). The marked decreasein cell viabilities was observed from 48 hours after transfection.All experiments were repeated at least thrice. The data were ana-
lyzed with the software package SPSS 10.0. The W2 test was per-formed to compare frequencies between the 2 groups. P G 0.05 were
considered significant statistically.
Increased Apoptosis in HeLa Cells Inducedby E6 siRNA
The number of apoptotic cells was determined by analysisof 1 106 HeLa cells stained by propidium iodide (Fig. 3). The percentage of apoptotic cells at 24, 48, and 72 hours after E6 siRNAinterference were 26.4%, 40.3%, and 55.8%, respectively. In ad-dition, the percentage of apoptotic cells in normal cells and m-siRNA Y infected cells were 6% and 10% at 48 hours, respectively.We conclude that siRNA directed against HPV-18 E6 specificallykills HPV-18 Y positive cancer cells with high efficiency through theinduction of apoptotic cell death.
Detection of Inhibition of E6 mRNA
Expression in HeLa Cells by RT-PCRRelative quantitative RT-PCR was used for analysis of E6
RNA expression in HeLa cells. The amplified DNA fragments were
FIGURE 1. Morphological changes in HeLa cells after transfection of siRNA under optical microscope (originalmagnification 40). A, Control group. B, Forty-eight hoursafter transfection of m-siRNA group. C, Forty-eight hours after transfection of the siRNA group. D, Seventy-two hoursafter transfection of the siRNA group.
FIGURE 2. Effect of E6 siRNA on the viability of HeLa cells.Data shown are the mean (SD) results of a representativeexperiment performed in triplicate. *P G 0.05 and **P G 0.01.
TABLE 1. Gene-specific primer pairs and product sizes
No. Gene Sequence (5¶ Y 3¶) Temperature, -C GC, % Product, bp
1 CCNG1 TGACAAGCCTGAGAAGGTAAACTG 63.7 45.8 148
TTGAAGCTGTGGGAAGACTGATAG 63.6 45.8
2 p21 TAACTCTGAGGACACGCATTTGG 64.9 47.8 120
TGAGTAGAAGAATCGTCGGTTGC 64.2 47.8
3 IGFBP3 GGGTGTCTGATCCCAAGTTCCA 64.0 50.0 129
AGGAGAAGTTCTGGGTATCTGTGC 65.0 54.5
4 UBE3A GCCATTGTTGCTGCTTC 62.9 54.5 103
TGGGCTCTTCATCATCTTC 63.2 50.0
5 HPV-18, E6 CCGTTGAATCCAGCAGA 67.3 54.5 130
TGCGTCGTTGGAGTCGT 65.0 50.0
6 GAPDH GCACCGTCAAGGCTGAGAAC 63.3 60.0 142
ATGGTGGTGAAGACGCCAGT 62.9 55.0
Min et al International Journal of Gynecological Cancer & Volume 19, Number 4, May 2009
550 * 2009 IGCS and ESGO
8/17/2019 Microarray Analysis Identifies Differentially
5/17Copyright @ 2009 by IGCS and ESGO. Unauthorized reproduction of this article is prohibited.
fractionated by agarose 1.5% gel electrophoresis and visualized byethidium bromide staining (Fig. 4). Gels were photographed and analyzed semiquantitatively with a laboratory image and analysissystem (UVP Inc). Optical density scanning was used to measuregray value, and GAPHD was used to assay the relative expressionof HPV-18 E6 mRNA. The results were expressed as the ratio
between the gray value of the E6 gene fragment (330 bp) and thegray value of the GAPHD amplified fragment (550 bp). It wascalculated that HPV-18 E6 mRNA expression in the cells treated by E6 siRNA at 24, 48, and 72 hours were significantly reduced byapproximately 57%, 78%, and 40%, respectively, as compared withthat of the negative and blank control groups, whereas the latter 2groups had similar expression levels. Therefore, it can be concluded that interference with siRNA against HPV-18 E6 gene can sig-nificantly inhibit E6 gene expression and induce HeLa cells toapoptosis.
Oligonucleotide Array Analysis of mRNALevels in Cells Interfered by E6 siRNA
To identify genes up-regulated or down-regulated by HPV-18 E6 , we used Agilent Human 1A 60mer oligo microarray and defined
the differential expression genes with a criterion (log ratio, P o 0.01and P R 1.5-fold change in mRNA levels). Among the whole 18716genes and expressed sequence tags, 359 differentially expressed genes were identified, containing 307 up-regulated genes and 52down-regulated genes. These genes were principally classified intoseveral biological process Y related functions using the Panther ana-lytical system, including (1) cell cycle; (2) apoptosis; (3) cell proli-feration and differentiation; (4) protein biosynthesis, metabolism,and modification; (5) nucleobases, nucleoside, nucleotide, and nucleicacid metabolism; (6) signal transduction; (7) immune and defense;
(8) transcription regulation; and so on. The differentially expressed genes involved in cell cycle, cell proliferation and differentiation, ap-optosis, and immune and defense were listed in Table 2.
Activities of genes were summarized according to the arraysupplier in combination with extensive information mainly from NCBI PubMed resources and used for grouping the genes. Cy3/Cy5ratio represented the proportion of the fluorescence intensity of sig-nals in E6 siRNA Y transfected cells to the control ones and reflected the change extent of each gene ( Table 3).
Validation of Gene Expression ChangesWith RT-PCR
Five genes including HPV-18 E6 , CCNG1, p21, IFBP3, and UBE3A were testified with RT-PCR. It was shown that the E6 levelof E6 siRNA Y treated cells was 39% to that of the control cells.Therefore, it proved that E6 siRNA significantly inhibited E6 geneexpression again. In addition, the results of the other 4 genes werein concord with microarray, signifying the high reliability of themicroarray results (Fig. 5).
DISCUSSIONSilencing RNA is a highly specific tool for targeted gene
knockdown, and it has advantages over the antisense oligo-DNA or ribozyme because it can be introduced into cells with a high effi-ciency and exert its gene-silencing effect at a concentration severalorders lower. Today, it is generally accepted that RNA interferenceis an effective, feasible, and stable approach for exploring genefunction and identifying and validating new drug targets in func-tional genomic studies. Using HPV-transformed tumor cells as amodel system, we demonstrate that siRNA targeting the viral E6 oncogene represent a very efficient molecular tool to kill virus- positive cancer cells specifically through induction of apoptosis.It is accordant with other previous study, showing that the sur-vival of HPV-positive cancer cells is strictly dependent on the anti-apoptotic function of E6 protein.21 Moreover, our findings indicatethat the molecular targeting of E6 by siRNAs represents a promi-sing novel approach for the development of specific treatment stra-tegies against HPV-positive cancers and dysplasias.22
In view of the central role of viral E6 oncogene expressionfor HPV-associated carcinogenesis, it will be important to identifydownstream regulatory pathways that are affected by E6 oncogene.This should help to gain insights into the cellular pathways targeted during viral transformation. In addition, these analyses may be use-ful to identify novel molecular markers for the diagnosis or the prog-nostic evaluation of cervical cancer.
E6 is the major transforming proteins of high-risk HPV typesand is known to have the ability to alter cellular differentiation,
FIGURE 3. Apoptosis analysis of HeLa cells interfered by E6 siRNA by hypoploidy analysis. The x -axis represents themeasurement of fluorescent intensity of Elite flow cytometry,with a resolution of 1024 in units of channels. The y -axis is therelative numbers of cells. The line (A Y E) within each figuremeans a threshold gate for detection of apoptosis cells. A,Normal cells. B, Cells interfered by nonspecific siRNA. C, Cellsinterfered by E6 siRNA for 24 hours. D, Cells interfered by E6 siRNA for 48 hours. F, Cells interfered by E6 siRNA for 72 hours.
FIGURE 4. Agarose gel electrophoresis of RT-PCR products of HPV-18 E6 gene (330 bp) and cellular GAPDH housekeepinggene (550 bp). M, DL 2000; lane 1, blank control; lane 2,24 hours after E6 siRNA transfection; lane 3, 48 hours after E6 siRNA transfection; lane 4, 72 hours after E6 siRNA transfection; lane 5, m-siRNA group.
International Journal of Gynecological Cancer & Volume 19, Number 4, May 2009 Microarray Analysis Identifies Genes
* 2009 IGCS and ESGO 551
8/17/2019 Microarray Analysis Identifies Differentially
6/17Copyright @ 2009 by IGCS and ESGO. Unauthorized reproduction of this article is prohibited.
TABLE 2. List of partial differentially expressed genes regulated by E6 siRNA
No. UniGene ID Symbol Gene Name Fold Changes*
Cell cycle
1 Hs.510225 RPS6KA5 Ribosomal protein S6 kinase, 90 kd, polypeptide 5 7.718
2 Hs.115242 DRG1 Developmentally regulated GTP-binding protein 1 5.445
3 Hs.79101 CCNG1 Cyclin G1 5.244
4 Hs.464419 FBXO6 F-box protein 6 5.228
5 Hs.285051 CCPG1 Cell cycle progression 1 4.409
6 Hs.239 FOXM1 Forkhead box M1 4.064
7 Hs.559215 MAD2L1 MAD2 mitotic arrest deficient Y like 1 (yeast) 4.036
8 Hs.73625 KIF20A Kinesin family member 20A 3.700
9 Hs.100426 BRMS1 Breast cancer metastasis suppressor 1 3.178
10 Hs.491682 PRKDC Protein kinase, DNA-activated, catalytic polypeptide 3.169
11 Hs.445758 E2F5 E2F transcription factor 5, p130 binding 2.954
12 Hs.370771 CDKN1A Cyclin-dependent kinase inhibitor 1A (p21, Cip1) 2.879
13 Hs.132161 FOXK2 Forkhead box K2 2.452
14 Hs.169487 MAFB V-maf musculoaponeurotic fibrosarcoma oncogene homolog B (avian) 2.38615 Hs.263812 NUDC Nuclear distribution gene C homolog ( Aspergillus nidulans) 2.353
16 Hs.3887 PSMD1 Proteasome (prosome, macropain) 26S subunit, non-ATPase, 1 2.346
17 Hs.275243 S100A6 S100 calcium-binding protein A6 (calcyclin) 2.296
18 Hs.498248 EXO1 Exonuclease 1 1.992
19 Hs.436035 TUBA6 Tubulin, alpha 6 1.608
20 Hs.122511 CETN1 Centrin, EF-hand protein, 1 1.522
23 Hs.306791 POLD2 Polymerase (DNA directed), delta 2, regulatory subunit 50 kd 0.629
24 Hs.520046 GPSM3 G-protein polymerase modulator 3(AGS3-like, Caenorhabditis elegans)
0.599
25 Hs.449410 FOXH1 Forkhead box H1 0.564
26 Hs.93002 UBE2C Ubiquitin-conjugating enzyme E2C 0.342
27 Hs.128073 CETN3 Centrin, EF-hand protein, 3 (CDC31 homolog, yeast) 0.178
Cell proliferation and differentiation28 Hs.233119 ME2 Inositol polyphosphate-5-phosphatase F 6.842
29 Hs.473082 ZFP64 Zinc finger protein 64 homolog (mouse) 6.659
30 Hs.467740 LPIN1 Lipin 1 4.428
31 Hs.26988 EFNB3 Ephrin-B3 3.000
32 Hs.497200 PLA2G4A Phospholipase A2, group IVA (cytosolic, calcium dependent) 2.596
33 Hs.386294 ZNF195 Zinc finger protein 195 2.451
34 Hs.459927 PTMA Prothymosin, alpha (gene sequence 28) 2.317
35 Hs.504613 PTMS Parathymosin 2.317
36 Hs.252229 MAFG V-maf musculoaponeurotic fibrosarcoma oncogene homolog G 1.726
39 Hs.190495 GPNMB Glycoprotein (transmembrane) nmb 0.582
40 Hs.140720 FRAT2 Frequently rearranged in advanced T-cell lymphomas 2 0.262
Apoptosis
41 Hs.484782 DFFA DNA fragmentation factor, 45 kd, alpha polypeptide 6.092
42 Hs.66180 NAP1L2 Nucleosome assembly protein 1 Y like 2 5.912
43 Hs.103755 RIPK2 Receptor-interacting serine-threonine kinase 2 5.460
44 Hs.3280 CASP6 Caspase 6, apoptosis-related cysteine peptidase 4.509
45 Hs.516075 TIA1 TIA1 cytotoxic granule Y associated RNA-binding protein 4.381
46 Hs.379970 RASSF2 Ras association (RalGDS/AF-6) domain family 2 3.436
47 Hs.25155 NET1 Neuroepithelial cell Y transforming gene 1 2.692
48 Hs.445898 MYBL1 V-myb myeloblastosis viral oncogene homolog (avian) Y like 1 2.525
49 Hs.129708 TNFSF14 Tumor necrosis factor (ligand) superfamily, member 14 2.322
50 Hs.450230 IGFBP3 Insulin-like growth factor Y binding protein 3 2.290
Min et al International Journal of Gynecological Cancer & Volume 19, Number 4, May 2009
552 * 2009 IGCS and ESGO
8/17/2019 Microarray Analysis Identifies Differentially
7/17Copyright @ 2009 by IGCS and ESGO. Unauthorized reproduction of this article is prohibited.
reactivate host DNA synthesis, and stimulate cell cycle progres-sion.23 In the current work, the differentially expressed genes that are regulated by inhibition of HPV-18 E6 in HeLa cells had beenidentified. We found by microarray analysis that at least 359 geneswere up-regulated or down-regulated after transfection of specific
E6 siRNA ( P G
0.01). In the analysis of microarray results, 4 genesincluding CCNG1, p21, IGFBP3, and UBE3A were chosen for RT-PCR validation. Among all differentially expressed genes, the 4genes were closely related to the expression of P53, which is clearlyaccepted as the target of E6 oncogene. Therefore, we only chosethese 4 genes in the preliminary analysis to verify the reliability of microarray results.
Among them, some alterations in gene expression (eg, p21and IGFBP3) were dependent on p53 degradation, which is involved in diverse cellular processes, including regulation of the cell cycle,apoptosis, senescence, DNA repair, cell differentiation, and an-giogenesis. One key downstream effector of p53 is p21Waf/Cip(hereafter referred to as p21), a cyclin-dependent kinase/cyclininhibitor whose up-regulation by p53 leads to cell cycle arrest.24 Be-cause p53 up-regulates expression of the cyclin-dependent kinase/ cyclin inhibitor p21, we anticipated that cells with E6 siRNAinterference and concomitant degradation of p53 would have higher levels of p21. In addition, the microarray analysis and RT-PCR validated that the p21 transcript was up-regulated by 3-folds inapoptotic cells induced by HPV-18 E6 siRNA.
The differences between the ability of the low-risk and HR-HPV types to induce immortalization and transformation may welllie in their abilities to interact with the cell cycle components,resulting in the loss of multiple cell cycle checkpoints that are im- portant in maintaining host genome fidelity, thus leading to poten-tial accumulation of genetic abnormalities.25 The E6 and E7 proteinsof HR-HPV bind to cell cycle regulatory proteins and interfere with both G1/S and G2/M cell cycle checkpoints much more effectivelythan the low-risk HPV. In addition, the HR-HPV proteins can (1) up-
regulate expression of cyclins A and B in association with im-mortalization; (2) up-regulate cyclin E expression, shown recently toinduce genetic instability; and (3) abrogate cyclin D1 expression,important in the Rb pathway.26
CCNG1 (cyclin G1) is also one of the target genes of the
transcription factor p53 and act as a mediator of p53 functions suchas growth inhibition, DNA repair, and apoptosis.27 Other reportsshowed, however, that cyclin G1 contributes to G2/M arrest of cellsin response to DNA damage and plays a role in apoptosis. 28 Several p53-induced target genes can promote apoptosis, although the ex- pression of each gene alone is usually insufficient to cause sig-nificant cell death. Apoptotic target genes may need to act in concert,activating parallel apoptotic pathways, to cause a full apoptoticresponse, and this might explain why disruption of the CCNG1gene alone did not seem to affect apoptosis. Overexpression of CCNG1 resulted in increased sensitivity to apoptosis induced by E6 siRNA.29 In our experiment, the expression of CCNG1 was ob-viously increased by 5.244 times, and it signified that CCNG1 might promote cell apoptosis with the p53 gene.
Inhibition of apoptosis is a mechanism of survival for virallyor chemically transformed malignant cells. One of the earliest and most consistent observed features of apoptosis is the induction of a series of cytosolic proteases, that is, caspases.30 Active caspasescleave numerous intracellular proteins and contribute to apoptoticcell death.31 At present, the fact that CASP6 and CASP4 were ac-tivated during the inhibition of E6 expression could further explainthe antiapoptosis capacity of the E6 protein in transformed cells.Insulin-like growth factor Y binding protein 3 ( IGFBP-3) is one of target genes of p53, an extracellular protein responsible for thecarriage of IGF-I but can act independently of IGF-I, inhibiting cellgrowth and enhancing apoptosis. Hollowood et al32 found that anautocrine/paracrine feedback loop existed between IGFBP-3 and p53, which may provide the social control necessary to maintainnormal tissue homeostasis.
TABLE 2. (Continued)
No. UniGene ID Symbol Gene Name Fold Changes*
51 Hs.435136 TXN Thioredoxin 2.199
52 Hs.276876 TM2D1 TM2 domain containing 1 2.102
53 Hs.446427 OAZ1 Ornithine decarboxylase antizyme 1 2.07154 Hs.94011 NDNL2 Necdin-like 2 2.027
55 Hs.302015 FKSG2 Apoptosis inhibitor 1.837
56 Hs.8375 TRAF4 TNF receptor Y associated factor 4 1.768
57 Hs.138378 CASP4 Caspase 4, apoptosis-related cysteine peptidase 1.754
58 Hs.502775 HRASLS3 HRAS-like suppressor 3 1.537
59 Hs.436657 CLU Clusterin 0.607
60 Hs.224137 ENDOG Mitochondrial endonuclease G 0.574
Defense/immune response
61 Hs.495985 TCIRG1 T-cell, immune regulator 1, ATPase, H + transporting, lysosomal 8.243
62 Hs.512152 HLA-G HLA-G histocompatibility antigen, class I, G 2.654
63 Hs.337557 XTP7 Protein 7 transactivated by hepatitis B virus X antigen (HbxAg) 2.320
64 Hs.374596 TPT1 Tumor protein, translationally controlled 1 1.812
65 Hs.534255 B2M A2-microglobulin 1.736
66 Hs.515369 TYROBP TYRO protein tyrosine kinase binding protein 0.575
67 Hs.464987 SFTPA2 Surfactant, pulmonary-associated protein A2 0.530
68 Hs.193122 FCAR Fc fragment of IgA, receptor for 0.523
*Mean of 2 independent experiments.ATPase, Adenosine triphosphatase; GTP, guanosine triphosphate; MAD2, mitotic arrest deficient 2.
International Journal of Gynecological Cancer & Volume 19, Number 4, May 2009 Microarray Analysis Identifies Genes
* 2009 IGCS and ESGO 553
8/17/2019 Microarray Analysis Identifies Differentially
8/17Copyright @ 2009 by IGCS and ESGO. Unauthorized reproduction of this article is prohibited.
TABLE 3. List of differentially expressed genes in Panther biological processes categories
No. UniGene ID Symbol Gene Name Ratio
Cell cycle
1 Hs.510225 RPS6KA5 Ribosomal protein S6 kinase, 90 kd, polypeptide 5 7.718
2 Hs.115242 DRG1 Developmentally regulated GTP-binding protein 1 5.445
3 Hs.79101 CCNG1 Cyclin G1 5.244
4 Hs.464419 FBXO6 F-box protein 6 5.228
5 Hs.285051 CCPG1 Cell cycle progression 1 4.409
6 Hs.239 FOXM1 Forkhead box M1 4.064
7 Hs.559215 MAD2L1 MAD2 mitotic arrest deficient Y like 1 (yeast) 4.036
8 Hs.73625 KIF20A Kinesin family member 20A 3.700
9 Hs.100426 BRMS1 Breast cancer metastasis suppressor 1 3.178
10 Hs.491682 PRKDC Protein kinase, DNA-activated, catalytic polypeptide 3.169
11 Hs.445758 E2F5 E2F transcription factor 5, p130-binding 2.954
12 Hs.370771 CDKN1A Cyclin-dependent kinase inhibitor 1A (p21, Cip1) 2.879
13 Hs.132161 FOXK2 Forkhead box K2 2.452
14 Hs.169487 MAFB V-maf musculoaponeurotic fibrosarcoma oncogene homolog B (avian) 2.38615 Hs.263812 NUDC Nuclear distribution gene C homolog ( Aspergillus nidulans) 2.353
16 Hs.3887 PSMD1 Proteasome (prosome, macropain) 26S subunit, non-ATPase, 1 2.346
17 Hs.275243 S100A6 S100 calcium-binding protein A6 (calcyclin) 2.296
18 Hs.498248 EXO1 Exonuclease 1 1.992
19 Hs.436035 TUBA6 Tubulin, alpha 6 1.608
20 Hs.122511 CETN1 Centrin, EF-hand protein, 1 1.522
21 Hs.465498 TXNL4A Thioredoxin-like 4A 1.475
22 Hs.344400 MPHOSPH6 M-phase phosphoprotein 6 1.440
23 Hs.306791 POLD2 Polymerase (DNA directed), delta 2, regulatory subunit 50 kd 0.629
24 Hs.520046 GPSM3 G-protein polymerase modulator 3 (AGS3-like, Caenorhabditis elegans) 0.599
25 Hs.449410 FOXH1 Forkhead box H1 0.564
26 Hs.93002 UBE2C Ubiquitin-conjugating enzyme E2C 0.342
27 Hs.128073 CETN3 Centrin, EF-hand protein, 3 (CDC31 homolog, yeast) 0.178Cell proliferation and differentiation
28 Hs.233119 ME2 Inositol polyphosphate-5-phosphatase F 6.842
29 Hs.473082 ZFP64 Zinc finger protein 64 homolog (mouse) 6.659
30 Hs.467740 LPIN1 Lipin 1 4.428
31 Hs.26988 EFNB3 Ephrin-B3 3.000
32 Hs.497200 PLA2G4A Phospholipase A2, group IVA (cytosolic, calcium-dependent) 2.596
33 Hs.386294 ZNF195 Zinc finger protein 195 2.451
34 Hs.459927 PTMA Prothymosin, alpha (gene sequence 28) 2.317
35 Hs.504613 PTMS Parathymosin 2.317
36 Hs.252229 MAFG V-maf musculoaponeurotic fibrosarcoma oncogene homolog G 1.726
37 Hs.440829 CEBPD CCAAT/enhancer binding protein (C/EBP), delta 1.436
38 Hs.158287 SDC3 Syndecan 3 ( N -syndecan) 0.733
39 Hs.190495 GPNMB Glycoprotein (transmembrane) nmb 0.582
40 Hs.140720 FRAT2 Frequently rearranged in advanced T-cell lymphomas 2 0.262
Protein biosynthesis
41 Hs.22867 EIF2C1 Eukaryotic translation initiation factor 2C, 1 5.654
42 Hs.515070 EEF2 Eukaryotic translation elongation factor 2 2.275
43 Hs.421608 EEF1B2 Eukaryotic translation elongation factor 1 beta 2 2.041
44 Hs.434248 PLEC1 Plectin 1, intermediate filament Y binding protein 500 kd 2.028
45 Hs.88977 EEF1E1 Eukaryotic translation elongation factor 1 epsilon 1 1.890
46 Hs.530734 MRPL16 Mitochondrial ribosomal protein L16 1.772
47 Hs.491988 TRAM1 Translocation-associated membrane protein 1 1.460
Min et al International Journal of Gynecological Cancer & Volume 19, Number 4, May 2009
554 * 2009 IGCS and ESGO
8/17/2019 Microarray Analysis Identifies Differentially
9/17Copyright @ 2009 by IGCS and ESGO. Unauthorized reproduction of this article is prohibited.
TABLE 3. (Continued)
No. UniGene ID Symbol Gene Name Ratio
Protein metabolism and modification
48 Hs.108332 UBE2D2 Ubiquitin-conjugating enzyme E2D 2 (UBC4/5 homolog, yeast) 6.998
49 Hs.472119 MKKS McKusick-Kaufman syndrome 6.98150 Hs.193226 UGCGL2 UDP-glucose ceramide glucosyltransferase Y like 2 6.954
51 Hs.233950 SPINT1 Serine peptidase inhibitor, Kunitz type 1 5.285
52 Hs.356769 MAN2B1 Mannosidase, alpha, class 2B, member 1 4.950
53 Hs.180758 GALNACT-2 Chondroitin sulfate GalNAcT-2 4.835
54 Hs.175322 USP13 Ubiquitin-specific peptidase 13 (isopeptidase T-3) 4.710
55 Hs.163776 UBE2J1 Ubiquitin-conjugating enzyme E2, J1 (UBC6 homolog, yeast) 4.610
56 Hs.744 FDX1 Ferredoxin 1 4.444
57 Hs.440833 PKN2 Protein kinase N2 4.319
58 Hs.531176 SARS Seryl-tRNA synthetase 3.779
59 Hs.49774 PTPRM Protein tyrosine phosphatase, receptor type, M 3.370
60 Hs.438231 TFPI2 Tissue factor pathway inhibitor 2 3.336
61 Hs.491682 PRKDC Protein kinase, DNA-activated, catalytic polypeptide 3.169
62 Hs.121676 ZFYVE19 Zinc finger, FYVE domain containing 19 3.157
63 Hs.73986 CLK2 CDC-like kinase 2 2.882
64 Hs.178748 ADAM21 ADAM metallopeptidase domain 21 2.839
65 Hs.523438 TRIM68 Tripartite motif Y containing 68 2.746
66 Hs.110364 PPIC Peptidylprolyl isomerase C (cyclophilin C) 2.594
67 Hs.72026 PRSS21 Protease, serine, 21 (testisin) 2.525
68 Hs.127407 GALNT7 UDP- N -acetyl-alpha-d-galactosamine:polypeptide N -acetylgalactosaminyltransferase7 (GalNAc-T7)
2.496
69 Hs.14511 SCO1 SCO cytochrome oxidase deficient homolog 1 (yeast) 2.492
70 Hs.158688 EIF5B Eukaryotic translation initiation factor 5B 2.480
71 Hs.233952 PSMA7 Proteasome (prosome, macropain) subunit, alpha type, 7 2.323
72 Hs.524648 LTA4H Leukotriene A4 hydrolase 2.311
73 Hs.520348 UBC Ubiquitin C 2.253
74 Hs.18349 MRPL15 Mitochondrial ribosomal protein L15 2.119
75 Hs.1197 HSPE1 Heat shock 10-kd protein 1 (chaperonin 10) 2.104
76 Hs.434248 PLEC1 Plectin 1, intermediate filament Y binding protein, 500 kd 2.028
77 Hs.520028 HSPA1A Heat shock 70-kd protein 1A 2.002
78 Hs.381167 SERPINB1 Serpin peptidase inhibitor, clade B (ovalbumin), member 1 1.993
79 Hs.522394 HSPA5 Heat shock 70-kd protein 5 (glucose-regulated protein, 78 kd) 1.989
80 Hs.423163 SLC35A1 Solute carrier family 35 (CMP Y sialic acid transporter), member A1 1.952
81 Hs.523936 PRCP GCRG-P224 1.830
82 Hs.47099 GALNT12 UDP- N -acetyl-alpha-d-galactosamine:polypeptide N -acetylgalactosaminyltransferase12 (GalNAc-T12)
1.808
83 Hs.128420 VPS4A Vacuolar protein sorting 4A (yeast) 1.782
84 Hs.368985 TRIP12 Thyroid hormone receptor interactor 12 1.761
85 Hs.57732 MAPK11 Mitogen-activated protein kinase 11 1.76186 Hs.356190 UBB Ubiquitin B 1.745
87 Hs.20013 SYF2 SYF2 homolog, RNA splicing factor (Saccharomyces cerevisiae) 1.684
88 Hs.7879 IFRD1 Interferon-related developmental regulator 1 1.635
89 Hs.191887 SEC61B Sec61 beta subunit 1.554
90 Hs.405410 OGT O-Linked N -acetylglucosamine (GlcNAc) transferase (UDP- N -acetylglucosamine: polypeptide- N -acetylglucosaminyl transferase)
1.535
91 Hs.521937 PPP1R16A Protein phosphatase 1, regulatory (inhibitor) subunit 16A 1.495
92 Hs.524690 PPIE Peptidylprolyl isomerase E (cyclophilin E) 1.483
93 Hs.466743 MAP3K10 Mitogen-activated protein kinase kinase kinase 10 1.435
(Continued on next page)
International Journal of Gynecological Cancer & Volume 19, Number 4, May 2009 Microarray Analysis Identifies Genes
* 2009 IGCS and ESGO 555
8/17/2019 Microarray Analysis Identifies Differentially
10/17Copyright @ 2009 by IGCS and ESGO. Unauthorized reproduction of this article is prohibited.
TABLE 3. (Continued)
No. UniGene ID Symbol Gene Name Ratio
94 Hs.477879 H2AFX H2A histone family, member X 1.398
95 Hs.232375 ACAT1 Acetyl-coenzyme A acetyltransferase 1 (acetoacetyl coenzyme A thiolase) 1.367
96 Hs.130988 DYRK1B Dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1B 0.73997 Hs.380742 PLXNB3 Plexin B3 0.708
98 Hs.484138 FBXW11 F-box and WD-40 domain protein 11 0.655
99 Hs.567354 UBE3A Ubiquitin protein ligase E3A (human papilloma virus E6AP, Angelman syndrome) 0.532
100 Hs.407856 SPINK1 Serine peptidase inhibitor, Kazal type 1 0.491
101 Hs.162241 UCHL3 Ubiquitin carboxyl-terminal esterase L3 (ubiquitin thiolesterase) 0.441
Nucleobase, nucleoside, nucleotide, and nucleic acid metabolism
102 Hs.534460 DUS2L Dihydrouridine synthase 2 Y like, SMM1 homolog (Saccharomyces cerevisiae) 10.023
103 Hs.200596 LCMT2 Leucine carboxyl methyltransferase 2 5.615
104 Hs.459857 CARHSP1 Calcium-regulated heat stable protein 1, 24 kd 5.532
105 Hs.478708 OPA1 Optic atrophy 1 (autosomal dominant) 5.389
106 Hs.242635 RAD50 RAD50 homolog (Saccharomyces cerevisiae) 4.875
107 Hs.65734 ARNTL Aryl hydrocarbon receptor nuclear translocator Y like 4.774
108 Hs.505004 TCEA2 Transcription elongation factor A (SII), 2 4.672
109 Hs.473087 CTPS CTP synthase 4.337
110 Hs.437582 MCM8 MCM8 minichromosome maintenance deficient 8 (Saccharomyces cerevisiae) 4.247
111 Hs.193163 BIN1 Bridging integrator 1 3.987
112 Hs.429666 CEBPG CCAAT/enhancer binding protein (C/EBP), gamma 3.637
113 Hs.98367 SOX17 SRY (sex-determining region Y)-box 17 3.585
114 Hs.437056 SUPT5H Suppressor of Ty 5 homolog (Saccharomyces cerevisiae) 3.337
115 Hs.509140 BAZ1A Bromodomain adjacent to zinc f inger domain, 1A 3.256
116 Hs.446318 HOXA7 Homeobox A7 3.256
117 Hs.469872 ERCC3 Excision repair cross-complementing rodent repair deficiency, complementationgroup 3 (xeroderma pigmentosum group B complementing)
3.197
118 Hs.170568 TATDN1 TatD DNase domain containing 1 3.176
119 Hs.491682 PRKDC Protein kinase, DNA-activated, catalytic polypeptide 3.169
120 Hs.323213 YIPF2 Yip1 domain family, member 2 2.934
121 Hs.293818 NEIL2 Nei-like 2 ( Escherichia coli) 2.824
122 Hs.368410 CBX2 Chromobox homolog 2 (Pc class homolog, Drosophila) 2.643
123 Hs.21160 ME1 Malic enzyme 1, NADP(+)-dependent, cytosolic 2.483
124 Hs.130098 DDX23 DEAD (Asp-Glu-Ala-Asp) box polypeptide 23 2.451
125 Hs.463456 NME2 Methionine sulfoxide reductase B3 2.321
126 Hs.408067 HIST2H2AC Histone 2, H2ac 2.147
127 Hs.235069 RECQL RecQ protein-like (DNA helicase Q1-like) 2.099
128 Hs.522767 SLC25A5 Solute carrier family 25 (mitochondrial carrier; adenine translocator), member 5 2.086
129 Hs.498248 EXO1 Exonuclease 1 1.992
130 Hs.515255 LSM4 LSM4 homolog, U6 small nuclear RNA associated (Saccharomyces cerevisiae) 1.967
131 Hs.525629 MTA1 Metastasis associated 1 1.869
132 Hs.124027 SEPHS1 Selenophosphate synthetase 1 1.811133 Hs.429 ATP5G3 ATP synthase, H + transporting, mitochondrial F0 complex, subunit C3 (subunit 9) 1.948
134 Hs.326387 MORF4L2 Mortality factor 4 like 2 1.794
135 Hs.557550 NPM1 TRK-fused gene 1.605
136 Hs.529798 BTF3 Basic transcription factor 3 1.548
137 Hs.369056 SP100 SP100 nuclear antigen 1.521
138 Hs.477481 MCM2 MCM2 minichromosome maintenance deficient 2, mitotin (Saccharomyces cerevisiae) 1.499
139 Hs.68714 SFRS1 Splicing factor, arginine/serine-rich 1 (splicing factor 2, alternate splicing factor) 1.497
140 Hs.440829 CEBPD CCAAT/enhancer binding protein (C/EBP), delta 1.436
141 Hs.346868 EBNA1BP2 EBNA1 binding protein 2 1.430
142 Hs.477879 H2AFX H2A histone family, member X 1.398
Min et al International Journal of Gynecological Cancer & Volume 19, Number 4, May 2009
556 * 2009 IGCS and ESGO
8/17/2019 Microarray Analysis Identifies Differentially
11/17Copyright @ 2009 by IGCS and ESGO. Unauthorized reproduction of this article is prohibited.
TABLE 3. (Continued)
No. UniGene ID Symbol Gene Name Ratio
143 Hs.288487 SMS Spermine synthase 1.384
144 Hs.387804 PABPC1 Poly(A)-binding protein, cytoplasmic 1 1.386
145 Hs.79110 NCL U23 small nucleolar RNA 1.352146 Hs.535499 RARA Retinoic acid receptor, alpha 0.646
147 Hs.306791 POLD2 Polymerase (DNA directed), delta 2, regulatory subunit, 50 kd 0.629
148 Hs.567358 WRN Werner syndrome 0.617
149 Hs.14839 POLR2G Polymerase (RNA) II (DNA directed) polypeptide G 0.600
150 Hs.255932 XRN2 5¶-3¶ exoribonuclease 2 0.579
151 Hs.227049 CTPS2 CTP synthase II 0.533
152 Hs.70937 HIST1H3H Histone 1, H3h 0.421
153 Hs.375179 ADSSL1 Adenylosuccinate synthase Y like 1 0.220
Signal transduction
154 Hs.553838 OR10C1 Olfactory receptor, family 10, subfamily C, member 1 8.210
155 Hs.415172 RABL4 RAB, member of RAS oncogene family Y like 4 7.718
156 Hs.191762 NOXO1 NADPH oxidase organizer 1 5.308
157 Hs.472861 CDH22 Cadherin-like 22 5.259
158 Hs.282326 DSCR1 Down syndrome critical region gene 1 4.941
159 Hs.247787 OPN1MW Opsin 1 (cone pigments), medium-wave sensitive (color blindness, deutan) 4.869
160 Hs.518149 TNR Tenascin R (restrictin, janusin) 4.691
161 Hs.553592 OR6N1 Olfactory receptor, family 6, subfamily N, member 1 4.070
162 Hs.379970 RASSF2 Ras association (RalGDS/AF-6) domain family 2 3.436
163 Hs.49774 PTPRM Protein tyrosine phosphatase, receptor type, M 3.370
164 Hs.321541 RAB11A RAB11A, member RAS oncogene family 3.263
165 Hs.74034 CAV1 Caveolin 1, caveolae protein, 22 kd 3.085
166 Hs.26988 EFNB3 Ephrin-B3 3.000
167 Hs.27018 RASL12 RAS-like, family 12 2.893
168 Hs.178748 ADAM21 ADAM metallopeptidase domain 21 2.839
169 Hs.7879 IFRD1 Interferon-related developmental regulator 1 2.786170 Hs.158348 HCRT Hypocretin (orexin) neuropeptide precursor 2.614
171 Hs.558543 PPCS Phosphopantothenoylcysteine synthetase 2.393
172 Hs.259461 PALM2-AKAP2 Paralemmin 2 2.324
173 Hs.450230 IGFBP3 Insulin-like growth factor Y binding protein 3 2.290
174 Hs.301540 SPR Sepiapterin reductase (7,8-dihydrobiopterin:NADP + oxidoreductase) 2.886
175 Hs.567639 SPSB4 SplA/ryanodine receptor domain and SOCS box containing 4 1.844
176 Hs.57732 MAPK11 Mitogen-activated protein kinase 11 1.761
177 Hs.501293 BSG Basigin (Ok blood group) 1.742
178 Hs.54483 NMI N-myc (and STAT) interactor 1.709
179 Hs.294603 CNIH Cornichon homolog (Drosophila) 1.544
180 Hs.119689 CGA Glycoprotein hormones, alpha polypeptide 1.512
181 Hs.209983 STMN1 Stathmin 1/oncoprotein 18 1.385
182 Hs.247838 CCL24 Chemokine (C-C motif) ligand 24 0.718183 Hs.522484 OLFM1 Olfactomedin 1 0.618
184 Hs.316997 EPS8 Epidermal growth factor receptor pathway substrate 8 0.561
185 Hs.175934 GABRA1 F-Aminobutyric acid (GABA) A receptor, alpha 1 0.531
186 Hs.193122 FCAR Fc fragment of IgA, receptor for 0.523
187 Hs.351812 CLEC4C C-type lectin domain family 4, member C 0.490
188 Hs.407587 GNRHR Gonadotropin-releasing hormone receptor 0.472
189 Hs.3945 C20orf45 Chromosome 20 open reading frame 45 0.467
(Continued on next page)
International Journal of Gynecological Cancer & Volume 19, Number 4, May 2009 Microarray Analysis Identifies Genes
* 2009 IGCS and ESGO 557
8/17/2019 Microarray Analysis Identifies Differentially
12/17Copyright @ 2009 by IGCS and ESGO. Unauthorized reproduction of this article is prohibited.
TABLE 3. (Continued)
No. UniGene ID Symbol Gene Name Ratio
Apoptosis
190 Hs.484782 DFFA DNA fragmentation factor, 45 kd, alpha polypeptide 6.092
191 Hs.66180 NAP1L2 Nucleosome assembly protein 1 Y
like 2 5.912192 Hs.103755 RIPK2 Receptor-interacting serine-threonine kinase 2 5.460
193 Hs.3280 CASP6 Caspase 6, apoptosis-related cysteine peptidase 4.509
194 Hs.516075 TIA1 TIA1 cytotoxic granule Y associated RNA-binding protein 4.381
195 Hs.379970 RASSF2 Ras association (RalGDS/AF-6) domain family 2 3.436
196 Hs.25155 NET1 Neuroepithelial cell transforming gene 1 2.692
197 Hs.445898 MYBL1 V-myb myeloblastosis viral oncogene homolog (avian) Y like 1 2.525
198 Hs.129708 TNFSF14 Tumor necrosis factor (ligand) superfamily, member 14 2.322
199 Hs.450230 IGFBP3 Insulin-like growth factor Y binding protein 3 2.290
200 Hs.435136 TXN Thioredoxin 2.199
201 Hs.276876 TM2D1 TM2 domain containing 1 2.102
202 Hs.446427 OAZ1 Ornithine decarboxylase antizyme 1 2.071
203 Hs.94011 NDNL2 Necdin-like 2 2.027
204 Hs.302015 FKSG2 Apoptosis inhibitor 1.837
205 Hs.8375 TRAF4 TNF receptor Y associated factor 4 1.768
206 Hs.138378 CASP4 Caspase 4, apoptosis-related cysteine peptidase 1.754
207 Hs.502775 HRASLS3 HRAS-like suppressor 3 1.537
208 Hs.448588 NGFRAP1 Nerve growth factor receptor (TNFRSF16) associated protein 1 1.395
209 Hs.436657 CLU Clusterin 0.607
210 Hs.224137 ENDOG Mitochondrial endonuclease G 0.574
Defense/immune response
211 Hs.495985 TCIRG1 T-cell, immune regulator 1, ATPase, H + transporting, lysosomal 8.243
V0 subunit A3
212 Hs.512152 HLA-G HLA-G histocompatibility antigen, class I, G 2.654
213 Hs.337557 XTP7 Protein 7 transactivated by hepatitis B virus X antigen (HbxAg) 2.320
214 Hs.374596 TPT1 Tumor protein, translationally controlled 1 1.812215 Hs.534255 B2M A2-microglobulin 1.736
216 Hs.524690 PPIE Peptidylprolyl isomerase E (cyclophilin E) 1.483
217 Hs.466743 MAP3K10 Mitogen-activated protein kinase kinase kinase 10 1.435
218 Hs.247838 CCL24 Chemokine (C-C motif) ligand 24 0.718
219 Hs.515369 TYROBP TYRO protein tyrosine kinase Y binding protein 0.575
220 Hs.464987 SFTPA2 Surfactant, pulmonary-associated protein A2 0.530
221 Hs.193122 FCAR Fc fragment of IgA, receptor for 0.523
Cell structure and motility
222 Hs.371139 KRT4 Keratin 4 5.623
223 Hs.478708 OPA1 Optic atrophy 1 (autosomal dominant) 5.389
224 Hs.474053 COL6A1 Collagen, type VI, alpha 1 3.939
225 Hs.500916 INA Internexin neuronal intermediate filament protein, alpha 3.688
226 Hs.558758 KRT6E Keratin 6E 3.525
227 Hs.435326 ACTL6A Actin-like 6A 2.855
228 Hs.512842 MFAP5 Microfibrillar-associated protein 5 2.456
229 Hs.406013 KRT18 Keratin 18 2.322
230 Hs.526500 DNAH3 Dynein, axonemal, heavy polypeptide 3 2.320
231 Hs.524390 K-ALPHA-1 Tubulin, alpha, ubiquitous 2.312
232 Hs.434248 PLEC1 Plectin 1, intermediate filament Y binding protein, 500 kd 2.028
233 Hs.128420 VPS4A Vacuolar protein sorting 4A (yeast) 1.782
234 Hs.437403 PPA1 Pyrophosphatase (inorganic) 1 1.728
235 Hs.433512 ACTR3 ARP3 actin-related protein 3 homolog (yeast) 1.467
Min et al International Journal of Gynecological Cancer & Volume 19, Number 4, May 2009
558 * 2009 IGCS and ESGO
8/17/2019 Microarray Analysis Identifies Differentially
13/17Copyright @ 2009 by IGCS and ESGO. Unauthorized reproduction of this article is prohibited.
TABLE 3. (Continued)
No. UniGene ID Symbol Gene Name Ratio
236 Hs.368525 PDLIM1 PDZ and LIM domain 1 (elfin) 0.711
237 Hs.497893 ENAH Enabled homolog (Drosophila) 0.698
238 Hs.467142 MYH14 Myosin, heavy polypeptide 14 0.685239 Hs.84359 GABARAP GABA(A) receptor-associated protein 0.640
Oncogenesis
240 Hs.536850 FBXL4 F-box and leucine-rich repeat protein 4 3.392
241 Hs.421597 VHL Von Hippel Y Lindau tumor suppressor 2.322
242 Hs.351316 TM4SF1 Transmembrane 4 L 6 Y family member 1 1.422
243 Hs.534597 MAGEA2 Melanoma antigen family A, 2B 1.400
244 Hs.116479 LOXL2 Lysyl oxidase Y like 2 0.489
Transcription/regulation of transcription
245 Hs.505004 TCEA2 Transcription elongation factor A (SII), 2 4.672
246 Hs.486507 TBPL1 TBP-like 1 4.486
247 Hs.410406 SMARCAD1 SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin,subfamily a, containing DEAD/H box 1
3.727
248 Hs.98367 SOX17 SRY (sex-determining region Y)-box 17 3.585249 Hs.128067 WASPIP Wiskott-Aldrich syndrome protein-interacting protein 3.575
250 Hs.437056 SUPT5H Suppressor of Ty 5 homolog (Saccharomyces cerevisiae) 3.337
251 Hs.509140 BAZ1A Bromodomain adjacent to zinc f inger domain, 1A 3.256
252 Hs.264345 ZNF675 Zinc finger protein 675 2.949
253 Hs.463456 NME2 Methionine sulfoxide reductase B3 2.321
254 Hs.118964 GATAD2A GATA zinc f inger domain containing 2A 2.018
Development processes
255 Hs.99141 COBL Cordon-bleu homolog (mouse) 5.458
256 Hs.159028 BTN2A1 Butyrophilin, subfamily 2, member A1 3.348
257 Hs.494163 GDA Guanine deaminase 3.148
258 Hs.7879 IFRD1 Interferon-related developmental regulator 1 2.786
259 Hs.326387 MORF4L2 Mortality factor 4 Y like 2 1.794
260 Hs.501293 BSG Basigin (Ok blood group) 1.742
261 Hs.322901 SAS10 Disrupter of silencing 10 1.653
262 Hs.288487 SMS Spermine synthase 1.384
263 Hs.438779 STARD6 START domain containing 6 0.526
Transport
264 Hs.491611 SLC20A2 Solute carrier family 20 (phosphate transporter), member 2 4.028
265 Hs.443826 MGC4399 PNC1 protein 3.473
266 Hs.162121 COPA Coatomer protein complex, subunit alpha 2.465
267 Hs.477789 ATP1B3 ATPase, Na + /K + transporting, beta 3 polypeptide 2.322
268 Hs.73769 FOLR1 Folate receptor 1 (adult) 2.317
269 Hs.568347 FTH1 Ferritin, heavy polypeptide 1 2.314
270 Hs.179522 SLC2A8 Solute carrier family 2 (facilitated glucose transporter), member 8 2.223
271 Hs.567337 SLC22A3 Solute carrier family 22 (extraneuronal monoamine transporter), member 3 2.189272 Hs.78888 DBI Diazepam-binding inhibitor (GABA receptor modulator, acyl-coenzyme A Y binding
protein)2.139
273 Hs.200600 SCAMP3 Secretory carrier membrane protein 3 2.020
274 Hs.290404 SLC25A3 Solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 3 1.899
275 Hs.491597 VDAC3 Voltage-dependent anion channel 3 1.800
276 Hs.9573 ABCF1 ATP-binding cassette, subfamily F (GCN20), member 1 1.742
277 Hs.467701 ODC1 Ornithine decarboxylase 1 1.640
278 Hs.500761 SLC16A3 Solute carrier family 16 (monocarboxylic acid transporters), member 3 1.377
(Continued on next page)
International Journal of Gynecological Cancer & Volume 19, Number 4, May 2009 Microarray Analysis Identifies Genes
* 2009 IGCS and ESGO 559
8/17/2019 Microarray Analysis Identifies Differentially
14/17Copyright @ 2009 by IGCS and ESGO. Unauthorized reproduction of this article is prohibited.
TABLE 3. (Continued)
No. UniGene ID Symbol Gene Name Ratio
Cell communication
279 Hs.49774 PTPRM Protein tyrosine phosphatase, receptor type, M 3.370
280 Hs.405410 OGT O-linked N -acetylglucosamine (GlcNAc) transferase (UDP- N -acetylglucosamine: polypeptide- N -acetylglucosaminyl transferase)
1.535
281 Hs.209983 STMN1 Stathmin 1/oncoprotein 18 1.385
Biological process unclassified
282 Hs.258576 CLDN12 Claudin 12 7.828
283 Hs.437599 HPS5 Hermansky-Pudlak syndrome 5 7.463
284 Hs.400625 GRWD1 Glutamate-rich WD repeat containing 1 7.298
285 Hs.162032 HBP1 HMG-box transcription factor 1 6.995
286 Hs.524082 NOD9 NOD9 protein 6.918
287 Hs.527412 ASAH1 N -Acylsphingosine amidohydrolase (acid ceramidase) 1 6.660
288 Hs.496191 TINF2 TERF1 (TRF1)-interacting nuclear factor 2 5.268
289 Hs.107622 SRFBP1 Serum response factor binding protein 1 5.314
290 Hs.388918 RECK Reversion-inducing cysteine-rich protein with kazal motifs 5.033
291 Hs.32018 SNAPAP SNAP-associated protein 4.997
292 Hs.157106 JMJD2C Jumonji domain containing 2C 4.798
293 Hs.533736 RBM7 RNA-binding motif protein 7 4.744
294 Hs.195710 ZNF503 Zinc finger protein 503 4.583
295 Hs.523715 VPS37C Vacuolar protein sorting 37C (yeast) 4.358
296 Hs.493739 UBAP2 Ubiquitin-associated protein 2 4.220
297 Hs.468702 COMMD1 Copper metabolism (Murr1) domain containing 1 4.070
298 Hs.385998 WDHD1 WD repeat and HMG-box DNA-binding protein 1 4.018
299 Hs.83916 NDUFA5 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 5, 13 kd 3.982
300 Hs.104320 GOLGA5 Golgi autoantigen, golgin subfamily a, 5 3.885
301 Hs.514330 EME1 Essential meiotic endonuclease 1 homolog 1 (Schizosaccharomyces pombe) 3.851
302 Hs.513315 NUDT16L1 Nudix (nucleoside diphosphate linked moiety X)-type motif 16 Y like 1 3.543
303 Hs.534398 COMMD3 COMM domain containing 3 3.443304 Hs.127432 DTWD1 DTW domain containing 1 3.072
305 Hs.500756 GOT1 Glutamic-oxaloacetic transaminase 1, soluble (aspartate aminotransferase 1) 3.028
306 Hs.57898 RG9MTD1 RNA (guanine-9-) methyltransferase domain containing 1 2.998
307 Hs.117780 KCNS1 Potassium voltage-gated channel, delayed-rectifier, subfamily S, member 1 2.989
308 Hs.443650 JARID1B Jumonji, AT-rich interactive domain 1B (RBP2-like) 2.805
309 Hs.7570 CNO Cappuccino homolog (mouse) 2.797
310 Hs.533543 F8A1 Coagulation factor VIII-associated (intronic transcript) 1 2.776
311 Hs.444770 SH3KBP1 SH3-domain kinase-binding protein 1 2.761
312 Hs.2430 VPS72 Vacuolar protein sorting 72 (yeast) 2.723
313 Hs.515317 IMPACT Impact homolog (mouse) 2.680
314 Hs.103561 ARL6IP4 ADP-ribosylation Y like factor 6 interacting protein 4 2.637
315 Hs.499620 GEMIN4 Gem (nuclear organelle) associated protein 4 2.449
316 Hs.527874 PSRC2 Proline/serine-rich coiled-coil 2 2.489
317 Hs.152173 ANAPC4 Anaphase promoting complex subunit 4 2.438
318 Hs.129614 TMEM27 Transmembrane protein 27 2.402
319 Hs.483305 HINT1 Histidine triad nucleotide binding protein 1 2.317
320 Hs.356440 CCDC72 Coiled-coil domain containing 72 2.316
321 Hs.177530 ATP5E ATP synthase, H + transporting, mitochondrial F1 complex, epsilon subunit 2.316
322 Hs.101007 DCUN1D3 DCN1, defective in cullin neddylation 1, domain containing 3 (Saccharomycescerevisiae)
2.093
323 Hs.434207 HARS2 Histidyl-tRNA synthetase 2 2.069
324 Hs.483136 COMMD10 COMM domain containing 10 2.062
Min et al International Journal of Gynecological Cancer & Volume 19, Number 4, May 2009
560 * 2009 IGCS and ESGO
8/17/2019 Microarray Analysis Identifies Differentially
15/17Copyright @ 2009 by IGCS and ESGO. Unauthorized reproduction of this article is prohibited.
The function of the HPV E6 protein that is most clearly linked tocarcinogenesis is the targeted degradation of p53, which is de- pendent on the E6AP ubiquitin ligase, the member of a family of ubiquitin ligases (or E3 enzymes). Kelley et al33 found that E6 and E6AP siRNAs elicited nearly identical alterations in thetranscriptional profile of HeLa, Caski, and SiHa cell line. Some of the expression alterations were apparent secondary effects of p53stabilization, whereas the basis of most other changes was not rec-oncilable with previously proposed E6 functions. They concluded that E6AP mediates a broad spectrum of E6 functions, includingvirtually all functions that impact on the transcriptional program of HPV-positive cell lines. It is noticeable that in our study, theexpression of E6AP gene was down-regulated (0.532 times) after E6 was inhibited. Therefore, we presume that both genes can affect each other and show a coincident trend and play a role in p53 stab-
ilization together. The phenomenon had not been reported before,so further validation and study are needed.
Another differentially expressed gene was the ubiquitin ligaseUBE2C . It is known that ubiquitin-dependent proteolysis by the26S proteasome plays a pivotal role in cell cycle progression and in tumorigenesis. Among the E2 gene family, the expression levelof UBE2C was extremely low in many of the normal tissues but prominent in most cancerous cell lines. Intriguingly, UBE2C wasexpressed at high levels in primary tumors derived from the lung,stomach, uterus, and bladder as compared with their correspondingnormal tissues, suggesting that UBE2C is involved in tumorigen-esis or progression of the tumor.34
Other groups have shown by microarray analysis that ex- pression of E6 down-regulated a large number of genes involved in keratinocyte differentiation, including several genes such as
TABLE 3. (Continued)
No. UniGene ID Symbol Gene Name Ratio
325 Hs.502745 FADS2 Fatty acid desaturase 2 1.994
326 Hs.494691 PFN1 Profilin 1 1.990
327 Hs.503546 FADS1 Fatty acid desaturase 1 1.905328 Hs.505735 NACA Nascent-polypeptide Y associated complex alpha polypeptide 1.824
329 Hs.511138 TMEM87A Transmembrane protein 87A 1.777
330 Hs.345694 KCMF1 Potassium channel modulatory factor 1 1.754
331 Hs.83758 CKS2 CDC28 protein kinase regulatory subunit 2 1.729
332 Hs.308122 ITPK1 Inositol 1,3,4-triphosphate 5/6 kinase 1.728
333 Hs.546285 RPLP0 Ribosomal protein, large, P0 1.718
334 Hs.98484 ILDR1 Immunoglobulin-like domain containing receptor 1 1.716
335 Hs.201641 BASP1 Brain abundant, membrane attached signal protein 1 1.677
336 Hs.416998 MRPL18 Mitochondrial ribosomal protein L18 1.663
337 Hs.418241 MT2A Metallothionein 2A 1.656
338 Hs.71465 SQLE Squalene epoxidase 1.652
339 Hs.69855 CSDE1 Cold shock domain containing E1, RNA binding 1.555
340 Hs.483765 SCGB3A2 Secretoglobin, family 3A, member 2 1.544
341 Hs.304613 NDUFB4 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 4, 15 kd 1.500
342 Hs.406515 NQO1 NAD(P)H dehydrogenase, polymer 1 1.487
343 Hs.50252 MRPL32 Mitochondrial ribosomal protein L32 1.479
344 Hs.472185 NDUFS5 NADH dehydrogenase (ubiquinone) Fe-S protein 5, 15 kd (NADH-coenzymeQ reductase)
1.466
345 Hs.438064 FN5 FN5 protein 1.436
346 Hs.91161 PFDN4 Prefoldin subunit 4 1.434
347 Hs.346868 EBNA1BP2 EBNA1 binding protein 2 1.430
348 Hs.14559 CEP55 Centrosomal protein, 55 kd 1.410
349 Hs.484991 HIST1H2BO Histone 1, H2bo 0.711
350 Hs.121592 AP1S2 Adaptor-related protein complex 1, sigma 2 subunit 0.701
351 Hs.5836 MRPS23 Mitochondrial ribosomal protein S23 0.699
352 Hs.21691 GPR75 G protein-coupled receptor 75 0.667
353 Hs.502378 LENG8 Leukocyte receptor cluster (LRC) member 8 0.661
354 Hs.202001 KIAA1012 Hypothetical protein LOC284242 0.661
355 Hs.513044 CSPG4 Chondroitin sulfate proteoglycan 4 (melanoma associated) 0.641
356 Hs.399984 WDR75 WD repeat domain 75 0.585
357 Hs.436527 ANAPC1 Anaphase promoting complex subunit 1 0.580
358 Hs.54056 FAM53C Cell division cycle 25C 0.551
359 Hs.493796 RUSC2 RUN and SH3 domain containing 2 0.535
CDC, Cell division cycle; CMP, cytidine 5¶-monophosphate: UDP, uridine 5¶-diphosphate; tRNA, transfer RNA.
International Journal of Gynecological Cancer & Volume 19, Number 4, May 2009 Microarray Analysis Identifies Genes
* 2009 IGCS and ESGO 561
8/17/2019 Microarray Analysis Identifies Differentially
16/17Copyright @ 2009 by IGCS and ESGO. Unauthorized reproduction of this article is prohibited.
small proline-rich protein genes, elafin, stratum corneum chymo-tryptic enzyme, involucrin, and keratinocyte transglutaminase, that play a role in the formation of the cornified envelope.35,36 Most of these genes were down-regulated regardless of p53 status. We alsoobserved that keratin family members KRT18 (2.322 times), KRT4 (5.623 times), and KRT6E (3.525 times) were all up-regulated after E6 was inhibited, signifying that HeLa cells may show atrend toward normal keratinocyte differentiation after E6 oncogeneinhibition.
Expression of E6 has also been shown to down-regulate ex- pression of genes involved in immune responses such as interferon-inducible genes. It has been reported that HPV-16, HPV-31, E6,and E7 can down-regulate genes involved in immune responsessuch as the interferon-regulated gene Stat-1.37 The differential ex- pression of the interferon-inducible gene Staf50 and several genesinvolved in inflammation such as TCIRG1, HLA-G , and XTP7 wereobserved in our experiment, suggesting that HPV-18 E6 also playsa role in regulation of immune/inflammatory response.
From the present work, it can be concluded that cellular ap-optosis induced by HPV-18 E6 siRNA mainly depends on the P53and ubiquitin proteolysis pathway to regulate gene expression, con-sequently inhibiting cell proliferation and promoting cell apoptosis.Meanwhile , the activation of antioncogene and upper regulation of immunization-related genes signified the degression of the malig-nant extent of tumor cells after E6 interferences. In addition, theapproach of using transcriptional profiles to reveal pathways affected by E6 proves useful.
ACKNOWLEDGMENTThe authors thank Dapeng Ding and Jueyu Zhou for con-
tributions to the microarray experiments.
REFERENCES1. van Doorn LJ, Kleter B, Quint WG. Molecular detection and genotyping
of human papillomavirus. Expert Rev Mol Diagn. 2001;1:394 Y 402.
2. van der Graaf Y, Molijn A, Doornewaard H, et al. Human papillomavirus and the long-term risk of cervical neoplasia. Am J Epidemiol . 2002;156:158 Y 164.
3. Walboomers JM, Jacobs MV, Manos MM, et al. Human papillomavirusis a necessary cause of invasive cervical cancer worldwide. J Pathol .1999;189:1 Y 3.
4. zur Hausen H. Papillomaviruses in human cancers. Proc Assoc Am Physicians. 1999;111:581 Y 587.
5. Bosch FX, Manos MM, Munoz N, et al. Prevalence of human papillomavirus in cervical cancer: a worldwide perspective. International
biological study on cervical cancer (IBSCC) Study Group. J Natl Cancer Inst . 1995;87:796 Y 802.
6. Pina-Sanchez P, Hernandez-Hernandez D, Lopez-Romero R, et al.Human papillomavirus Y specific viral types are common in Mexicanwomen affected by cervical lesions. Int J Gynecol Cancer . 2006;16:1 Y 7.
7. Tong SY, Lee YS, Park JS, et al. Human papillomavirus genotype asa prognostic factor in carcinoma of the uterine cervix. Int J Gynecol
Cancer . 2007;17:1307 Y 1313.
8. Burger RA, Monk BJ, Kurosaki T, et al. Human papillomavirus type 18:association with poor prognosis in early stage cervical cancer. J Natl Cancer Inst . 1996;88:1361 Y 1368.
9. Schwartz SM, Daling JR, Shera KA, et al. Human papillomavirus and prognosis of invasive cervical cancer: a population-based study. J ClinOncol . 2001;19:1906 Y 1915.
10. Lombard I, Vincent-Salomon A, Validire P, et al. Human papillomavirusgenotype as a major determinant of the course of cervical cancer.
J Clin Oncol . 1998;16:2613 Y 2619.
11. Zhang J, Rose BR, Thompson CH, et al. Associations betweenoncogenic human papillomaviruses and local invasive patterns incervical cancer. Gynecol Oncol . 1995;57:70 Y 77.
12. Rose BR, Thompson CH, Simpson JM, et al. Human papillomavirusdeoxyribonucleic acid as a prognostic indicator in early-stage cervicalcancer: a possible role for type 18. Am J Obstet Gynecol . 1995;173:
1461 Y 1468.
13. Im SS, Wilczynski SP, Burger RA, et al. Early stage cervical cancerscontaining human papillomavirus type 18 DNA have more nodalmetastasis and deeper stromal invasion. Clin Cancer Res. 2003;9:4145 Y 4150.
14. Spitkovsky D, Aengeneyndt F, Braspenning J, et al. p53-independent growth regulation of cervical cancer cells by the papillomavirus E6oncogene. Oncogene. 1996;13:1027 Y 1035.
15. Scheffner M, Whitaker NJ. Human papillomavirus-induced carcinogenesis and the ubiquitin-proteasome system. Semin Cancer
Biol . 2003;13:59 Y 67.
16. Phelps WC, Yee CL, Munger K, et al. The human papillomavirustype 16 E7 gene encodes transactivation and transformation functionssimilar to those of adenovirus E1A. Cell . 1988;53:539 Y 547.
17. He Y, Huang L. Growth inhibition of human papillomavirus 16DNA-positive mouse tumor by antisense RNA transcribed from U6
promoter. Cancer Res. 1997;57:3993 Y 3999.
18. Tan TM, Ting RC. In vitro and in vivo inhibition of human papillomavirus type 16 E6 and E7 genes. Cancer Res. 1995;55:4599 Y 4605.
19. Sima N, Wang S, Wang W, et al. Antisense targeting human papillomavirus type 16 E6 and E7 genes contributes to apoptosisand senescence in SiHa cervical carcinoma cells. Gynecol Oncol .2007;106:299 Y 304.
20. Blagosklonny MV, el-Deiry WS. In vitro evaluation of a p53-expres sing adenovirus as an anti-can cer drug. Int J Cancer .1996;67:386 Y 392.
21. Butz K, Ristriani T, Hengstermann A, et al. siRNA targeting of theviral E6 oncogene efficiently kills human papillomavirus-positivecancer cells. Oncogene. 2003;22:5938 Y 5945.
22. Hallez S, Simon P, Maudoux F, et al. Phase I/II trial of immunogenicityof a human papillomavirus (HPV) type 16 E7 protein-based vaccine
in women with oncogenic HPV-positive cervical intraepithelialneoplasia. Cancer Immunol Immunother . 2004;53:642 Y 650.
23. Mantovani F, Banks L. The human papillomavirus E6 protein and its contribution to malignant progression. Oncogene. 2001;20:7874 Y 7887.
24. el-Deiry WS. p21/p53, cellular growth control and genomic integrity.Curr Top Microbiol Immunol . 1998;227:121 Y 137.
25. Syrjänen SM, Syrjänen KJ. New concepts on the role of human papillomavirus in cell cycle regulation. Ann Med . 1999;31:175 Y 187.
26. Southern SA, Herrington CS. Disruptions of cell cycle control by human papillomaviruses with special reference to cervical carcinoma. Int J Gynecol Cancer . 2000;10:263 Y 274.
27. Tamura K, Kanaoka Y, Jinno S, et al. Cyclin G: a new mammalian cyclinwith homology to fission yeast Cig1. Oncogene. 1993;8:2113 Y 2118.
FIGURE 5. Comparison of 5 differential expression genesbetween the microarray and RT-PCR analyses.
Min et al International Journal of Gynecological Cancer & Volume 19, Number 4, May 2009
562 * 2009 IGCS and ESGO
8/17/2019 Microarray Analysis Identifies Differentially
17/17
28. Kimura SH, Ikawa M, Ito A, et al. Cyclin G1 is involved in G2/M arrest in response to DNA damage and in growth control after damagerecovery. Oncogene. 2001;20:3290 Y 3300.
29. Zhao L, Samuels T, Winckler S, et al. Cyclin G1 has growth inhibitoryactivity linked to the ARF-Mdm2-p53 and pRb tumor suppressor
pathways. Mol Cancer Res. 2003;1:195 Y 206.
30. Zimmermann KC, Bonzon C, Green DR. The machinery of programmed cell death. Pharmacol Ther . 2001;92:57 Y 70.
31. Afford S, Randhawa S. Apoptosis. Mol Pathol . 2000;53:55 Y 63.
32. Hollowood AD, Lai T, Perks CM, et al. IGFBP-3 prolongs the p53response and enhances apoptosis following UV irradiation. Int J Cancer .2000;88:336 Y 341.
33. Kelley ML, Keiger KE, Lee CJ, et al. The global transcriptional effects
of the human papillomavirus E6 protein in cervical carcinoma cell linesare mediated by the E6AP ubiquitin ligase. J Virol . 2005;9:3737 Y 3747.
34. Okamoto Y, Ozaki T, Miyazaki K, et al. UbcH10 is the cancer-related E2 ubiquitin-conjugating enzyme. Cancer Res. 2003;63:4167 Y 4173.
35. Duffy CL, Phillips SL, Klingelhutz AJ. Microarray analysis identifiesdifferentiation-associated genes regulated by humanpapillomavirus type16 E6. Virology. 2003;314:196 Y 205.
36. Chang YE, Laimins LA. Microarray analysis identifiesinterferon-inducible genes and Stat-1 as major transcriptional targets of human papillomavirus type 31. J Virol . 2000;74:4174 Y 4182.
37. Wall SJ, Edward DR. Quantitative reverse transcription-polymerasechain reaction (TR-PCR): a comparison of prime-dropping, competitive,and real-time RT-PCRs. Anal Biochem. 2002;300:269 Y 273.
International Journal of Gynecological Cancer & Volume 19, Number 4, May 2009 Microarray Analysis Identifies Genes
* 2009 IGCS and ESGO 563