OCCURRENCE AND QUANTIFICATION OF VIBRIO PARAHAEMOLYTICUS IN SHRIMP AQUACULTURE
AND ENVIRONMENT
Nur Bainun Binti Mohd Zin
27601
QR 67 Bachelor of Science with Honours N974 (Biotechnology Resource) 2013 2013
Pusat Khidmat Maklumat Akademik UNTVERSrn MALAYSIA SARAWAK
Occurrence and quantification of Vibrio parahaemolyticus in shrimp aquaculture and
environment
NUR BAINUN MOHD ZIN (27601) P,KHIOMAT MAKLUMAT AKAOEMIK
III
A final report submitted in partial fulfillment of the Final Year Project (STF 3012) Course
Supervisor: Dr. Lesley Maurice Bilung
Co-Supervisor: Dr. Micky Vincent
Resource Biotechnology
Department of Molecular Biology
Faculty of Resource Science and Technology
UNIVERSITI MALAYSIA SARAWAK
2013
Declaration
I, hereby declare that this Final Year Project is based on my original work except for
quotations and citations which have been properly acknowledged. I also declared that it has
not been previously or concurrently submitted for any other degree in UNIMAS or other
institutions.
I
Date: !)Jj 1uN .).f) '3
11
/
Acknowledgement
First, I would like to thank my supervisor, Dr. Lesley Maurice Bilung for giving me
the trust and opportunity to undertake this project and for all her supervision and guidance
throughout the project.
Furthermore, I also want to thank to all my fellow friends in the Microbiology
Laboratory 4; Nurulhuda Najihah bt Zainal Abidin, Sze Fan, Siaw Yew, Poh Yiin, Lilian,
Jesmie, Zhao Ning, Lee Tze and post-garquate student, Velnetti Linang for all their
continuous help and support. Of course, Encik Aziz for all his assistance with equipment
needed.
Last but not least, to my family and all my coursemates for all their advices and
endless support.
iii
Pusat Khidmat Maklumat Akademik UNIVERSm MALAYSIA SARAWAK
TABLE OF CONTENTS
Page
TITLE AND FRONT COVER I DECLARATION II ACKNOWLEDGEMENT III TABLE OF CONTENTS IV LIST OF TABLES VI LIST OF FIGURES VII LIST OF ABBREVIATIONS VIII
ABSTRACT 1
CHAPTER 1 INTRODUCTION 2
..J
CHAPTER 2 LITERATURE REVIEW 5
2.1 Family Vibrionaceae 5 2.2 Vibrio parahaemolyticus 6
2.2.1 Morphology and culture 6 2.2.2 Virulence factors 7 2.2.3 Vibriosis 8 2.2.4 Human diseases and economic loss to aquaculture industry 9
CHAPTER 3 MATERIALS AND METHOD 11
3.1 Materials 11 3.1.1 Water samples 3.1.2 Shrimp samples 11
3.2 Methods 11 3.2.1 Isolation ofpathogenic Vibrio species 11
3.2.1.1 Processing and enrichment ofbacteria sample 11 3.2.1.2 Enumeration ofbacteria sample 12
3.2.2 Molecular analysis 12 3.2.2.1 DNA extraction 12 3.2.2.2 Species specific PCR 13 3.2.2.3 Agarose gel electrophoresis 14
3.2.3 Statistical analysis 15
CHAPTER 4 RESULT 16
4.1 Enumeration of bacteria sample 16 4.2 Species specific PCR 16 4.3 Statistic analysis 18
iv
..."
LIST OF TABLES
Table Page
Table 1 Materials for PCR analysis to detect toxR gene 13
toxR gene
MPN/ml
Table 2 Conditions for PCR analysis to detect toxR gene 14
Table 3 Oligonucleotide primers used for species specific to detect 14
Table 4 The mean ofwater samples for paired-samples t test 19
Table 5 Pearson correlation coefficient and P value between variables 19
Table 6 Total samples positive for V. parahaemolyticus and MPN value, 31
Table 7 Data for paired-sample t test between ponds 31
Table 8 Data for Pearson correlation analysis between water samples 32
and environmental parameters
Table 9 Data for Pearson correlation analysis between shrimp samples 33
and environmental parameters
Table 10 Data for Pearson correlation analysis between water samples and 33
shrimp samples
V1
• ....
LIST OF FIGURES
Figure Page
Figure 1 Agarose gel electrophoresis for detection of toxR gene of 17
V. parahaemolyticus for water samples
/ Figure 2 Agarose gel electrophoresis for detection of toxR gene of 17
V. parahaemolyticus for shrimp samples
Figure 3 The relationships between incidence of V. parahaemolyticus 20
(log CFU/ml) for water samples with enviromnental parameters
Figure 4 The relationships between incidence of V. parahaemolyticus 20
(log CFU/ml) for shrimp samples with enviromnental parameters
Figure 5 The relationships between incidence of V. parahaemolyticus in water 21
samples and shrimp samples
vii
I
AGE
APW
bp
CFU
DNA
DO
FAO
FOOD
g
kg
mg
MgCh
ml
mM
MPN
PCR
sp
LIST OF ABBREVIATIONS
Agarose gel electrophoresis
Alkaline Peptone Water
Base pairs
Colony fonning unit
Deoxyribonucleic acid
Dissolved oxygen
Food and Agriculture Organization ofUnited Nations
Foodbome Outbreaks Online Database
Gram
Kilogram
Milligram
Magnesium chloride
Millilitre
Millimolar
Most Probable Number
Degree Celcius
Polymerase Chain Reaction
Species
Vlll
spp Species
TBE Tris borate EDT
TeBS Thiosulphate citrate bile salt sucrose agar
TDH Thermostable direct hemolysin
tdh Thermostable direct hemolysin
toxR Toxin operon gene
TRH TDH related hemolysin
trh TDH related hemolysin
USD US dollar
UV Ultraviolet
V Vibrio
~m Micromolar
IX
Occurrence and quantification of Vibrio parahaemolyticus in aquaculture of shrimp and
environment
By Nur Bainun binti Mohd Zin (27601)
Resource Biotechnology F acuity of Resource Science and Technology
Universiti Malaysia Sarawak
ABSTRACT
Vibrio spp. occurs naturally in aquatic environments and are one of the most commonlyoccuring bacteria in shrimp farming. At least 14 species had been found in panaeid shrimp culture system. V. parahaemolyticus can cause outbreak of gastroenteritis due to the consumption of raw or undercooked seafood. V. parahaemolyticus in the aquaculture may cause vibriosis to shrimp. This project was conducted using water and shrimp samples taken from a shrimp aquaculture in Bako, Sarawak to study the presence of toxR gene of V. parahaemolyticus by utilizing species specific PCR and enumeration with MPN method. Statist ic analyses were carried out to identify the relationship and correlation between the occurrence of V. parahaemolyticus and environmental parameters comprises of pairedsample t test and Pearson correlation analysis. The findings indicated 86% water samples and 14% shrimp samples harboured toxR gene for V. parahaemolyticus. There were no significant difference in both statistical analyses. Hence, the present study highlighted the potential risk of V. parahaemolyticus from shrimp aquaculture and environment to infect human and animal upon consumption.
Keywords: Vibrio parahaemolyticus, toxR gene, PCR, MPN, statistic analysis.
ABSTRAK
Vibrio spp. adalah hidupan semulajadi dalam persekitaran akuatik dan salah satu bakteria yang selalu dijumpai dalam penternakan udang. Sekurang-kurangnya 14 spesies telah ditemui di dalam akuakultur udang panaeid. fa boleh menyebabkan wabak gastroentiritis apabi/a mengambil makanan laut mentah atau kurang masak. V. parahaemolyticus dalam akuakultur terutamanya berpotensi mengakibatkan vibriosis kepada udang. Kajian ini dijalankan dengan menggunakan sampel air dan udang yang diambil dari Bako, Sarawak untuk mengkaji kehadiran gen toxR V. parahaemolyticus dengan menggunakan PCR spesies tertentu dan penghitungan dengan kaedah MPN. Analisis statistik telah dijalankan untuk mengenal pasti hubungan dan korelasi antara kehadiran V. parahaemolyticus dan parameter persekitaran menggunakan ujian sampel berpasangan t dan analisis korelasi Pearson. Hasil kajian mendapati 86% sampel air dan 14% sampel udang mengandungi gen toxR untuk V. parahaemolyticus. Tiada signifikan di dalam kedua-dua analysis statistik. Oleh itu, kajian ini menekankan potensi risiko V. parahaemolyticus daripada akuakultur udang dan persekitaran untuk menjangkiti manusia dan haiwan.
Kata kunci: Vibrio parahaemolyticus, gen toxR, PCR, MPN, analisis statistik.
..:
CHAPTER 1
INTRODUCTION
V parahaemolyticus is a Vibrio species originated from the phylum Y-proteobacteria
of domain Bacteria. It is Gram negative bacteria with curved, comma shaped rod or straight
rod by having a capsule. This facultative anaerobes are motile with having one or more polar
flagella and fermentative with the production of acid rather than gas. V parahaemolyticus
possessed positive oxidase reaction and require sodium ions for growth. The organisms can
be found in the environment especially in the aquatic environment (Pina et al., 2005).
In aquaculture of shrimp, there are several Vibrio species that had been recognized
such as V parahaemolyticus that is the natural micro flora of aquatic environment (Norma et
al., 2009). But, Vibrio species can be an opportunistic pathogen if the natural defense
mechanism is suppressed (Brock and Lightner, 1990). According to Food and Agriculture
Organization of the United Nations (2013b), one of the major diseases sufferred by Penaeus
vannamei is vibriosis that is caused by Vibrio spp. particularly V harveyi and V
parahaemolyticus.
Vibriosis may cause high mortality when shrimps' environment are stressed. It
usually occurs in postlarvae and young juvenile shrimps. According to Najiah and Lee
(2008), shrimp suffering from vibriosis will exhibit decreased appetite, become darker and
light or dark brown focal lesion and necrosis appeared on appendage tips.
Among the Vibrio species, V parahaemolyticus had been identified as foodbome
pathogen besides V mimicus, V cholerae and V vulnificus (Reham and Amani, 2012). Based
on the data from Foodbome Outbreak Online Database (FOOD) (2010), there was an
2
....
incidence offoodborne outbreak caused by V. parahaemolyticus in August~ 2010 occurred in
Washington, United States.
This species is the important cause of gastroenteritis associated with the consumption
of raw or undercooked seafood (Pina et al., 2005). Based on Reham and Amani (2012), the
infection may cause septicemia that is life threatening to immunocompromised people as well
as prolonged steroid use. The pathogenicity of V. parahaemolyticus is due to the presence of
tdh gene encoding thermostable direct haemolysin and trh gene encoding thermostable direct
related haemolysin which make the strains capable of producing TDH, TRH or both are
virulent strains (Pina et al., 2005).
Experimentally, samples from the shrimp aquaculture site in Bako were extracted
either from water or shrimp. These samples were examined for the identification of V.
parahaemolyticus via Polymerase Chain Reaction (PCR) for the detection of regulatory genes
such as toxR gene as this method is comparatively easy, efficient, accurate, less time
consuming than phenotypic methods (Zulkifli et al., 2009). In this study, species specific
peR was used to confirm the presence of toxin operon (toxR) gene which is the regulatory
gene of Vibrio spp. (Zulkifli et ai., 2009). According to Ubong et al. (2011), specific forward
and reverse primer pairs were used to detect Vibrio spp. Kim et al. (1999) also stated that
specific forward and reverse primers are used to detect V. parahaemolyticus toxR region with
50 percent G/C contents. Detection of trh and tdh gene were done to confirm the
pathogenicity of V. parahaemolyticus isolates. Additionally, most probable number technique
and CFU counting were performed in this study to enumerate the target organism in the
samples.
The main objective of this study was to investigate the occurrence and to enumerate
V. parahaemolyticus in the aquaculture farm in Bako from water and shrimp samples. Thus,
3
~.
this study provides informations on the prevalence of V. parahaemolyticus and its risk to
human.
Objectives of the study are to:
1) Detect the presence of V. parahaemolyticus from water and shrimp samples of shrimp
aquaculture and environment by using species specific peR, targeting the species specific
gene, toxR.
2) Enumerate V. parahaemolyticus from the samples collected by utilizing most probable
number (MPN) method.
3) Determine the correlation and its significance between the occurrence of V.
parahaemolyticus and environmental parameters by performjng paired-sample t test and
Pearson correlation analysis.
4
P~~EKRSh~~mat Maklumat Akademik I III MALAYSIA SARAWAK
CHAPTER 2
LITERATURE REVIEW
2.1 Family Vibrionaceae
The family Vibrionaceae is a member of Y-proteobacteria which is the subdivision of
phylum Proteobacteria in the domain Bacteria. Nishiguchi and Jones (2004) reported that the
bacteria are divided into five subdivisions (a, p, Y, 0, and €) on the basis of 168 rRNA
sequence data. Then, Y-proteobacteria is divided into three major subgroups that are Y-l, Y-2
and y-3 which consist of family Vibrionaceae. According to Holt (1994), Vibrionaceae
consists of five genera which are Vibrio, Aeromonas, Enhydrobacter, Photobacterium, and
Plesiomonas. However, genus Aeromonas have been transferred into family
Aeromonadaceae while Plesiomonas into family Enterobacteriaceae which Plesiomonas
had been suggested transferred to genus Proteus in the family Enterobacteriaceae due to its
58 rRNA is closely related to that of Proteus mirabilis (Holt, 1994).
Vibrionaceae was firstly proposed by Veron in 1965 as they are fermentative bacteria
and have polar flagella and a positive oxidase reaction for purpose ofdifferentiation between
Vibrionaceae from closely related family Enterobacteriaceae. Many species of Vibrionaceae
are widely distributed in the environment by contributing to the cycling of organic and
inorganic compounds (Martin et at., 2006). According to Bergey and Holt (2000), the
species is primarily aquatic inhabitants that can be found in seawater and fresh water and in
association with aquatic animals. It can be found either at the water surface, shrimp or in the
sediment (Shubha et at., 2005).
. Species of this family can be pathogenic or non-pathogenic. Healthy shellfish is
protected with its own immune system so that, Vibrio spp. cannot grow on its flesh. But,
5
when the shellfish dies, Vibrio spp. can proliferate and with poor food handling and
undercooked shellfish, this can cause health risk to the consumers (Aberoumend, 2010).
Since 1996, Vibrio parahaemolyticus cases had increased across the world which it can
cause gastroenteritis (Aberoumend, 2010).
2.2 Vibrio parahaemolyticus
2.2.1 Morphology and culture
Vibrio parahaemolyticus are Gram negative bacteria that appear as either curved,
comma-shaped rod or straight rod microscopically which ressemble Vibrio cholerae but
having a capsule (Parija, 2009). The bacteria is small in size with 0.5-0.8 ~m in width and
1.4-2.6 I.lID in length. The species are motile with polar flagella which are enclosed in a
sheath continuous with the outer membrane of the cell wall (Holt, 1994). V.
parahaemolyticus is oxidase positive and fennentative without producing gas. V.
parahaemolyticus fennent glucose, arabidose, maltose, mannitol, and mannose with the
production of acids but does not fennent sucrose, lactose and salicin, and it is capable to
reduce nitrate to nitrite while requiring sodium ions for growth (Parija, 2009). V.
parahaemolyticus can multiply rapidly between 20°C and 40°C but its optimum temperature
is at 37°C (Aberoumend, 2010).
The oftenly used medium to isolate Vibrio spp. is thiosulfate citrate bile salts sucrose
(TeBS) agar. When the bacteria are grown onto the medium, Vibrio parahaemolyticus
produce smooth green colonies on TCBS agar because of sucrose negative (Engelkirk and
Engelkirk, 2008). V. parahaemolyticus is acid sensitive and grow best at pH 7.5 to 8.5
(Aberoumend, 2010). For the use of identification of Vibrio spp., salt tolerance can be applied
according to their salt requirement. Other key characteristics for identification for Vibrio spp.
are positive for production of catalase, oxidase, cell lysis and sodium desoxychollate,
6
productions of ge1atinase, decarboxylation of lysine and ornithine and fermentation of
glucose, sucrose and mannitol (Pina et al., 2005).
The combination between identification method and traditional enumeration method,
the most probable number (MPN) are usually performed to detect and enumerate V.
parahaemolyticus (Nishibuchi, 2006). The major drawbacks of this technique are amount of
workload, the materials and the time needed to complete identification.
Hence, this problem can be overcome by using MPN method coupled with species
specific polymerase chain reaction (PCR). Martin et al. (2004) stated that the combination
between MPN method and species specific PCR enables the completion of enumeration
within 2 days. Other researchers have reported the success of MPN combined with PCR for
detection and quantification of pathogens (Savill et al., 2001; Freds1und et al., 2001; Martin
et al., 2004; Chai et al., 2007; Lee et al., 2009).
2.2.2 Virulence factors
As reported by Hassan et al. (2012), Vibrio is one of the genus in Vibrionaceae with
65 species in the genus had been described (Twedt, 1989) with twelve species are recognized
as human pathogens (Nair et al., 2006) with eight species considered to be foodborne
pathogens. Among the recognized human pathogens from Vibrio species are V. cholerae
0110139, V. cholerae non-01/non-0139, V. mimicus, V. parahaemolyticus, V. fluvialis, V.
furnissii, V. hollisae, V. vulnificus, V. damsel, V. alginolyticus, V. metschnikovii, V.
cincinnatiensis and V. harveyi (Engelkirk and Engelkirk, 2008). On the other hand, foodborne
pathogens from Vibrio species are V. parahaemolyticus, V. mimicus, V. cholerae and V.
vulnificus (Reham and Amani, 2012).
7
As reported by Duangkhae et al. (2011), the toxR is found as regulatory gene in
Vibrio spp. which is about 368 bp. However, the toxR gene also is the regulatory gene
specific for V. parahaemolyticus with size about 368 bp (Zulkifli et al., 2009). Based on
previous studies, the occurrence of V. parahaemolyticus can be detected by using species
specific peR by targeting the toxR gene as regulatory gene and as an taxonomic marker in
Vibrio spp. with size about 368 bp (Zulkifli et al., 2009; Duangkhae et al., 2011).
V. parahaemolyticus carried tdh gene encoding thermostable direct hemolysin and
also has trh gene encoding for TDH related hemolysin which make the strains capable of
producing TDH, TRH or both are virulent strains (Duangkhae et al., 2011).
2.2.3 Vibriosis
In aquatic environment, Vibrio spp. is widely distributed on the surface of the water,
at the shrimp and sediment (Shubha, 2005). It has mutualistic relationship between aquatic
organisms in which they assist in the digestion process with the presence of chitinase
(Seckbach, 2004). However, it can be an agent of disease that affects the aquatic organisms
and causes disease outbreak because shrimp lacks an adaptive immune system and rely on
innate immune responses against microbial invasion (Rajasekar et al., 2011). Vibriosis is one
ofthe major disease that occur in shellfish and fmfish aquaculture typically in shrimp culture,
particularly by V. parahaemolyticus (FAO, 2013a).
According to Sinderman (1990), Vibrio spp. are part ofthe natural micro flora of wild
and cultured shrimps whereas Brock and Lightner (1990) reported that it becomes
opportunistic pathogens when natural defense mechanisms are suppressed. The V.
parahaemolyticus may enter the host through wounds in the exoskeleton or pores. Sizemore
and Davis (1985) stated that outbreaks may occur when environmental facto~s trigger the
multiplication of bacteria that already tolerated at low levels within shrimp blood or by
8
bacterial penetration of host barriers. This situation can worsen at temperature above 20°C
because proliferation of Vibrio spp. ispromoted (Boer et al., 2010). According to Najiah and
Lee (2008), shrimp suffering from vibriosis will exhibit decreased appetite, become darker
and light or dark brown focal lesion and necrosis appeared on appendage tips.
2.2.4 Human diseases and economic loss to aquaculture industry
Nowadays, the consumption of shellfish such as shrimp had increased due to · the
awareness of its low cholesterol, fat content, important source of vitamins, minerals,
polyunsaturated fatty acids of the n-3 family and high quality animal protein content that
make it component in human diet (Reham and Amani, 2012). However, some Vibrio species
like V. cholerae, V. parahaemolyticus, V. mimicus, V. vulnificus and V. hollisae can cause
severe human disease such as food poisoning due to the consumption of raw or undercooked
seafood.
According to Pina et al. (2005), after ingestion, viable cells may reach the small
intestine. If the cells survive in acidic environment of the stomach, they start to produce toxin
which can cause alteration of the ions transport. Subsequently, this condition will lead to
voluminous secretory diarrhea.
According to Vasanthakumari (2007), V. parahaemolyticus was originally isolated in
an outbreak of food poisoning due to sea fish in Japan and India. Strains isolated from human
usually hemolytic due to the tdh or trh gene (Pina et al., 2005) which is the most important
cause of gastrointestinal illness associated with the consumption of raw or undercooked
seafood (Zulkitli et al., 2009). The patient will suffer watery and bloody diarrhea, abdominal
pain, vomiting, fever, headache, nausea and chill (Pina et al., 2005). Based on studies by
Reh8rn. and Amani (2012), although the illness is self-limited, the infection may cause
9
septicemia that is life threatening to immunocompromised people as well as prolonged
steroid user.
Therefore, bacterial disease such as vibriosis and human foodborne disease due to
Vibrio species could become the biggest problem to the economy of shrimp aquaculture in
Malaysia as aquaculture is the fastest growing food sector globally. As one of the most
popular seafood in the world, the market demand for shrimp continues to grow rapidly.
According to Food and Agriculture Organization of United Nations (F AO) (2013a),
aquaculture bas been identified as one of the critical activities to ensure food security since
the Seventh Malaysia Plan (1996-2000) which the value of production of black tiger shrimp
bas continued to be the leading species for the last five years at a value of USD 160 186.
Vibrio species can cause great damage and loss to the economy of aquaculture especially
aquacultured shrimp in Malaysia.
10
CHAPTER 3
MATERIALS AND METHOD
3.1 Materials
3.1.1 Water samples
The 500 ml water were obtained from two different ponds identified as pond 1 and
pond 14 from shrimp aquaculture farm and environment at Bako, Sarawak. The samples were
placed in sterile 500 ml falcon tubes and were stored in 4°C inside the ice box and were
transported to UNlMAS Microbiology Lab for further processing.
3.1.2 Shrimp samples
About 30 g fresh shrimp samples were obtained from two different ponds identified as
Pond 1 and Pond 14 from shrimp aquaculture farm and environment at Bako, Sarawak. The
shrimp samples were placed in sterile plastic bag and stored in 4°C inside the ice box and
were transported to UNlMAS Microbiology Lab for further processing.
3.2 Methods
3.2.1 Isolation of V. parahaemo[yt;cus
3.2.1.1 Processing and enrichment of bacteria sample
Isolation of V. parahaemolyticus from sampling area were performed by pre
enrichment step in Alkaline Peptone Water (APW). Each sample was homogenized in
Allcaline Peptone Water (APW) with pH 8.6 and 1-2% (w/v) of NaCI (Elliot et al., 1978;
Kaysner et a/., 1992; Harwood et al., 2004). For water samples, 10 m1 from each sample were
added with 90 m1 APW while for shrimp samples, 25 g from each sample were added with
225 ml APW. The sample were incubated at 37°C for 18 hours.
11
3.2.1.2 Enumeration of bacteria sample
Enumeration was performed by using most probable number (MPN) method. The
eminched culture of Vibrio species were introduced to a three-tube MPN method. The serial
dilutions of fluid into 10-1 , 10-2 and 10-3 were performed with 9 mL of APW in each tubes.
All tubes were incubated at 37°C for 18 hours. After incubation, the turbid tubes were
subjected to further analysis using species specific PCR for the detection of regulatory gene,
toxR gene.
About 0.1 ml of each serial dilution from 10-3 until 10-7 were transferred onto a TCBS
agar. Then, spread plate were carried out. The plates were incubated at 37°C for 18 hours.
3.2.2 Molecular analysis
3.2.2.1 DNA extraction
In this study, boiled cell extraction method were carried out based on Vengadesh et at.
(2012). Briefly 1 mL of the overnight cultures were centrifuged at 10000 rpm for 2 minutes.
Then, the supernatants were removed and 500 III of sterile distilled water were added and
vortexed. The micro centrifuge tubes were subjected to boiling at 100°C for 10 minutes and
were immersed into ice for 10 minutes immediately. The mixtures were centrifuged at 13 000
rpm for 3 minutes. The supernatants were transferred into a new 1.5 mL micro centrifuge tube
and were used for further species specific PCR analysis.
12
3.2.2.2 Species specific peR
Species specific PCR were carried out to detect toxR gene with the oligonucleotide
sequences shown in Table 3. About 20.0 ~l reaction mixture was put into 1.5 ml microfuge
tubes which consist of the materials shown in Table 1 while the PCR were conducted based
on the conditions shown in Table 2.
Table 1: Materials for peR analysis to detect toxR gene.
Materials Volume (~l)
Sterile distilled water 12.5
10 times PCR buffer 4.0
25mMMgCh 3.0
10 mM deoxyribonucleotide phosphates 1.0
Primer 1.0
5 units TaqDNA 0.5
Template DNA 2.0
Total 25
13
Table 2: Conditions for PCR analysis to detect toxR gene.
Step Temperature (OC) Duration (minute)
Pre-denaturation 96 5
Denaturation 94 1
Annealing 63 1.5
Extension 72 1.5
Final extension 72 7
Table 3: Oligonucleotide primer sequences used for species specific to detect toxR gene. Targeted Pathogens Primer sites (5'-3') Amplicon Sources
genes size (bp)
toxR V. F: 5'- GTCTTCTGACGCAATCGT- 368 Kimet parahaemolyticus 3 ' al., 1999
R: 5'ATACGAGTGGTTGCTGTCATG3'
.1.2.3 Agarose gel electrophoresis (AGE)
The PCR products were loaded into sample wells of 1.0% (w/v) agarose gel. The gel
stained with 0.5 ~glml ethidium bromide solution for 15 minute in IX TBE. The gel
destained in distilled water for 15 minutes. The voltage were set at 85 volt for 1 hour.
'lben, the gel were visualized and photographed under UV transilluminator.
14