+ All Categories
Home > Documents > Nsw 20150217

Nsw 20150217

Date post: 07-Apr-2016
Category:
Upload: star-weekly
View: 242 times
Download: 3 times
Share this document with a friend
Description:
Northern Star Weekly Community News 20150217
16
FEBRUARY 17, 2015 \ NORTHERN.STARWEEKLY.COM.AU SATURDAY NIGHT 80 Northcorp Blvd, Broadmeadows, 3047 THIS NEWS + SPORT + PROPERTY GUIDE Apache Cat – the horse – will be one of the star attractions of next month’s Live.Grow.Explore festival at Living Legends, the Greenvale property that’s home to some of Australia’s most successful retired racehorses. The champion sprinter, pictured with handler Nicole Devlin, will be a star again when Living Legends opens its gates to the public to host the jointly run Landcare and Hume council community day. The festival will feature tours of the homestead; TV gardener Vasili Kanidiadis will run a workshop; and there’ll be a pedal-powered energy display with walking tours, pony rides, face-painting, free food stalls and three iPad minis up for grabs. It’s all at Woodlands Historic Park, Oaklands Road, Greenvale, from 11am-4pm on Sunday, March 15. Lexi Cottee (Joe Mastroianni) Apache Cat set to star again By Lexi Cottee Paramedics have been called to more than 70 cases of children locked in cars in Melbourne’s northern and western suburbs since the start of the year. Ambulance Victoria’s group manager Brett Drummond says paramedics are frustrated that parents aren’t heeding the message about the dangers of leaving children in cars. “ere’s been a significant amount of media coverage this summer to warn against the dangers of leaving children in cars,” Mr Drummond said. “Despite that, people are still wanting to gamble with their children’s lives.” Since January 1, Ambulance Victoria has received 73 calls to attend to incidents in the northern and western suburbs. is is despite a recent move by the state government to increase the penalties for leaving a child unattended in a car. e new laws have increased the fine to $2165 or up to three months’ imprisonment. When a call is made to triple-0 about a child locked in a car, Victoria Police, Ambulance Victoria and the Metropolitan Fire Brigade personnel oſten all attend. But the task of smashing a car window is leſt to the MFB. MFB northern district commander Gary Cronin said nine out of 10 cases he attended were accidental. “Mothers give their children their car keys to play with and, by accident, the child locks themselves in the car,” he said. He cautioned parents to be mindful about where they leave their keys. “If they’re leſt at the bottom of a handbag on the car seat, they can become compressed and lock the car,” he warned. In the past few weeks, Mr Cronin was called to a family home in omastown where a child had accidentally locked itself in the car while parked in the driveway. He also attended an incident in the Epping Plaza carpark where a child had also locked itself inside a car. He said on a hot day, the temperature inside a car could rise to more than 40 or 50 degrees within 10 minutes. at is enough for a child to die of dehydration, he said. Hume’s Acting Inspector Phil Nash urged parents and the public to stay vigilant. “It’s always been an issue around Christmas time and during the school holidays, but the public are more vigilant now than they used to be,” he said. “e people doing this risk harm to their children,” Inspector Nash said. “And it’s an offence.” Child car lock-ins still rife ‘‘ People doing this risk harm to their children … and it’s an offence ’’ - Phil Nash
Transcript
  • FEBRUARY 17, 2015 \ NORTHERN.STARWEEKLY.COM.AU

    SATURDAY NIGHTTheMeadows.org.au/AusCupCarnival

    80 Northcorp Blvd, Broadmeadows, 3047

    THIS

    NEWS + SPORT + PROPERTY GUIDE

    Apache Cat the horse will be one of the star attractions of next months Live.Grow.Explore festival at Living Legends, the Greenvale property thats home to some of Australias most successful retired racehorses. The champion sprinter, pictured with handler Nicole Devlin, will be a star again when Living Legends opens its gates to the public to host the jointly run Landcare and Hume council community day. The festival will feature tours of the homestead; TV gardener Vasili Kanidiadis will run a workshop; and therell be a pedal-powered energy display with walking tours, pony rides, face-painting, free food stalls and three iPad minis up for grabs. Its all at Woodlands Historic Park, Oaklands Road, Greenvale, from 11am-4pm on Sunday, March 15. Lexi Cottee

    (Joe

    Mas

    troi

    anni

    )

    Apache Cat set to star again

    By Lexi Cottee

    Paramedics have been called to more than 70 cases of children locked in cars in Melbournes northern and western suburbs since the start of the year.

    Ambulance Victorias group manager Brett Drummond says paramedics are frustrated that parents arent heeding the message about the dangers of leaving children in cars.

    eres been a signicant amount of media coverage this summer to warn against the dangers of leaving children in cars, Mr Drummond said.

    Despite that, people are still wanting to gamble with their childrens lives.

    Since January 1, Ambulance Victoria has received 73 calls to attend to incidents in the northern and western suburbs.

    is is despite a recent move by the state government to increase the penalties for leaving a child unattended in a car.

    e new laws have increased the ne to $2165 or up to three months imprisonment.

    When a call is made to triple-0 about a child locked in a car, Victoria Police, Ambulance Victoria and the Metropolitan Fire Brigade personnel oen all attend. But the task of smashing a car window is le to the MFB.

    MFB northern district commander Gary Cronin said nine out of 10 cases he attended were accidental.

    Mothers give their children their

    car keys to play with and, by accident, the child locks themselves in the car, he said.

    He cautioned parents to be mindful about where they leave their keys.

    If theyre le at the bottom of a handbag on the car seat, they can become compressed and lock the car, he warned.

    In the past few weeks, Mr Cronin was called to a family home in omastown where a child had accidentally locked itself in the car while parked in the driveway.

    He also attended an incident in the Epping Plaza carpark where a child had also locked itself inside a car.

    He said on a hot day, the temperature inside a car could rise to more than 40 or 50 degrees within 10 minutes.

    at is enough for a child to die of dehydration, he said.

    Humes Acting Inspector Phil Nash urged parents and the public to stay vigilant.

    Its always been an issue around Christmas time and during the school holidays, but the public are more vigilant now than they used to be, he said.

    e people doing this risk harm to their children, Inspector Nash said.

    And its an oence.

    Child car lock-insstill rife

    People doing this risk harm to their children and its an offence - Phil Nash

  • 2 NORTHERN STAR WEEKLY \ FEBRUARY 17, 2015

    KNOW YOUR GRASSFIRE RISK THIS SUMMERIf you live near open grassland, parks, paddocks or reserves, you could be impacted by grassfire.

    ITS UP TO YOU TO KNOW WHAT TO DO IF A FIRE STARTS.

    Remember, its up to you to monitor weather conditions and warnings. Always keep an eye on the conditions outside - you may be aware of a fire before emergency services. If you see smoke or flames, call Triple Zero (000).

    Authorised by the Victorian Government, 1 Treasury Place, Melbourne

    DO YOU LIVE ON A FENCELINE NEXT TO GRASSLAND? If a fire starts, quickly move one

    or two streets away from the fenceline or park boundary

    Act early, even if you havent received a warning

    Keep the roads clear so emergency services can respond

    DO YOU LIVE ONE OR TWO STREETS AWAY FROM GRASSLAND?

    Stay inside your home grassfires are unlikely to spread past the first row of houses

    Keep the roads clear so emergency services can respond

  • NORTHERN.STARWEEKLY.COM.AU NEWS

    3 NORTHERN STAR WEEKLY \ FEBRUARY 17, 2015

    Min Charge includes $10 Delivery + $20 Prepayment Outside Included Value + $99.95 Setup. The plan has an access connection speed of up to 12Mbps download/1Mbps upload. Actual throughput speeds may be slower and could vary due to various factors. Only available for residential customers in selected coverage areas and must not be used for commercial purposes. Unlimited local calls includes 13/1300. Calls to Aus Mobiles and Directory Services are not included. 100 International Minutes Per Month offer does not include calls to satellite phones. Unused included International Minutes expire at the end of each month. Prepayment of $20for commercial purposes. Unlimited local calls includes 13/1300. Calls to Aus Mobiles and Directory Services are not included. not include calls to satellite phones. Unused included International Minutes expire at the end of each month. Prepayment of $20for commercial purposes. Unlimited local calls includes 13/1300. Calls to Aus Mobiles and Directory Services are not included.

    required for excluded call charges. Some call types not supported, incl fax, pay TV program purchase, back to base alarms and similar. Plan fees payable monthly in advance. Prepayment automatically topped up if it falls below $10. Service barred if prepayment top up payment fails. This offer may be withdrawn at any time. For full terms, conditiotypes not supported, incl fax, pay TV program purchase, back to base alarms and similar. Plan fees payable monthly in advance. below $10. Service barred if prepayment top up payment fails. This offer may be withdrawn at any time. For full terms, conditiotypes not supported, incl fax, pay TV program purchase, back to base alarms and similar. Plan fees payable monthly in advance.

    ns & exclusions visit tpg.com.au.

    13 31 60

    Standard SpeedNBN HOME PHONE+

    Local Calls Unlimited STD National Calls Unlimited International 100 Minutes

    $6999DATA USAGEDDDAAATTTAAA UUUSSSAAAGGGEEEUNLIMITEDUNLIMITEDMIN CHARGE IN 1ST MONTH $199 94

    Includes Upfront Fees

    $6999permonthNO LOCK-IN CONTRACT

    EPPING9408 4577

    10012266-01-a17JunMMP

    FREE OPEN DAYDATE 2015sunday february 22

    TIME10.00am to 12.30pm

    LOCATIONj.c. donath reservewagga rd reservoir[melways reference 18j1]

    FREE ENTRY INCLUDESfree coaching clinics for all ages and abilitiesfree use of equipmenthot shotsmembership & social tennis detailsfree sausage sizzle

    ENQUIRIESbarbara 94703552 ashlea 0423 917 978 morgana 0439 353 009

    [email protected]

    FIND US ON:

    1173

    226-

    HM

    07-1

    5 1

    0022

    737-

    0111

    7322

    6-H

    M07

    -15

    100

    2273

    7-01

    1173

    226-

    HM

    07-1

    5 1

    0022

    737-

    0111

    7322

    6-H

    M07

    -15

    100

    2273

    7-01

    9438 20499 Collins Street, Diamond Creek | www.brightsmiles.com.au

    Highest quality dental care in the area for over 20 years.Visit us for a friendly, modern & relaxing service,

    including cosmetic options: veneers bridges crowns implantsNew Patients & Emergencies Welcome

    EVENINGS & SATURDAYS AVAILABLE BY APPOINTMENT

    Fast Health Insurance Claims On The Spot Member of the Australian Dental Association

    DENTISTDENTISTDENTISTDENTISTDENTISTDENTISTDENTISTDENTISTDr Raymond Khong

    Diamond Creek Dental Clinic

    Dr Nancy Henein

    10020254-02-a16D

    ecMMP

    MP Bernie Finn has urged Local Government Minister Natalie Hutchins to conrm an independent Sunbury council will come into existence on July 1.

    Western Metropolitan Liberal Mr Finn told State Parliament last week the new government had to honour a resounding yes vote for Sunbury out of Hume.

    It wasnt just the people in Sunbury. Right across Hume people voted for Sunbury to have a stand-alone council, he said.

    e former government respected the voice of the people and announced last year there would be a new council as of July 1 this year. Since the election there has been silence.

    As reported by Star Weekly, the Star Weekly, the Star WeeklyAustralian Services Union has launched a petition urging the government to allow a new, compulsory vote on whether Sunbury should break away from the municipality of Hume.

    Hume council has met Ms Hutchins several times to raise its concerns with the secession process.

    Mr Finn said people in Sunbury were worried about the campaign against an independent Sunbury.

    ey may be worried with good reason, given the governments silence on this particular matter, he said.

    Ms Hutchins has previously said there were issues with the secession that couldnt be ignored and the government would not rush its review.

    Matt Crossman

    Honour Hume vote, says Finn

    By Lexi Cottee

    Detectives investigating a fatal shooting in Campbelleld last ursday have not been able to establish whether there was a connection between the victim and the oender, or why the victim was in the area at the time.

    Police and Ambulance Victoria were called to the scene in Merri Concourse at 6.20am on ursday aer nearby workers heard gunre and called triple-0.

    A man in his mid-30s was found dead in a pool of blood in a factory driveway.

    Detective Sergeant Shane OConnell, of the homicide squad, said the dead man had gunshot wounds to his chest.

    Its a tragic set of circumstances, he said. He didnt work at any of these factories.

    But while the victim, whose name had not been released by the time Star Weeklywent to press, did not work in the area, he was known socially to people who worked at nearby factories.

    e shooting took place in an industrial pocket that has been linked to various motorcycle gangs but detectives were quick to play down links to bikies.

    No weapons have been recovered and police were unable to provide a description of the perpetrator.

    Detectives were talking to a group of people who were in the area socialising at the time of the shooting.

    One man was taken away in handcus in an unmarked police car.

    Half an hour later, another man and a woman were taken from the scene. But police said no arrests had been made.

    A sta member from a nearby business,

    Campbelleld kill puzzle

    A man assists police with their inquiries in Campbelleld. (Penny Stephens/The Age)The Age)The Age

    who declined to give her name, said the incident had hampered business.

    Our trucks arent allowed into the street, she said.

    Our suppliers are screaming for our containers. We had three trucks booked for

    this morning, but weve had to cancel them. Another company in the street, Imajpak, closed for business for the day.

    Police are appealing for anyone with information to contact Crime Stoppers on 1800 333 000.

  • NEWS NORTHERN.STARWEEKLY.COM.AU

    4 NORTHERN STAR WEEKLY \ FEBRUARY 17, 2015

    www.kumoninstructors.com.au/franchise

    Become a Kumon FranchiseeKUMON THOMASTOWN EDUCATION CENTRE FOR SALEIf having the flexibility of owning a business, working with children and being part of your community appeals to you, then a Kumon Franchise may be ideal for you.

    As a Kumon Instructor you will:

    To find out more about this opportunity please register to attend an information session by contacting us on (03) 9684 8700 or email [email protected].

    By Lexi Cottee

    irty-nine workers have been made redundant at Broadmeadows confectionery maker Betta Foods.

    Accounting rm Cor Cordis announced on Wednesday that a review of the business le administrators with no choice but to make a number of sta redundant.

    Managing partner Bruno Secatore said a preliminary review showed that a restructure was needed for the business to continue operating as a going concern.

    liquorice and Eskimo chocolate snowballs, and counts Coles, Woolworths and Aldi among its retail distributors.

    e King William Street-based business was sold to British restructuring company Hilco Capital in October last year.

    It was established in 1954 and was generating revenue of $40 million annually, as of last year.

    Prior to Wednesdays announcement, the company employed about 160 people.

    Mr Secatore said at this stage there are no plans for further sta redundancies.

    Of the 39 redundancies, he said, 28 came

    Unfortunately, that has meant that we have to reduce head count, he said.

    irty-nine sta were informed of their redundancies this is always a very dicult decision when theyre trying to save a company.

    We have consulted with the unions and are dealing with this as compassionately as we can, Mr Secatore said.

    Cor Cordis was appointed as the voluntary administrator of the manufacturer on January 20 when it was announced Betta Foods had collapsed nancially.

    Betta Foods manufactures Capricorn

    from the factory oor and the rest from management.

    Mr Secatore said the business was likely to sell within the next few weeks as Cor Cordis had received more than 26 expressions of interest since January 20, most from Australia-based companies looking to buy the companys assets.

    We are expecting formal oers by the end of this week, and the signs are encouraging that there is a future for Betta Foods, Mr Secatore said.

    Union United Voice has been contacted for comment.

    Factory jobs go at Betta Foods

    Craigieburn CFA senior station ofcer Peter Spicer and his team have polished the stations brass torches and pressed their uniforms for Craigieburn Festivals annual torchlight parade in which the reys march though the suburb on the rst evening of celebrations. This year marks the 70th year of the CFA, so Hume council is encouraging the community to line the streets and applaud the volunteer and career reghters who play an indispensable role in the community. The festival is on Saturday, February 28, from 3-10pm and the next day, Sunday, from 11am-4pm at DS Aitken Reserve, Craigieburn. Festival highlights will include reworks, kite-making workshops, a performance by popular childrens group The Kazoos, and clinics conducted by Tennis Australia, Cricket Australia and the North Melbourne Football Club. Lexi Cottee

    Fireys aglow for Craigieburn festa

    (Joe

    Mas

    troi

    anni

    )

  • NORTHERN.STARWEEKLY.COM.AU NEWS

    5 NORTHERN STAR WEEKLY \ FEBRUARY 17, 2015

    SATURDAY NIGHT

    TheMeadows.org.au/AusCupCarnivalTheMeadows.org.au/AusCupCarnivalTheMeadows.org.au/AusCupCarnival

    80 Northcorp Blvd, Broadmeadows, 3047

    THIS

    Clean Up Australia Day celebrates its 25th anniversary this year. Since the rst event was held in 1990, Australians have donated almost 30 million hours to cleaning up waterways, parks, bushland and streets. The 2015 event is on March 1, and Whittlesea residents have nominated 17 sites around the shire that will be cleared of litter. You can volunteer to work at one of these sites or start your own. Mayor Ricky Kirkham and local residents (above) have already made a start, but more helpers will be required on the day at Mill Park Recreation Reserve; McDonalds restaurants in Epping, Whittlesea and Thomastown; and Samuel Court in Bundoora. Other sites include Blind Creek in Sunbury and Global Park in Westmeadows. The clean-up will run from 10am until noon on March 1 and wrap up with a light snack. Visit www.cleanupaustraliaday.org.au. Lexi Cottee

    Your chance to come clean

    (Phi

    l OB

    rien

    )

    By Lexi Cottee

    A petition to x poor internet services and black spots at Beveridge, Whittlesea and Wallan is lling fast.

    Almost 400 people have signed the Better connected Yan Yean petition, which calls for improved access to adequate and reliable internet services and activating notorious mobile black spots.

    Better Beveridge Group secretary Ian Rankin said the community group started the petition last year to encourage the government and Telstra to upgrade existing facilities.

    Beveridge grazier and group president Greg Heernan hopes to lodge the petition in state and federal Parliaments within the next few weeks.

    He said most people had to install a satellite or use wi, which is expensive and very slow.

    Another Beveridge resident, who declined to give her name, has written to Telstra chief executive David odey airing her frustrations at having to make do without broadband.

    She and her partner moved into their home about a year ago only to learn there were no ADSL ports le in the area. Shes been unable to run her online business ever since and is forced to use the local librarys internet service to hunt for jobs. e new residents of Mandalay have all the services they need yet the people who have lived here their whole lives get nothing, she said.

    Whittlesea council has been lobbying the federal government and Telstra to bring high-speed broadband to the community for some years.

    Brad Winter, the councils organisation improvement manager, said it was unlikely Telstra would upgrade communications infrastructure in areas such as Doreen and Mernda because the NBN would come along within the next 10 years.

    Under the act they only have to provide a telephone service, he said. ats the problem at the moment.

    e council applied to the federal governments Mobile Black Spot Program but was knocked back because it didnt meet the prerequisite of being in a regional area.

    A Telstra spokesman said the availability of ADSL ports would change over time with demand and upgrades to the network.

    In the past year, we have completed three exchange-based port upgrades as well as six upgrades to parts of our streetside cabinet network. We have plans in place to improve the port availability in parts of Mernda, scheduled for completion in June 2015, the spokesman said.

    Poor internet prompts action

    We have plans in place to improve the port availability - Telstra spokesman

  • NEWS NORTHERN.STARWEEKLY.COM.AU

    6 NORTHERN STAR WEEKLY \ FEBRUARY 17, 2015

    Overnewton Year 7&9

    Academic Scholarships

    AAPPPPPPLLIICCAATATATATATATAATATA IIOONNSS CCLLOOSSEE MMAARRCCHH 1111Academic scholarships are being offered for students commencing Year 7 and Academic scholarships are being offered for students commencing Year 7 and Year 9 in 2016 applications close on March 11. The test date is 21 March 2015.

    For more information call Shirley Seit on 9334 0140.

    SCHOOL ALIVE TOURS 2015I FRIDAY 6 MARCH I TUESDAY 19 MAY I

    I WEDNESDAY 26 AUGUST I FRIDAY 9 OCTOBER I

    Enrolment opportunities available for 2016. Discover the Overnewton difference at one of our School Alive Tours. Weekly scheduled tours are also available.

    For more information or to book a tour please call Diane King on 9334 0141.

    Two campuses: Keilor and Taylors Lakes. Prep to Year 12 co-educational college. overnewton.vic.edu.au

    GEARBOX, DIFF & TRANSMISSION MECHANICAL REPAIRS TO MOST MAKES & MODELS INCLUDING

    4WDs & LIGHT COMMERCIALS.

    ALL WORK GUARANTEED.

    PICK-UP OF UNITS & DELIVERY IN METRO AREA.

    GEARS & DIFFS

    9462 2077

    FREEROAD TEST

    246 WOLSELEY PLACE, THOMASTOWN

    G355

    4892

    AA-v8Feb

    GEARBOX, DIFF, TRANSMISSION AND MECHANICAL REPAIRS TO MOST MAKES AND MODELS INCLUDING 4WDS & LIGHT COMMERCIALS. ALL WORK GUARANTEED. PICK UP OF

    UNITS & DELIVERY INMETRO AREA.

    GEARBOX, DIFF, TRANSMISSION

    FREEROAD TESTTo Northern Weekly

    Readers

    246 WOLSELEY PLACE,THOMASTOWN

    9462 2077We accept

    1171

    978-

    CG08

    -15

    All Insurance & Private Work

    Quality Workshop

    Oven Baked Finish

    All Work Guaranteed

    4/A Buch Ave, Epping Ph/Fax 94014444

    FREE LOAN CAR

    NO OBLIGATIONFREE QUOTES!

    G355

    5221

    AA-v8Feb

    All Insurance& Private Work

    Quality Workshop

    Oven Baked Finish

    All Work Guaranteed

    4/A Buch Ave, EppingPh/Fax 94014444

    *Conditions apply

    FREELOAN CAR

    All Insurance & Private Work

    Quality Workshop

    Oven Baked Finish

    All Work Guaranteed

    4/A Buch Ave, Epping Ph/Fax 94014444

    FREE LOAN CAR

    NO OBLIGATIONFREE QUOTES!

    G355

    5221

    AA-v8Feb

    1131620-LB19-14

    ~ V.I .P. ~LIMOUSINES & HIRE CARS

    LIMO BUS

    Tel: 9436 8666Mob: 0418 381 895

    Websitewww.viplimos.com.au

    *Baby Seats Available

    "GO ON, INDULGE YOURSELF'VIP LIMOUSINEWINERY TOUR

    If you are a lover of fine Victorian wine & Cuisine, why not indulge yourself in a wine tour with VIP Limousines

    1170846-DJ04-15 10021754-011170846-DJ04-15 10021754-01

    not indulge yourself in a wine tour with VIP LimousinesFEBRUARY OFFER:

    Hire 2 Stretch Limos for Wedding ONLY $700

    Top Quality Affordable Price17 Greenaway Street, Bulleen VIC 3105 Ph: 98501629

    Shop onlinewww. .com.auauscrown

    High Pressure LPGas Burners

    Big Stock Pot Burners

    Stainless Steel GasWok CookersWok Cookers

    Double

    Single

    Commercial ElectricRice CookersRice Cookers

    Made in KoreaMade in Korea

    10016918-06-2D

    ecMMP

    CONTACT US

    PHONE \ 03 8318 5777

    LOCATION \ Corner Thomsons Road and Keilor Park Drive,Keilor Park, 3042

    DISTRIBUTION \ 1300 656 [email protected]

    ADVERTISING

    SALES DIRECTOR \ BEN [email protected]

    GENERAL SALES [email protected]

    CLASSIFIEDS \ 1300 666 808FAX \ 5945 0667EMAIL \ [email protected]

    EDITORIAL

    EDITOR-IN-CHIEF \ STEPHEN [email protected]

    GENERAL EDITORIAL [email protected]

    COMMUNITY CALENDAR [email protected]

    Published by MMP Star Pty Ltd ACN 168 220 399Head Ofce Corner Thomsons Road and Keilor Park Drive, Keilor Park, 3042Publisher/General Manager, Colin MossAll material is copyright to MMP Star Pty Ltd.Responsibility for election comment is accepted by Colin Moss.All signicant errors will be corrected as quickly as possible. Distribution numbers, areas and coverage are estimates only. For our terms and conditions please visitwww.starweekly.com.au

    REAL ESTATE SALES DIRECTOR \ JACK [email protected]

    ACCOUNT MANAGERDOMENIC SGAMBELLONE \[email protected]

    DISTRIBUTION \ 55,000 copies**Publishers estimate

    NORTHERN.STARWEEKLY.TARWEEKLY.TARWEEKLY COM.AU Briefs

    Police chargedTwo police from the north-west metro region have been charged on summons following an investigation by Professional Standards Command. A senior constable and a constable were charged with possessing the proceeds of crime, trafcking a drug of dependence, three counts of theft and three counts of misconduct in public ofce. They are due to appear at Melbourne Magistrates Court on February 24 and have been suspended without pay.

    House blazePolice are investigating a suspicious re at an unoccupied single-storey house in Hallston Court, Meadow Heights, just before 6pm last Saturday. Fire crews took 25 minutes to bring the blaze under control and damage was estimated at $100,000.

    Butt out those cigarettes Discarded cigarette butts have been blamed for a spate of grassres in Hume after emergency services were called to four res in a week. Acting Inspector Phil Nash appealed to motorists not to throw cigarette butts from car windows.

    Seniors get sports complexA new sport and social complex has opened in Mernda Retirement Village. Whittlesea mayor Ricky Kirkham and Yan Yean MP Danielle Green were at the opening on Friday. Included are a caf and bar, billiards room, library, theatre room, hair salon, heated indoor pool and gym.

    Schools will begin circulating immunisation consent forms this week before nurses do their rounds next month. This year, the Boostrix vaccine that protects teenagers against diphtheria, tetanus and whooping cough is being offered to years 7 to 10 students. In previous years it has been offered only to year 10 students. A spike in cases of whooping cough has prompted the state government to reintroduce free vaccines for expectant mothers and parents of newborns. In the past 12 months, there has been a 58 per cent rise in known cases, from 2926 in 2013 to 4615 last year. For the past few years, Whittlesea council has immunised about 75 per cent of year 10 students. According to a council spokeswoman, misplaced consent forms are largely to blame for the 25 per cent who miss out. Mayor Ricky Kirkham urged parents to check their teenagers school bags for consent cards; its as simple as nd it, sign it, return it, he said. Lexi Cottee

    Sign up to stay healthy

    (File

    pic

    ture

    )

  • NORTHERN.STARWEEKLY.COM.AU NEWS

    7 NORTHERN STAR WEEKLY \ FEBRUARY 17, 2015

    Natural Look Denture Clinic

    Solutions to your dentures problems

    9717 6551

    Creating a natural look to suit your features.

    39-41 Grimshaw StGREENSBOROUGH

    book a denture CheCk-up today

    Its time for a bright, whiter, natural-looking smile!

    natural-looking, full and partial denturesQuality materials

    highly experienced dental prosthetistoffering a range of dentures to suit your budget

    Veterans affairs & Victorian denture Scheme

    10009455-01-a6MayMMP

    Classic car enthusiasts can relive their youth while raising money for community projects at a show in Sunbury later this month.

    Dozens of cars and motorbikes will line up for the inaugural North West Show and Shine.

    It is being organised by Sunbury Rotary Club whose event co-ordinator Mario Spiteri says there will be all manner of rare and unique vehicles on display, but they will all have one thing in common: metal bumpers.

    Its restricted to entries from the early 80s and older, he says. A few of us guys at the Rotary Club have old cars, so we thought it was a great opportunity to use them as a

    vehicle to raise money for projects around town, including the Sunbury Community Kitchen.

    Entries will be accepted on the day and cost $20 for cars and $10 for motorbikes.

    General admission is by gold coin donation.

    e show and shine is at Masters Sunbury, in Vineyard Road, from 7-10pm on Friday, February 27.

    Matt Crossman

    A bumper cash drive

    Rotary member Lee Straham and his GT Falcon. (Joe Mastroianni)

    82 Mahoneys RoadThomastown

    Ph: 9460 3666

    RIDES & ENTERTAINMENTAND FUN FOR ALL AGES

    $15 Parma specialavailable all Day

    in our Bistro1173449-LN08-15

    By Lexi Cottee

    A petition to add another lane to Lakes Boulevard in South Morang has gained more than 500 signatures in less than 24 hours.

    South Morang resident Helen Georgiou created the petition on Change.org last ursday aernoon, calling for Whittlesea council to ease trac congestion by adding another lane to Lakes Boulevard, which runs between Plenty and Findon roads.

    Ms Georgiou said she was encouraged to start the petition aer a member of the South Morang Community Notice Page Facebook

    driven by pure frustration. Ive been here six years and Ive had enough.

    e 39-year-old said infrastructure hadnt kept pace with the inux of residential housing in the area.

    Whittlesea councils acting director of infrastructure and technology, Gri Davis, said trac congestion was an ongoing issue.

    group posted a photo of peak-hour gridlock in Lakes Boulevard.

    I commented on the photo that Id like to do something about this and someone suggested I start a petition. So I did, she said.

    Within two hours more than 200 drivers had signed the petition.

    Ms Georgiou moved from Lalor into Hawkstowe Parade six years ago.

    e commute to her business in omastown, about 12 kilometres away, takes well over an hour each day.

    Being ve minutes late can cause me a half-hour delay, she said. is petition is

    He said the duplication of Lakes Boulevard was one of several road improvement projects the council would like to carry out in South Morang to accommodate increasing trac.

    Almost $5 million will be spent in the 2014-15 nancial year on improvements to local roads, Mr Davis said.

    Although funds have yet to be set aside for the duplication of Lakes Boulevard, it has been identied by council as a future road improvement project.

    Ms Georgiou said she would lodge her petition with the council before its next meeting on February 24.

    Frustration drives road petition Ive been here six years and Ive had enough - Helen Georgiou

    The latest localnews at your

    fingertips

    Visit our websitenorthern.starweekly.com.au

  • NEWS NORTHERN.STARWEEKLY.COM.AU

    8 NORTHERN STAR WEEKLY \ FEBRUARY 17, 2015

    03 9439 [email protected]

    Natural Coloured Diamonds and Precious Stones

    725 Main Road Eltham, 3095

    An educational forum about the drug ice will be held in South Morang next month.

    e forum, one of 19 to be held across the state before mid-April, will tackle issues of using crystal methamphetamine (ice), alcohol and other drugs.

    e Australian Drug Foundations Good Sport program is co-ordinating the forums to teach people, those in sports clubs particularly, how to help members and families avoid drug and alcohol abuse.

    Mernda Football Club vice-president Jason Berry says that while he has never had to deal with a club member falling prey to ice, he will be at the forum.

    Laurimar Football Club president Alasdair Walker, who also isnt aware of ice use among club members and parents, is keen to attend, as is Lalor Football Club president Rodney Lowry.

    Experts in the eld and police will tell clubs how to develop an alcohol and drugs policy.

    Last year, State Parliaments law reform, drugs and crime prevention committees inquiry into ice use concluded the drug is impacting signicantly on communities and becoming increasingly normalised for some young people.

    e local forum will be at Plenty Ranges Arts and Convention Centre on Wednesday, March 18.

    For more information, visit: www.goodsports.com.au/tack letheissue/forums/March.

    Lexi Cottee

    Sports clubs tackle ice use

    By Lexi Cottee

    Guy Grossi is big on tradition. e restaurateur upholds many of the customs maintained by his parents, who moved to Melbourne from Milan in 1960.

    e Italian tradition of making passata, a tomato puree made from cooking and straining tomatoes, is his next culinary adventure.

    e Grossi family, of renowned Melbourne restaurants Grossi Florentino, Ombra Salumi and Merchant, will host Melbournes rst tomato festival at Farm Vigano, South Morang, next month.

    Passata Day, as its called, brings families together to crush, boil and bottle the seasons harvest, all the while drinking wine, eating and laughing. e Grossis wanted to replicate this great family tradition at Farm Vigano, so the festival will include plenty of opportunities to cook, eat, drink and be merry.

    Cooking demonstrations, talks, gardening tutorials and, of course, passata-making classes will be led by some of the citys best chefs, including Karen Martini, Rosa Mitchell, Frank Camorra and maestro Guy Grossi.

    Grossis sister, Elizabeth Grossi Rodriguez, says passata-making is a harvest celebration.

    Its about culture but also about preserving the way we eat and how we prepare what we eat, Ms Rodriguez said.

    Farm Vigano was rst owned and developed by restaurateur Mario Vigano and his artist wife, Maria Teresa. e Melbourne Tomato Festival is on Sunday, March 1, at Farm Vigano, 10 Bushmans Way, South Morang.

    Tickets presale only and covering all events are $25 for adults and $10 for children aged six-13, with children ve and under admitted free. More details are at www.melbournetomatofestival.com.

    Festival of rosy reds

    ELIZABETH GROSSI RODRIGUEZ AND LOREDANA GROSSI (Joe

    Mas

    troi

    anni

    )

  • 9 NORTHERN STAR WEEKLY \ FEBRUARY 17, 2015

    FARM VIGAN10 Bushmans Way, South Morang

    The perfect setting for a special meal, Farm Vigan is both scenic and part of local folklore. Iconic Italian restaurateur, Mario Vigan, lived on the farm while running Marios in Exhibition Street with his wife, Maria Teresa, a noted artist during the 1930s, 40s and 50s. Today, this property still has an orchard and is dedicated to preserving the art of true Italian food and culture, specialising in weddings and other functions. A true local gem.

    THIRD PLACE CAF286 Epping Road, Wollert

    Built in 1866 by the Hehr family from Germany, Hehrs Pine Park Farm is now a contemporary dining room/caf designed by prominent heritage architects 6 Degrees. The property retains many of its original features. The farmhouse and outbuildings, including milking sheds, drystone walls and dairy machinery and shearing sheds walls are all preserved, creating an historic setting for modern dining. Patrons can eat in the dining room, garden or a marquee and choose from an a la carte, pizza and breakfast menu.

    TWO BEANS AND A FARM10 Hathfelde Boulevard, Mernda

    This historic property once housed one of Victorias first water-powered flour mills. Two Beans and a Farm Restaurant is part of Carome Homestead, built on the property in 1861 from local bluestone. Some remnants of the mill remain overlooking the Plenty River, creating a majestic setting for a special meal. The restaurants from the garden to the plate philosophy serves it well. Its chefs are passionate about using homegrown and locally sourced produce, respecting seasonality, and creating the restaurants delicious wares from scratch.

    MONTELEONE RESTAURANT915 Donnybrook Road, Donnybrook

    Owned and operated by the Monteleone family, who have made Artisan gourmet cheese for five generations, Monteleone Restaurant believes that cheese enhances every delicious meal and specialises in wood-fired pizza and fresh rustic Southern Italian dishes. The restaurant caters for small or large groups, who can eat inside or outside taking in surrounding countryside. Attached to the Donnybrook Farmhouse Cheese Shop, diners can also sample the shops fresh dairy produce made from its own herd of cows.

    TURNERS BAKEHOUSE EATERY107 Schotters Road, Mernda

    This heritage-listed Victorian cottage bakery makes many of its delicious products in a 130-year-old traditional scotch oven. Those who eat in can enjoy their wood-fired sourdough breads, handmade pies, pasties and sausage rolls, homemade sweets and cakes in a magnificently restored homestead. Turners specialises in breakfast, brunch, lunch, high tea and catering. It also has bakery tours and workshops for budding bakers and food history buffs.

    How did Mario Vigan know your father, Pietro?It was in 1960 that he brought out my Dad (from Italy) as a young chef. I never went to the farm as a child but he had lots of parties there.

    Did Pietro tell you about the farm?He just said how great it was that they had a farm where they grew vegetables for the restaurant. They grew things like tomato, lettuce, green beans, carrots, those sorts of things. Theres an orchard.

    Why do we need a tomato festival?Its about maintaining culture and looking after our earth and growing that whole awareness about where our food comes from, celebrating the seasons and bringing the community together.

    Have we had anything like this in Melbourne before?I dont think weve ever had a tomato festival in Melbourne. Its all about the celebration of the wonderful Italian culture thats been bestowed upon our city and how we do it as Melbournese.

    Is it based on the Italian tradition of making passata (tomato puree) at the end of summer?When the tomatoes are harvested, thats when you put all the sauce into the bottles so that youve got those lovely bursts of taste over the winter months. Its about maintaining those traditions.

    What tomato varieties are good for making pasta sauce?San Marzano and a really good Roma. Theyre the things people will learn; the varieties and how to do it (make sauce).

    Why is Farm Vigan the best location?It has a cultural significance due to its migrant heritage and we had a personal connection to its history. Its a great setting for that sort of thing. Its picturesque. It has a lovely outlook.

    Who is the festival geared to?People who care about their food and where it comes from, people who want to learn new things, people who like to get together to have fun, and people who like to try new foods and enjoy a good wine.

    Apart from local chefs, what are some of the highlights?We have some great guest speakers coming to talk about growing food and the history of the tomato, a panel discussion on the future of food in Australia and agriculture, and all that sort of thing. There will be fresh produce and food vendors selling risotto, pasta, pizza and meatballs (just to mention a few). We have Fabrizia Lanza coming from Tasca dAlmerita Wines in Sicily.

    The Melbourne Tomato festival will be held on Sunday, March 1, from10.00am to 6pm at Farm Vigano, 10 Bushmans Way, South Morang. Adults $25, children aged 6 to 13 $10, children under 5 free.Book at: melbournetomatofestival.com

    dyob.com.au/whittlesea farmvigano.com.au melbournetomatofestival.com grossi.com.au

    WHERE TO GO \ WHITTLESEA

    What better venue for the first Melbourne Tomato Festival than Farm Vigan? Italian restaurateur Mario Vigan and his wife, Teresa, lived at the South Morang farm from 1934 until Mario died in 1966. For 30 years they ran Melbournes famous Marios restaurant and grew produce at the farm,now a restaurant and function centre.

    Among Marios chefs was Italian migrant Pietro Grossi, father of Grossi Restaurants founder and My Kitchen Rules chef, Guy Grossi. Now a Farm Vigan patron, Guy Grossi and his family created the festival with support from the City of Whittlesea, Mint Inc, Friends of Farm Vigan and Punt Road Winery. It will feature cooking demonstrations by Guy Grossi, Frank Camorra, Rosa Mitchell, Karen Martini, Glenn Laurie and Dani Valent, passata making with Home Make It, gardening workshops, childrens activities, a small Melbourne farmers market, produce stalls, talks, panel discussions and Italian street food.

    FARM VIGAN

    IN THE KNOWCHERYL CRITCHLEY CHATS WITH CELEBRITY CHEF AND RESTAURATEUR, GUY GROSSI

    BOUGHT TO YOU BY PROUDLY SUPPORTED BY

    HOME BAKED

    CHEESEMAJESTICHISTORICSCENIC

    Loredana Grossi

  • NEWS NORTHERN.STARWEEKLY.COM.AU

    10 NORTHERN STAR WEEKLY \ FEBRUARY 17, 2015

    Family Fete Family Fete On

    Saturday 21st February From

    10am-3pm

    14 South Circular Rd, Gladstone Park

    All are Welcome

    Bring the whole family and enjoy some light shopping through out various stalls with Plants, Jewellery, Baked goods, Bric & Brac, and hand made Ornaments and Toiletries from our lovely

    residents, plus much more. Afterwards have a seat in our secure courtyard

    to enjoy some lovely music and a nice chit chat.

    Is celebrating 35 years of providing quality care Is celebrating 35 years of providing quality care to the elderly citizens of the communality.

    By presenting a

    1173317-CB8-15 10022782-01

    COMMUNITY CALENDARWANT YOUR EVENT LISTED? Community Calendar is made available free of charge to not-for-prot organisations to keep the public informed of special events and activities. Send item details to Star Weekly Community Calendar, Corner Thomsons Road and Keilor Park Drive, Keilor Park, 3042, or email to [email protected]. Deadline for copy and announcements is noon Tuesday.

    Craigieburn art on showCraigieburn Art Group is holding its 25th exhibition at the Craigieburn function rooms, 127 Craigieburn Road West, on Saturday, February 28, and Sunday, March1, 10am until 5pm. Admission is free and artists will give demonstrations from 11am on both days. Kathy, 9306 8600

    Grow your own foodBack by popular demand, electricity distributor Jemena and Landcare Australia are hosting a free Live. Grow. Explore. community day for its third year. Star of the show will be TV gardener Vasili Kanidiadis and therell be a feast of family fun; free food; and environmental and energy awareness workshops. Interact and learn on the sustainability trail, with great prizes. Its at Living Legends at Woodlands Historic Park, Oaklands Road, Greenvale, on Sunday, March 15, 11am-4pm. www.landcareonline.com.au

    Playgroup and occasional careThe new Galada kindergarten at 10a Forum Way, Epping North (in Aurora estate), is now open. Enrol your child in a playgroup or for occasional care. Places are limited. Geny, 9407 6205 or [email protected]

    Thomastown by twilightThe Totally Thomastown Twilight Market is on February 27, 4-8pm, with food and craft stalls, live music, free childrens activities.

    Thanks for askingFirst Impressions Youth Theatre will perform its latest work, Thanks for Asking, Thanks for Asking, Thanks for Askingstarting February 26 at Woodstock Theatre, South Morang. The show evolved from young members asking: What is something you never get asked but would like to be? 9217 2174.

    (Thi

    nkst

    ock)

    Stallholders wanted. Apply at www.tnh.org.au or email [email protected] Justine, 8376 6939

    Stay cool Find out low-cost ways to keep your home cooler through summer, including low-cost

    options for renters, on February 17. Learn how to keep heat out, different shading options and staying cool without relying on an air-conditioner. Energy saving freebies will be handed out. At The Age Library, 1093 Pascoe Vale Road, Broadmeadows. 9205 2473

    Back to black and whiteVisit the National Seniors Greensborough branch on Tuesday, February 17, 10am, at Greensborough RSL, 111 Main Street, where Dorothy Baker will speak about her television experiences in the mediums early days. Bookings not required. All over-50s are welcome. David, 9459 0653

    Get babies on trackHaving trouble feeding your baby? Come to Whittlesea councils drop-in sessions for parents on Mondays, Wednesdays and Fridays at Epping, Epping North and Mernda, and get advice from a health professional. No appointment required. 9404 8888 or email [email protected].

    Sustain our suburbsJoin the celebration that helps sustain a nation this February. Its the Sustainable Living Festival, running all around Victoria until February 28. Hume council is hosting several sustainability events this month, highlighting its Enviro Champions program. For more details go to www.slf.org.au. 9341 6510 or www.hume.vic.gov.au

    WIN THIS

    Captain Barnacles and his trusty crew join forces with a host of colourful Australian reef-dwellers on a mission to save the Great Barrier Reef in Octonauts Live! Operation Reef Shieldat Melbournes Comedy Theatre from March 12-14. Dont miss this all-new musical adventure live on stage for the rst time this year; visit www.octonautslive.com.au. Enter now for a chance to win one of two family passes (admits four), each valued at $208.

    To enter, visit winthisnow.com.au and follow the prompts. Entries close on Sunday, February 22, at 11.59pm and will be drawn at 10am next day at the ofces of MMP Group, 214 Park Street, South Melbourne, VIC, 3205. Winners will be notied in writing and their names published at winthisnow.com.au. Terms and conditions are available at winthisnow.com.au.

  • 11 NORTHERN STAR WEEKLY \ FEBRUARY 17, 2015

    Employmentsection of Network Classifi eds.

    Call or visit us online!networkclassifi eds.com.au

    G6280824AA

    -dc10S

    ep

    CARPET STEAM &DOMESTIC CLEANINGOffice & Car cleaning

    G6280824AA

    -dc10S

    ep$25per roomper roomor seatMob: 0418 180 020 Tel 9264 1802Mob: 0418 180 020 Tel 9264 1802 G6280

    824A

    A-dc10Se

    p

    All work guaranteedMob: 0418 180 020 Tel 9264 1802

    All work guaranteedMob: 0418 180 020 Tel 9264 1802

    V Carpet CleaningALL VIC REMOVALS & STORAGEALL VIC REMOVALS & STORAGE

    Cheap boxes 4 salePacking, Pianos, Antiques and Billiard Tables, Local, Country & Interstate.

    No job too small. Unwanted goods, or rubbish taken to tip.All areas from $89p/h (min 2 hours), 24 hours/7 days

    9310 1070 - 0403 046 998

    G6616651AA-dc11Feb

    1156

    306-HM40

    -14

    1156

    303-HM40

    -14

    MICHAEL LEE REMOVALSt-PDBMDPVOUSZJOUFSTUBUFt)PNF0GmDF

    t1JBOP"OUJRVFTt1SFQBDLJOHt'SJFOEMZSFMJBCMF4FSWJDF

    0427 522 030 or 9437 7370XXXNJDIBFMMFFSFNPWBMTDPNBV G67

    94573A

    A-dc29Ap

    r

    1132

    382-RC

    19-14

    V PlumbingTotal BathroomRenovations

    G663

    9422

    AA-dc15A

    prG6

    6394

    22AA

    -dc15A

    pr

    TOTAL QUALITY BATHROOMS AT AN AFFORDABLE COST.

    Mark 0411 860 973www.tbr.net.au

    Pensioner Discount FREE QUOTES

    V Furniture RemovalsA GRADE ELECTRICIANAll work guaranteed - Reasonable rates - Free quotes.Rewires, new Installations, Safety switches, Smoke Detectors, Sensor lights. Ceiling & Exhaust fans.

    Phone Geoff Roach0412 434 529 or 9370 8130

    REC.10991

    G6461642AA-dc19Nov

    V Bathroom & KitchensV Electricians

    TopRate FloorsSpecialising in:

    Sanding, Polishing and repairs of all timber floors.Fast free quotes, Top quality workmanship at Mates Rates

    Phone 0412 488 732G6581136G65811361163330-HM47-14

    V Floor Services PEST & TERMITE CONTROLCall 7 days for a free quote

    1300 699 6980418 280 391

    15 years experience Eftpos facilities available

    G6280727AA

    -dc10S

    ep

    12 years experience. Slate Stencil Latest Designs Exposed Aggregate Plain concrete Colour concrete

    Call for a free quote and reasonable pricesCall Joe 0405 140 571

    or 9390 9476

    CONCRETINGTop Notch

    G6275730AA-dc3Sep

    V Pest Control

    Guaranteed Lowest PricesFACTORY DIRECT G6

    252873AA

    -dc27A

    ugG6

    252873AA

    -dc27A

    ug

    Designer Quality at Factory PricesFor a Free Quote PH: 9379 0123

    V Awnings, Blinds & Curtains

    G6531515AA

    -dc21JanGeorges Fencing

    Timber Paling Colorbond Picket Fencing

    For an obligation free quote call George on...Mob: 0415 457 379 Ph: 9324 5844

    V Fencing & Gates A DEPENDABLELOCKSMITH

    s,OCKSOPENEDs,OCKSREPAIREDs#OMBINATIONSCHANGEDs,OCKSSUPPLIEDANDlTTED

    Pensioner discounts0LEASECALLs,/#+)4

    LOCKST ROCKST ROCKST ROCKST R11

    6245

    8-HM

    46-14

    Rowland Concreting;nfei[Z7]]h[]Wj[9ebekhFbW_dIbWj[

    Ij[dY_bH[i[Wb_d]I^[ZIbWXi7dZWbb7if[Yjie\BWdZiYWf_d]

    No Obligation,FREE Quote

    Contact Trevor on:0417 997 060 1133

    020-HM19

    -14

    V LocksmithsV Concrete Products & Services

    7DAYS A WEEK

    **Local Technicians On STAND-BY**FREE TV Point with NEW Antenna InstallFREE TV Lead with NEW TV PointFREE Signal Strength TestingHOME THEATRE InstallationsBlackSpot SpecialistsEXTRA TV PointsLCD TV Mounting

    Call Matt:

    www.aerials.net.au

    0478 297 148FREEQUOTES

    1158

    584-KC

    42-14

    V Antennas

    1156

    305-HM40

    -14

    Carpet Steam Cleaning4 ROOMS FROM $65 min

    Call Paul 0412 816 479

    FLETCHERSCARPET CLEANINGABN 92 465 717 255

    18 Years Experience

    BASED ON LOCATIONUPHOLSTERY CLEANINGFREE DEODORISING

    *conditions apply

    1148

    125-HM

    32-14

    V ElectriciansV Carpet Cleaning24 HOUR EMERGENCY SERVICE24 HOUR EMERGENCY SERVICE24 HOUR EMERGENCY SERVICE

    Free Call: 1300 666 701

    24 HOUR EMERGENCY SERVICE24 HOUR EMERGEN24 HOUR EMERGENCY SERVICE24 HOUR EMERGEN24 HOUR EMERGEN

    Shop fronts Doors Windows Splashbacks

    Table Tops Shower Screens Mirrors Insurance Claims

    Glass Partitions Specialising In

    www.aaaglass.com.au

    G633

    5255

    AA-dc1Oc

    t

    Vivid Glass & GlazingVivid Glass & GlazingVivid Glass & GlazingVivid Glass & GlazingVivid Glass & GlazingVivid Glass & GlazingVivid Glass & GlazingVivid Glass & GlazingVivid Glass & GlazingVivid Glass & GlazingVivid Glass & GlazingVivid Glass & GlazingVivid Glass & GlazingVivid Glass & GlazingVivid Glass & GlazingVivid Glass & GlazingVivid Glass & GlazingVivid Glass & GlazingVivid Glass & GlazingVivid Glass & Glazing

    G6689043AA-dc18MarG6689043AA-dc18Mar

    For all your glass needsFor all your glass needst#SPLFOXJOEPXTSFQBJSFEt(MBTTSFQMBDFNFOUt4QMBTICBDLTt(MBTTUBCMFUPQTt.JSSPSTt1FUEPPST1I0412 101 421&[email protected]@gmail.com

    ay

    Specialising in:s%VAPORATIVE#OOLINGs!DDON2EFRIGERATED#OOLING

    s2EVERSE#YCLE7ALL(UNG3PLIT3YSTEMs2EVERSE#YCLE3PLIT$UCTED3YSTEM!2#!5WE COME TO YOU FOR ALL YOUR COOLING NEEDS

    For free quotes call now: 1300 550 901

    1153

    601-PB37

    -14

    V Air Conditioning

    1148

    589-CG36

    -14

    V Glass/Glazing

    Call 9379 5381 0411 136 259

    Spring SpecialsBOBS YOUR UNCLE

    Old fashioned gardening, rubbish & treesPENSIONER DISCOUNTS FREE ESTIMATES

    1153

    586-LB

    37-14

    AbsoluteGarden and Landscaping

    20% off first service - Fully Insuredwww.absolutegarden.com.au

    Gardening: s(EDGINGs0RUNINGs4REELOPPINGs'ARDENCLEANUPS

    Landscaping:s'ARDENMAKEOVERSs.EWHOMES

    s4IMBERRETAININGWALLSs$ECKINGs'ARDENBEDTOPPINGSs,ILYDALEs3PRINKLERSYSTEMSs4URF

    Phone Paul for a quote on 0419 799 999

    1163

    488-RC46

    -14Placing your classified

    advert is so easy...Phone: 1300 666 808 (Open 8.30-5pm Mon-Fri)Fax: 03 5945 0667Email: [email protected](include your name, address and phone number)

    Mail: Network Classifieds, PO Box 9, Pakenham VIC 3810

    We accept payment by: VISA/MASTERCARD/EFTPOS(1.5% credit card processing fee applies. Cheques and money orders can be posted in or hand delivered to our local office)

    Ask about our discounted ongoing advertising rates and how choosing more newspapers gives your advertising more

    impact and saves you money...

    DEADLINESTrades: 4pm ThursdayClassifieds: 3pm FridayWheel & Deal: 3pm Friday

    1136

    027-RC21

    -14

    V Garden ServicesV Deadline

    1173

    146-LB

    07-15

    Connecting People and Communities.

    Grow your business with Trades and

    Services

    Call 1300 666 808

    From plumbers to pest control, carpet cleaning to building services, dry From plumbers to pest control, carpet cleaning to building services, dry From plumbers to pest control, carpet cleaning to building services, dry cleaning to computer repairs, lawn mowing and more, Northern Star Weekly has been connecting local businesses with the local community with our Trades and Services each week.

    Speak to our classified team and find out how easy it is to advertise. Start building your brand today and be seen every week in Northern Star Weekly Trades and Services.

    We advertise in the We advertise in the We advertise in the We advertise in the We advertise in the We advertise in the We advertise in the We advertise in the We advertise in the We advertise in the We advertise in the We advertise in the We advertise in the We advertise in the We advertise in the We advertise in the We advertise in the We advertise in the We advertise in the We advertise in the We advertise in the We advertise in the We advertise in the We advertise in the We advertise in the We advertise in the We advertise in the We advertise in the We advertise in the We advertise in the We advertise in the We advertise in the We advertise in the We advertise in the We advertise in the We advertise in the We advertise in the We advertise in the We advertise in the We advertise in the We advertise in the We advertise in the We advertise in the We advertise in the We advertise in the We advertise in the We advertise in the We advertise in the We advertise in the We advertise in the We advertise in the We advertise in the We advertise in the

    Northern Star Weekly Northern Star Weekly Northern Star Weekly Northern Star Weekly Northern Star Weekly Northern Star Weekly Northern Star Weekly Northern Star Weekly Northern Star Weekly Northern Star Weekly Northern Star Weekly Northern Star Weekly Northern Star Weekly Northern Star Weekly Northern Star Weekly Northern Star Weekly Northern Star Weekly Northern Star Weekly Northern Star Weekly Northern Star Weekly Northern Star Weekly Northern Star Weekly Northern Star Weekly Northern Star Weekly Northern Star Weekly Northern Star Weekly Northern Star Weekly Northern Star Weekly Northern Star Weekly Northern Star Weekly Northern Star Weekly Northern Star Weekly Northern Star Weekly Northern Star Weekly Northern Star Weekly Northern Star Weekly Northern Star Weekly Northern Star Weekly Northern Star Weekly Northern Star Weekly Northern Star Weekly Northern Star Weekly Northern Star Weekly Northern Star Weekly Northern Star Weekly Northern Star Weekly Northern Star Weekly Northern Star Weekly

    because it brings because it brings because it brings because it brings because it brings because it brings because it brings because it brings because it brings because it brings because it brings because it brings because it brings because it brings because it brings because it brings because it brings because it brings because it brings because it brings because it brings because it brings because it brings because it brings because it brings because it brings because it brings because it brings because it brings because it brings because it brings because it brings because it brings because it brings because it brings

    local businesss to local businesss to local businesss to local businesss to local businesss to local businesss to local businesss to local businesss to local businesss to local businesss to local businesss to local businesss to local businesss to local businesss to local businesss to local businesss to local businesss to local businesss to local businesss to local businesss to local businesss to local businesss to local businesss to local businesss to local businesss to local businesss to local businesss to local businesss to local businesss to

    the attention of local the attention of local the attention of local the attention of local the attention of local the attention of local the attention of local the attention of local the attention of local the attention of local the attention of local the attention of local the attention of local the attention of local the attention of local the attention of local the attention of local the attention of local the attention of local the attention of local the attention of local the attention of local the attention of local the attention of local the attention of local

    residents - Anthonyresidents - Anthonyresidents - Anthonyresidents - Anthonyresidents - Anthonyresidents - Anthonyresidents - Anthonyresidents - Anthonyresidents - Anthonyresidents - Anthonyresidents - Anthonyresidents - Anthonyresidents - Anthonyresidents - Anthonyresidents - Anthonyresidents - Anthonyresidents - Anthonyresidents - Anthony

    1148

    589-CG36

    -14

    Trades & Services

  • 12 NORTHERN STAR WEEKLY \ FEBRUARY 17, 2015

    Want to place an ad but not sure where to start?Call our helpful classifi ed team between 8:30am-5pm

    Mon-Fri for FREE advice!FREE advice!FREE

    YOUR LOCAL TAXI SERVICE

    9310 5422

    G6022281AA

    -dc18Jun

    G6022281AA

    -dc18Jun

    V Car/TruckRentals

    Generalsection of Network Classifi eds.section of Network Classifi eds.section of Network Classifi

    Find it in the

    Employment

    The Right C ?9DO YOU HAVEDO YOU HAVE

    Is your ResumeSuccessful?Get the interviews

    for the job YOU WANT!Money back guarantee

    Call Carolyn onMob: 0431 304 296

    Mobile Service

    G6582293AA

    -dc21Jan

    V Resumes/EmploymentServices

    Qualified ChefRequired for a busy

    Western Suburbsalacarte restaurant

    Various shifts available.Must have own

    transport.Please call

    0437 319 614

    DISCRIMINATION INADVERTISING IS UNLAWFULThe Victorian Equal Opportunity Act 1995 makes itunlawful for an advertiser to show any intention to

    discriminate on the basis of sex, pregnancy, race, age,marital status, political or religious belief or physical

    features, disability, lawful sexual activity/sexualorientation, HIV/AIDS status or on the basis of being

    associated with a person with one of the abovecharacteristics, unless covered by an exception under

    the Act. As Network Classifieds could be legally liable ifan unlawful advertisement is printed, Network

    Classifieds will not accept advertisements that appearto break the law. For more information about

    discrimination in advertising, contact your legal advisersor the Equal Opportunity Commission.

    1133052-LB19-14

    V Positions Vacant V ProfessionalV Wardrobes

    HOME BASED INCOME, earnmore money, more time,$0-$10K plus with a simplepart time opportunity. 0402031 395.

    Wait StaffRequired for a busy

    Western Suburbsalacarte restaurant

    Casual positionavailable. Must have

    own transport.Please call

    0437 319 614

    G6668339AA

    -dc4Mar

    D n A Security DoorsFree measure & quotes9337 2403 or Dave 0411 205 313

    Quality Security Doors and Fly Screenswww.dnasecuritydoors.com

    Trades & Servicessection of Network Classifi eds.

    V Security & Screen DoorsCarpet

    Steam CleanerEarn up $3,000 pw. No exp.necessary. Full training. Worksupplied daily. For further info.9826 1111 or 0415 326 685

    HR DriverHR Licenced Driver required for

    busy skip bin company. Musthave road ranger gear-boxexperience. Send email to:

    [email protected]

    V BusinessOpportunities

    V Positions VacantAARONS TILING

    Over 30 Years Experience Specialising In: Floor & Wall Tiles Old & New Homes

    Kitchen & Bathroom Renovation Free Measure & Quote.

    0432 774 645 G672

    3428

    AA-dc29A

    pr

    EmploymentV Tiling

    CHIHUAHUA PUPPY, born 23/10/14, innoculated, microchippedand wormed. 982000363088847. $850. 0405 555 443.

    V Pets & Services

    ADVERTISERS, in this section arequalified practitioners and offernon-sexual services.

    V MassageTherapists

    C1046377-KG34-12

    C1046377-KG34-12

    Manual/electric & remote control operated with smoke alarm & manual override

    Factory/ShowroomKealba

    2 Malcolm Court, Kealba, Vic 3021Tel: 9364 2232

    Epping494 High Street,Epping, Vic 3076Tel: 9401 2232

    G6220211AA

    -dc20A

    ugANCHOR SECURITY DOORS

    Still the BestQUALITYSERVICE

    LOW PRICES

    9338 24379338 2944Cnr. Keilor Park Dve &Tullamarine Park Rd

    www.doorsbyanchor.com

    5 FLYSCREENS

    FROM$25

    V Roller Shutters NATURAL PLUS7 days, 9.30am - 9.30pm.5 City Place, Sunshine.

    Phone 9311 0198.

    V Security & Screen Doors DAY63(&,$/6

    ManhattanTerrace

    554-556 Swanston St, Melbourne

    Open 24 hrs - 7 days

    03 9347 6000(2hr meter parking out front)

    Girls always available

    SWA4281be

    &%'%URWKHO

    2SHQKRXUV11

    7057

    9-RC

    05-15

    Full Body MassageRELAXATION

    219 Ascot Vale Rd, 3032.9004 1477 or 0487 097 290.

    ARE U BI CURIOUSWHATEVER Try a sensual malebody rub by an attractivefriendly guy. 0402 640 397swa1159xe.

    V Health AndFitnessMYRUF ROOFINGRoof Repairs & Restorations.

    Rebedding & Flexible Repointing.FREE QUOTES 0413 400 324

    G6515965AA-dc25Feb1173767-LB08-15 Email: [email protected]: [email protected]

    V Adult Services

    V RoofingALL AROUNDREBLOCKING & UNDERPINNINGREBLOCKING & UNDERPINNINGREBLOCKING & UNDERPINNING

    Tel: 9309 2351Tel: 9309 2351Tel: 9309 2351Tel: 9309 2351Tel: 9309 2351Tel: 9309 2351Tel: 9309 2351Tel: 9309 2351Tel: 9309 2351Tel: 9309 2351Tel: 9309 2351Tel: 9309 2351Tel: 9309 2351Tel: 9309 2351Tel: 9309 2351Tel: 9309 2351Tel: 9309 2351Tel: 9309 2351Tel: 9309 2351Tel: 9309 2351Tel: 9309 2351Tel: 9309 2351

    Free Quote Free Quote 17 Years Guarantee 17 Years Guarantee All Suburbs All Suburbs 10% Pensioner Discount10% Pensioner Discount Insurance Insurance Insurance Council Permit Supplied Council Permit Supplied Elevation Computer Levelling

    977914

    DB-L-29449DB-L-29449

    177646 David: 0425 811 882 Ash: 0403 619 333

    G6519072AA-dc21JanG6519072AA-dc21Jan

    CLAIRVOYANT Tarot card read-ings etc. Past, present, future.All you wish to know and muchmore. I can help with problems,jealousy, marriage and bad luck.Please call 9354 8440. Coburg.

    V Clairvoyant/Psychic

    1136373-RC22-14

    Phone - 1300 Escort1300 372 678.

    24hrs/7 days. swa4281be.

    FIVE STAR REBLOCKING & UNDERPINNING

    Full Insurance All work Council approved 15 years guarantee All Council permits supplied 100% computer levelling Concrete pump used 15 years experience For a free quote and advice

    Contact Simon:9309 0700 - 0411 174 000

    5

    STARG6

    638324AA

    -dc18Feb

    ALL FETISH! Anything goes!from 99c/min 1300 700 904

    1902 226 323 Chat now!$5.45/min pay/mob extra

    V Reblocking/Underpinning Ishimpo.com.auSensual erotic body works.

    Nuru Tantra. Fitzroy. 9415 7762.swa7930xbe.

    V Adult PhoneTalk

    ALL ADVERTISEMENTS bookedunder this classification arestrictly for ancillary roles only.To comply with the law it is stillan offence under the Sex WorkAct 1994 to publish anystatements intended or likely toinduce a person to seek work asa sex worker.

    1173250-CB8-15

    G6581233AA

    -dc21Jan

    VANTAGE PLUMBING & MAINTENANCELic N.O: 37409

    CALL MAURICE FOR A FREE QUOTE0432 501 802

    24 Hours Service 7 days a week Plumbing & Drainage

    Domestic Service & Maintenance Hot Water Services Seniors Discounts

    [email protected]

    SECURE WINDOW ROLLER SHUTTERS

    Value for Money Shutters

    Hot Special Price1.8 x 1.8 *$598, ManualMotorised $698 plus GST

    (using Shinilion motor)*Must purchase minimum 3 shutters

    Call 1800 554 877Or visit our showroom:

    7/112 Main Road East, St Albans/Kealba(Beside United Service Station)

    www.securewindowrollershutters.com.au

    1172

    803-DJ

    08-15

    Far Eastern RelaxationAffordable PricesAffordable Prices

    FromFrom

    $65$65 Discreet RearDiscreet RearParkingCREDIT CARDS & EFTPOS WELCOMECREDIT CARDS & EFTPOS WELCOME

    Ladies Warmly WelcomedMEL REF: P43 B1 / Tram 57 Stop 22MEL REF: P43 B1 / Tram 57 Stop 22

    SWA 6143BSWA 6143B

    77Racecourse Rd, NthMelbourne77Racecourse Rd, NthMelbourne 9326 83889326 8388 2030574v2

    1145

    621-PB

    30-14

    V Situations WantedV Plumbing V Roller Shutters V AdultEmployment

    V Adult Services

    Trades & Services General Classifi eds Employment

  • 13 NORTHERN STAR WEEKLY \ FEBRUARY 17, 2015

    SPORT

    By Tara Murray

    A determined innings from Greenvale Kangaroos captain James Lidgett wasnt enough to get his side over the line against Monash Tigers in Premier Cricket.

    Lidgett came to the crease at 2-59 and was the backbone of an innings that ultimately fell 28 runs short of victory.

    e captain made 71 from 185 balls before being last man out when the score was 239, chasing 256.

    Wicketkeeper Ben Cox contributed 48 in the middle order, while the bottom order all stayed at the crease for vital overs supporting Lidgett.

    In the Victorian Turf Cricket Association senior division, Greenvale and Tullamarine split their weekend matches.

    On Saturday, the Kangaroos lost their two-day clash against St Bernards.

    Chasing 165, the Kangaroos were restricted to 117. St Bernards then made 222 in its second innings before the Kangaroos nished the day at 2-15.

    In Sundays make-up match, the Kangaroos defeated Hampton whose 142 was chased down by the Roos with two wickets in hand.

    Bentleigh hauled in Tullamarines 154 with ease, taking rst innings points with only three wickets down in their two-day match.

    On Sunday, Tullamarine defeated McKinnon, which, batting rst, managed just 138. Tullamarine tallied 6-151 in reply.

    In north division, Westmeadows and Altona North shared the points, as the teams drew their two-day match. Chasing 221, Westmeadows was 8-151 at stumps.

    In Sundays make-up match, Westmeadows was thrashed by Keilor Park. Needing 160 for victory, the Meadows was skittled for 83.

    Craigieburn was a big winner in North A1, winning both its Saturday and Sunday matches. With less than four points separating the top six teams going into the weekend, Craigieburns defeat of St Albans in its two-day clash was followed up by victory against Glenroy on Sunday.

    Against St Albans, Craigieburns lower- order batsmen saved the day. Resuming at 7-78, Craigieburn passed the total on its way to 121. In the one-day match against Glenroy, Craigieburn nished 9-183 aer chasing down Glenroys 8-178.

    In B1, Jacana sits second on the ladder despite losing to Pascoe Vale Sports.

    Jacana was never in the game as Pascoe Vale Sports passed the total with four wickets down. It nished the day at 5-102.

    Captains knock in vain

    Greenvales wicketkeeper Ben Cox made 48 in the Kangaroos innings. (Shawn Smits)

    It will be a new look Jacana on and o the eld in the Essendon District Football Leagues division 2 this season.

    A new coach appointed in the o-season has been followed by a number of changes in key football roles and players.

    New coach Aaron Collins said that aer a slow start to the pre-season, the Jaguars now had all guns blazing as the season drew nearer.

    Collins replaced Matthew Sacco, who planned to take a year o from football but has since been appointed coach at Longwood.

    It started slowly, but it is really good now, Collins said. A lot of them were playing cricket, so we changed the training nights and now we get more numbers to training.

    Were getting 40-50 each night and there are a lot of new faces.

    Collins said more players wanted to play at the club.

    We had the footy department signing contracts for two hours the other night, he said. People want to play for Jacana.

    ere are 15 new faces that can go straight into the rsts, so it gives us a lot of depth.

    Among the signings is Dylan Wolfgramm who has previously played with Avondale Heights, Matthew ORourke and Eppings Jake Wilkinson.

    Returning to the club is young gun Beau Naim, who won the EDFLs division 2 best and fairest award in 2013

    Another who will pull on the boots for the Jaguars is three-time Brisbane Lions AFL premiership player Chris Johnson, who played six games with the club last year.

    Hes going to help out and he has bought some A-grade players to the club, Collins said. Hell play when he can and he has been a real mentor for me and has lots of experience to pass on.

    Brian Bell, Brett Caton and Bradley Cunningham have decided to return to Diggers Rest, while Daniel Sacco has followed his cousin to Longwood.

    Collins, who was assistant coach last season, is loving the challenge of stepping up to the top role.

    Its really good and an exciting challenge in the senior role. We have new runners, new team manager . . . we have the right people in place.

    Tara Murray

    New-look Jags on both sidesof the line

    Craigieburn family makes a pitch for cricket historyCraigieburns Mitchell Kermath couldnt believe his ears when his mum Sue called him on ursday night to tell him his cricket clubs team selections for the weekend.

    Not being available for day two of the two-day match in the clubs top grades, Mitch thought he would have the weekend o.

    e club had other ideas and in the process, Mitchell, Sue and Ray Kermath made history.

    Mum called from the club to say that herself, dad and I would be playing in the same team on Saturday, Mitchell said.

    I asked, Are you sure? she said, Yes, which was pretty exciting.

    e three played in Craigieburns North West Metropolitan Cricket Associations Barry Clissold Shield side against Pascoe Vale Sports

    Club. Ray, who is in his second year at the club, normally plays in the side, while Sue plays for the club womens team and lls in for the mens XI when shes needed.

    Sue is in her third year at the club aer initially oering to be a substitute elder.

    Fittingly, there were two of the Kermaths at the crease when the winning runs were hit.

    I ended up batting with dad at the end of the innings, Mitchell said.

    I nished 64 not out, while dad was nought not out.

    Mum was in next. I think she was hoping dad would go out so we could bat together, too.

    Mitchell said the match was one of his career highlights.

    Ray, Sue and Mitchell Kermath a cricket family affair. (Supplied)

    It denitely is as its likely to be a one-o, he said. Its the rst time Ive played with either of them.

    Craigieburn secretary Mike Brown said it was special for the club to be able to let the three play together.

    Sue and Ray have played together previously and when we were looking at the players for the side, we thought it would be a nice touch for all three to play together.

    A lot of people were surprised by the decision but understood once we explained Mitch couldnt play in his normal side.

    Weve had father and sons play together, but this is unique.

    Tara Murray

  • SPORT NORTHERN.STARWEEKLY.COM.AU

    14 NORTHERN STAR WEEKLY \ FEBRUARY 17, 2015

    SCOREBOARD Q BOWLSBOWLS VICTORIA SATURDASATURDASA Y TURDAY TURDA METROPOLITAN METROPOLITAN METROPOLIT PENNANT: Rd 17: Premier Div ALTONA ALTONA AL 16-80 bt MCC KEWSPORTS 2-61 (S Fordham 23 bt G Ball 12 B Peck18 bt C Ball 16 B Foley 14 lost to C Mills 20 M Rennex 25 bt P Peruaz 13), BUNDOORA RSL 16-92bt YARRA YARRA Y GLEN 2-77 (A Galloway 25 bt T Stafford16 D Di Florio 25 bt M Creighton 13 N McIntyre 12lost to S Smith 28 B Spurr 30 bt G McBride 20),MOONEE PONDS 2-63 lost to MENTONE 16-97(D Murphy 13 lost to D Rushton 22 A Crowle 22 btB McCallum 11 E Pistoni 15 lost to C TwentymanTwentymanT26 J Hubber 13 lost to D Jones 38), CLAYTON CLAYTON CLA 16-84 bt MELBOURNE 2-71 (D Benwell 14 lost to G Hopwood 18 L Adams 27 bt R Green 18 D Holt 23bt B Leighton 16 G Archer 20 bt D Hoareau 19),ESSENDON 18-132 bt BRIGHTON 0-48 (A Flapper22 bt I Hosken 18 P Loe 38 bt F DAgostino 11 M Strochnetter 34 bt A Alexandrou 9 N Wilson 38 btP Kennedy 10). Div 1: Sec 1: Deer Pk (1) 18-101Fern Gul (1) 0-65, Burw Dist (1) 0-66 MCC (2) 18-84, Keys (1) 4-64 Bund RSL (2) 14-78, Whitt (1)9-79 Mitch (1) 9-79, Bright (2) 18-90 Croy (1) 0-48.Sec 2: Lal (2) 17-91 Alt (2) 1-61, Ber (1) 4-60 Wbee(1) 14-91, Elth (1) 2-74 Donv (1) 16-75, Lily (1) 14-86 Ess (2) 4-73, Elst Clb (1) 9-0 Melton (1) 9-0. Div1: Sec 3: Burd Pk (1) 2-71 Rich Uni (1) 16-85, Ment(2) 18-144 Lal (1) 0-38, St Kil (1) 4-69 Chelt (1)14-83, Edith (1) 0-66 Yarra/Foot Yarra/Foot Y (1) 18-80, MoonVal (1) 16-76 Glenr (1) 2-71. Sec 4: MCC (1) 18-83 Cran (1) 0-60, Heathm (1) 16-85 Ring (1) 2-74,Kings (1) 2-75 Fitz Vic (1) 16-80, Mulg CC (1) 12-80Glen Wav (1) 6-79. Div 2: Sec 1: Werribee (2) 3-70Sunb (1) 15-86, Rosam (1) 15-85 Suns C (1) 3-67,Yarr/Foot Yarr/Foot Y (2) 0-65 Hopp (1) 18-82, Melton (2) 0-61Will (1) 18-100, Alt Sports (1) 14-88 Flem/Kens (1)4-73. Sec 2: Pres-Res (1) 4-66 Broad (1) 14-80, W Cob (1) 12-75 Keil (1) 6-74, Buck Pk (1) 2-62 Craig(1) 16-102, Glenr (2) 16-98 Strath (1) 2-47, FitzVic (2) 2-64 Ess (3) 16-88. Sec 3: MCC (3) 16-93Heid Golf (1) 2-57, Rich Uni (2) 9-0 Green (1) 9-0,Rosan (1) 4-69 Bund RSL (3) 14-75, C of Heid (1)4-77 Ivan (1) 14-80, Montm (1) 16-85 Dare C (1)2-75. Sec 4: Warb (1) 18-105 Burw Dist (2) 0-65,Bays (1) 16-99 Chirn Pk (1) 2-51, Moorool (1) 18-95Montm (2) 0-50, Yarr Yarr Y Glen (2) 4-73 Elth (2) 14-91,Hurst (1) 16-100 Lily (2) 2-68. Sec 5: Mt Wav (1)2-68 Heathm (2) 16-96, Up Tec Tec T (1) 16-83 Black (1)2-60, Mitch (2) 2-62 Verm Sth (1) 16-70, Ash (1)2-74 Monb (1) 16-87, Camb Cent (1) 16-90 BurwDist (3) 2-65. Sec 6: Black (2) 16-71 Ber (2) 2-69,Melb (2) 2-67 Coates (1) 16-95, Glen Wav (2) 9-0SOC (1) 9-0, Verm Sth (2) 3-73 Clay (2) 15-84. Sec7: Hamp Park (1) 4-74 Cran RSL (1) 14-97, Cran (2)14-82 Burd Pk (2) 4-70, Nar War (1) 18-98 MulgCC (2) 0-62, Clay (3) 16-87 Ber (3) 2-65, Mord (1)16-89 Pak (2) 2-59. Sec 8: Glen E-McK (1) 2-75 MidPk (1) 16-86, Bent (1) 18-103 Ment (3) 0-45, Hamp(1) 18-117 Bright (3) 0-47, Albert Pk (1) 4-91 Melb(3) 14-95, Chelt (2) 16-83 Elst Pk (1) 2-66, Div3: Sec 1: Foots Pk (1) 16-109 Suns RSL (1) 2-55,Wbee (3) 4-63 Moon Pds (2) 14-88, Will (2) 0-55Alt (3) 18-103, Port Melb (1) 16-78 New (1) 2-65,Hopp (2) 4-73 Yarr/Foot Yarr/Foot Y (3) 14-83. Sec 2: Keil (2)18-135 Moon Pds (3) 0-32, Strath (2) 13-89 MoonVal (2) 5-85, Yarr/Foot Yarr/Foot Y (4) 18-103 Buck Pk (2) 0-50,Craig (2) 16-86 Mari Pk (1) 2-77. Sec 3: Epp RSL(1) 17-105 Fair (1) 1-62, Diam Ck (1) 16-76 Lal(3) 2-73, Ivan (2) 15-100 Montm (3) 3-77, Glenr(3) 2-67 Kings (2) 16-102, E Ivan (1) 16-89 Whitt(2) 2-63. Sec 4: Ring (2) 4-67 N Bal (1) 14-79, Grey(1) 16-79 Chirn Pk (2) 2-64, Heals (1) 16-91 TempTempT(1) 2-57, Croy (2) 14-89 Moorool (2) 4-87, Donv (2)14-80 Donc (1) 4-70. Sec 5: Bor (1) 14-76 Box H RSL (1) 4-75, Black (3) 17-102 Rich Uni (3) 1-53,Moorool (3) 0-64 Aub (1) 18-116, Donc (2) 14-83East Glf (1) 4-76, Verm Sth (3) 0-66 Heath Rec (1)

    18-112. Sec 6: Card Waters (1) 16-84 Mulg CC (3)2-69, Nob Pk (1) 16-81 Mt Wav (2) 2-72, Ber (4)14-80 Cran (3) 4-66, Wav Glf (1) 16-84 Nar War (2) 2-63, Dand Clb (1) 16-112 Glen Wav (3) 2-60.Sec 7: Hamp RSL (1) 4-81 Moorab (1) 14-83, Beau(1) 16-101 Park (1) 2-64, Arma (2) 18-90 Chelt (3)0-57, Sand (1) 4-68 Caul Pk Alma (1) 14-75, Carr(1) 0-63 Edith (2) 18-86. Sec 8: S Oak (2) 2-81 Bent(2) 16-101, Murr Pk (1) 4-58 MCC (4) 14-68, CaulPk Alma (2) 16-87 Elst Clb (2) 2-60, Arma (3) 18-94St Kil (2) 0-58, Coates (2) 18-116 Clay (4) 0-45. Div 4: Sec 1: City of Melb (1) 5-73 Wbee (4) 13-78,Keil (3) 0-63 Deer Pk (2) 18-90, Suns VRI (1) 14-85Melton (3) 4-59, Alt North (1) 18-108 Lav (1) 0-35,Alt (4) 16-85 St. Albans (1) 2-61. Sec 2: Lal (4) 9-0W Cob (2) 9-0, Wbee (5) 0-50 Pres-Res (2) 18-97,Prin Pk Carlton (1) 14-95 Cob More (1) 4-56, Ess(4) 9-0 Aber (1) 9-0, Glad Pk (1) 3-64 Bruns (1)15-81. Sec 3: Alph (1) 4-74 Diam Ck (2) 14-80, Ivan(3) 0-43 MCC Kew Sports (2) 18-106, Elth (3) 4-69Hurst (2) 14-83, Y Val CC (1) 9-0 Rosan (2) 9-0,Bund RSL (4) 18-87 Kings (3) 0-55. Sec 4: BlackNth (1) 2-61 Bays (2) 16-86, Box H RSL (2) 16-83Heathm (3) 2-72, Mitch (3) 18-105 Verm Sth (4)0-51, Heath Rec (2) 18-102 Donv (3) 0-51, Montm(4) 4-74 Donc (3) 14-79. Sec 5: Heathm (4) 4-69 UpTec Tec T (2) 14-74, Mulg CC (4) 9-0 Bor (2) 9-0, Monb (2)16-93 Heath Rec (3) 2-63, Glen Wav (4) 9-0 Moorool(4) 9-0, Yarr Yarr Y Glen (3) 16-88 Chirn Pk (3) 2-71. Sec 6:Mt Wav (3) 16-81 Benn (1) 2-65, Mid Pk (2) 16-109Glen E-McK (2) 2-58, St Kil (3) 14-87 Hawth (1)4-85, Toor (1) 15-79 Ash (2) 3-60. 4-85, Toor (1) 15-79 Ash (2) 3-60. 4-85, T Sec 7: Dand RSLRec (1) 4-71 Nob Pk (2) 14-77, Chad (1) 9-0 HampPark (2) 9-0, Burd Pk (3) 3-75 Murr (1) 15-80, MulgCC (5) 9-0 Keys (2) 9-0, Cran (4) 2-65 Ber (5) 16-85. Sec 8: Chels (1) 16-85 Beau (2) 2-75, Blk Rk (1)17-98 Hamp RSL (2) 1-56, High (1) 4-67 Mord (2)14-77, Bright (4) 0-47 Arma (4) 18-100. Div 5: Sec 1: Suns C (2) 14-71 Wbee (6) 4-67,Hopp (3) 16-79 Alt (5) 2-53, Will (3) 15-96 AltSports (2) 3-65, Mari Pk (2) 14-81 Buck Pk (3)4-78. Sec 2: Clift Pk (2) 15-78 Hopp (4) 3-64, Broad(2) 9-0 Strath (3) 9-0, Buck Pk (4) 2-61 Sunb (4)16-76, Moon Val (3) 2-68 Glenr (4) 16-72. Sec 3:Green (2) 18-136 Ivan (4) 0-43, Heid Golf (2) 3-62Bund RSL (5) 15-72, Lal (5) 9-0 Pres-Res (3) 9-0,Dare C (2) 16-84 Whitt (3) 2-53, Fawk (1) 9-0 C of Heid (2) 9-0. Sec 4: Fitz Vic (3) 16-93 Black (4)2-58, N Bal (2) 4-77 Lily (3) 14-84, Donv (4) 4-75 E Ivan (2) 14-78, Donc (4) 1-62 Mitch (4) 17-93, Ring(3) 16-94 Mulg CC (6) 2-63. Sec 5: Lily (4) 4-73Fern Gul (3) 14-74, Bor (3) 2-64 Warb (2) 16-79,East Glf (2) 16-83 Ring (4) 2-72, Bays (3) 16-92Heathm (5) 2-78, Heath Rec (4) 16-82 Cockatoo (1)2-73. Sec 6: Mulg CC (7) 9-0 Chad (2) 9-0, Cran RSL(2) 14-88 Mt Wav (4) 4-62, Nob Pk (3) 2-57 DandClb (2) 16-91, Burw Dist (4) 0-0 Keys (3) 18-15, Oak(2) 16-88 Wav Glf (2) 2-61. Sec 7: Ment (4) 16-86MCC (5) 2-72, Beau (3) 18-107 Bent (3) 0-61, Arma(5) 0-56 Coates (3) 18-74, Hamp (3) 2-58 Clay (5)16-80, Chelt (4) 16-76 Sand (2) 2-69. Sec 8: RichUni (4) 9-0 Ash (3) 9-0, Mid Pk (3) 16-83 MCC (6)2-65, Melb (4) 13-81 Caul Pk Alma (3) 5-78, ElstPk (2) 15-89 Elst Clb (3) 3-70, Aub (2) 16-101 AlbPk (2) 2-46, Div 6-Sec 1: Alt (6) 1-59 Keil (4) 17-102, Deer Pk (3) 18-91 City of Melb (2) 0-64, Lav(2) 2-71 Hopp (5) 16-85, Yarr/Foot Yarr/Foot Y (6) 18-103 Will(4) 0-51, Melton (4) 14-75 Port Melb (2) 4-72. Sec2: Strath (4) 2-52 Rosam (2) 16-107, Keil (5) 16-94Glenr (5) 2-62, Aber (2) 2-68 Glad Pk (2) 16-81,Mari Pk (3) 2-51 Ess (5) 16-95, Hopp (6) 16-71 W Cob (3) 2-67. Sec 3: Bund RSL (6) 5-69 Hurst (3)13-70, Fair (2) 1-54 Thorn (1) 17-96, Whitt (4) 11-66 Rosan (3) 7-66, Kings (5) 2-60 Elth (4) 16-100,Green (3) 18-115 Diam Ck (3) 0-60. Sec 4: Alph (2)18-85 Grey (2) 0-61, Box H RSL (3) 0-69 Fitz Vic(4) 18-94, N Bal (3) 16-103 Green (4) 2-53, ChirnPk (4) 14-75 Montm (5) 4-74, Rosan (4) 0-46 Croy(3) 18-114. Sec 5: Chirn Pk (5) 6-73 Ring (5) 12-85,Yarry Yarry Y Junct (1) 14-89 Moorool (5) 4-81, Heathm (6)18-86 Lily (5) 0-56, Croy (4) 14-85 Heals (2) 4-63,

    Monb (3) 16-117 East Glf (3) 2-52. Sec 6: Glen Wav (5) 9-0 Verm Sth (5) 9-0, SOC (2) 14-79 Will Lod (1)4-72, Ber (6) 16-82 Burd Pk (4) 2-69. Sec 7: Benn(2) 17-89 Black (5) 1-61, Ber (7) 16-91 Arma (6)2-68, Toor (2) 4-60 St Kil (4) 14-93. 2-68, Toor (2) 4-60 St Kil (4) 14-93. 2-68, T Sec 8: Park (2)14-92 Sand (3) 4-58, Moorab (2) 14-78 Chels (2)4-59, Elst Clb (4) 9-0 Chelt (5) 9-0, Caul Pk Alma(4) 4-64 Edith (4) 14-82. Div 7: Sec 1: Palm Lake (1) 18-104 Deer Pk (4)0-52, New (2) 18-101 Yarr/Foot Yarr/Foot Y (7) 0-56, Pt CookVill. (1) 18-15 Suns VRI (2) 0-0, Hopp (7) 2-77 AltNorth (2) 16-96, St. Albans (2) 18-15 Wbee (7)0-0. Sec 2: Moon Val (4) 16-93 Keil (6) 2-65, CobMore (2) 0-0 Prin Pk Carlton (2) 18-15, Buck Pk (5)0-19 Bruns (2) 18-199, Clift Pk (3) 18-89 Strath (5)0-61. Sec 3: Broad (3) 9-0 Epp RSL (2) 9-0, Dare C (3) 4-61 Fawk (2) 14-98, Pres-Res (4) 18-117 Lal(6) 0-44, Bund RSL (7) 0-0 Whitt (6) 18-15, Whitt(5) 16-90 Glad Pk (3) 2-74. Sec 4: Thorn (2) 16-104Green (5) 2-49, C of Heid (3) 2-75 Elth (5) 16-108,Montm (6) 18-100 Ivan (5) 0-58, Temp Temp T (2) 16-88N Bal (4) 2-63, Donc (5) 17-85 Y Val CC (2) 1-59,Diam Ck (4) 16-84 Heid Golf (3) 2-70. Sec 5: Croy(5) 18-138 Box H RSL (4) 0-41, Verm Sth (6) 3-71Black Nth (2) 15-93, Chirn Pk (7) 0-0 Yarr Yarr Y Glen (4)18-15, Lily (6) 5-74 Chirn Pk (6) 13-81, Mitch (5)4-72 Donv (5) 14-74, Heath Rec (5) 18-111 Donc(6) 0-49. Sec 6: Moorool (6) 16-81 Bor (4) 2-58,Ring (6) 18-83 Up Tec Tec T (3) 0-67, Wav Glf (3) 2-43Pak (4) 16-93, Dand Clb (3) 18-87 Fern Gul (5)0-45, Mulg CC (9) 9-0 Ber (8) 9-0, Nar War (3) 16-83 Mulg CC (10) 2-59. Sec 7: Ash (4) 14-75 GlenE-McK (3) 4-60, Rich Uni (5) 9-0 Caul Pk Alma (5)9-0, Caul Pk Alma (6) 2-52 St Kil (5) 16-93, Elst Pk(3) 4-76 Aub (3) 14-79, Alb Pk (3) 18-15 MCC (7)0-0. Sec 8: Moorab (3) 2-55 Beau (4) 16-99, Ment(5) 15-90 Hamp RSL (3) 3-58, Oak (3) 2-68 Carr (2)16-78, Coates (4) 18-105 High (2) 0-50, Chad (3)9-0 Hamp (4) 9-0, Bright Beach (1) 18-102 Cran (5)0-59, Div 8: Sec 1: Deer Pk (5) 1-33 Flem/Kens (3)13-45, Port Melb (3) 14-15 Suns C (3) 0-0, New (3)0-0 Mari Pk (4) 14-15. Sec 2: Hurst (4) 14-15 W Cob(4) 0-0, Ess (7) 14-15 Clift Pk (4) 0-0, Rosan (5) 0-0Craig (3) 14-15, E Ivan (3) 14-42 Temp Temp T (3) 0-29.Sec 3: Burw Dist (5) 0-0 Heathm (7) 14-15, Benn(3) 13-47 Glen Wav (6) 1-26, Mitch (6) 0-30 Mt Wav (5) 14-43, Donv (6) 13-38 Warb (3) 1-37, Mt Wav (6) 14-52 Bays (4) 0-25. Sec 4: Cran RSL (3) 0-39Card Waters (2) 14-43, Clay (6) 0-25 Dand City (1)14-59, Hamp Park (4) 12-39 Nob Pk (4) 2-36, Murr(2) 14-43 Nar War (4) 0-27. Sec 5: Bent (4) 14-46Blk Rk (2) 0-41, Sand (4) 12-42 Hamp (5) 2-38,Bright (5) 14-15 Mid Pk (5) 0-0, Chelt (6) 12-43Alb Pk (4) 2-25.Div 9-Sec 1: Wav Glf (4) 12-47 Black (6) 2-45, Donc(7) 14-15 Bent (5) 0-0.

    BOWLS VICTORIA MIDWEEK METROPOLITAN METROPOLITAN METROPOLIT PENNANT: Rd 17: Premier Div: Women: BUNDOORA RSL 0-47lost to LALOR 16-74 (C Spiteri 12 lost to B Withers24, M Watt 12 lost to B Edwards 25, L Thomas 23lost to G Edwards 25), MULGRAVE MULGRAVE MULGRA CC 14-77 btCLAYTON CLAYTON CLA 2-57 (G Baric 20 lost to V Troster Troster T 28,J Lindores 29 bt C Archer 11, E Martin 28 bt M Spizer 18), GLENROY 14-59 bt GLEN WAVERLEYWAVERLEYWA2-54 (J Salmon 19 bt A Hele 16, S Whana 22 bt M Russell 17, J Hurst 18 lost to P Whorlow 21), YARR/FOOTSCRAY FOOTSCRAY FOOTSCRA 14-68 bt MONTMORENCY 2-40 (EGrinham 22 bt J Ward 19, P Glynn 33 bt G Swann5, J Smith 13 lost to M Millar 16), KEILOR 0-42 lostto ARMADALE 16-66 (A OBrien 16 lost to R Hymes23, J Montague 12 lost to G Nadelman 19, J Knight14 lost to D Brick 24).Womens Only: Sec 1: Mari Pk (1) 14-79 Wbee (2)2-53, Melton (1) 16-93 Yarr/Foot Yarr/Foot Y (2) 0-40, Wbee (1)16-92 Alt (1) 0-42, bye 7-50 Sunb (1) 9-57. Sec 2:Wav Glf (1) 1-54 Edith (1) 15-64, Mulg CC (2) 12-59Glen Wav (2) 4-57, Donc (1) 14-56 Cran (1) 2-48,Heath Rec (1) 2-45 Black (1) 14-62. Sec 3: Whitt (1)12-54 Kings (1) 4-50, Montm (2) 16-73 Pres-Res(1) 0-56, Donc (2) 12-60 Montm (3) 4-57, Lal (2)

    15-64 Bund RSL (2) 1-57. Sec 4: Verm Sth (1) 16-66 Mulg CC (4) 0-47, Glen Wav (3) 2-52 Heath Rec(2) 14-71, Mulg CC (3) 16-15 Glen Wav (4) 0-0, MtWav (1) 13-58 Wav Glf (2) 3-50.Div 1-Sec 1: Alt Nth (1) 1-40 Hopp (1) 15-77, AltSpts (1) 1-51 Port Melb (1) 15-60, Melton (2) 16-71Will (1) 0-42, Lav (1) 3-48 Wbee (3) 13-53, Strath(1) 12-66 New (1) 4-58. Sec 2: E Ivan (1) 16-58Bund RSL (3) 0-50, Elth (1) 16-83 Kings (2) 0-35,Thorn (1) 14-65 Craig (1) 2-40, Strath (2) 0-37 BuckPk (1) 16-75, Whitt (2) 2-60 Ivan (1) 14-62. Sec 3:Diam Ck (1) 14-64 Elth (2) 2-61, Box H RSL (1)2-50 C of Heid (1) 14-51, Rosan (1) 16-83 Grey(1) 0-37, Green (1) 2-46 Hurst (1) 14-69, Montm(4) 16-76 Ivan (2) 0-36. Sec 4: Yarr Yarr Y Glen (1) 14-68 Ring (1) 2-42, East Glf (1) 0-41 Moorool (1) 16-68, Heathm (1) 16-61 Warb (1) 0-48, Chirn Pk (1)2-55 Lily (1) 14-57. Sec 5: MCC Kew Spts (1) 16-85East Glf (2) 0-37, Bays (1) 2-56 Verm Sth (2) 14-83, Mitch (1) 4-52 N Bal (1) 12-61, Donv (1) 14-75Heathm (2) 2-50, MCC (1) 15-71 Fern Gul (1) 1-53.Sec 6: Dand Clb (1) 15-61 Nar War (1) 1-54, CardWtrs (1) 14-71 Keys (1) 2-55, Clay (2) 16-88 NobPk (1) 0-37, Cran (2) 14-56 Verm Sth (3) 2-47. Sec7: Chelt (1) 14-75 Caul Pk Alma (1) 2-41, Arma (2)16-82 Coates (1) 0-48, Bright (1) 16-93 Murr Pk(1) 0-42, Ash (1) 14-83 Glen E-McKinnon (1) 2-52,Burw Dist (1) 2-55 Ment (1) 14-85. Sec 8: Arma (3)2-52 Elst Pk (1) 14-53, Caul Pk Alma (2) 14-72 ElstClb (1) 2-46, Mid Pk (1) 16-75 Hamp (1) 0-55, Ment(2) 12-63 Bright (2) 4-55, Beau (1) 12-62 AlbertPark (1) 4-56.Div 2 sec 1: Deer Pk (1) 2-56 Sunb (2) 14-65, SunsC (1) 4-51 Alt (2) 12-52, Suns RSL (1) 0-36 Pt CookVlge (1) 16-85. Sec 2: Lal (3) 16-74 Moon Pds (1)0-43, Broad (1) 0-25 Dare C (1) 16-85, W Cob (1)16-15 Strath (3) 0-0, Fair (1) 2-64 Prin Pk Carl (1)14-69, Fawk (1) 0-37 Ess (1) 16-69. Sec 3: C ofHeid (2) 2-53 Box H RSL (2) 14-54, Elth (3) 14-59 Diam Ck (2) 2-45, Heid Golf (1) 16-79 Whitt (3)0-36, Temp Temp T (1) 1-48 Rich Uni (1) 15-64, N Bal (2)16-68 Montm (5) 0-43. Sec 4: Moorool (2) 14-70Heals (1) 2-54, Ring (2) 14-61 Bor (1) 2-56, Lily (2)14-66 Burw Dist (2) 2-56, Black (2) 14-67 Box H RSL (3) 2-54, Y Val CC (1) 12-69 Donv (2) 4-61. Sec5: Bor (2) 12-66 Bays (2) 4-48, Benn (1) 15-81 Lily(3) 1-41, Ber (1) 16-79 Verm Sth (4) 0-40, Fern Gul(3) 1-41, Ber (1) 16-79 Verm Sth (4) 0-40, Fern Gul(3) 1-41, Ber (1) 16-79 V(2) 14-64 Heath Rec (3) 2-44, Heathm (3) 13-72East Glf (3) 3-44. Sec 6: Elst Clb (2) 16-70 Mal (1)0-37, Camb Cent (1) 12-59 Murr (1) 4-56, Chad (1)12-62 MCC (2) 4-57, Caul Pk Alma (3) 14-57 Ber(2) 2-47, Oak (1) 16-75 Ash (2) 0-46. Sec 7: Keys(2) 2-52 Card Wtrs (2) 14-53, Ber (3) 16-81 DandClb (2) 0-39, Edith (2) 2-50 Hamp Pk (2) 14-59,Burd Pk (1) 16-87 Dand RSL Rec (1) 0-43, FernGul (3) 14-61 Cran (3) 2-57. Sec 8: Sand (1) 13-55Park (1) 3-54, Carr (1) 16-85 Blk Rk (1) 0-41, SOC(1) 16-92 Mord (1) 0-43, Bright (3) 2-53 Edith (3)14-91, Moorab (1) 13-70 Chels (1) 0-55.Div 3 sec 1: C of Melb (1) 14-75 Hopp (3) 2-47,Melton (3) 16-78 Keil (2) 0-37, Wbee (4) 16-75 StAlb (1) 0-53, Pt Cook Vlge (2) 4-53 Mari Pk (2) 12-60, Yarr/Foot Yarr/Foot Y (4) 12-71 Suns C (2) 4-61. Sec 2: GladPk (1) 14-67 Lal (4) 2-50, Sunb (3) 2-54 Kings (3)14-73, Heid Golf (2) 2-54 Glenr (2) 14-55, Green (2)12-60 Rosan (2) 4-59, Keil (3) 16-75 Buck Pk (3)0-40. Sec 3: E Ivan (2) 16-75 Black North (1) 0-32,Donv (3) 2-54 Donc (3) 14-57, Mitch (2) 15-73 Y Val CC (2) 1-40, Croy (2) 12-55 Hurst (2) 4-53, N Bal (3) 2-47 Chirn Pk (2) 14-56. Sec 4: Lily (4) 14-76 Donv (4) 2-37, Heals (2) 15-66 Donc (4) 1-40,Heath Rec (4) 0-55 Monb (2) 16-79, Ring (3) 4-54Chirn Pk (3) 12-64, Yarry Yarry Y Jct (1) 14-64 Moorool (3)2-51. Sec 5: MCC Kew Spts (2) 16-75 Benn (2)0-41, Mt Wav (2) 2-42 Lily (5) 14-76, Chirn Pk (4)12-56 N Bal (4) 4-55, Moorool (4) 2-37 Alph (1)14-73, MCC (3) 14-70 Black (3) 2-66. Sec 6: Wav Glf (3) 2-57 Ber (4) 14-65, Nar War (2) 0-36 Pak(1) 16-83, Will Lod (1) 2-51 Fern Gul (4) 14-61,Clay (3) 0-44 Mulg CC (6) 16-111, Nob Pk (2) 13-59 Keys (3) 3-57. Sec 7: Burw Dist (3) 15-79 Mt

    Wav (3) 1-41, Aub (1) 4-51 Arma (4) 12-56, AlbertPk (2) 15-76 Mid Pk (2) 1-43, Nob Pk (3) 14-65Caul Pk Alma (4) 2-49. Sec 8: Beau (3) 14-72 HampRSL (1) 2-40, Park (2) 1-47 Chelt (2) 15-66, Ment(3) 1-54 Mord (2) 15-61, Chels (2) 14-67 High (1)2-56, Hamp (2) 14-57 Arma (5) 2-56.Div 4 sec 1: Port Melb (2) 13-70 Melton (4) 3-61, Alt(3) 16-15 Suns RSL (2) 0-0, New (2) 16-91 PalmLake (1) 0-42, Will (2) 16-79 Lav (2) 0-41. Sec 2:Moon Val (1) 12-66 Cob More (1) 4-58, Broad (2)16-56 Dare C (2) 0-41, Palm Lake (2) 14-75 St Alb(2) 2-42, Pres/Res (3) 14-65 Rosam (1) 2-52, Fawk(2) 4-48 Ess (2) 12-52. Sec 3: Kings (4) 2-41 Elth(4) 14-74, Lal (5) 2-45 Pres/Res (2) 14-55, Montm(6) 14-61 Donv (5) 2-48, Bund RSL (4) 2-66 Ess(3) 14-68. Sec 4: Kings (5) 0-45 N Bal (5) 16-61,Chirn Pk (5) 14-61 Yarr Yarr Y Glen (2) 2-51, Montm (7)0-53 Whitt (5) 16-64. Sec 5: MCC Kew Spts (3) 2-39Monb (3) 14-70, Black Nth (2) 1-51 Fitz Vic (1) 15-78, Bor (3) 14-59 MCC (4) 2-40, Mulg CC (7) 16-15Chad (2) 0-0, Verm Sth (5) 16-70 Ash (3) 0-37. Sec6: Pak (2) 16-87 Dand Clb (3) 0-30, Ber (5) 14-63Wav Glf (4) 2-58, Verm Sth (6) 14-61 Cran RSL (1)2-58, Fern Gul (5) 16-73 Mulg CC (8) 0-42. Sec 7:Coates (2) 2-56 Elst Pk (2) 14-72, Mal (2) 2-49 Sand(2) 14-60, Mulg CC (9) 14-70 Moorab (2) 2-51, Arma(6) 16-57 Caul Pk Alma (5) 0-46, Arma (8) 12-62Elst Clb (3) 4-55. Sec 8: Edith (4) 2-56 Carr (2) 14-59, Arma (7) 14-73 Beau (4) 2-48, Caul Pk Alma (6)14-65 Sand (3) 2-44, Bright Bch (1) 2-54 Ment (4)14-56, Hamp (3) 2-48 Chelt (3) 14-62.Div 5 sec 1: Ivan (3) 12-56 Donc (5) 2-33, Box H RSL(4) 12-45 Diam Ck (3) 2-34, Craig (2) 2-32 Thorn (2)12-62, Elth (5) 11.5-42 bye 2.5-36. Sec 2: Heathm(5) 2-31 Croy (4) 12-36, Dand C (1) 12-43 Cran (4)2-36, Bays (3) 0-27 Croy (3) 14-47.Q SCHOOL SPORTAGSV: Boys: BASKETBALL: Mentone 49 bt Camberwell25, Assumption 43 bt Yarra Yarra Y Valley 41, Marcellin 44bt PEGS 32, Peninsula 38 bt Ivanhoe 30. TENNIS:Yarra Yarra Y Valley 12-111 bt Assumption 0-27, PEGS 9-79bt Marcellin 1-21, Ivanhoe 9-107 bt Peninsula 3-66,Mentone v Camberwell washed out. BADMINTON:Peninsula 6-10-230 bt Mentone 0-0-93, Camberwell4-8-230 bt PEGS 2-3-198, Ivanhoe 5-8-221 btYarra Yarra Y Valley 1-3-176. TABLE TABLE T TENNIS: Camberwell 10-34 bt


Recommended