What is a nucleotide??

What are the base pairing rules in DNA??

In RNA??

What is the structure of the DNA?

Protein synthesis is the process by which genes within DNA are decoded into instructions for protein production in the cells.

This process takes place in three steps:

-Step 1→ Transcription -Step 2→ Translation -Step 3 → Amino Acid Formation

Is a nucleic acid Consist of a long chain of nucleotides Three types of RNA:

-mRNA: serves as messengers from DNA to the rest of the cell

-rRNA: makes up the ribosomes, clamps on to mRNA and uses its information to

assemble amino acids

-tRNA: transports amino acids to the ribosomes to be assembled into proteins.

Sugar in RNA →ribose Sugar in DNA→ deoxyribose RNA → single-stranded DNA → double stranded RNA contains uracil DNA contains thymine

In the nucleus, enzymes make an RNA copy of a portion of DNA

Requires an enzyme called RNA polymerase

During transcription, RNA polymerase binds to DNA and separates the DNA strands.

RNA polymerase then uses one strand of DNA as a template strand to form RNA

DNA unwinds, becomes single stranded. Serves as template for synthesizing mRNA

mRNA molecules move to nucleus where specific codes are transcripted and carried into cytoplasm

A(from DNA)U(RNA)C (from DNA) GT(from DNA)A

Results of Transcription-one single-stranded RNA molecule

is formed-mRNA is produced

http://highered.mcgraw-hill.com/sites/0072507470/student_view0/chapter3/animation__mrna_synthesis__transcription___quiz_1_.html

AATGCCATTAATCGCCGGATGACT

What is the structure of RNA?

What are the results of transcription?

What is the enzyme that is required for transcription?

language of the mRNA is translated into the language of proteins

Takes place in the ribosomes tRNA transfers amino acids to the site

of the growing protein chain (polypeptide).

3 steps initiation, elongation, termination

Translation begins at the start codon AUG Each tRNA molecule recognizes a specific,

three base-pair mRNA code or codon Anti-codon:

A sequence of three adjacent nucleotides located on one end of transfer RNA

Translation Video

When trying to find the amino acid sequence it is important to remember that you are only reading from the mRNA codons NOT the tRNA anti-codons

Stop codons are present. UAA, UGA, UAG is the stop codon that signals for the termination of the protein synthesis process. DOES NOT CODE FOR AN AMINO ACID

The nucleotide sequence transcribed from DNA to RNA acts as a genetic message

protein synthesis video

What is a code?-A system of words, letters, figures, or

other symbols used to represent others

Living organisms have their own code called the genetic code

the language of the mRNA instructions

it is read three letters at a time

Ex: UCGCACGGU ↓

UCG-CAC-GGU ↓

Serine-Histidine-Glycine

Codons represent the different amino acids

Genetic Code Video