Origin and Inheritance of Group I Introns in 26S rRNA Genes ofGaeumannomyces graminis
M.K. Tan
Biological and Chemical Research Institute, NSW Agriculture, PMB 10, Rydalmere, NSW 2116, Australia
Received: 17 May 1996 / Accepted: 14 January 1997
Abstract. Studies of the distribution of the three groupI introns (intron A, intron T, and intron AT) in the 26SrDNA of Gaeumannomyces graminishad suggested thatthey were transferred to a common ancestor ofG. grami-nis var. avenaeand var.tritici after it had branched offfrom var. graminis. Intron AT and intron A exhibitedvertical inheritance and coevolved in concert with theirhosts. Intron loss could occur after its acquisition. Lossof any one of the three introns could occur in var.triticiwhereas only loss of intron T had been found in themajority of var.avenaeisolates. The existence of isolatesof var. tritici and var.avenaewith three introns sug-gested that intron loss could be reversed by intron ac-quisition and that the whole process is a dynamic one.This process of intron acquisition and intron loss reacheddifferent equilibrium points for different varieties andsubgroups, which explained the irregular distribution ofthese introns inG. graminis.Each of the three group Iintrons was more closely related to other intron se-quences that share the same insertion point in the 26SrDNA than to each other. These introns in distantly re-lated organisms appeared to have a common ancestry.This system had provided a good model for studies onboth the lateral transfer and common ancestry of group Iintrons in the 26S rRNA genes.
Gaeumannomyces graminis(Sacc.) Arx & D. L. Olivieris a soil-borne ascomycete that parasitizes the roots, stembases, and leaf sheaths of Gramineae. Four varieties ofG. graminis have been described—var.graminis, var.avenae,var. tritici, and var.maydis. G. graminisvar.tritici J. Walker causes the take-all disease in wheat andbarley in temperate areas. Take-all is the most damagingroot disease of wheat worldwide. Var.avenaeis the maincause of take-all in oats and of take-all patch disease inturfgrasses. Var.graminis is pathogenic to turfgrassesand one species of rice (Ou 1972) but is generally notpathogenic to other cereals. Var.maydis causes corntake-all and was described recently (Yao 1993).
Three group I introns have been discovered in the 26SrRNA genes ofG. graminis(Tan and Wong 1996). Thiswork sought to understand the distribution of these threegroup I introns among the three well-characterizedG.graminis varieties (var.graminis, var. tritici, and var.avenae). Their distribution would shed light on the mo-bility and inheritance of these group I introns inG.graminis. Var. tritici is a complex heterogenous groupwith wide variations in their host pathogenicity (O’Dellet al. 1992; Tan et al. 1994). An understanding of theevolutionary history of these introns inG. graminismayprovide a valuable framework for the utility of thesegroup I introns as molecular markers for the differentvarieties and subgroups of this group of economicallyimportant plant pathogens.
It would be of interest also to compare these group Iintrons with those in the nuclear rDNA, especially 26SrDNA (LSU), of other pathogenic fungi. Phylogeneticanalysis of group I introns in small-subunit (SSU) rRNA
*Present address:EMAI, NSW Agriculture, PMB 8, Menangle, NSW2570, Australia
had been undertaken to assess their origin (Bhattacharyaet al. 1994). To date, comparatively few group I intronsin the LSU gene have been uncovered. Comparison withthese LSU rRNA group I introns would provide an in-sight into the origin of these three group I introns ofG.graminiswhich shared little sequence similarity even intheir catalytic core elements (Tan and Wong 1996). Thefew group I introns (with known secondary structures)reported from LSU rDNA of fungi (Liu and Leibowitz1993; Mercure et al. 1993; Neuve´glise and Brygoo 1994)were analyzed together with a small set of three group Iintrons from nuclear 18S rDNA (SSU) of pathogenicfungi (Nishida et al. 1993; De Wachter et al. 1992).Group I intron from the green algaAnkistrodesmus stipi-tatus (Davila-Aponte et al. 1991), the protozoanTetra-hymena thermophila(Kan and Gall 1982) and the myxo-mycete Physarum polycephalum(Otsuka et al. 1983)were included in the analysis.
Methods
The isolates of each variety used in the study were collected from manydifferent locations in Australia and overseas as shown in Table 1. DNAwas extracted as described (Tan et al. 1994) from freeze-dried mycelialculture. Eight primers (Fig. 1) used in this study were designed basedon the alignment of partial 26S rDNA sequences of aPhialophorasp.(lobed hyphopodia) isolate, DAR 32098; aG. g.var. graminis isolate,DAR 24167; aG. g. var. avenaeisolate, 91/56 and aG. g. var. triticiisolate, 90/921 (accession No. U17158, U17159, U17160, and U17161in GenBank, respectively).
Amplification of DNA.Specific DNA regions were amplified bypolymerase chain reactions (PCR) using DNA polymerase fromTher-mus aquaticus(Boehringer Mannheim). The PCR amplification reac-tions were performed in 40ml of 50 mM Tris (pH 9.0), 20 mM NaCl,1% Triton X-100, 0.1% gelatin, 3 mM MgCl2, 200 mM of each of thefour deoxynucleotides dATP, dTTP, dCTP, and dGTP (Promega); 50ng of each of a primer pair; 10 ng of genomic DNA and 1.5 units ofTaqpolymerase. Control reactions include all components except templateDNA.
Amplification was performed in a Corbett Research FTS-960 Ther-mal Sequencer programmed for 1 cycle of 95°C for 3 min, 57°C for 30s, and 72°C for 1.5 min, followed by 4 cycles of 94°C for 1 min, 57°Cfor 30 s, and 72°C for 1.5 min; followed by 25 cycles of 94°C for 30s, 60°C for 30 s and 72°C for 1.5 min; and finally followed by a 10-minincubation at 72°C. After amplification, one-tenth of the reaction prod-ucts were visualized by electrophoresis in 1% horizontal agarose gels.
Restriction Digestion and Electrophoresis.Amplified DNA frag-ments were purified with Wizard PCR Preps DNA Purification System(Promega) and eluted in 40ml sterile water; 10ml of purified DNAfragments was used for restriction digestion as described in Sambrooket al. (1989) using the 10× digestion buffer supplied with the enzyme.The restriction fragments were separated in mini (9 × 6.5 cm) 7%polyacrylamide gels and visualized by staining with ethidium bromide.
Sequencing Reactions.Amplified fragments of representative iso-lates (Fig. 3) were sequenced using dye-labeled dideoxy-nucleotidesand Taq polymerase in the Applied Biosystems (ABI, USA) 373ADNA sequencer at Westmead Hospital, Sydney. All sequencing traceswere checked visually and edited manually.
Phylogenetic Analyses of Intron Sequences.The phylogeneticanalyses included 10 LSU group I introns and three SSU group I
introns. The LSU group I intron sequences (with GenBank accessionnumbers shown where available) included were:G. graminisintron T(U17161), G. graminis intron A (U17160),G. graminis intron AT(U17160 and U17161),Candida albicans(X74272),Beauveria brong-niartii (Neuveglise and Brygoo 1994),Pneumocystis cariniistrain Pc1(L13615),P. carinii strain Pc3 (X62396),P. polycephalum(Otsuka etal. 1983),T. thermophila(V01416); and the SSU group I intron se-quences (with GenBank accession numbers where available) includedwere Ustilago maydis(X62396), Protomyces inouyei(Nishida et al.1993), andA. stipitatus(X56100). The sequences were initially aligned
Table 1. G. graminisisolates used in the study and their identitiesbased on type of hyphopodia and ascospore length (Walker 1972) andrestriction fragment length polymorphisms of 26S rDNA (Tanet al.1994)
Isolate code Host Origin
Var. avenaeDAR 37722 Avena sativaL. Wales, UKDAR 37725 Agrostissp. Tumut, NSWOP1 Turfgrass Colorado, USA92/1 Agrostissp. Little Bay, NSW91/56 Turfgrass Kingston Heath, Vic.Gp 27 A. sativa Wexford, IrelandGp 33 A. sativa Wexford, IrelandGp 36 A. sativa Wexford, IrelandGp 41 A. sativa Wexford, IrelandPO86/441 Triticum aestivumL. Wexford, Ireland
Var. tritici, subgroup T1
DAR 17916 T. aestivum Dubbo, NSWDAR 23159 T. aestivum Zeeland, DenmarkDAR 23160 T. aestivum Zeeland, DenmarkDAR 23161 T. aestivum Zeeland, Denmark90/921 Hordeum vulgare Griffith, NSW90/1071 T. aestivum Widgelli, NSWC2 T. aestivum Washington State, USAC3 H. leporinumLink Cowra, NSW92/35 T. aestivum Hillston, NSW90/19 T. aestivum Harden, NSWPO81-149 Secale cereale Suffolk, UKPO81-158 H. vulgare Suffolk, UKPO82-196 T. aestivum Bedfordshire, UKPO82-220 T. aestivum Avon, UK
Var. tritici, subgroup T2
DAR 23580 T. aestivum Carnamah, WADAR 37726 T. aestivum Tallimba, NSW92/52 A. sativa Walcha, NSW92/53 A. sativa Walcha, NSWWUF1 T. aestivum Great Northern Hwy,
WA
Var. tritici, subgroup T3
90/20 T. aestivum Morongla, NSW92/36 Native grass
(unidentified)Walcha, NSW
92/37 Native grass(unidentified)
Walcha, NSW
PO81/159 H. vulgare Suffolk, UKPO82/222 H. vulgare Kent, UKWUF 127 T. aestivum Minginew, WADAR 37721 T. aestivum Rothamsted, UKOTACARS A. sativa Cowra, NSW88/1665D A. sativa Binalong, NSWPO86/439 A. sativa Wexford, Ireland274 T. aestivum Badgingarra, WA
638
at the 58-P-Q-R-S-38 regions, and then other flanking conserved regionswere subsequently added to the alignment on the basis of secondarystructure considerations (Michel and Westhof 1990). Stems P5b andP5c were not present in all of the group I introns analyzed here andhence were not included in the alignment. A total of 139 nucleotideswere included in the alignment (Fig. 2).
The distance method and the maximum-likelihood methods wereimplemented with the Phylip 3.57c to analyze the evolutionary rela-tionships amongst the 13 intron sequences. Bootstrap resamplings wereused in neighbor-joining and global rearrangement option was used inmaximum-likelihood analyses to assess the stability of monophyleticgroups.
Results
Primersgt1 and28N amplified a 488-bp fragment con-taining intron T (Fig. 1). Intron T was found in one var.avenaeisolate and all var.tritici isolates of subgroups T1and T2 (Table 2). Isolates in subgroup T3 of var.triticigave two fragment sizes (1,639 bp and 2,035 bp) whenamplified with primers28F and 28N. Isolates in sub-group T3 that produced the lower fragment did not pos-sess intron T (subgroup T3−) whereas isolates that gavethe higher fragment possessed intron T (subgroup T3+;Table 2). Restriction analysis of all amplified intron Twith restriction enzymesHae III, RsaI, Pst I, andHindIII gave one profile specific to each enzyme. Intron Twas thus hypothesized to be inserted at the same site inall isolates analyzed.
Fragments of six isolates representative of each of thevarieties and subgroups were amplified with primersgt1and28Nand sequenced with primergt2 (Fig. 3A). Therewas no base difference in the catalytic core elements ofthe intron. Two base changes from C to T were observedin isolates DAR 17916 and WUF 127. Both occurred onthe P2 arm of the intron. Two base changes were ob-served on the P2.1 arm. A base change from T to C wasobserved in isolates—88/1665D, DAR 37722, and DAR
17916; and the other from A to G in isolates—DAR37721, DAR 17916, and WUF 127. The direction ofchange was unknown and statements of observed basechanges in intron T had no connotation of ancestry.
Primersgtga1 and gt1rev amplified a 541-bp frag-ment containing intron AT. Intron AT was found in allisolates of var.avenae,var. tritici subgroup T1, and var.tritici subgroup T3 (Table 2). It was absent in var.tritici,subgroup T2.Rsa I analysis gave no site difference inintron AT among the isolates. However, twoMsp I re-striction profiles, mA and mT (Table 2) were observed.All var. avenaeisolates gave the mA profile. All exam-ined var.tritici subgroup T1 isolates had the mT profileexcept isolate 90/921 and 90/1071 which had the mApattern (Table 2). Var.tritici, subgroup T3− also had themT Msp I restriction profile, whereas both profiles werefound in subgroup T3+ isolates.
The mT profile had one 105-bp fragment instead oftwo fragments of 51 bp and 54 bp (which appeared as adoublet in the mA profile). Sequence analysis of sevenrepresentative isolates (Fig. 3B) attributed the loss of theMsp I site between the 51-bp and 54-bp fragments to abase change of the penultimate G of the sequence‘CCGG’ to A. The base adjacent to the 38 end of thesecondMsp I site of the mA profile was observed tochange from G to A in the representative isolates (WUF127, 37721, 17916, 90/20) with the mT profile. Boththese base changes occurred on the P2.1 arm of the in-tron. The thirdMsp I site was similar in the two profiles.
Sequence analysis of intron AT revealed other basedifferences. A base change from T to C on the P2.1 arm,one from A to T on the P6b arm, and a third from G toA on the P8 arm were observed in a subgroup of therepresentative var.tritici isolates with the mT profile(17916, 90/20). Another base difference was observed onthe P6b arm, with one group—90/921, 91/56, and WUF127 possessing a ‘‘C’’ and the other group (Fig. 3B)having a ‘‘T.’’ Both restriction and sequence analysissuggested that intron AT was inserted at the same site invar. avenaeand var.tritici.
Primers28F and ga2 amplified a 509-bp fragmentbearing intron A. Intron A had the sameHha I restrictionpattern for all examined isolates.Hae III and Msp Ianalysis of intron A gave two profiles of HA or HT andMA or MT, respectively, for each of the enzymes. Var.avenaeand var.tritici subgroup T2 had the HA and MAprofiles, var.tritici subgroup T3− had the HT and MTprofiles and subgroup T3+ had either profiles (Table 2)for each of the enzymes.
The HA profile of intron A was observed to display anadditional fragment of 131 bp compared with profile HT(data not shown). Sequence data (Fig. 3C) suggested thatthe observed absence of the 131-bp fragment in the HTprofile was due to the presence of aHae III site locatedat 12 bp from the proximal end of the fragment. TheHaeIII site arose from a base change of a ‘‘T’’ in isolates
Fig. 1. Schematic diagram to illustrate alignment of 26S rDNA se-quences between primers28F and28N of (a) var. tritici, 90/921,(b)var.avenae,91/56,(c) var.graminis,DAR 24167, and(d) Phialophorasp. (lobed hyphopodia), DAR 32098.Open boxesrepresent homolo-gous 26S rDNA sequences andshaded boxesrepresent intron se-quences. A, AT, and T indicate the locations of the three group Iintrons, intron A, intron AT, and intron T, respectively. Thearrowsindicate the positions and orientation of primers used in this study.Sequences of the oligonucleotides were as follows:28F(gtgatttctgc-ccagtgctctg),ga2(attagatgacgaggcatttggc),ga3(cttttacgtggcagacacgc),gtga1(ccagcgcccgaaattacgtccct),gt1rev(gtgaacaatccaacgcttaccg),gt1(ga t t taggtgacacta tagaat tcggtaagcgt tggat tg t tcac) ,gt2(gttcctattggtggtaatag), and28N(actaacctgtctcacgac).
639
with the HA profile to a ‘‘C’’ in isolates with the HTprofile. ThisHae III site thus gave rise to two fragmentsof 12 bp (undetected) and 119 bp; the latter migrated asa doublet with the 117-bp fragment in the HT profile(data not shown).
One of the fragments in the MA profile is a large317-bp fragment whereas the MT profile gave twoshorter fragments of 209 bp and 108 bp in addition totwo other fragments of 128 bp and 59 bp (results notshown). The sequence data had shown that intron A withthe MT profile had fourMsp I sites whereas the MAprofile had only two (Fig. 3C). One of the two extraMspI sites in isolates with the MT profile resided on the317-bp fragment of the MA profile which gave rise to the209-bp and 108-bp fragments inMsp I analysis. Theother extraMsp I site was situated 2 bp distal from thefirst Msp I site of the MA profile and accounted for the59-bp fragment in the MT profile. Both these two extraMspI sites in the MT profile arose from a base change ofa ‘‘T’’ to a ‘‘C’’ in the sequence CTGG located on theP5b and P6b arm of the intron.
Analysis of sequence data of intron A of seven rep-resentative isolates (Fig. 3C) revealed 13 other base dif-ferences. Six of these distinguished the isolates into thetwo groups which corresponded with the two groups re-solved byHae III and Msp I analysis. Five of these basechanges; G→ A, C → T, A → G, G→ A, and T→ Cwere located on the P1, P6b, P6c, P6a, and P9 arms of theintron, respectively. The sixth base change was a deletionof a base ‘‘C’’ in the P8 arm in isolates (90/20,WUF127). Nothing can yet be inferred from the otherseven base differences observed in the sequences ana-
lyzed. In spite of 15 base changes observed in the intronA sequences, no base difference was detected in the cata-lytic core elements.
Discussion
The 26S rRNA genes ofGaeumannomyces graminisex-hibited length polymorphisms due to the presence ofgroup I introns (Tan and Wong 1996). The investigationof the distribution of the three group I introns inG.graminis has enabled the origin of these introns to beassessed as well as the evolution of the varieties to beunderstood in relation to their pathogenicity. No intronwas found in var.graminisandPhialophorasp. (lobedhyphopodia) which are generally not pathogenic towheat, oats, and barley.
Var. avenaewith the exception of isolate DAR 37722possessed both intron A and intron AT. Restrictionanalysis of intron A in var.avenaerevealed noHha I,HaeIII, and MspI site differences. Sequence data of 379bases of intron A of representative isolates of 91/56,37722, and OP1 (Fig. 3C) revealed no site difference.Similarly there were noRsaI andMsp I site differencesdetected in intron AT of var.avenae.Sequence analysisof intron AT of var.avenaeisolates of 91/56 and 37722(Fig. 3B) showed only one site difference which lay out-side the catalytic core elements. The same intron A andthe same intron AT thus existed in var.avenae.
DAR 37722 was the only var.avenaeisolate to haveintron T in addition to intron A and intron AT. The
Fig. 2. Partial alignment of 139 nucleotides of 13 group I intron sequences at the catalytic core regions, P, Q, R, and S [boxed, Cech TR (1988)]and their flanking regions; and at stems P1 and P2. Thestars (*) mark breaks in the intron sequences anddash (-)mark alignment gaps.
640
sequence data of intron T of 37722 was similar to that ofvar. tritici isolates—23580 and 88/1665D (Fig. 3A).These isolates also shared the same restriction profiles intheir intron A and/or intron AT (Table 2). Furthermore,only seven base differences were observed between in-
tron T of 37722 and the other var.tritici isolates. Thesebase differences were located outside the catalytic coreelements. The catalytic core elements were thus con-served in all intron T sequences analyzed and hence thesame intron T existed in both var.avenaeand var.tritici.
Table 2. Fragmentsa (bp) amplified with the indicated pairs of primers (see Methods and Fig. 1) and their restriction profiles (in brackets)
a Fragment sizes have been determined by comparison of fragments amplified with those sequenced from DAR 24167, DAR 32098, 91/56, and90/921 (accession No. U17158, U17159, U17160, and U17161, respectively, in GenBank)b Restriction analysis of intron T with restriction enzymesHae III, RsaI, Pst I, andHind III gave one profile specific to each enzymec Two restriction profiles were observed for each of the restriction enzymesHae III and Msp I. The profiles are HA or HT forHae III digests andMA or MT for Msp I digests (see text)d Two Msp I restriction profiles, mA or mT, were observed (see text).RsaI analysis gave no site differencee Ref: Tan and Wong (1996)f (N): restriction analysis was not done
641
Var. tritici was observed to be the most complexgroup of pathogens with respect to the distribution of thethree group I introns. They possessed two or all of thethree group I introns (intron A, intron T, and intron AT)discovered in the 26S rDNA ofG. graminis.All threepossible combinations of a set of two introns [(T, AT),(A, T), and (A, AT)] could be found in var.tritici (Ta-ble 2).
Var. tritici subgroup T1 had the intron combination of(T, AT). Var. tritici subgroup T2 possessed the set (A,T). Isolates of var.tritici subgroup T3 that possessed twointrons (subgroup T3−) had the third combination of (A,AT). Isolates of var.tritici subgroup T3 that gave thehigher fragment of 2,035 bp during amplification withprimers28F and 28N (subgroup T3+) had all the threegroup I introns.
Intron T was found in all var.tritici isolates exceptsubgroup T3−. No site differences inHae III, RsaI, PstI, and Hind III were detected in intron T among theisolates possessing it. Sequence analysis of intron T ofrepresentative isolates (Fig. 3A) revealed seven base dif-ferences which resided outside the catalytic core ele-ments. Two of these base changes were C→ T locatedon the P2 arm of the intron. These two base differencesappeared to distinguish the representative isolates intothe two groups which correlated with the two groupsresolved by restriction analysis of their intron A and/orintron AT (Table 2). The restriction site, ACTGGG, (Fig.3A) was present in var.tritici isolates with the restrictionprofiles of (HA, MA) and/or mA in their intron A and/orintron AT, respectively. This site was absent in the othergroup due to a base change of C to T. This base changecan thus be confirmed for intron T sequences of otherisolates by using the restriction enzymeBfi I in futurework.
Those var.tritici isolates that did not possess intron T(subgroup T3−) had the same set of two introns, intronAT and intron A, as var.avenae.These isolates werepreviously indistinguishable from var.avenaeby restric-tion fragment-length polymorphism (RFLP) studies ofthe rDNA (Tan et al. 1994) but were separable by theconventional morphological criterion of ascospore length(Walker 1972). This work had shown that both intron ATand intron A in var.tritici subgroup T3− could be dis-tinguished from those in var.avenaeby restriction analy-sis (Table 2).
Sequence analysis of intron A in representative iso-lates (Fig. 3C) revealed 15 base differences amongstthem. Eight of these distinguished the isolates into twogroups that correlated with the two groups defined byMsp I and Hae III restriction analysis (Table 2). Hence,these eight base differences separated intron A of var.avenaefrom that of var. tritici, subgroup T3−. Theseeight base differences were located outside the catalyticcore elements in the P1, P5b, P6a, P6b, P6c, P8, and P9arms of the intron. Two of these base changes accountedfor the two distinguishing restriction profiles observedfor each of the enzymes,Hae III and Msp I.
Sequence data of intron AT of representative isolates(Fig. 3B) uncovered two base differences between var.avenaeand var.tritici, subgroup T3−. Both occurred onthe P2.1 arm. One of these base changes resulted in theloss of anMsp I site to give rise to the mT profile.
The catalytic core elements were conserved in all in-tron A sequences analyzed. They were similarly con-served in all intron AT sequences obtained. Thus thesame ancestral intron A and intron AT must have existedin var. avenaeand var.tritici and these intron sequenceshave coevolved with their host.
The existence of intron A, intron T, and intron AT in
Fig. 3. Alignments of sequences of representative isolates (with ac-cession numbers in descending order) of(A) intron T (U17161,L81106, L81105, L81107, L81108, L81109, and L81110)—theBfi Isite that could be used to discriminate the intron T sequences into twogroups isunderlined; (B) intron AT (U17161, U17160, L81111,L81112, L81117, L81113, L81114, L81115, and L81116)—theMsp Isites that were used to distinguish the restriction profiles into mA andmT (Table 2) areunderlined; and (C) intron A (U17160,L80008,L81101, L81102, L81102, L81103, and L81104)—theHae III
(. . . .) andMsp I (——) sites that differentiate the restriction profilesinto HA or HT and MA or MT respectively (Table 2) areunderlined.Only sections displaying nucleotide differences are shown. Thenum-bers above alignmentsin A, B and C indicate the positions of thenucleotides from the 58 nucleotide of intron T of 921, intron AT of 921,and intron A of 91/56, respectively. Thestars (*) mark breaks in theintron sequences; adot (.) indicates identity with the top sequence; adash (-)indicates an alignment gap.
642
both var.avenaeand var.tritici suggested strongly thatthey were acquired by a common ancestor of var.avenaeand var.tritici (Fig. 4). That var.graminisdid not pos-sess any of the three introns implied that the acquisitionof these introns must have occurred after the branchingof var.graminisfrom the ancestor of var.avenaeand var.tritici. The evolutionary relationships of the threeG.graminisvarieties as deduced from the acquisition of theintrons were consistent with the results obtained by thephylogenetic analysis of internal transcribed sequencesof rDNA (Bryan et al. 1995).
All the var. avenaeisolates except 37722 had onlyintron A and intron AT (Table 2). DAR 37722 had allthree introns. This suggested that loss of intron T couldoccur in var.avenaeisolates with three introns to giveisolates with intron A and intron AT. Similarly, acquisi-tion of intron T could occur to give var.avenaeisolateswith three introns. The process of intron loss and intronacquisition is in a dynamic flux with the equilibriumtoward var.avenaewith intron A and intron AT.
Var. tritici subgroup T3+ (except WUF 127 and DAR37721) possessed all three introns which showed remark-able sequence similarity to those of the var.avenaeiso-late, DAR 37722. Loss of intron A could occur to givevar. tritici subgroup T1 (90/921, 90/1071), and loss ofintron AT could occur to give var.tritici subgroup T2(Fig. 4). Intron loss and intron acquisition in this systemis also an active reversible process with an equilibrium inwhich the number of isolates in subgroup T3+ and sub-
group T2 far exceeded the number of isolates in sub-group T1 (with mA profile in intron AT).
Restriction and sequence analysis showed that intronA and intron AT coevolved in concert with their host,resulting in the possibility of differentiating intron AT invar. avenaefrom those in var.tritici (subgroup T1 andsubgroup T3−) and intron A in var.avenaefrom those invar. tritici (subgroup T3−). Sequence analysis of intron Tfrom representative isolates gave some evidence that in-tron T also coevolved with their host. Further analysis isrequired to confirm this preliminary observation that thetwo groups defined by intron T analysis correspondedwith the two groups resolved by restriction analysis oftheir corresponding intron A and/or intron AT (Table 2).
Isolate 37721 had all three introns. Its intron A hadthe same restriction profiles (HA, MA) as other isolatesin subgroup T3+ but its intron AT had undergone basechanges to give the mT restriction profile (Table 2). Se-quence analysis had clustered intron T of DAR 37721with those of isolates possessing the (HA, MA) and/ormA profiles in their intron A and/or intron AT, respec-tively (data not shown). This suggested that loss of intronAT could occur in DAR 37721 to an isolate of var.tritici,subgroup T2. Conversely, an intron AT (with the mTprofile) could be laterally transferred into var.tritici sub-group T2 to give an isolate of the type of DAR 37721(Fig. 4). There is at present no evidence to suggest thatloss of intron A from DAR 37721 could occur. This isbecause DAR 37721 has the mT profile for its intron AT,
Fig. 4. Schematic diagram toillustrate the inheritance and mobility ofthree group I introns (AT, A, and T) in26S rDNA of G. graminisvarieties.The restriction profiles as designated inTable 2 were indicated beside therespective introns.
643
and the group of intron T sequences, to which DAR37721 belonged, existed together only with intron ATwith the mA profile.
Isolate WUF 127 had undergone evolutionary basechanges in both intron AT and intron A to give the pro-files mT and (HT, MT), respectively (Table 2, Fig. 4).Loss of intron A could occur to give subgroup T1 (except90/921, 90/1071) and loss of intron T could occur to givesubgroup T3− (Fig. 4). The equilibrium in this systemappeared to shift toward either subgroup T1 or subgroupT3−.
The distribution studies have indicated that thesegroup I introns are highly mobile in the genetic systemsthey reside in. The mobility of group I introns that en-code endonucleases is attributed to the endonucleaseswhich recognize and cleave intronless alleles to insert acopy of the intron by a double-stranded DNA break andrepair mechanism (Dujon 1989; Doolittle 1993; Lam-bowitz and Belfort 1993). As these group I introns inG.graminis lack endonuclease coding regions, their mobil-ity must result from the operation of another pathway.The transesterification reactions in the splicing of groupI introns are reversible, and thus it had been proposedthat reverse splicing followed by reverse transcription bythe recombined RNA and integration into genomic DNAcould contribute to intron mobility (Sharp 1985). Theidentification of intron-related reverse transcriptase-likeproteins will facilitate the elucidation of the mechanismof the comings and goings of these introns.
Both phylogenetic analyses of the examined group Iintron sequences using the maximum likelihood ap-proach (Felsenstein 1981, Phylip 3.5c) with global rear-rangement (Fig. 5) and the neighbor-joining method(Saitou and Nei 1987) based on distances of nucleotidedifferences (Kimura 1980, data not shown) gave a simi-lar clustering of each of the three group I introns in threeseparate monophyletic groups. Members of each mono-phylectic group have the same insertion site in the 26SrRNA gene.
Intron A is closely related to the group I self-splicingintron of P. carinii isolate, Pc1 from rat andP. cariniiisolate, Pc3 from human. All three have the same inser-tion point in the LSU gene (Fig. 5). Similarly, intron ATwas clustered with the intron I ofP. polycephalumandthey both shared the same insertion site in the LSUrDNA. On the same note, intron T and the group I self-splicing intron of the entomopathogenic fungusB.brongniartii, which had the same insertion point, werefound to be closely related (Fig. 5).
The degree to which group I introns were related toeach other was correlated with their insertion position inthe ribosomal genes. Results suggest that group I intronswith a similar insertion site across distantly related or-ganisms (e.g.,G. graminisandP. polycephalum) couldhave a common ancestry. The group I introns inG.graminishad thus provided a very useful model for un-
derstanding the evolution of group I introns in thenuclear LSU gene. Both lateral transfer and vertical in-heritance had been involved in the evolution of theseelements and this process was intimately linked with theevolution of the host organisms as well. This system alsoshowed that intron loss could occur after intron acquisi-tion, and the whole system appears to be in a geneticflux, with different equilibrium points for different sys-tems. These events did not appear to have occurred atrandom, and it would be interesting to pursue the drivingforce behind them.
Acknowledgments. Thanks are expressed to Dr. P. T. W. Wong andMr. M. Priest for access to fungal cultures in N.S.W. Agriculture Her-barium, to Mr. L. Turton for photography, and to Mr. B. Neal forsequencing.
References
Bhattacharya D, Surek B, Ru¨sing M, Damberger S, Melkonian M(1994) Group I introns are inherited through common ancestry inthe nuclear-encoded rRNA of Zygnematales (Charophyceae). ProcNatl Acad Sci USA 91:9916–9920
Bryan GT, Daniels MJ, Osbourn AE (1995) Comparison of fungiwithin the Gaeumannomyces-Phialophoracomplex by analysis ofribosomal DNA sequences. Appl Environ Microbiol 61(2):681–689
Cech TR (1988) Conserved sequences and structures of group I introns:building an active site for RNA catalysis—a review. Gene 73:259–271
Davila-Aponte JA, Huss VSR, Sogin ML, Cech TR (1991) A self-splicing group I intron in the nuclear pre-rRNA of the green alga,Ankistrodesmus stipitatus.Nucleic Acids Res 19:4429–4436
De Wachter R, Neefs J-M, Goris A, Van de Peer Y (1992) The genecoding for small ribosomal subunit RNA in the basidiomyceteUs-tilago maydiscontains a group I intron. Nucleic Acids Res 20:1251–1257
Doolitle RF (1993) The comings and goings of homing endonucleasesand mobile introns. Proc Natl Acad Sci USA 90:5379–5381
Fig. 5. Unrooted phylogenetic tree of examined group I intron se-quences constructed with Phylip 3.5c DNA maximum-likelihood pro-gram (Felsenstein 1981) with the global rearrangement option. A totalof 747 trees were examined. The two segments marked between the‘‘ x’’s have less than 95% confidence limits; the two segments markedbetweenasteriskshave greater than 95% confidence limits; and the restof the segments have greater than 99% confidence limits. Thebarindicates the distance corresponding to 10 changes per 100 nucleotidepositions.
644
Dujon B (1989) Group I introns as mobile genetic elements: facts andmechanistic speculations—a review. Gene 82:91–114
Felsenstein J (1981) Evolutionary trees from DNA sequences: a maxi-mum likelihood approach. J Mol Evol 17:368–376
Kan NC, Gall JG (1982) The intervening sequence of the ribosomalRNA gene is highly conserved between twoTetrahymenaspecies.Nucleic Acids Res 10:2809–2822
Kimura M (1980) A simple method for estimating evolutionary rate ofbase substitutions through comparative studies of nucleotide se-quences. J Mol Evol 16:111–120
Lambowitz AM, Belfort M (1993) Introns as mobile genetic elements.Annu Rev Biochem 62:587–622
Liu Y, Leibowitz MJ (1993) Variation and in vitro splicing of group Iintrons in rRNA genes. Nucleic Acids Res 21:2415–2421
Mercure S, Montplaisir S, Lemay G (1993) Correlation between thepresence of a self-splicing intron in the 25S rDNA ofC. albicansand strains susceptibility to 5-fluorocytosine. Nucleic Acids Res21:6020–6027
Michel F, Westhof E (1990) Modelling of the three-dimensional archi-tecture of group I catalytic introns based on comparative sequenceanalysis. J Mol Biol 216:585–610
Neuveglise C, Brygoo Y (1994) Identification of group-I introns in the28S rDNA of the entomopathogenic fungusBeauveria brongniar-tii. Curr Genet 27:38–45
Nishida H, Blanz PA, Sugiyama J (1993) The higher fungusProtomy-ces inouyeihas two group I introns in the 18S rRNA gene. J MolEvol 37:25–28
O’Dell M, Flavell RB (1992) The classification of isolates ofGaeu-
mannomyces graminisfrom wheat, rye and oats using restrictionfragment length polymorphisms in families of repeated DNA se-quences. Plant Pathol 41:554–562
Otsuka T, Nomiyama H, Yoshida H, Kukita T, Kuhara S, Sakaki Y(1983) Complete nucleotide sequence of the 26S rRNA gene ofPhysarum polycephalum:its significance in gene evolution. ProcNatl Acad Sci USA 80:3163–3167
Ou SH (1972) Rice diseases. Commonwealth Mycological Institute,Kew, United Kingdom
Saitou N, Nei M (1987) The neighbour-joining method: a new methodfor reconstructing phylogenetic trees. Mol Biol Evol 4:406–425
Sambrook J, Fritsch EF, Maniatis T (1989) Molecular cloning a labo-ratory manual. 2nd ed. Cold Spring Harbor Laboratory Press, ColdSpring Harbor, NY
Sharp PA (1985) On the origin of RNA splicing and introns—a review.Cell 42:397–400
Tan MK, Wong PTW (1996) Group I introns in 26S rRNA genes ofGaeumannomyces graminisas possible indicators of host specific-ity of G. graminisvarieties. Mycol Res 100(3):337–342
Tan MK, Wong PTW, Holley MP (1994) Characterization of nuclearribosomal DNA(rDNA) inGaeumannomyces graminisand corre-lation of rDNA variation withG. graminisvarieties. Mycol Res98(5):553–561
Walker J (1972) Type studies onGaeumannomyces graminisand re-lated fungi. Trans Br Mycol Soc 58(3):427–457
Yao JM (1993) The discovery and classification of the corn take-allpathogen in China abstr. 8.1.12. Abstracts of the 6th InternationalCongress of Plant Pathology 132
