1 School of Chinese Medicine China Medical University No 91 Hsueh-Shih Road Taichung 40402 Taiwan2Division of Urology Department of Surgery Taichung Branch Buddhist Tzu Chi General Hospital Taichung 40402 Taiwan3Department of Biotechnology Asia University Taichung 41354 Taiwan4 Institute of Biochemistry and Molecular Biology National Yang-Ming University Taipei 11221 Taiwan5 Research Institute of Biotechnology Hungkuang University Taichung 43302 Taiwan
Correspondence should be addressed to Ching-Ting Lin gingtingmailcmuedutw
Received 10 May 2013 Accepted 17 July 2013
Academic Editor Seung-Heon Hong
Copyright copy 2013 Tien-Huang Lin et alThis is an open access article distributed under theCreative CommonsAttribution Licensewhich permits unrestricted use distribution and reproduction in any medium provided the original work is properly cited
Klebsiella pneumoniae is the predominant pathogen isolated from liver abscess of diabetic patients in Asian countries With thespread of multiple-drug-resistant K pneumoniae there is an increasing need for the development of alternative bactericides andapproaches to block the production of bacterial virulence factors Capsular polysaccharide (CPS) especially from the K1 and K2serotypes is considered the major determinant for K pneumoniae virulence We found that extracts of the traditional Chinesemedicine Fructusmume inhibited the growth ofK pneumoniae strains of both serotypes Furthermore Fructusmume decreased themucoviscosity and the CPS produced in a dose-dependentmanner thus reducing bacterial resistance to serumkilling Quantitativereverse transcription polymerase chain reaction analyses showed that Fructus mume downregulated the mRNA levels of cpsbiosynthesis genes in both serotypes possibly by increasing the intracellular iron concentration in K pneumoniae Moreover citricacid a major organic acid in Fructus mume extracts was found to have an inhibitory effect on growth and CPS biosynthesis in Kpneumoniae Taken together our results indicate that Fructus mume not only possesses antibacterial activity against highly virulentK pneumoniae strains but also inhibits bacterial CPS biosynthesis thereby facilitating pathogen clearance by the host immunesystem
1 Introduction
Klebsiella pneumoniae is an enteric gram-negative bacteriumthat causes community-acquired diseases including pneu-monia bacteremia septicemia and urinary and respira-tory tract infections particularly in immunocompromisedpatients [1ndash4] In Asian countries especially in Taiwan andKorea K pneumoniae is the predominant pathogen respon-sible for pyogenic liver abscess in diabetic patients [2 3 5 6]In recent years reports of Klebsiella liver abscess (KLA) inwestern countries have also been accumulating [6 7] Amongthe virulence factors identified in K pneumoniae capsularpolysaccharide (CPS) is considered as the major determinantfor K pneumoniae virulence Pyogenic liver abscess isolates
often carry heavy CPS loads that could protect the bacteriafrom phagocytosis and killing by serum factors [6ndash8] Thecapsular serotypes of K pneumoniae have been classifiedinto more than 77 known types [9 10] In Taiwan a highprevalence of the K1 and K2 serotypes of K pneumoniae hasbeen documented in liver abscess in diabetesmellitus patients[11] Extended spectrum 120573-lactamase- (ESBL-) producingK pneumoniae for which clinical treatment is difficult hasa wide distribution [4 12] As a result there is an urgentneed to develop a novel antimicrobial strategy to block theproduction of virulence factors
In accordance with the significance of CPS in the phys-iology and pathogenesis of K pneumoniae the biosynthesisof CPS is controlled by a complex network of multiple
2 Evidence-Based Complementary and Alternative Medicine
regulators such as the Rcs system RmpA RmpA2 KvhRKvgAS and KvhAS [13ndash16] Recently we found that CPSproduction by K pneumoniae was controlled by externaliron and glucose concentrations via the regulation of ferricuptake regulator (Fur) and cAMP-dependent carbon catabo-lite repression (CCR) respectively [17 18] Iron availabilityhas been demonstrated to affect multiple cellular functionssuch as oxidative stress energy metabolism acid toleranceand virulence factor production in many bacteria [19ndash22]Likewise cAMP signaling has been demonstrated to regulatethe expression of various genes encoding carbon metabolismenzymes and virulence factors such as flagella fimbriaeprotease exotoxin and secretion systems [23ndash32] Thesestudies indicate that in response to specific environmentalsignals pathogenic bacteria express genes encoding virulencefactors that help them to establish a successful infection
Traditional Chinese medicine (TCM) has been a richnatural source of antimicrobial agents for treating variousinfectious diseases for more than 4000 years Mei Prunusmume has long played an important role in human diet andhealth Fructus mume the smoked fruit of Prunus mume is aTCMthat has been used to relieve cough treat ulceration andimprove digestive function Prunus mume extract has alsobeen shown to inhibit Helicobacter pylori infection which isassociated with gastritis and gastric ulcers [33] In additionFructus mume extract is a potential candidate for developingan oral antimicrobial agent to control or prevent dentaldiseases associated with several oral pathogenic bacteria [34ndash36] A study involving high-pressure liquid chromatography(HPLC) analysis has also demonstrated that citric acid is themain organic acid in Fructus mume extract [35 36]
In this study we aimed to assess the antibacterial activityof Fructusmume againstK pneumoniae and 2 highly virulentclinical strains NTUH-K2044 and CG43S3 respectivelybelonging to the K1 and K2 serotypes were used in thefollowing analyses We found that Fructus mume not onlypossess antibacterial activity against the 2 K pneumoniaestrains but also reduced bacterial CPS production thusdecreasing the survival rate of bacteria in normal humanserum The regulatory effect of Fructus mume on cps geneexpression in K pneumoniae has also been clarified
2 Materials and Methods
21 K pneumoniae Strains and Primers K pneumoniaestrains and primers used in this study are listed in Table 1Bacteriawere routinely cultured at 37∘C in Luria-Bertani (LB)broth or agar plate
22 Preparation of Fructus mume Extract The concentratedherbalmedicine Fructus mume was purchased fromChuangSong Zong Pharmaceutical Co Ltd (Kaohsiung Taiwan)under the good manufacturing practice (GMP) criteriaFructus mume powder was dissolved in LB broth by end-over-end mixing at room temperature for 2 h The extract ofFructusmumewas collected by centrifugation (13000 rpm for10min) to remove starch and then filtered by 045120583m filter
23 Antibacterial Activity of Fructus mume Extract LB brothor LB broth supplemented with 5 10 or 20mgmL Fructusmume extract was initially inoculated with K pneumoniaeNTUH-K2044 or CG43S3 (approximate 108 CFUmL) Cul-tures were incubated at 37∘C and samples were taken at 02 6 and 24 h to determine the viable counts (CFUmL) foreach strain The assay was performed in triplicate each withtriplicate samples
24 Assessment of K pneumoniae Mucoviscosity and CPSProduction The mucoviscosity of K pneumoniae was mea-sured by a low speed centrifugation as previously described[37] Briefly equal numbers of overnight-cultured bacteriawere centrifuged at 6000 g for 5min Then formation ofthe bacterial pellet could be observed To further evaluatethe CPS amount of K pneumoniae the bacterial CPS wasextracted and then quantified as previously described [38]The glucuronic acid content representing the amount of KpneumoniaeK1 and K2 CPS was determined from a standardcurve of glucuronic acid (Sigma-Aldrich) and expressed asmicrograms per 109 CFU [39]
25 Quantitative Reverse Transcription Polymerase ChainReaction (qRT-PCR) Total RNAs were isolated from early-exponential-phase grown bacteria cells by use of the RNeasymidi-column (QIAGEN) according to the manufacturerrsquosinstructions RNA was DNase-treated with RNase-freeDNase I (MoBioPlus) to eliminateDNA contamination RNAof 100 ng was reverse-transcribed with the Transcriptor FirstStrand cDNA Synthesis Kit (Roche) using random primersqRT-PCR was performed in a Roche LightCycler 15 Instru-ment using LightCycler TaqMan Master (Roche) Primersand probes were designed for selected target sequencesusing Universal ProbeLibrary Assay Design Center (Roche-applied science) and listed in Table 1 Data were analyzedusing the real time PCR software of Roche LightCycler 15Instrument Relative gene expressions were quantified usingthe comparative threshold cycle 2minusΔΔCT method with 23SrRNA as the endogenous reference
26 Bacterial Survival in Serum Normal human serumpooled from healthy volunteers was divided into equalvolumes and stored at minus70∘C before use Bacterial survivalin serum was determined with minor modifications [37]In brief LB broth or LB broth supplemented with 5 10or 20mgmL Fructus mume extract was initially inoculatedwith K pneumoniae NTUH-K2044 or CG43S3 (approx-imate 108 CFUmL) After overnight incubation at 37∘Cthe bacteria were collected washed twice with phosphate-buffered saline (PBS) and then adjusted to approximately1 times 106 CFUmL The reaction mixture containing 250 120583L ofthe cell suspension and 750120583L of pooled human serum wasincubated at 37∘C for 15min The number of viable bacteriawas then determined by plate counting The survival ratewas expressed as the number of viable bacteria treated withhuman serum compared to the number of pretreatmentThe assay was performed in triplicate each with triplicatesamples
Evidence-Based Complementary and Alternative Medicine 3
Table 1 Bacteria strains and primer used in this study
(a)
Strains Descriptions Reference or sourceK pneumoniae
NTUH-K2044 K1 serotype From Dr Jin-TownWangCG43S3 K2 serotype From Dr Hwei-Ling Peng
(b)
Primer Sequence (51015840 rarr 31015840) TaqMan probes TargetRT03 CGTCATCCAGACCAAAGAGC 83 orf1 in K1 cps gene clusterRT04 CCGGTTTTTCAATAAACTCGAC orf11015840 in K2 cps gene clusterRT134 TACCGGGACAGAGAATGAGC 78 orf3 in K1 cps gene clusterRT135 TAACTGGCCAACCCAAGGTRT136 CGTTTTATGGTAATGTTCTCCTCA 26 orf7 in K1 cps gene clusterRT137 TCTGCCCATAACCTCGAAAGRT05 CGATGACCGGCTTTTTAATG 83 orf31015840 in K2 cps gene clusterRT06 CTAGCGGAGATTTGGTACTGCRT07 CAGTCCACCTTTATTCCGATTG 67 orf161015840 in K2 cps gene clusterRT08 AGGTACGACCCCGACTGG
0
50
100
150
200
250
300
LB alone
350
2 6 240 (h)
5 mgmL FM in LB10 mgmL FM in LB20 mgmL FM in LB
lowastlowastlowast
lowast
lowast
No
of b
acte
ria (1
06
cfu
mL)
(a) NTUH-K2044
2 6 24
50
100
150
200
0 0
250
(h)
No
of b
acte
ria (1
06
cfu
mL)
LB alone5 mgmL FM in LB
10 mgmL FM in LB20 mgmL FM in LB
lowast
lowast
lowast
lowast
(b) CG43S3
Figure 1 Antibacterial activity of the Fructus mume extract againstK pneumoniaeThe addition of different concentrations of Fructus mumeextract (FM) as indicated to LB broth affects the growth of K pneumoniaeNTUH-K2044 (a) or CG43S3 (b) LB broth only inoculated withthe bacteria serves as a negative control lowast 119875 lt 005 compared to the indicated group
27 Streptonigrin Sensitivity To measure bacterial suscepti-bility to the iron-activated antibiotic streptonigrin overnightgrown K pneumoniae were 1 10 diluted in LB or LB brothsupplemented with different concentrations of Fructus mumeextract After 2 h incubation with or without streptonigrin(2120583gmL) at 37∘C with agitation aliquots (5120583L) of culturesserially diluted tenfold in LB broth were spotted onto LBagar The plates were incubated at 37∘C overnight andphotographed
28 Statistical Method An unpaired 119905-test was used todetermine the statistical significance and values of 119875 lt 005and 119875 lt 001 were considered significant Each samplewas assayed in triplicate and the mean activity and standarddeviation are presented
29 Ethics Statement For isolation of normal human serumfrom healthy volunteers the procedure and the respective
4 Evidence-Based Complementary and Alternative Medicine
0 20105NTUH-K2044FM
(mgmL)
(a)
CG43S3FM
(mgmL) 0 20105
(b)
Figure 2 Fructus mume reduces K pneumoniae mucoviscosity Different concentrations of Fructus mume extract (FM) as indicated wereadded to LB broth inoculated with K pneumoniae NTUH-K2044 (a) or CG43S3 (b) After overnight incubation at 37∘C the bacterialmucoviscosity was assessed by a low speed centrifugation LB broth only inoculated with the bacteria serves as a negative control
Surv
ival
rate
in n
orm
al h
uman
seru
m (
)
0
5
10
15
20
25
30
35
0 5 10FM(mgmL) NTUH-K2044
20CG43S3
0 5 10 20
lowast lowastlowast
lowastlowast lowast lowast
Figure 3 Effect of Fructus mume on K pneumoniae susceptibilityto normal human serum Different concentrations of Fructus mumeextract (FM)were added to LB broth inoculatedwithK pneumoniaeNTUH-K2044 (a) or CG43S3 (b) as indicated in the margin Afterovernight incubation at 37∘C the bacterial serum resistance wasdetermined LB broth only inoculated with the bacteria serves as anegative control lowast 119875 lt 005 compared to the indicated group
consent documents were approved by the Ethics Committeeof the China Medical University Hospital Taichung TaiwanAll healthy volunteers provided written informed consent
3 Results
31 Fructus mume Inhibits the Growth of K pneumoniaeTo examine the antibacterial activity of Fructus mume Kpneumoniae NTUH-K2044 and CG43S3 were coculturedwith increasing amounts of Fructus mume extract andbacterial growth was monitored by plate counting As shownin Figure 1 compared to the results for the control groupsaddition of 5mgmL Fructus mume extract to LB broth didnot obviously influence the growth of the 2 strains at any timeinterval while the addition of 10 or 20mgmL Fructus mumeextract caused significant growth reduction after 6 and 24 hincubationsThis inhibitory effect of Fructus mume extract is
Table 2 Quantification of CPS amount of K pneumoniae strainscocultured with Fructus mume extract
Fructus mume(mgmL)
CPS amounta ( relative to the control group)NTUH-K2044 CG43S3
aglucuronic acid content (120583g109 cfu)bND not determined
dose dependent Besides Fructus mume extract appeared toexert a stronger growth inhibitory effect in the case ofNTUH-K2044 than in the case of CG43S3 Bactericidal activity of the20mgmL Fructus mume extract was observed for NTUH-K2044 but not CG43S3 Additionally the pH values of LBbroth supplemented with 5 10 and 20mgmL FM extractwere sim50 44 and 36 respectively
32 Fructus mume Reduces the Biosynthesis of CPS In thecase of K pneumoniae strains high mucoviscosity resultingfrom a large amount of surface CPS has been correlatedwith increased pathogenicity [8 40] To investigate whetherFructus mume affects this mucoviscosity NTUH-K2044and CG43S3 were respectively cocultured with increasingamounts of Fructus mume extract After 24 h of incubationthe sedimentation test revealed that the addition of Fructusmume extract to LB broth obviously decreasedmucoviscosityin the case of 2 K pneumoniae strains K pneumoniaecocultured with Fructus mume extract formed a compactpellet after centrifugation while the control group could notbe pelleted down (Figure 2) Since the addition of 5mgmLFructus mume extract did not influence bacterial growth(Figure 1) we suggest that Fructus mume affected the muco-viscosity by regulating the biosynthesis of CPS As shown inTable 2 in comparisonwith the control groupNTUH-K2044produced a larger amount of CPS approximately 155 foldthan that of CG43S3 The addition of Fructus mume extractreduced CPS production in both strains in a dose-dependent
Evidence-Based Complementary and Alternative Medicine 5
Relat
ive a
mou
nt o
f mRN
A
00
02
04
06
08
10
12
LB alone10 mgmL FM in LB
lowast lowast
lowastlowast
K1cps mRNA
orf1 orf3 orf7
(a) NTUH-K2044
Relat
ive a
mou
nt o
f mRN
A
00
02
04
06
08
10
12
LB alone10 mgmL FM in LB
lowast
lowast
lowastlowast
K2cps mRNA
orf1 998400 orf3 998400 orf16 998400
(b) CG43S3
Figure 4 Fructus mume downregulates cps transcription qRT-PCR analyses of the expression of the K1 cps genes (orf1 orf3 and orf7) inNTUH-K2044 (a) or K2 cps genes (orf11015840 orf31015840 and orf161015840) in CG43S3 (b) in LB or LB broth supplemented with 10mgmL Fructus mumeextract (FM) lowast 119875 lt 005 and lowastlowast 119875 lt 001 compared to LB alone
manner Moreover Fructus mume extract appeared to exert astronger inhibitory effect on NTUH-K2044 than on CG43S3(Table 2)
33 Fructus mume Reduces the Serum Resistance Activity ofK pneumoniae CPS plays a crucial role in the resistanceof K pneumoniae to serum killing Since the Fructus mumeextract decreased the CPS production of K pneumoniaethe effect of the extract on bacterial serum resistance wasfurther analyzedNTUH-K2044 orCG43S3was respectivelycocultured with 5 10 or 20mgmL Fructus mume extractand the bacteria were then collected washed and subjectedto incubation with pooled human sera After 15min ofincubation the survival rate of the bacteria was determinedby plate counting As shown in Figure 3 Fructus mumeextract obviously decreased the serum resistance activity ofNTUH-K2044 and CG43S3 in a dose-dependent mannerpossibly due to reduced CPS production by the bacteria
34 Effect of Fructus mume on cps Transcription The biosyn-thesis of K pneumoniae K1 and K2 CPS is controlled by 20and 17 genes respectively [41 42] Both the K1 and K2 cpsgene clusters contain 3 transcriptional units orf1-2 orf3-6
and orf7-20 in the K1 cps gene cluster and orf11015840-21015840 orf31015840-151015840 and orf161015840-171015840 in the K2 cps gene cluster [41 42] Toinvestigate how Fructus mume extract affects the biosynthesisof K pneumoniae CPS NTUH-K2044 and CG43S3 werecocultured with 10mgmL Fructus mume extract and themRNA levels of the 3 transcripts belonging to the K1 orK2 cps gene cluster were measured by qRT-PCR As shownin Figure 4 compared to the control group the additionof 10mgmL Fructus mume extract obviously reduced themRNA levels of all the cps transcripts suggesting that Fructusmume regulated CPS biosynthesis at the transcriptional level
35 Fructus mume Reduces CPS Biosynthesis by RegulatingK pneumoniae Intracellular Iron Concentration We havepreviously demonstrated that iron depletion activated CPSproduction in K pneumoniae at the transcriptional level[18] To analyze whether iron is involved in Fructus mume-regulated CPS production we assessed intracellular ironlevels in K pneumoniae cocultured with increasing amountsof Fructus mume extract using the iron-activated antibioticstreptonigrin which requires iron for its bactericidal actionthat causes DNA degradation [43] As shown in Figure 5when NTUH-K2044 or CG43S3 was grown in LB broth onlythe bacteria exhibited a streptonigrin-resistant phenotype
6 Evidence-Based Complementary and Alternative Medicine
LB alone FM
(mgmL)
FM(mgmL)
0
20
10
5
0
20
10
5
10minus1 10
minus210
minus310
minus410
minus510
minus6
10minus1 10
minus210
minus310
minus410
minus5
LB with SNG (2 120583gmL)
100
(a) NTUH-K2044
LB alone FM
(mgmL)
FM(mgmL)
0
20
10
5
0
20
10
5
10minus1 10
minus210
minus310
minus410
minus510
minus6
10minus1 10
minus210
minus310
minus410
minus5
LB with SNG (2 120583gmL)
100
(b) CG43S3
Figure 5 Fructus mume increasesK pneumoniae susceptibility to streptonigrinK pneumoniaeNTUH-K2044 (a) or CG43S3 (b) coculturedwith different concentrations of Fructus mume extract (FM) were grown in LB alone or LB that supplemented with 2120583gmL streptonigrin(SNG) incubated for 2 h Then tenfold serial dilutions were spotted onto an LB agar to observe the colony formation
However the streptonigrin susceptibility of the bacteriaincreased upon coculturing with increasing amounts of Fruc-tusmume extract suggesting thatFructusmume increased theintracellular level of free iron in a dose-dependent manner inK pneumoniae
36 Citric Acid Inhibits K pneumoniae Growth and CPSBiosynthesis Citric acid has been demonstrated to be themain organic acid in Fructus mume extract [35] To examineif citric acid plays a role in the inhibitory effects of Fructusmume extract onK pneumoniae growth andCPS productionNTUH-K2044 and CG43S3 were cocultured with variousconcentrations of citric acid and then the growth curvesof the bacteria were monitored The result showed thatcitric acid obviously reduced the growth of NTUH-K2044and CG43S3 in a dose-dependent manner (Figure 6(a))Furthermore CPS production in the 2 K pneumoniae strainsalso decreased when citric acid was added to the growthmedium (Figure 6(b)) These results indicated that citric acidis an active component of Fructus mume extract that has
bactericidal activity and downregulates CPS biosynthesis inK pneumoniae
4 Discussion
Since the 1980s K pneumoniae is emerging as an importantpathogen in both community and hospital settings [44]In the hospital environment due to the extensive use ofantibiotics multiple drug resistance has been increasinglyobserved in K pneumoniae especially in ESBL-producingstrains Carbapenems are considered to be the preferredagents for the treatment of serious infections caused by ESBL-producing K pneumoniae because of their high stabilitywith respect to 120573-lactamase hydrolysis and the observedretained susceptibility of ESBL producers [45] HoweverK pneumoniae isolates resistant to carbapenems have beenreported worldwide since the 2000s [46ndash49] The emergenceof carbapenem-resistant enterobacteria is worrisome becausethe option for antimicrobial treatment is further restricted Inthis study we screened a series of TCMs for the identification
Evidence-Based Complementary and Alternative Medicine 7
NTUH-K2044
0 100 200 300 400 500 600 700
OD
600
00
05
10
15
20
25 CG43S3
(min)(min)0 100 200 300 400 500 600 700
OD
600
00
05
10
15
20
25
LB alone1 mgmL citric acid2 mgmL citric acid
3 mgmL citric acid4 mgmL citric acid
LB alone1 mgmL citric acid2 mgmL citric acid
3 mgmL citric acid4 mgmL citric acid
(a)
0
5
10
15
20
25
30
35
Citric acid(mgmL)
1 20 210
NTUH-K2044 CG43S3
Glu
curo
nic a
cid
(120583g109
cfu)
lowastlowast
lowast
(b)
Figure 6 Citric acid inhibits K pneumoniae growth and CPS levels K pneumoniae NTUH-K204 or CG43S3 cocultured with differentconcentrations of citric acid as indicated and the growth curve (a) as well as the CPS levels (b) were measured Bacteria were grown in LBbroth at 37∘C with agitation lowast 119875 lt 005 compared to the indicated group
of new antibacterial agents (data not shown) and then focusedon Fructus mume the smoked fruit of Prunus mume whichhas been demonstrated to efficiently inhibit H pylori andother oral bacteria [33ndash36] As shown in Figure 1 Fructusmume extract was found to have antibacterial activity againstclinically isolated K pneumoniae strains
Clinically isolated K pneumoniae strains usually producea large amount of CPS which confers not only a mucoidphenotype to the bacteria but also resistance to engulfmentby phagocytes and to serum bactericidal factors [40 50] Thedegree of mucoviscosity has also been positively correlated
with the successful establishment of infection [51 52] Amongthe 77 described capsular types of K pneumoniae K1 andK2 serotypes are highly virulent in experimental infectionin mice and are often associated with severe infections inhumans and animals [52ndash55] particularly with the tightassociation between the 2 serotypes and liver abscess [11 56]As shown in Figure 2 and Table 2 in K pneumoniae strainsof both the K1 and K2 serotypes Fructus mume extractsignificantly reduced bacterial hypermucoviscosity and CPSlevels and thus may result in the decreased resistance ofK pneumoniae to serum killing (Figure 3) On the other
8 Evidence-Based Complementary and Alternative Medicine
hand we also found that heat inactivated serum did nothave obvious bactericidal effects on K pneumoniae (data notshown) suggesting an importance of the complement system
Both prokaryotic and eukaryotic cells in natural envi-ronments are constantly challenged by various environ-mental stresses K pneumoniae like many gastrointestinalpathogens needs to penetrate the gastric acid barrier facethe challenge of the immune system and cope with thelimited supply of oxygen and nutrition to effect colonizationand infection [57 58] Therefore bacteria activate or repressthe expression of virulence genes to adapt to environmentalstimuli [59ndash62] In K pneumoniae CPS biosynthesis isregulated by multiple environmental stimuli and proteinregulators Our previous studies have shown that ferricions can repress K pneumoniae CPS production throughFur regulation [18 63] Under iron-repletion conditionsFur-Fe(II) can tightly repress cps transcription resulting inlowered CPS production in K pneumoniae [18] To furtherinvestigate how Fructus mume reduces CPS levels in Kpneumoniae we performed qRT-PCR analyses and foundthat CPS reduction was regulated at the transcriptionallevel (Figure 4) All 3 transcripts of K1 or K2 cps geneswere obviously downregulated especially orf1orf11015840 encodingGalF a putative UDP-glucose pyrophosphatase (Figure 4)In addition the streptonigrin sensitivity assay also indicatedthat Fructus mume could increase the intracellular iron levelsofK pneumoniae (Figure 5) implying that ferric iron and Furparticipate in Fructus mume-mediated CPS reduction Ironis essential to most bacteria for growth and reproductionbut iron overloading would lead to the formation of unde-sired reactive oxygen species (ROS) by the Fenton reactionto damage DNA or other biological macromolecules [64]Although how Fructus mume affects bacterial iron-uptakeremains unknown the increase in intracellular iron leadingto the formation of undesired ROS may account for part ofits bactericidal activity
The ingredients of Prunus mume extract are organicacids including citric acid (the main ingredient) tartaricacid oxalic acid and other unknown components [35 36]Although the acidic components of Prunus mume showedsome antibacterial activity it is less compared to that ofthe original extract implying that other active componentspossess considerable antibacterial activity [36] As seen inFigure 6 we also showed that citric acid could inhibit growthand CPS production in K pneumoniae The acidic propertymay be one of the antibacterialmechanisms of Fructusmumehowever there should be other active components since LBbroth supplemented with 20mgmL Fructus mume pHsim36 has stronger bactericidal activity than LB broth adjustedto pH 35 using HCl (data not shown) For future clinicalapplication more studies are required to determine the activecomponents of Fructus mume and its mechanism of action
5 Conclusion
To our knowledge this study is the first to report theantibacterial activity of Fructus mume against highly virulentK pneumoniae isolates Moreover we found that Fructus
mume reduced K pneumoniae CPS biosynthesis at thetranscriptional level possibly by regulating the intracellulariron concentration of the bacteria thereby helping the hostimmune system eliminate the pathogen
Conflict of Interests
The authors declare no conflict of interests in this work
Authorsrsquo Contribution
T-H Lin S-H Huang and C-C Wu contributed equally tothis work
Acknowledgments
The authors thank Professor Hwei-Ling Peng from NationalChiao Tung University Taiwan for providing theK pneumo-niae CG43S3 and Dr Jin-Town Wang from National TaiwanUniversity Hospital for providing K pneumoniae NTUH-K2044 The authors thank Yi-Ming Hong and Jing-Ciao Linfor their technical assistance during the study The workis supported by the Grants from National Science Council(NSC 99-2320-B-039-002-MY3) China Medical University(CMU98-ASIA-01) and Buddhist Tzu Chi general hospital(TTCRD101-17)
References
[1] F Chou and H Kou ldquoEndogenous endophthalmitis associatedwith pyogenic hepatic abscessrdquo Journal of the American Collegeof Surgeons vol 182 no 1 pp 33ndash36 1996
[2] S-H B Han ldquoReview of hepatic abscess from Klebsiellapneumoniaemdashan association with diabetes mellitus and septicendophthalmitisrdquo Western Journal of Medicine vol 162 no 3pp 220ndash224 1995
[3] Y Lau B Hu W Wu Y Lin H Chang and Z Shi ldquoIden-tification of a major cluster of Klebsiella pneumoniae isolatesfrom patients with liver abscess in Taiwanrdquo Journal of ClinicalMicrobiology vol 38 no 1 pp 412ndash414 2000
[4] H L Peng P Y Wang J L Wu C T Chiu and H Y ChangldquoMolecular epidemiology of Klebsiella pneumoniaerdquo ZhonghuaMin GuoWei ShengWu Ji Mian Yi Xue Za Zhi vol 24 no 3 pp264ndash271 1991
[5] Y Yang L K Siu K Yeh et al ldquoRecurrent Klebsiella pneumo-niae liver abscess clinical and microbiological characteristicsrdquoJournal of Clinical Microbiology vol 47 no 10 pp 3336ndash33392009
[6] L K Siu K M Yeh J C Lin C P Fung and F Y ChangldquoKlebsiella pneumoniae liver abscess a new invasive syndromerdquoThe Lancet Infectious Diseases vol 12 no 11 pp 881ndash887 2012
[7] E R Lederman and N F Crum ldquoPyogenic liver abscess witha focus on Klebsiella pneumoniae as a primary pathogen anemerging disease with unique clinical characteristicsrdquo Amer-ican Journal of Gastroenterology vol 100 no 2 pp 322ndash3312005
[8] H Sahly R Podschun T A Oelschlaeger et al ldquoCapsuleimpedes adhesion to and invasion of epithelial cells byKlebsiellapneumoniaerdquo Infection and Immunity vol 68 no 12 pp 6744ndash6749 2000
Evidence-Based Complementary and Alternative Medicine 9
[9] C Fung B Hu F Chang et al ldquoA 5-year study of the ser-oepidemiology of Klebsiella pneumoniae high prevalence ofcapsular serotype K1 in Taiwan and implication for vaccineefficacyrdquo Journal of Infectious Diseases vol 181 no 6 pp 2075ndash2079 2000
[10] Y Pan H Fang H Yang et al ldquoCapsular polysaccharide syn-thesis regions in Klebsiella pneumoniae serotype K57 and a newcapsular serotyperdquo Journal of Clinical Microbiology vol 46 no7 pp 2231ndash2240 2008
[11] C-P Fung F-Y Chang S-C Lee et al ldquoA global emergingdisease of Klebsiella pneumoniae liver abscess is serotype K1 animportant factor for complicated endophthalmitisrdquo Gut vol50 no 3 pp 420ndash424 2002
[12] D L Paterson ldquoResistance in gram-negative bacteria enter-obacteriaceaerdquo American Journal of Medicine vol 119 supple-ment 1 no 6 pp S20ndashS28 S60ndashS70 2006
[13] C Lin T Huang W Liang and H Peng ldquoHomologousresponse regulators KvgA KvhA and KvhR regulate the synthe-sis of capsular polysaccharide inKlebsiella pneumoniaeCG43 ina coordinated mannerrdquo Journal of Biochemistry vol 140 no 3pp 429ndash438 2006
[14] N Majdalani and S Gottesman ldquoThe Rcs phosphorelay acomplex signal transduction systemrdquo Annual Review of Micro-biology vol 59 pp 379ndash405 2005
[15] S Gottesman and V Stout ldquoRegulation of capsular polysaccha-ride synthesis in Escherichia coli K12rdquo Molecular Microbiologyvol 5 no 7 pp 1599ndash1606 1991
[16] V Stout ldquoRegulation of capsule synthesis includes interactionsof the RcsCRcsB regulatory pairrdquoResearch inMicrobiology vol145 no 5-6 pp 389ndash392 1994
[17] C T Lin Y C Chen T R Jinn C C Wu Y M Hong andW H Wu ldquoRole of the cAMP-dependent carbon cataboliterepression in capsular polysaccharide biosynthesis in Klebsiellapneumoniaerdquo PLoS ONE vol 8 no 2 Article ID e54430 2013
[18] C Lin C Wu Y Chen et al ldquoFur regulation of the capsularpolysaccharide biosynthesis and iron-acquisition systems inKlebsiella pneumoniae CG43rdquoMicrobiology vol 157 part 2 pp419ndash429 2010
[19] D J Hassett P A Sokol M L Howell et al ldquoFerric uptakeregulator (Fur) mutants of Pseudomonas aeruginosa demon-strate defective siderophore-mediated iron uptake altered aer-obic growth and decreased superoxide dismutase and catalaseactivitiesrdquo Journal of Bacteriology vol 178 no 14 pp 3996ndash4003 1996
[20] U A Ochsner and M L Vasil ldquoGene repression by the ferricuptake regulator in Pseudomonas aeruginosa cycle selection ofiron-regulated genesrdquo Proceedings of the National Academy ofSciences of the United States of America vol 93 no 9 pp 4409ndash4414 1996
[21] J J E Bijlsma B Waidner A H M Van Vliet et al ldquoTheHelicobacter pylori homologue of the ferric uptake regulator isinvolved in acid resistancerdquo Infection and Immunity vol 70 no2 pp 606ndash611 2002
[22] A H M van Vliet J Stoof S W Poppelaars et al ldquoDifferentialregulation of amidase- and formamidase-mediated ammoniaproduction by theHelicobacter pylori fur repressorrdquoThe Journalof Biological Chemistry vol 278 no 11 pp 9052ndash9057 2003
[23] M Baga M Goransson S Normark and B E Uhlin ldquoTran-scriptional activation of a pap pilus virulence operon fromuropathogenic Escherichia colirdquo The EMBO Journal vol 4 no13 pp 3887ndash3893 1985
[24] S Lory MWolfgang V Lee and R Smith ldquoThemulti-talentedbacterial adenylate cyclasesrdquo International Journal of MedicalMicrobiology vol 293 no 7-8 pp 479ndash482 2004
[25] K Skorupski and R K Taylor ldquoCyclic AMP and its receptorprotein negatively regulate the coordinate expression of choleratoxin and toxin-coregulated pilus in Vibrio choleraerdquo Proceed-ings of the National Academy of Sciences of the United States ofAmerica vol 94 no 1 pp 265ndash270 1997
[26] S E H West A K Sample and L J Runyen-Janecky ldquoThe vfrgene product required for Pseudomonas aeruginosa exotoxin Aand protease production belongs to the cyclic AMP receptorprotein familyrdquo Journal of Bacteriology vol 176 no 24 pp 7532ndash7542 1994
[27] M Mendez I-H Huang K Ohtani R Grau T Shimizuand M R Sarker ldquoCarbon catabolite repression of type IVpilus-dependent gliding motility in the anaerobic pathogenClostridium perfringensrdquo Journal of Bacteriology vol 190 no 1pp 48ndash60 2008
[28] E J Kalivoda N A Stella D M OrsquoDee G J Nau and R M QShanks ldquoThe cyclic AMP-dependent catabolite repression sys-tem of Serratia marcescensmediates biofilm formation throughregulation of type 1 fimbriaerdquo Applied and EnvironmentalMicrobiology vol 74 no 11 pp 3461ndash3470 2008
[29] C M Muller A Aberg J Straseviciene L Emody B E Uhlinand C Balsalobre ldquoType 1 fimbriae a colonization factor ofuropathogenic Escherichia coli are controlled by the metabolicsensor CRP-cAMPrdquo PLoS Pathogens vol 5 no 2 Article IDe1000303 2009
[30] E L Fuchs E D Brutinel E R Klem A R Fehr T L Yahrand M C Wolfgang ldquoIn vitro and in vivo characterization ofthe Pseudomonas aeruginosa cyclic AMP (cAMP) phosphodi-esterase CpdA required for cAMP homeostasis and virulencefactor regulationrdquo Journal of Bacteriology vol 192 no 11 pp2779ndash2790 2010
[31] T Endoh and J N Engel ldquoCbpA a polarly localized novel cyclicAMP-binding protein in Pseudomonas aeruginosardquo Journal ofBacteriology vol 191 no 23 pp 7193ndash7205 2009
[32] N A Stella E J Kalivoda D M OrsquoDee G J Nau and R M QShanks ldquoCatabolite repression control of flagellum productionby Serratia marcescensrdquo Research in Microbiology vol 159 no7-8 pp 562ndash568 2008
[33] S Enomoto K Yanaoka H Utsunomiya et al ldquoInhibitoryeffects of Japanese apricot (Prunus mume Siebold et ZuccUme) onHelicobacter pylori-related chronic gastritisrdquo EuropeanJournal of Clinical Nutrition vol 64 no 7 pp 714ndash719 2010
[34] R W K Wong U Hagg L Samaranayake M K Z Yuen CJ Seneviratne and R Kao ldquoAntimicrobial activity of Chinesemedicine herbs against common bacteria in oral biofilmA pilotstudyrdquo International Journal of Oral and Maxillofacial Surgeryvol 39 no 6 pp 599ndash605 2010
[35] C J Seneviratne R W K Wong U Hagg et al ldquoPrunus mumeextract exhibits antimicrobial activity against pathogenic oralbacteriardquo International Journal of Paediatric Dentistry vol 21no 4 pp 299ndash305 2011
[36] Y Chen RW KWong C J Seneviratne et al ldquoThe antimicro-bial efficacy of Fructus mume extract on orthodontic bracketa monospecies-biofilm model study in vitrordquo Archives of OralBiology vol 56 no 1 pp 16ndash21 2011
[37] Y Lai H Peng and H Chang ldquoRmpA2 an activator ofcapsule biosynthesis in Klebsiella pneumoniae CG43 regulatesK2 cps gene expression at the transcriptional levelrdquo Journal ofBacteriology vol 185 no 3 pp 788ndash800 2003
10 Evidence-Based Complementary and Alternative Medicine
[38] P Domenico S Schwartz and B A Cunha ldquoReduction ofcapsular polysaccharide production inKlebsiella pneumoniae bysodium salicylaterdquo Infection and Immunity vol 57 no 12 pp3778ndash3782 1989
[39] N Blumenkrantz and G A Hansen ldquoNew method for quanti-tative determination of uronic acidsrdquo Analytical Biochemistryvol 54 no 2 pp 484ndash489 1973
[40] J Lin F Chang C Fung et al ldquoHigh prevalence of phagocytic-resistant capsular serotypes of Klebsiella pneumoniae in liverabscessrdquo Microbes and Infection vol 6 no 13 pp 1191ndash11982004
[41] Y Arakawa R Wacharotayankun T Nagatsuka H Ito NKato and M Ohta ldquoGenomic organization of the Klebsiellapneumoniae cps region responsible for serotype K2 capsularpolysaccharide synthesis in the virulent strain chedidrdquo Journalof Bacteriology vol 177 no 7 pp 1788ndash1796 1995
[42] KWuN Li J Yan et al ldquoGenome sequencing and comparativeanalysis of Klebsiella pneumoniae NTUH-K2044 a strain caus-ing liver abscess and meningitisrdquo Journal of Bacteriology vol191 no 14 pp 4492ndash4501 2009
[43] H N Yeowell and J R White ldquoIron requirement in thebactericidal mechanism of streptonigrinrdquo Antimicrobial Agentsand Chemotherapy vol 22 no 6 pp 961ndash968 1982
[44] Y Keynan and E Rubinstein ldquoThe changing face of Klebsiellapneumoniae infections in the communityrdquo International Journalof Antimicrobial Agents vol 30 no 5 pp 385ndash389 2007
[45] R Colodner R Raz B Chazan and W Sakran ldquoSusceptibilitypattern of extended-spectrum 120573-lactamase producing bacteriaisolated from inpatients to five antimicrobial drugs in a com-munity hospital in Northern Israelrdquo International Journal ofAntimicrobial Agents vol 24 no 4 pp 409ndash410 2004
[46] E B Hirsch and V H Tam ldquoDetection and treatment optionsfor Klebsiella pneumoniae carbapenemases (KPCs) an emerg-ing cause of multidrug-resistant infectionrdquo Journal of Antimi-crobial Chemotherapy vol 65 no 6 pp 1119ndash1125 2010
[47] K K Kumarasamy M A Toleman T R Walsh et al ldquoEmer-gence of a new antibiotic resistance mechanism in India Pak-istan and the UK a molecular biological and epidemiologicalstudyrdquoThe Lancet Infectious Diseases vol 10 no 9 pp 597ndash6022010
[48] P Nordmann G Cuzon and T Naas ldquoThe real threat ofKlebsiella pneumoniae carbapenemase-producing bacteriardquoTheLancet Infectious Diseases vol 9 no 4 pp 228ndash236 2009
[49] D Yong M A Toleman C G Giske et al ldquoCharacterizationof a new metallo-120573-lactamase gene bla NDM-1 and a novelerythromycin esterase gene carried on a unique genetic struc-ture in Klebsiella pneumoniae sequence type 14 from IndiardquoAntimicrobial Agents and Chemotherapy vol 53 no 12 pp5046ndash5054 2009
[50] V Regueiro M A Campos J Pons S Albertı and J ABengoechea ldquoThe uptake of a Klebsiella pneumoniae capsulepolysaccharide mutant triggers an inflammatory response byhuman airway epithelial cellsrdquoMicrobiology vol 152 part 2 pp555ndash566 2006
[51] X Nassif N Honore T Vasselon S T Cole and P J SansonettildquoPositive control of colanic acid synthesis in Escherichia coliby rmpA and rmpB two virulence-plasmid genes of Klebsiellapneumoniaerdquo Molecular Microbiology vol 3 no 10 pp 1349ndash1359 1989
[52] X Nassif and P J Sansonetti ldquoCorrelation of the virulence ofKlebsiella pneumoniaeK1 and K2 with the presence of a plasmid
encoding aerobactinrdquo Infection and Immunity vol 54 no 3 pp603ndash608 1986
[53] K Mizuta M Ohta and M Mori ldquoVirulence for mice ofKlebsiella strains belonging to the O1 group relationship totheir capsular (K) typesrdquo Infection and Immunity vol 40 no1 pp 56ndash61 1983
[54] I Ofek K Kabha A Athamna et al ldquoGenetic exchange ofdeterminants for capsular polysaccharide biosynthesis betweenKlebsiella pneumoniae strains expressing serotypes K2 andK21ardquo Infection and Immunity vol 61 no 10 pp 4208ndash42161993
[55] A M Simoons-Smit A M J J Verwey-van Vught I Y RKanis and D M MacLaren ldquoVirulence of Klebsiella strains inexperimentally induced skin lesions in the mouserdquo Journal ofMedical Microbiology vol 17 no 1 pp 67ndash77 1984
[56] C Lee H Leu T Wu L Su and J Liu ldquoRisk factors for sponta-neous rupture of liver abscess caused byKlebsiella pneumoniaerdquoDiagnosticMicrobiology and Infectious Disease vol 52 no 2 pp79ndash84 2005
[57] C De Champs M P Sauvant C Chanal et al ldquoProspectivesurvey of colonization and infection caused by expanded-spectrum-120573-lactamase-producing members of the familyEnterobacteriaceae in an intensive care unitrdquo Journal of ClinicalMicrobiology vol 27 no 12 pp 2887ndash2890 1989
[58] S MMarkowitz J M Veazey Jr and F L Macrina ldquoSequentialoutbreaks of infection due to Klebsiella pneumoniae in a neona-tal intensive care unit implication of a conjugative R plasmidrdquoJournal of Infectious Diseases vol 142 no 1 pp 106ndash112 1980
[59] A M Stock V L Robinson and P N Goudreau ldquoTwo-component signal transductionrdquo Annual Review of Biochem-istry vol 69 pp 183ndash215 2000
[60] C Fuqua and E P Greenberg ldquoSelf perception in bacteriaquorum sensing with acylated homoserine lactonesrdquo CurrentOpinion in Microbiology vol 1 no 2 pp 183ndash189 1998
[61] P Romby F Vandenesch and E G H Wagner ldquoThe role ofRNAs in the regulation of virulence-gene expressionrdquo CurrentOpinion in Microbiology vol 9 no 2 pp 229ndash236 2006
[62] B L Bassler ldquoHow bacteria talk to each other regulationof gene expression by quorum sensingrdquo Current Opinion inMicrobiology vol 2 no 6 pp 582ndash587 1999
[63] H Y Cheng Y S Chen C YWu H Y Chang Y C Lai andHL Peng ldquoRmpA regulation of capsular polysaccharide biosyn-thesis in Klebsiella pneumoniae CG43rdquo Journal of Bacteriologyvol 192 no 12 pp 3144ndash3158 2010
[64] D Touati ldquoIron and oxidative stress in bacteriardquo Archives ofBiochemistry and Biophysics vol 373 no 1 pp 1ndash6 2000
2 Evidence-Based Complementary and Alternative Medicine
regulators such as the Rcs system RmpA RmpA2 KvhRKvgAS and KvhAS [13ndash16] Recently we found that CPSproduction by K pneumoniae was controlled by externaliron and glucose concentrations via the regulation of ferricuptake regulator (Fur) and cAMP-dependent carbon catabo-lite repression (CCR) respectively [17 18] Iron availabilityhas been demonstrated to affect multiple cellular functionssuch as oxidative stress energy metabolism acid toleranceand virulence factor production in many bacteria [19ndash22]Likewise cAMP signaling has been demonstrated to regulatethe expression of various genes encoding carbon metabolismenzymes and virulence factors such as flagella fimbriaeprotease exotoxin and secretion systems [23ndash32] Thesestudies indicate that in response to specific environmentalsignals pathogenic bacteria express genes encoding virulencefactors that help them to establish a successful infection
Traditional Chinese medicine (TCM) has been a richnatural source of antimicrobial agents for treating variousinfectious diseases for more than 4000 years Mei Prunusmume has long played an important role in human diet andhealth Fructus mume the smoked fruit of Prunus mume is aTCMthat has been used to relieve cough treat ulceration andimprove digestive function Prunus mume extract has alsobeen shown to inhibit Helicobacter pylori infection which isassociated with gastritis and gastric ulcers [33] In additionFructus mume extract is a potential candidate for developingan oral antimicrobial agent to control or prevent dentaldiseases associated with several oral pathogenic bacteria [34ndash36] A study involving high-pressure liquid chromatography(HPLC) analysis has also demonstrated that citric acid is themain organic acid in Fructus mume extract [35 36]
In this study we aimed to assess the antibacterial activityof Fructusmume againstK pneumoniae and 2 highly virulentclinical strains NTUH-K2044 and CG43S3 respectivelybelonging to the K1 and K2 serotypes were used in thefollowing analyses We found that Fructus mume not onlypossess antibacterial activity against the 2 K pneumoniaestrains but also reduced bacterial CPS production thusdecreasing the survival rate of bacteria in normal humanserum The regulatory effect of Fructus mume on cps geneexpression in K pneumoniae has also been clarified
2 Materials and Methods
21 K pneumoniae Strains and Primers K pneumoniaestrains and primers used in this study are listed in Table 1Bacteriawere routinely cultured at 37∘C in Luria-Bertani (LB)broth or agar plate
22 Preparation of Fructus mume Extract The concentratedherbalmedicine Fructus mume was purchased fromChuangSong Zong Pharmaceutical Co Ltd (Kaohsiung Taiwan)under the good manufacturing practice (GMP) criteriaFructus mume powder was dissolved in LB broth by end-over-end mixing at room temperature for 2 h The extract ofFructusmumewas collected by centrifugation (13000 rpm for10min) to remove starch and then filtered by 045120583m filter
23 Antibacterial Activity of Fructus mume Extract LB brothor LB broth supplemented with 5 10 or 20mgmL Fructusmume extract was initially inoculated with K pneumoniaeNTUH-K2044 or CG43S3 (approximate 108 CFUmL) Cul-tures were incubated at 37∘C and samples were taken at 02 6 and 24 h to determine the viable counts (CFUmL) foreach strain The assay was performed in triplicate each withtriplicate samples
24 Assessment of K pneumoniae Mucoviscosity and CPSProduction The mucoviscosity of K pneumoniae was mea-sured by a low speed centrifugation as previously described[37] Briefly equal numbers of overnight-cultured bacteriawere centrifuged at 6000 g for 5min Then formation ofthe bacterial pellet could be observed To further evaluatethe CPS amount of K pneumoniae the bacterial CPS wasextracted and then quantified as previously described [38]The glucuronic acid content representing the amount of KpneumoniaeK1 and K2 CPS was determined from a standardcurve of glucuronic acid (Sigma-Aldrich) and expressed asmicrograms per 109 CFU [39]
25 Quantitative Reverse Transcription Polymerase ChainReaction (qRT-PCR) Total RNAs were isolated from early-exponential-phase grown bacteria cells by use of the RNeasymidi-column (QIAGEN) according to the manufacturerrsquosinstructions RNA was DNase-treated with RNase-freeDNase I (MoBioPlus) to eliminateDNA contamination RNAof 100 ng was reverse-transcribed with the Transcriptor FirstStrand cDNA Synthesis Kit (Roche) using random primersqRT-PCR was performed in a Roche LightCycler 15 Instru-ment using LightCycler TaqMan Master (Roche) Primersand probes were designed for selected target sequencesusing Universal ProbeLibrary Assay Design Center (Roche-applied science) and listed in Table 1 Data were analyzedusing the real time PCR software of Roche LightCycler 15Instrument Relative gene expressions were quantified usingthe comparative threshold cycle 2minusΔΔCT method with 23SrRNA as the endogenous reference
26 Bacterial Survival in Serum Normal human serumpooled from healthy volunteers was divided into equalvolumes and stored at minus70∘C before use Bacterial survivalin serum was determined with minor modifications [37]In brief LB broth or LB broth supplemented with 5 10or 20mgmL Fructus mume extract was initially inoculatedwith K pneumoniae NTUH-K2044 or CG43S3 (approx-imate 108 CFUmL) After overnight incubation at 37∘Cthe bacteria were collected washed twice with phosphate-buffered saline (PBS) and then adjusted to approximately1 times 106 CFUmL The reaction mixture containing 250 120583L ofthe cell suspension and 750120583L of pooled human serum wasincubated at 37∘C for 15min The number of viable bacteriawas then determined by plate counting The survival ratewas expressed as the number of viable bacteria treated withhuman serum compared to the number of pretreatmentThe assay was performed in triplicate each with triplicatesamples
Evidence-Based Complementary and Alternative Medicine 3
Table 1 Bacteria strains and primer used in this study
(a)
Strains Descriptions Reference or sourceK pneumoniae
NTUH-K2044 K1 serotype From Dr Jin-TownWangCG43S3 K2 serotype From Dr Hwei-Ling Peng
(b)
Primer Sequence (51015840 rarr 31015840) TaqMan probes TargetRT03 CGTCATCCAGACCAAAGAGC 83 orf1 in K1 cps gene clusterRT04 CCGGTTTTTCAATAAACTCGAC orf11015840 in K2 cps gene clusterRT134 TACCGGGACAGAGAATGAGC 78 orf3 in K1 cps gene clusterRT135 TAACTGGCCAACCCAAGGTRT136 CGTTTTATGGTAATGTTCTCCTCA 26 orf7 in K1 cps gene clusterRT137 TCTGCCCATAACCTCGAAAGRT05 CGATGACCGGCTTTTTAATG 83 orf31015840 in K2 cps gene clusterRT06 CTAGCGGAGATTTGGTACTGCRT07 CAGTCCACCTTTATTCCGATTG 67 orf161015840 in K2 cps gene clusterRT08 AGGTACGACCCCGACTGG
0
50
100
150
200
250
300
LB alone
350
2 6 240 (h)
5 mgmL FM in LB10 mgmL FM in LB20 mgmL FM in LB
lowastlowastlowast
lowast
lowast
No
of b
acte
ria (1
06
cfu
mL)
(a) NTUH-K2044
2 6 24
50
100
150
200
0 0
250
(h)
No
of b
acte
ria (1
06
cfu
mL)
LB alone5 mgmL FM in LB
10 mgmL FM in LB20 mgmL FM in LB
lowast
lowast
lowast
lowast
(b) CG43S3
Figure 1 Antibacterial activity of the Fructus mume extract againstK pneumoniaeThe addition of different concentrations of Fructus mumeextract (FM) as indicated to LB broth affects the growth of K pneumoniaeNTUH-K2044 (a) or CG43S3 (b) LB broth only inoculated withthe bacteria serves as a negative control lowast 119875 lt 005 compared to the indicated group
27 Streptonigrin Sensitivity To measure bacterial suscepti-bility to the iron-activated antibiotic streptonigrin overnightgrown K pneumoniae were 1 10 diluted in LB or LB brothsupplemented with different concentrations of Fructus mumeextract After 2 h incubation with or without streptonigrin(2120583gmL) at 37∘C with agitation aliquots (5120583L) of culturesserially diluted tenfold in LB broth were spotted onto LBagar The plates were incubated at 37∘C overnight andphotographed
28 Statistical Method An unpaired 119905-test was used todetermine the statistical significance and values of 119875 lt 005and 119875 lt 001 were considered significant Each samplewas assayed in triplicate and the mean activity and standarddeviation are presented
29 Ethics Statement For isolation of normal human serumfrom healthy volunteers the procedure and the respective
4 Evidence-Based Complementary and Alternative Medicine
0 20105NTUH-K2044FM
(mgmL)
(a)
CG43S3FM
(mgmL) 0 20105
(b)
Figure 2 Fructus mume reduces K pneumoniae mucoviscosity Different concentrations of Fructus mume extract (FM) as indicated wereadded to LB broth inoculated with K pneumoniae NTUH-K2044 (a) or CG43S3 (b) After overnight incubation at 37∘C the bacterialmucoviscosity was assessed by a low speed centrifugation LB broth only inoculated with the bacteria serves as a negative control
Surv
ival
rate
in n
orm
al h
uman
seru
m (
)
0
5
10
15
20
25
30
35
0 5 10FM(mgmL) NTUH-K2044
20CG43S3
0 5 10 20
lowast lowastlowast
lowastlowast lowast lowast
Figure 3 Effect of Fructus mume on K pneumoniae susceptibilityto normal human serum Different concentrations of Fructus mumeextract (FM)were added to LB broth inoculatedwithK pneumoniaeNTUH-K2044 (a) or CG43S3 (b) as indicated in the margin Afterovernight incubation at 37∘C the bacterial serum resistance wasdetermined LB broth only inoculated with the bacteria serves as anegative control lowast 119875 lt 005 compared to the indicated group
consent documents were approved by the Ethics Committeeof the China Medical University Hospital Taichung TaiwanAll healthy volunteers provided written informed consent
3 Results
31 Fructus mume Inhibits the Growth of K pneumoniaeTo examine the antibacterial activity of Fructus mume Kpneumoniae NTUH-K2044 and CG43S3 were coculturedwith increasing amounts of Fructus mume extract andbacterial growth was monitored by plate counting As shownin Figure 1 compared to the results for the control groupsaddition of 5mgmL Fructus mume extract to LB broth didnot obviously influence the growth of the 2 strains at any timeinterval while the addition of 10 or 20mgmL Fructus mumeextract caused significant growth reduction after 6 and 24 hincubationsThis inhibitory effect of Fructus mume extract is
Table 2 Quantification of CPS amount of K pneumoniae strainscocultured with Fructus mume extract
Fructus mume(mgmL)
CPS amounta ( relative to the control group)NTUH-K2044 CG43S3
aglucuronic acid content (120583g109 cfu)bND not determined
dose dependent Besides Fructus mume extract appeared toexert a stronger growth inhibitory effect in the case ofNTUH-K2044 than in the case of CG43S3 Bactericidal activity of the20mgmL Fructus mume extract was observed for NTUH-K2044 but not CG43S3 Additionally the pH values of LBbroth supplemented with 5 10 and 20mgmL FM extractwere sim50 44 and 36 respectively
32 Fructus mume Reduces the Biosynthesis of CPS In thecase of K pneumoniae strains high mucoviscosity resultingfrom a large amount of surface CPS has been correlatedwith increased pathogenicity [8 40] To investigate whetherFructus mume affects this mucoviscosity NTUH-K2044and CG43S3 were respectively cocultured with increasingamounts of Fructus mume extract After 24 h of incubationthe sedimentation test revealed that the addition of Fructusmume extract to LB broth obviously decreasedmucoviscosityin the case of 2 K pneumoniae strains K pneumoniaecocultured with Fructus mume extract formed a compactpellet after centrifugation while the control group could notbe pelleted down (Figure 2) Since the addition of 5mgmLFructus mume extract did not influence bacterial growth(Figure 1) we suggest that Fructus mume affected the muco-viscosity by regulating the biosynthesis of CPS As shown inTable 2 in comparisonwith the control groupNTUH-K2044produced a larger amount of CPS approximately 155 foldthan that of CG43S3 The addition of Fructus mume extractreduced CPS production in both strains in a dose-dependent
Evidence-Based Complementary and Alternative Medicine 5
Relat
ive a
mou
nt o
f mRN
A
00
02
04
06
08
10
12
LB alone10 mgmL FM in LB
lowast lowast
lowastlowast
K1cps mRNA
orf1 orf3 orf7
(a) NTUH-K2044
Relat
ive a
mou
nt o
f mRN
A
00
02
04
06
08
10
12
LB alone10 mgmL FM in LB
lowast
lowast
lowastlowast
K2cps mRNA
orf1 998400 orf3 998400 orf16 998400
(b) CG43S3
Figure 4 Fructus mume downregulates cps transcription qRT-PCR analyses of the expression of the K1 cps genes (orf1 orf3 and orf7) inNTUH-K2044 (a) or K2 cps genes (orf11015840 orf31015840 and orf161015840) in CG43S3 (b) in LB or LB broth supplemented with 10mgmL Fructus mumeextract (FM) lowast 119875 lt 005 and lowastlowast 119875 lt 001 compared to LB alone
manner Moreover Fructus mume extract appeared to exert astronger inhibitory effect on NTUH-K2044 than on CG43S3(Table 2)
33 Fructus mume Reduces the Serum Resistance Activity ofK pneumoniae CPS plays a crucial role in the resistanceof K pneumoniae to serum killing Since the Fructus mumeextract decreased the CPS production of K pneumoniaethe effect of the extract on bacterial serum resistance wasfurther analyzedNTUH-K2044 orCG43S3was respectivelycocultured with 5 10 or 20mgmL Fructus mume extractand the bacteria were then collected washed and subjectedto incubation with pooled human sera After 15min ofincubation the survival rate of the bacteria was determinedby plate counting As shown in Figure 3 Fructus mumeextract obviously decreased the serum resistance activity ofNTUH-K2044 and CG43S3 in a dose-dependent mannerpossibly due to reduced CPS production by the bacteria
34 Effect of Fructus mume on cps Transcription The biosyn-thesis of K pneumoniae K1 and K2 CPS is controlled by 20and 17 genes respectively [41 42] Both the K1 and K2 cpsgene clusters contain 3 transcriptional units orf1-2 orf3-6
and orf7-20 in the K1 cps gene cluster and orf11015840-21015840 orf31015840-151015840 and orf161015840-171015840 in the K2 cps gene cluster [41 42] Toinvestigate how Fructus mume extract affects the biosynthesisof K pneumoniae CPS NTUH-K2044 and CG43S3 werecocultured with 10mgmL Fructus mume extract and themRNA levels of the 3 transcripts belonging to the K1 orK2 cps gene cluster were measured by qRT-PCR As shownin Figure 4 compared to the control group the additionof 10mgmL Fructus mume extract obviously reduced themRNA levels of all the cps transcripts suggesting that Fructusmume regulated CPS biosynthesis at the transcriptional level
35 Fructus mume Reduces CPS Biosynthesis by RegulatingK pneumoniae Intracellular Iron Concentration We havepreviously demonstrated that iron depletion activated CPSproduction in K pneumoniae at the transcriptional level[18] To analyze whether iron is involved in Fructus mume-regulated CPS production we assessed intracellular ironlevels in K pneumoniae cocultured with increasing amountsof Fructus mume extract using the iron-activated antibioticstreptonigrin which requires iron for its bactericidal actionthat causes DNA degradation [43] As shown in Figure 5when NTUH-K2044 or CG43S3 was grown in LB broth onlythe bacteria exhibited a streptonigrin-resistant phenotype
6 Evidence-Based Complementary and Alternative Medicine
LB alone FM
(mgmL)
FM(mgmL)
0
20
10
5
0
20
10
5
10minus1 10
minus210
minus310
minus410
minus510
minus6
10minus1 10
minus210
minus310
minus410
minus5
LB with SNG (2 120583gmL)
100
(a) NTUH-K2044
LB alone FM
(mgmL)
FM(mgmL)
0
20
10
5
0
20
10
5
10minus1 10
minus210
minus310
minus410
minus510
minus6
10minus1 10
minus210
minus310
minus410
minus5
LB with SNG (2 120583gmL)
100
(b) CG43S3
Figure 5 Fructus mume increasesK pneumoniae susceptibility to streptonigrinK pneumoniaeNTUH-K2044 (a) or CG43S3 (b) coculturedwith different concentrations of Fructus mume extract (FM) were grown in LB alone or LB that supplemented with 2120583gmL streptonigrin(SNG) incubated for 2 h Then tenfold serial dilutions were spotted onto an LB agar to observe the colony formation
However the streptonigrin susceptibility of the bacteriaincreased upon coculturing with increasing amounts of Fruc-tusmume extract suggesting thatFructusmume increased theintracellular level of free iron in a dose-dependent manner inK pneumoniae
36 Citric Acid Inhibits K pneumoniae Growth and CPSBiosynthesis Citric acid has been demonstrated to be themain organic acid in Fructus mume extract [35] To examineif citric acid plays a role in the inhibitory effects of Fructusmume extract onK pneumoniae growth andCPS productionNTUH-K2044 and CG43S3 were cocultured with variousconcentrations of citric acid and then the growth curvesof the bacteria were monitored The result showed thatcitric acid obviously reduced the growth of NTUH-K2044and CG43S3 in a dose-dependent manner (Figure 6(a))Furthermore CPS production in the 2 K pneumoniae strainsalso decreased when citric acid was added to the growthmedium (Figure 6(b)) These results indicated that citric acidis an active component of Fructus mume extract that has
bactericidal activity and downregulates CPS biosynthesis inK pneumoniae
4 Discussion
Since the 1980s K pneumoniae is emerging as an importantpathogen in both community and hospital settings [44]In the hospital environment due to the extensive use ofantibiotics multiple drug resistance has been increasinglyobserved in K pneumoniae especially in ESBL-producingstrains Carbapenems are considered to be the preferredagents for the treatment of serious infections caused by ESBL-producing K pneumoniae because of their high stabilitywith respect to 120573-lactamase hydrolysis and the observedretained susceptibility of ESBL producers [45] HoweverK pneumoniae isolates resistant to carbapenems have beenreported worldwide since the 2000s [46ndash49] The emergenceof carbapenem-resistant enterobacteria is worrisome becausethe option for antimicrobial treatment is further restricted Inthis study we screened a series of TCMs for the identification
Evidence-Based Complementary and Alternative Medicine 7
NTUH-K2044
0 100 200 300 400 500 600 700
OD
600
00
05
10
15
20
25 CG43S3
(min)(min)0 100 200 300 400 500 600 700
OD
600
00
05
10
15
20
25
LB alone1 mgmL citric acid2 mgmL citric acid
3 mgmL citric acid4 mgmL citric acid
LB alone1 mgmL citric acid2 mgmL citric acid
3 mgmL citric acid4 mgmL citric acid
(a)
0
5
10
15
20
25
30
35
Citric acid(mgmL)
1 20 210
NTUH-K2044 CG43S3
Glu
curo
nic a
cid
(120583g109
cfu)
lowastlowast
lowast
(b)
Figure 6 Citric acid inhibits K pneumoniae growth and CPS levels K pneumoniae NTUH-K204 or CG43S3 cocultured with differentconcentrations of citric acid as indicated and the growth curve (a) as well as the CPS levels (b) were measured Bacteria were grown in LBbroth at 37∘C with agitation lowast 119875 lt 005 compared to the indicated group
of new antibacterial agents (data not shown) and then focusedon Fructus mume the smoked fruit of Prunus mume whichhas been demonstrated to efficiently inhibit H pylori andother oral bacteria [33ndash36] As shown in Figure 1 Fructusmume extract was found to have antibacterial activity againstclinically isolated K pneumoniae strains
Clinically isolated K pneumoniae strains usually producea large amount of CPS which confers not only a mucoidphenotype to the bacteria but also resistance to engulfmentby phagocytes and to serum bactericidal factors [40 50] Thedegree of mucoviscosity has also been positively correlated
with the successful establishment of infection [51 52] Amongthe 77 described capsular types of K pneumoniae K1 andK2 serotypes are highly virulent in experimental infectionin mice and are often associated with severe infections inhumans and animals [52ndash55] particularly with the tightassociation between the 2 serotypes and liver abscess [11 56]As shown in Figure 2 and Table 2 in K pneumoniae strainsof both the K1 and K2 serotypes Fructus mume extractsignificantly reduced bacterial hypermucoviscosity and CPSlevels and thus may result in the decreased resistance ofK pneumoniae to serum killing (Figure 3) On the other
8 Evidence-Based Complementary and Alternative Medicine
hand we also found that heat inactivated serum did nothave obvious bactericidal effects on K pneumoniae (data notshown) suggesting an importance of the complement system
Both prokaryotic and eukaryotic cells in natural envi-ronments are constantly challenged by various environ-mental stresses K pneumoniae like many gastrointestinalpathogens needs to penetrate the gastric acid barrier facethe challenge of the immune system and cope with thelimited supply of oxygen and nutrition to effect colonizationand infection [57 58] Therefore bacteria activate or repressthe expression of virulence genes to adapt to environmentalstimuli [59ndash62] In K pneumoniae CPS biosynthesis isregulated by multiple environmental stimuli and proteinregulators Our previous studies have shown that ferricions can repress K pneumoniae CPS production throughFur regulation [18 63] Under iron-repletion conditionsFur-Fe(II) can tightly repress cps transcription resulting inlowered CPS production in K pneumoniae [18] To furtherinvestigate how Fructus mume reduces CPS levels in Kpneumoniae we performed qRT-PCR analyses and foundthat CPS reduction was regulated at the transcriptionallevel (Figure 4) All 3 transcripts of K1 or K2 cps geneswere obviously downregulated especially orf1orf11015840 encodingGalF a putative UDP-glucose pyrophosphatase (Figure 4)In addition the streptonigrin sensitivity assay also indicatedthat Fructus mume could increase the intracellular iron levelsofK pneumoniae (Figure 5) implying that ferric iron and Furparticipate in Fructus mume-mediated CPS reduction Ironis essential to most bacteria for growth and reproductionbut iron overloading would lead to the formation of unde-sired reactive oxygen species (ROS) by the Fenton reactionto damage DNA or other biological macromolecules [64]Although how Fructus mume affects bacterial iron-uptakeremains unknown the increase in intracellular iron leadingto the formation of undesired ROS may account for part ofits bactericidal activity
The ingredients of Prunus mume extract are organicacids including citric acid (the main ingredient) tartaricacid oxalic acid and other unknown components [35 36]Although the acidic components of Prunus mume showedsome antibacterial activity it is less compared to that ofthe original extract implying that other active componentspossess considerable antibacterial activity [36] As seen inFigure 6 we also showed that citric acid could inhibit growthand CPS production in K pneumoniae The acidic propertymay be one of the antibacterialmechanisms of Fructusmumehowever there should be other active components since LBbroth supplemented with 20mgmL Fructus mume pHsim36 has stronger bactericidal activity than LB broth adjustedto pH 35 using HCl (data not shown) For future clinicalapplication more studies are required to determine the activecomponents of Fructus mume and its mechanism of action
5 Conclusion
To our knowledge this study is the first to report theantibacterial activity of Fructus mume against highly virulentK pneumoniae isolates Moreover we found that Fructus
mume reduced K pneumoniae CPS biosynthesis at thetranscriptional level possibly by regulating the intracellulariron concentration of the bacteria thereby helping the hostimmune system eliminate the pathogen
Conflict of Interests
The authors declare no conflict of interests in this work
Authorsrsquo Contribution
T-H Lin S-H Huang and C-C Wu contributed equally tothis work
Acknowledgments
The authors thank Professor Hwei-Ling Peng from NationalChiao Tung University Taiwan for providing theK pneumo-niae CG43S3 and Dr Jin-Town Wang from National TaiwanUniversity Hospital for providing K pneumoniae NTUH-K2044 The authors thank Yi-Ming Hong and Jing-Ciao Linfor their technical assistance during the study The workis supported by the Grants from National Science Council(NSC 99-2320-B-039-002-MY3) China Medical University(CMU98-ASIA-01) and Buddhist Tzu Chi general hospital(TTCRD101-17)
References
[1] F Chou and H Kou ldquoEndogenous endophthalmitis associatedwith pyogenic hepatic abscessrdquo Journal of the American Collegeof Surgeons vol 182 no 1 pp 33ndash36 1996
[2] S-H B Han ldquoReview of hepatic abscess from Klebsiellapneumoniaemdashan association with diabetes mellitus and septicendophthalmitisrdquo Western Journal of Medicine vol 162 no 3pp 220ndash224 1995
[3] Y Lau B Hu W Wu Y Lin H Chang and Z Shi ldquoIden-tification of a major cluster of Klebsiella pneumoniae isolatesfrom patients with liver abscess in Taiwanrdquo Journal of ClinicalMicrobiology vol 38 no 1 pp 412ndash414 2000
[4] H L Peng P Y Wang J L Wu C T Chiu and H Y ChangldquoMolecular epidemiology of Klebsiella pneumoniaerdquo ZhonghuaMin GuoWei ShengWu Ji Mian Yi Xue Za Zhi vol 24 no 3 pp264ndash271 1991
[5] Y Yang L K Siu K Yeh et al ldquoRecurrent Klebsiella pneumo-niae liver abscess clinical and microbiological characteristicsrdquoJournal of Clinical Microbiology vol 47 no 10 pp 3336ndash33392009
[6] L K Siu K M Yeh J C Lin C P Fung and F Y ChangldquoKlebsiella pneumoniae liver abscess a new invasive syndromerdquoThe Lancet Infectious Diseases vol 12 no 11 pp 881ndash887 2012
[7] E R Lederman and N F Crum ldquoPyogenic liver abscess witha focus on Klebsiella pneumoniae as a primary pathogen anemerging disease with unique clinical characteristicsrdquo Amer-ican Journal of Gastroenterology vol 100 no 2 pp 322ndash3312005
[8] H Sahly R Podschun T A Oelschlaeger et al ldquoCapsuleimpedes adhesion to and invasion of epithelial cells byKlebsiellapneumoniaerdquo Infection and Immunity vol 68 no 12 pp 6744ndash6749 2000
Evidence-Based Complementary and Alternative Medicine 9
[9] C Fung B Hu F Chang et al ldquoA 5-year study of the ser-oepidemiology of Klebsiella pneumoniae high prevalence ofcapsular serotype K1 in Taiwan and implication for vaccineefficacyrdquo Journal of Infectious Diseases vol 181 no 6 pp 2075ndash2079 2000
[10] Y Pan H Fang H Yang et al ldquoCapsular polysaccharide syn-thesis regions in Klebsiella pneumoniae serotype K57 and a newcapsular serotyperdquo Journal of Clinical Microbiology vol 46 no7 pp 2231ndash2240 2008
[11] C-P Fung F-Y Chang S-C Lee et al ldquoA global emergingdisease of Klebsiella pneumoniae liver abscess is serotype K1 animportant factor for complicated endophthalmitisrdquo Gut vol50 no 3 pp 420ndash424 2002
[12] D L Paterson ldquoResistance in gram-negative bacteria enter-obacteriaceaerdquo American Journal of Medicine vol 119 supple-ment 1 no 6 pp S20ndashS28 S60ndashS70 2006
[13] C Lin T Huang W Liang and H Peng ldquoHomologousresponse regulators KvgA KvhA and KvhR regulate the synthe-sis of capsular polysaccharide inKlebsiella pneumoniaeCG43 ina coordinated mannerrdquo Journal of Biochemistry vol 140 no 3pp 429ndash438 2006
[14] N Majdalani and S Gottesman ldquoThe Rcs phosphorelay acomplex signal transduction systemrdquo Annual Review of Micro-biology vol 59 pp 379ndash405 2005
[15] S Gottesman and V Stout ldquoRegulation of capsular polysaccha-ride synthesis in Escherichia coli K12rdquo Molecular Microbiologyvol 5 no 7 pp 1599ndash1606 1991
[16] V Stout ldquoRegulation of capsule synthesis includes interactionsof the RcsCRcsB regulatory pairrdquoResearch inMicrobiology vol145 no 5-6 pp 389ndash392 1994
[17] C T Lin Y C Chen T R Jinn C C Wu Y M Hong andW H Wu ldquoRole of the cAMP-dependent carbon cataboliterepression in capsular polysaccharide biosynthesis in Klebsiellapneumoniaerdquo PLoS ONE vol 8 no 2 Article ID e54430 2013
[18] C Lin C Wu Y Chen et al ldquoFur regulation of the capsularpolysaccharide biosynthesis and iron-acquisition systems inKlebsiella pneumoniae CG43rdquoMicrobiology vol 157 part 2 pp419ndash429 2010
[19] D J Hassett P A Sokol M L Howell et al ldquoFerric uptakeregulator (Fur) mutants of Pseudomonas aeruginosa demon-strate defective siderophore-mediated iron uptake altered aer-obic growth and decreased superoxide dismutase and catalaseactivitiesrdquo Journal of Bacteriology vol 178 no 14 pp 3996ndash4003 1996
[20] U A Ochsner and M L Vasil ldquoGene repression by the ferricuptake regulator in Pseudomonas aeruginosa cycle selection ofiron-regulated genesrdquo Proceedings of the National Academy ofSciences of the United States of America vol 93 no 9 pp 4409ndash4414 1996
[21] J J E Bijlsma B Waidner A H M Van Vliet et al ldquoTheHelicobacter pylori homologue of the ferric uptake regulator isinvolved in acid resistancerdquo Infection and Immunity vol 70 no2 pp 606ndash611 2002
[22] A H M van Vliet J Stoof S W Poppelaars et al ldquoDifferentialregulation of amidase- and formamidase-mediated ammoniaproduction by theHelicobacter pylori fur repressorrdquoThe Journalof Biological Chemistry vol 278 no 11 pp 9052ndash9057 2003
[23] M Baga M Goransson S Normark and B E Uhlin ldquoTran-scriptional activation of a pap pilus virulence operon fromuropathogenic Escherichia colirdquo The EMBO Journal vol 4 no13 pp 3887ndash3893 1985
[24] S Lory MWolfgang V Lee and R Smith ldquoThemulti-talentedbacterial adenylate cyclasesrdquo International Journal of MedicalMicrobiology vol 293 no 7-8 pp 479ndash482 2004
[25] K Skorupski and R K Taylor ldquoCyclic AMP and its receptorprotein negatively regulate the coordinate expression of choleratoxin and toxin-coregulated pilus in Vibrio choleraerdquo Proceed-ings of the National Academy of Sciences of the United States ofAmerica vol 94 no 1 pp 265ndash270 1997
[26] S E H West A K Sample and L J Runyen-Janecky ldquoThe vfrgene product required for Pseudomonas aeruginosa exotoxin Aand protease production belongs to the cyclic AMP receptorprotein familyrdquo Journal of Bacteriology vol 176 no 24 pp 7532ndash7542 1994
[27] M Mendez I-H Huang K Ohtani R Grau T Shimizuand M R Sarker ldquoCarbon catabolite repression of type IVpilus-dependent gliding motility in the anaerobic pathogenClostridium perfringensrdquo Journal of Bacteriology vol 190 no 1pp 48ndash60 2008
[28] E J Kalivoda N A Stella D M OrsquoDee G J Nau and R M QShanks ldquoThe cyclic AMP-dependent catabolite repression sys-tem of Serratia marcescensmediates biofilm formation throughregulation of type 1 fimbriaerdquo Applied and EnvironmentalMicrobiology vol 74 no 11 pp 3461ndash3470 2008
[29] C M Muller A Aberg J Straseviciene L Emody B E Uhlinand C Balsalobre ldquoType 1 fimbriae a colonization factor ofuropathogenic Escherichia coli are controlled by the metabolicsensor CRP-cAMPrdquo PLoS Pathogens vol 5 no 2 Article IDe1000303 2009
[30] E L Fuchs E D Brutinel E R Klem A R Fehr T L Yahrand M C Wolfgang ldquoIn vitro and in vivo characterization ofthe Pseudomonas aeruginosa cyclic AMP (cAMP) phosphodi-esterase CpdA required for cAMP homeostasis and virulencefactor regulationrdquo Journal of Bacteriology vol 192 no 11 pp2779ndash2790 2010
[31] T Endoh and J N Engel ldquoCbpA a polarly localized novel cyclicAMP-binding protein in Pseudomonas aeruginosardquo Journal ofBacteriology vol 191 no 23 pp 7193ndash7205 2009
[32] N A Stella E J Kalivoda D M OrsquoDee G J Nau and R M QShanks ldquoCatabolite repression control of flagellum productionby Serratia marcescensrdquo Research in Microbiology vol 159 no7-8 pp 562ndash568 2008
[33] S Enomoto K Yanaoka H Utsunomiya et al ldquoInhibitoryeffects of Japanese apricot (Prunus mume Siebold et ZuccUme) onHelicobacter pylori-related chronic gastritisrdquo EuropeanJournal of Clinical Nutrition vol 64 no 7 pp 714ndash719 2010
[34] R W K Wong U Hagg L Samaranayake M K Z Yuen CJ Seneviratne and R Kao ldquoAntimicrobial activity of Chinesemedicine herbs against common bacteria in oral biofilmA pilotstudyrdquo International Journal of Oral and Maxillofacial Surgeryvol 39 no 6 pp 599ndash605 2010
[35] C J Seneviratne R W K Wong U Hagg et al ldquoPrunus mumeextract exhibits antimicrobial activity against pathogenic oralbacteriardquo International Journal of Paediatric Dentistry vol 21no 4 pp 299ndash305 2011
[36] Y Chen RW KWong C J Seneviratne et al ldquoThe antimicro-bial efficacy of Fructus mume extract on orthodontic bracketa monospecies-biofilm model study in vitrordquo Archives of OralBiology vol 56 no 1 pp 16ndash21 2011
[37] Y Lai H Peng and H Chang ldquoRmpA2 an activator ofcapsule biosynthesis in Klebsiella pneumoniae CG43 regulatesK2 cps gene expression at the transcriptional levelrdquo Journal ofBacteriology vol 185 no 3 pp 788ndash800 2003
10 Evidence-Based Complementary and Alternative Medicine
[38] P Domenico S Schwartz and B A Cunha ldquoReduction ofcapsular polysaccharide production inKlebsiella pneumoniae bysodium salicylaterdquo Infection and Immunity vol 57 no 12 pp3778ndash3782 1989
[39] N Blumenkrantz and G A Hansen ldquoNew method for quanti-tative determination of uronic acidsrdquo Analytical Biochemistryvol 54 no 2 pp 484ndash489 1973
[40] J Lin F Chang C Fung et al ldquoHigh prevalence of phagocytic-resistant capsular serotypes of Klebsiella pneumoniae in liverabscessrdquo Microbes and Infection vol 6 no 13 pp 1191ndash11982004
[41] Y Arakawa R Wacharotayankun T Nagatsuka H Ito NKato and M Ohta ldquoGenomic organization of the Klebsiellapneumoniae cps region responsible for serotype K2 capsularpolysaccharide synthesis in the virulent strain chedidrdquo Journalof Bacteriology vol 177 no 7 pp 1788ndash1796 1995
[42] KWuN Li J Yan et al ldquoGenome sequencing and comparativeanalysis of Klebsiella pneumoniae NTUH-K2044 a strain caus-ing liver abscess and meningitisrdquo Journal of Bacteriology vol191 no 14 pp 4492ndash4501 2009
[43] H N Yeowell and J R White ldquoIron requirement in thebactericidal mechanism of streptonigrinrdquo Antimicrobial Agentsand Chemotherapy vol 22 no 6 pp 961ndash968 1982
[44] Y Keynan and E Rubinstein ldquoThe changing face of Klebsiellapneumoniae infections in the communityrdquo International Journalof Antimicrobial Agents vol 30 no 5 pp 385ndash389 2007
[45] R Colodner R Raz B Chazan and W Sakran ldquoSusceptibilitypattern of extended-spectrum 120573-lactamase producing bacteriaisolated from inpatients to five antimicrobial drugs in a com-munity hospital in Northern Israelrdquo International Journal ofAntimicrobial Agents vol 24 no 4 pp 409ndash410 2004
[46] E B Hirsch and V H Tam ldquoDetection and treatment optionsfor Klebsiella pneumoniae carbapenemases (KPCs) an emerg-ing cause of multidrug-resistant infectionrdquo Journal of Antimi-crobial Chemotherapy vol 65 no 6 pp 1119ndash1125 2010
[47] K K Kumarasamy M A Toleman T R Walsh et al ldquoEmer-gence of a new antibiotic resistance mechanism in India Pak-istan and the UK a molecular biological and epidemiologicalstudyrdquoThe Lancet Infectious Diseases vol 10 no 9 pp 597ndash6022010
[48] P Nordmann G Cuzon and T Naas ldquoThe real threat ofKlebsiella pneumoniae carbapenemase-producing bacteriardquoTheLancet Infectious Diseases vol 9 no 4 pp 228ndash236 2009
[49] D Yong M A Toleman C G Giske et al ldquoCharacterizationof a new metallo-120573-lactamase gene bla NDM-1 and a novelerythromycin esterase gene carried on a unique genetic struc-ture in Klebsiella pneumoniae sequence type 14 from IndiardquoAntimicrobial Agents and Chemotherapy vol 53 no 12 pp5046ndash5054 2009
[50] V Regueiro M A Campos J Pons S Albertı and J ABengoechea ldquoThe uptake of a Klebsiella pneumoniae capsulepolysaccharide mutant triggers an inflammatory response byhuman airway epithelial cellsrdquoMicrobiology vol 152 part 2 pp555ndash566 2006
[51] X Nassif N Honore T Vasselon S T Cole and P J SansonettildquoPositive control of colanic acid synthesis in Escherichia coliby rmpA and rmpB two virulence-plasmid genes of Klebsiellapneumoniaerdquo Molecular Microbiology vol 3 no 10 pp 1349ndash1359 1989
[52] X Nassif and P J Sansonetti ldquoCorrelation of the virulence ofKlebsiella pneumoniaeK1 and K2 with the presence of a plasmid
encoding aerobactinrdquo Infection and Immunity vol 54 no 3 pp603ndash608 1986
[53] K Mizuta M Ohta and M Mori ldquoVirulence for mice ofKlebsiella strains belonging to the O1 group relationship totheir capsular (K) typesrdquo Infection and Immunity vol 40 no1 pp 56ndash61 1983
[54] I Ofek K Kabha A Athamna et al ldquoGenetic exchange ofdeterminants for capsular polysaccharide biosynthesis betweenKlebsiella pneumoniae strains expressing serotypes K2 andK21ardquo Infection and Immunity vol 61 no 10 pp 4208ndash42161993
[55] A M Simoons-Smit A M J J Verwey-van Vught I Y RKanis and D M MacLaren ldquoVirulence of Klebsiella strains inexperimentally induced skin lesions in the mouserdquo Journal ofMedical Microbiology vol 17 no 1 pp 67ndash77 1984
[56] C Lee H Leu T Wu L Su and J Liu ldquoRisk factors for sponta-neous rupture of liver abscess caused byKlebsiella pneumoniaerdquoDiagnosticMicrobiology and Infectious Disease vol 52 no 2 pp79ndash84 2005
[57] C De Champs M P Sauvant C Chanal et al ldquoProspectivesurvey of colonization and infection caused by expanded-spectrum-120573-lactamase-producing members of the familyEnterobacteriaceae in an intensive care unitrdquo Journal of ClinicalMicrobiology vol 27 no 12 pp 2887ndash2890 1989
[58] S MMarkowitz J M Veazey Jr and F L Macrina ldquoSequentialoutbreaks of infection due to Klebsiella pneumoniae in a neona-tal intensive care unit implication of a conjugative R plasmidrdquoJournal of Infectious Diseases vol 142 no 1 pp 106ndash112 1980
[59] A M Stock V L Robinson and P N Goudreau ldquoTwo-component signal transductionrdquo Annual Review of Biochem-istry vol 69 pp 183ndash215 2000
[60] C Fuqua and E P Greenberg ldquoSelf perception in bacteriaquorum sensing with acylated homoserine lactonesrdquo CurrentOpinion in Microbiology vol 1 no 2 pp 183ndash189 1998
[61] P Romby F Vandenesch and E G H Wagner ldquoThe role ofRNAs in the regulation of virulence-gene expressionrdquo CurrentOpinion in Microbiology vol 9 no 2 pp 229ndash236 2006
[62] B L Bassler ldquoHow bacteria talk to each other regulationof gene expression by quorum sensingrdquo Current Opinion inMicrobiology vol 2 no 6 pp 582ndash587 1999
[63] H Y Cheng Y S Chen C YWu H Y Chang Y C Lai andHL Peng ldquoRmpA regulation of capsular polysaccharide biosyn-thesis in Klebsiella pneumoniae CG43rdquo Journal of Bacteriologyvol 192 no 12 pp 3144ndash3158 2010
[64] D Touati ldquoIron and oxidative stress in bacteriardquo Archives ofBiochemistry and Biophysics vol 373 no 1 pp 1ndash6 2000
Evidence-Based Complementary and Alternative Medicine 3
Table 1 Bacteria strains and primer used in this study
(a)
Strains Descriptions Reference or sourceK pneumoniae
NTUH-K2044 K1 serotype From Dr Jin-TownWangCG43S3 K2 serotype From Dr Hwei-Ling Peng
(b)
Primer Sequence (51015840 rarr 31015840) TaqMan probes TargetRT03 CGTCATCCAGACCAAAGAGC 83 orf1 in K1 cps gene clusterRT04 CCGGTTTTTCAATAAACTCGAC orf11015840 in K2 cps gene clusterRT134 TACCGGGACAGAGAATGAGC 78 orf3 in K1 cps gene clusterRT135 TAACTGGCCAACCCAAGGTRT136 CGTTTTATGGTAATGTTCTCCTCA 26 orf7 in K1 cps gene clusterRT137 TCTGCCCATAACCTCGAAAGRT05 CGATGACCGGCTTTTTAATG 83 orf31015840 in K2 cps gene clusterRT06 CTAGCGGAGATTTGGTACTGCRT07 CAGTCCACCTTTATTCCGATTG 67 orf161015840 in K2 cps gene clusterRT08 AGGTACGACCCCGACTGG
0
50
100
150
200
250
300
LB alone
350
2 6 240 (h)
5 mgmL FM in LB10 mgmL FM in LB20 mgmL FM in LB
lowastlowastlowast
lowast
lowast
No
of b
acte
ria (1
06
cfu
mL)
(a) NTUH-K2044
2 6 24
50
100
150
200
0 0
250
(h)
No
of b
acte
ria (1
06
cfu
mL)
LB alone5 mgmL FM in LB
10 mgmL FM in LB20 mgmL FM in LB
lowast
lowast
lowast
lowast
(b) CG43S3
Figure 1 Antibacterial activity of the Fructus mume extract againstK pneumoniaeThe addition of different concentrations of Fructus mumeextract (FM) as indicated to LB broth affects the growth of K pneumoniaeNTUH-K2044 (a) or CG43S3 (b) LB broth only inoculated withthe bacteria serves as a negative control lowast 119875 lt 005 compared to the indicated group
27 Streptonigrin Sensitivity To measure bacterial suscepti-bility to the iron-activated antibiotic streptonigrin overnightgrown K pneumoniae were 1 10 diluted in LB or LB brothsupplemented with different concentrations of Fructus mumeextract After 2 h incubation with or without streptonigrin(2120583gmL) at 37∘C with agitation aliquots (5120583L) of culturesserially diluted tenfold in LB broth were spotted onto LBagar The plates were incubated at 37∘C overnight andphotographed
28 Statistical Method An unpaired 119905-test was used todetermine the statistical significance and values of 119875 lt 005and 119875 lt 001 were considered significant Each samplewas assayed in triplicate and the mean activity and standarddeviation are presented
29 Ethics Statement For isolation of normal human serumfrom healthy volunteers the procedure and the respective
4 Evidence-Based Complementary and Alternative Medicine
0 20105NTUH-K2044FM
(mgmL)
(a)
CG43S3FM
(mgmL) 0 20105
(b)
Figure 2 Fructus mume reduces K pneumoniae mucoviscosity Different concentrations of Fructus mume extract (FM) as indicated wereadded to LB broth inoculated with K pneumoniae NTUH-K2044 (a) or CG43S3 (b) After overnight incubation at 37∘C the bacterialmucoviscosity was assessed by a low speed centrifugation LB broth only inoculated with the bacteria serves as a negative control
Surv
ival
rate
in n
orm
al h
uman
seru
m (
)
0
5
10
15
20
25
30
35
0 5 10FM(mgmL) NTUH-K2044
20CG43S3
0 5 10 20
lowast lowastlowast
lowastlowast lowast lowast
Figure 3 Effect of Fructus mume on K pneumoniae susceptibilityto normal human serum Different concentrations of Fructus mumeextract (FM)were added to LB broth inoculatedwithK pneumoniaeNTUH-K2044 (a) or CG43S3 (b) as indicated in the margin Afterovernight incubation at 37∘C the bacterial serum resistance wasdetermined LB broth only inoculated with the bacteria serves as anegative control lowast 119875 lt 005 compared to the indicated group
consent documents were approved by the Ethics Committeeof the China Medical University Hospital Taichung TaiwanAll healthy volunteers provided written informed consent
3 Results
31 Fructus mume Inhibits the Growth of K pneumoniaeTo examine the antibacterial activity of Fructus mume Kpneumoniae NTUH-K2044 and CG43S3 were coculturedwith increasing amounts of Fructus mume extract andbacterial growth was monitored by plate counting As shownin Figure 1 compared to the results for the control groupsaddition of 5mgmL Fructus mume extract to LB broth didnot obviously influence the growth of the 2 strains at any timeinterval while the addition of 10 or 20mgmL Fructus mumeextract caused significant growth reduction after 6 and 24 hincubationsThis inhibitory effect of Fructus mume extract is
Table 2 Quantification of CPS amount of K pneumoniae strainscocultured with Fructus mume extract
Fructus mume(mgmL)
CPS amounta ( relative to the control group)NTUH-K2044 CG43S3
aglucuronic acid content (120583g109 cfu)bND not determined
dose dependent Besides Fructus mume extract appeared toexert a stronger growth inhibitory effect in the case ofNTUH-K2044 than in the case of CG43S3 Bactericidal activity of the20mgmL Fructus mume extract was observed for NTUH-K2044 but not CG43S3 Additionally the pH values of LBbroth supplemented with 5 10 and 20mgmL FM extractwere sim50 44 and 36 respectively
32 Fructus mume Reduces the Biosynthesis of CPS In thecase of K pneumoniae strains high mucoviscosity resultingfrom a large amount of surface CPS has been correlatedwith increased pathogenicity [8 40] To investigate whetherFructus mume affects this mucoviscosity NTUH-K2044and CG43S3 were respectively cocultured with increasingamounts of Fructus mume extract After 24 h of incubationthe sedimentation test revealed that the addition of Fructusmume extract to LB broth obviously decreasedmucoviscosityin the case of 2 K pneumoniae strains K pneumoniaecocultured with Fructus mume extract formed a compactpellet after centrifugation while the control group could notbe pelleted down (Figure 2) Since the addition of 5mgmLFructus mume extract did not influence bacterial growth(Figure 1) we suggest that Fructus mume affected the muco-viscosity by regulating the biosynthesis of CPS As shown inTable 2 in comparisonwith the control groupNTUH-K2044produced a larger amount of CPS approximately 155 foldthan that of CG43S3 The addition of Fructus mume extractreduced CPS production in both strains in a dose-dependent
Evidence-Based Complementary and Alternative Medicine 5
Relat
ive a
mou
nt o
f mRN
A
00
02
04
06
08
10
12
LB alone10 mgmL FM in LB
lowast lowast
lowastlowast
K1cps mRNA
orf1 orf3 orf7
(a) NTUH-K2044
Relat
ive a
mou
nt o
f mRN
A
00
02
04
06
08
10
12
LB alone10 mgmL FM in LB
lowast
lowast
lowastlowast
K2cps mRNA
orf1 998400 orf3 998400 orf16 998400
(b) CG43S3
Figure 4 Fructus mume downregulates cps transcription qRT-PCR analyses of the expression of the K1 cps genes (orf1 orf3 and orf7) inNTUH-K2044 (a) or K2 cps genes (orf11015840 orf31015840 and orf161015840) in CG43S3 (b) in LB or LB broth supplemented with 10mgmL Fructus mumeextract (FM) lowast 119875 lt 005 and lowastlowast 119875 lt 001 compared to LB alone
manner Moreover Fructus mume extract appeared to exert astronger inhibitory effect on NTUH-K2044 than on CG43S3(Table 2)
33 Fructus mume Reduces the Serum Resistance Activity ofK pneumoniae CPS plays a crucial role in the resistanceof K pneumoniae to serum killing Since the Fructus mumeextract decreased the CPS production of K pneumoniaethe effect of the extract on bacterial serum resistance wasfurther analyzedNTUH-K2044 orCG43S3was respectivelycocultured with 5 10 or 20mgmL Fructus mume extractand the bacteria were then collected washed and subjectedto incubation with pooled human sera After 15min ofincubation the survival rate of the bacteria was determinedby plate counting As shown in Figure 3 Fructus mumeextract obviously decreased the serum resistance activity ofNTUH-K2044 and CG43S3 in a dose-dependent mannerpossibly due to reduced CPS production by the bacteria
34 Effect of Fructus mume on cps Transcription The biosyn-thesis of K pneumoniae K1 and K2 CPS is controlled by 20and 17 genes respectively [41 42] Both the K1 and K2 cpsgene clusters contain 3 transcriptional units orf1-2 orf3-6
and orf7-20 in the K1 cps gene cluster and orf11015840-21015840 orf31015840-151015840 and orf161015840-171015840 in the K2 cps gene cluster [41 42] Toinvestigate how Fructus mume extract affects the biosynthesisof K pneumoniae CPS NTUH-K2044 and CG43S3 werecocultured with 10mgmL Fructus mume extract and themRNA levels of the 3 transcripts belonging to the K1 orK2 cps gene cluster were measured by qRT-PCR As shownin Figure 4 compared to the control group the additionof 10mgmL Fructus mume extract obviously reduced themRNA levels of all the cps transcripts suggesting that Fructusmume regulated CPS biosynthesis at the transcriptional level
35 Fructus mume Reduces CPS Biosynthesis by RegulatingK pneumoniae Intracellular Iron Concentration We havepreviously demonstrated that iron depletion activated CPSproduction in K pneumoniae at the transcriptional level[18] To analyze whether iron is involved in Fructus mume-regulated CPS production we assessed intracellular ironlevels in K pneumoniae cocultured with increasing amountsof Fructus mume extract using the iron-activated antibioticstreptonigrin which requires iron for its bactericidal actionthat causes DNA degradation [43] As shown in Figure 5when NTUH-K2044 or CG43S3 was grown in LB broth onlythe bacteria exhibited a streptonigrin-resistant phenotype
6 Evidence-Based Complementary and Alternative Medicine
LB alone FM
(mgmL)
FM(mgmL)
0
20
10
5
0
20
10
5
10minus1 10
minus210
minus310
minus410
minus510
minus6
10minus1 10
minus210
minus310
minus410
minus5
LB with SNG (2 120583gmL)
100
(a) NTUH-K2044
LB alone FM
(mgmL)
FM(mgmL)
0
20
10
5
0
20
10
5
10minus1 10
minus210
minus310
minus410
minus510
minus6
10minus1 10
minus210
minus310
minus410
minus5
LB with SNG (2 120583gmL)
100
(b) CG43S3
Figure 5 Fructus mume increasesK pneumoniae susceptibility to streptonigrinK pneumoniaeNTUH-K2044 (a) or CG43S3 (b) coculturedwith different concentrations of Fructus mume extract (FM) were grown in LB alone or LB that supplemented with 2120583gmL streptonigrin(SNG) incubated for 2 h Then tenfold serial dilutions were spotted onto an LB agar to observe the colony formation
However the streptonigrin susceptibility of the bacteriaincreased upon coculturing with increasing amounts of Fruc-tusmume extract suggesting thatFructusmume increased theintracellular level of free iron in a dose-dependent manner inK pneumoniae
36 Citric Acid Inhibits K pneumoniae Growth and CPSBiosynthesis Citric acid has been demonstrated to be themain organic acid in Fructus mume extract [35] To examineif citric acid plays a role in the inhibitory effects of Fructusmume extract onK pneumoniae growth andCPS productionNTUH-K2044 and CG43S3 were cocultured with variousconcentrations of citric acid and then the growth curvesof the bacteria were monitored The result showed thatcitric acid obviously reduced the growth of NTUH-K2044and CG43S3 in a dose-dependent manner (Figure 6(a))Furthermore CPS production in the 2 K pneumoniae strainsalso decreased when citric acid was added to the growthmedium (Figure 6(b)) These results indicated that citric acidis an active component of Fructus mume extract that has
bactericidal activity and downregulates CPS biosynthesis inK pneumoniae
4 Discussion
Since the 1980s K pneumoniae is emerging as an importantpathogen in both community and hospital settings [44]In the hospital environment due to the extensive use ofantibiotics multiple drug resistance has been increasinglyobserved in K pneumoniae especially in ESBL-producingstrains Carbapenems are considered to be the preferredagents for the treatment of serious infections caused by ESBL-producing K pneumoniae because of their high stabilitywith respect to 120573-lactamase hydrolysis and the observedretained susceptibility of ESBL producers [45] HoweverK pneumoniae isolates resistant to carbapenems have beenreported worldwide since the 2000s [46ndash49] The emergenceof carbapenem-resistant enterobacteria is worrisome becausethe option for antimicrobial treatment is further restricted Inthis study we screened a series of TCMs for the identification
Evidence-Based Complementary and Alternative Medicine 7
NTUH-K2044
0 100 200 300 400 500 600 700
OD
600
00
05
10
15
20
25 CG43S3
(min)(min)0 100 200 300 400 500 600 700
OD
600
00
05
10
15
20
25
LB alone1 mgmL citric acid2 mgmL citric acid
3 mgmL citric acid4 mgmL citric acid
LB alone1 mgmL citric acid2 mgmL citric acid
3 mgmL citric acid4 mgmL citric acid
(a)
0
5
10
15
20
25
30
35
Citric acid(mgmL)
1 20 210
NTUH-K2044 CG43S3
Glu
curo
nic a
cid
(120583g109
cfu)
lowastlowast
lowast
(b)
Figure 6 Citric acid inhibits K pneumoniae growth and CPS levels K pneumoniae NTUH-K204 or CG43S3 cocultured with differentconcentrations of citric acid as indicated and the growth curve (a) as well as the CPS levels (b) were measured Bacteria were grown in LBbroth at 37∘C with agitation lowast 119875 lt 005 compared to the indicated group
of new antibacterial agents (data not shown) and then focusedon Fructus mume the smoked fruit of Prunus mume whichhas been demonstrated to efficiently inhibit H pylori andother oral bacteria [33ndash36] As shown in Figure 1 Fructusmume extract was found to have antibacterial activity againstclinically isolated K pneumoniae strains
Clinically isolated K pneumoniae strains usually producea large amount of CPS which confers not only a mucoidphenotype to the bacteria but also resistance to engulfmentby phagocytes and to serum bactericidal factors [40 50] Thedegree of mucoviscosity has also been positively correlated
with the successful establishment of infection [51 52] Amongthe 77 described capsular types of K pneumoniae K1 andK2 serotypes are highly virulent in experimental infectionin mice and are often associated with severe infections inhumans and animals [52ndash55] particularly with the tightassociation between the 2 serotypes and liver abscess [11 56]As shown in Figure 2 and Table 2 in K pneumoniae strainsof both the K1 and K2 serotypes Fructus mume extractsignificantly reduced bacterial hypermucoviscosity and CPSlevels and thus may result in the decreased resistance ofK pneumoniae to serum killing (Figure 3) On the other
8 Evidence-Based Complementary and Alternative Medicine
hand we also found that heat inactivated serum did nothave obvious bactericidal effects on K pneumoniae (data notshown) suggesting an importance of the complement system
Both prokaryotic and eukaryotic cells in natural envi-ronments are constantly challenged by various environ-mental stresses K pneumoniae like many gastrointestinalpathogens needs to penetrate the gastric acid barrier facethe challenge of the immune system and cope with thelimited supply of oxygen and nutrition to effect colonizationand infection [57 58] Therefore bacteria activate or repressthe expression of virulence genes to adapt to environmentalstimuli [59ndash62] In K pneumoniae CPS biosynthesis isregulated by multiple environmental stimuli and proteinregulators Our previous studies have shown that ferricions can repress K pneumoniae CPS production throughFur regulation [18 63] Under iron-repletion conditionsFur-Fe(II) can tightly repress cps transcription resulting inlowered CPS production in K pneumoniae [18] To furtherinvestigate how Fructus mume reduces CPS levels in Kpneumoniae we performed qRT-PCR analyses and foundthat CPS reduction was regulated at the transcriptionallevel (Figure 4) All 3 transcripts of K1 or K2 cps geneswere obviously downregulated especially orf1orf11015840 encodingGalF a putative UDP-glucose pyrophosphatase (Figure 4)In addition the streptonigrin sensitivity assay also indicatedthat Fructus mume could increase the intracellular iron levelsofK pneumoniae (Figure 5) implying that ferric iron and Furparticipate in Fructus mume-mediated CPS reduction Ironis essential to most bacteria for growth and reproductionbut iron overloading would lead to the formation of unde-sired reactive oxygen species (ROS) by the Fenton reactionto damage DNA or other biological macromolecules [64]Although how Fructus mume affects bacterial iron-uptakeremains unknown the increase in intracellular iron leadingto the formation of undesired ROS may account for part ofits bactericidal activity
The ingredients of Prunus mume extract are organicacids including citric acid (the main ingredient) tartaricacid oxalic acid and other unknown components [35 36]Although the acidic components of Prunus mume showedsome antibacterial activity it is less compared to that ofthe original extract implying that other active componentspossess considerable antibacterial activity [36] As seen inFigure 6 we also showed that citric acid could inhibit growthand CPS production in K pneumoniae The acidic propertymay be one of the antibacterialmechanisms of Fructusmumehowever there should be other active components since LBbroth supplemented with 20mgmL Fructus mume pHsim36 has stronger bactericidal activity than LB broth adjustedto pH 35 using HCl (data not shown) For future clinicalapplication more studies are required to determine the activecomponents of Fructus mume and its mechanism of action
5 Conclusion
To our knowledge this study is the first to report theantibacterial activity of Fructus mume against highly virulentK pneumoniae isolates Moreover we found that Fructus
mume reduced K pneumoniae CPS biosynthesis at thetranscriptional level possibly by regulating the intracellulariron concentration of the bacteria thereby helping the hostimmune system eliminate the pathogen
Conflict of Interests
The authors declare no conflict of interests in this work
Authorsrsquo Contribution
T-H Lin S-H Huang and C-C Wu contributed equally tothis work
Acknowledgments
The authors thank Professor Hwei-Ling Peng from NationalChiao Tung University Taiwan for providing theK pneumo-niae CG43S3 and Dr Jin-Town Wang from National TaiwanUniversity Hospital for providing K pneumoniae NTUH-K2044 The authors thank Yi-Ming Hong and Jing-Ciao Linfor their technical assistance during the study The workis supported by the Grants from National Science Council(NSC 99-2320-B-039-002-MY3) China Medical University(CMU98-ASIA-01) and Buddhist Tzu Chi general hospital(TTCRD101-17)
References
[1] F Chou and H Kou ldquoEndogenous endophthalmitis associatedwith pyogenic hepatic abscessrdquo Journal of the American Collegeof Surgeons vol 182 no 1 pp 33ndash36 1996
[2] S-H B Han ldquoReview of hepatic abscess from Klebsiellapneumoniaemdashan association with diabetes mellitus and septicendophthalmitisrdquo Western Journal of Medicine vol 162 no 3pp 220ndash224 1995
[3] Y Lau B Hu W Wu Y Lin H Chang and Z Shi ldquoIden-tification of a major cluster of Klebsiella pneumoniae isolatesfrom patients with liver abscess in Taiwanrdquo Journal of ClinicalMicrobiology vol 38 no 1 pp 412ndash414 2000
[4] H L Peng P Y Wang J L Wu C T Chiu and H Y ChangldquoMolecular epidemiology of Klebsiella pneumoniaerdquo ZhonghuaMin GuoWei ShengWu Ji Mian Yi Xue Za Zhi vol 24 no 3 pp264ndash271 1991
[5] Y Yang L K Siu K Yeh et al ldquoRecurrent Klebsiella pneumo-niae liver abscess clinical and microbiological characteristicsrdquoJournal of Clinical Microbiology vol 47 no 10 pp 3336ndash33392009
[6] L K Siu K M Yeh J C Lin C P Fung and F Y ChangldquoKlebsiella pneumoniae liver abscess a new invasive syndromerdquoThe Lancet Infectious Diseases vol 12 no 11 pp 881ndash887 2012
[7] E R Lederman and N F Crum ldquoPyogenic liver abscess witha focus on Klebsiella pneumoniae as a primary pathogen anemerging disease with unique clinical characteristicsrdquo Amer-ican Journal of Gastroenterology vol 100 no 2 pp 322ndash3312005
[8] H Sahly R Podschun T A Oelschlaeger et al ldquoCapsuleimpedes adhesion to and invasion of epithelial cells byKlebsiellapneumoniaerdquo Infection and Immunity vol 68 no 12 pp 6744ndash6749 2000
Evidence-Based Complementary and Alternative Medicine 9
[9] C Fung B Hu F Chang et al ldquoA 5-year study of the ser-oepidemiology of Klebsiella pneumoniae high prevalence ofcapsular serotype K1 in Taiwan and implication for vaccineefficacyrdquo Journal of Infectious Diseases vol 181 no 6 pp 2075ndash2079 2000
[10] Y Pan H Fang H Yang et al ldquoCapsular polysaccharide syn-thesis regions in Klebsiella pneumoniae serotype K57 and a newcapsular serotyperdquo Journal of Clinical Microbiology vol 46 no7 pp 2231ndash2240 2008
[11] C-P Fung F-Y Chang S-C Lee et al ldquoA global emergingdisease of Klebsiella pneumoniae liver abscess is serotype K1 animportant factor for complicated endophthalmitisrdquo Gut vol50 no 3 pp 420ndash424 2002
[12] D L Paterson ldquoResistance in gram-negative bacteria enter-obacteriaceaerdquo American Journal of Medicine vol 119 supple-ment 1 no 6 pp S20ndashS28 S60ndashS70 2006
[13] C Lin T Huang W Liang and H Peng ldquoHomologousresponse regulators KvgA KvhA and KvhR regulate the synthe-sis of capsular polysaccharide inKlebsiella pneumoniaeCG43 ina coordinated mannerrdquo Journal of Biochemistry vol 140 no 3pp 429ndash438 2006
[14] N Majdalani and S Gottesman ldquoThe Rcs phosphorelay acomplex signal transduction systemrdquo Annual Review of Micro-biology vol 59 pp 379ndash405 2005
[15] S Gottesman and V Stout ldquoRegulation of capsular polysaccha-ride synthesis in Escherichia coli K12rdquo Molecular Microbiologyvol 5 no 7 pp 1599ndash1606 1991
[16] V Stout ldquoRegulation of capsule synthesis includes interactionsof the RcsCRcsB regulatory pairrdquoResearch inMicrobiology vol145 no 5-6 pp 389ndash392 1994
[17] C T Lin Y C Chen T R Jinn C C Wu Y M Hong andW H Wu ldquoRole of the cAMP-dependent carbon cataboliterepression in capsular polysaccharide biosynthesis in Klebsiellapneumoniaerdquo PLoS ONE vol 8 no 2 Article ID e54430 2013
[18] C Lin C Wu Y Chen et al ldquoFur regulation of the capsularpolysaccharide biosynthesis and iron-acquisition systems inKlebsiella pneumoniae CG43rdquoMicrobiology vol 157 part 2 pp419ndash429 2010
[19] D J Hassett P A Sokol M L Howell et al ldquoFerric uptakeregulator (Fur) mutants of Pseudomonas aeruginosa demon-strate defective siderophore-mediated iron uptake altered aer-obic growth and decreased superoxide dismutase and catalaseactivitiesrdquo Journal of Bacteriology vol 178 no 14 pp 3996ndash4003 1996
[20] U A Ochsner and M L Vasil ldquoGene repression by the ferricuptake regulator in Pseudomonas aeruginosa cycle selection ofiron-regulated genesrdquo Proceedings of the National Academy ofSciences of the United States of America vol 93 no 9 pp 4409ndash4414 1996
[21] J J E Bijlsma B Waidner A H M Van Vliet et al ldquoTheHelicobacter pylori homologue of the ferric uptake regulator isinvolved in acid resistancerdquo Infection and Immunity vol 70 no2 pp 606ndash611 2002
[22] A H M van Vliet J Stoof S W Poppelaars et al ldquoDifferentialregulation of amidase- and formamidase-mediated ammoniaproduction by theHelicobacter pylori fur repressorrdquoThe Journalof Biological Chemistry vol 278 no 11 pp 9052ndash9057 2003
[23] M Baga M Goransson S Normark and B E Uhlin ldquoTran-scriptional activation of a pap pilus virulence operon fromuropathogenic Escherichia colirdquo The EMBO Journal vol 4 no13 pp 3887ndash3893 1985
[24] S Lory MWolfgang V Lee and R Smith ldquoThemulti-talentedbacterial adenylate cyclasesrdquo International Journal of MedicalMicrobiology vol 293 no 7-8 pp 479ndash482 2004
[25] K Skorupski and R K Taylor ldquoCyclic AMP and its receptorprotein negatively regulate the coordinate expression of choleratoxin and toxin-coregulated pilus in Vibrio choleraerdquo Proceed-ings of the National Academy of Sciences of the United States ofAmerica vol 94 no 1 pp 265ndash270 1997
[26] S E H West A K Sample and L J Runyen-Janecky ldquoThe vfrgene product required for Pseudomonas aeruginosa exotoxin Aand protease production belongs to the cyclic AMP receptorprotein familyrdquo Journal of Bacteriology vol 176 no 24 pp 7532ndash7542 1994
[27] M Mendez I-H Huang K Ohtani R Grau T Shimizuand M R Sarker ldquoCarbon catabolite repression of type IVpilus-dependent gliding motility in the anaerobic pathogenClostridium perfringensrdquo Journal of Bacteriology vol 190 no 1pp 48ndash60 2008
[28] E J Kalivoda N A Stella D M OrsquoDee G J Nau and R M QShanks ldquoThe cyclic AMP-dependent catabolite repression sys-tem of Serratia marcescensmediates biofilm formation throughregulation of type 1 fimbriaerdquo Applied and EnvironmentalMicrobiology vol 74 no 11 pp 3461ndash3470 2008
[29] C M Muller A Aberg J Straseviciene L Emody B E Uhlinand C Balsalobre ldquoType 1 fimbriae a colonization factor ofuropathogenic Escherichia coli are controlled by the metabolicsensor CRP-cAMPrdquo PLoS Pathogens vol 5 no 2 Article IDe1000303 2009
[30] E L Fuchs E D Brutinel E R Klem A R Fehr T L Yahrand M C Wolfgang ldquoIn vitro and in vivo characterization ofthe Pseudomonas aeruginosa cyclic AMP (cAMP) phosphodi-esterase CpdA required for cAMP homeostasis and virulencefactor regulationrdquo Journal of Bacteriology vol 192 no 11 pp2779ndash2790 2010
[31] T Endoh and J N Engel ldquoCbpA a polarly localized novel cyclicAMP-binding protein in Pseudomonas aeruginosardquo Journal ofBacteriology vol 191 no 23 pp 7193ndash7205 2009
[32] N A Stella E J Kalivoda D M OrsquoDee G J Nau and R M QShanks ldquoCatabolite repression control of flagellum productionby Serratia marcescensrdquo Research in Microbiology vol 159 no7-8 pp 562ndash568 2008
[33] S Enomoto K Yanaoka H Utsunomiya et al ldquoInhibitoryeffects of Japanese apricot (Prunus mume Siebold et ZuccUme) onHelicobacter pylori-related chronic gastritisrdquo EuropeanJournal of Clinical Nutrition vol 64 no 7 pp 714ndash719 2010
[34] R W K Wong U Hagg L Samaranayake M K Z Yuen CJ Seneviratne and R Kao ldquoAntimicrobial activity of Chinesemedicine herbs against common bacteria in oral biofilmA pilotstudyrdquo International Journal of Oral and Maxillofacial Surgeryvol 39 no 6 pp 599ndash605 2010
[35] C J Seneviratne R W K Wong U Hagg et al ldquoPrunus mumeextract exhibits antimicrobial activity against pathogenic oralbacteriardquo International Journal of Paediatric Dentistry vol 21no 4 pp 299ndash305 2011
[36] Y Chen RW KWong C J Seneviratne et al ldquoThe antimicro-bial efficacy of Fructus mume extract on orthodontic bracketa monospecies-biofilm model study in vitrordquo Archives of OralBiology vol 56 no 1 pp 16ndash21 2011
[37] Y Lai H Peng and H Chang ldquoRmpA2 an activator ofcapsule biosynthesis in Klebsiella pneumoniae CG43 regulatesK2 cps gene expression at the transcriptional levelrdquo Journal ofBacteriology vol 185 no 3 pp 788ndash800 2003
10 Evidence-Based Complementary and Alternative Medicine
[38] P Domenico S Schwartz and B A Cunha ldquoReduction ofcapsular polysaccharide production inKlebsiella pneumoniae bysodium salicylaterdquo Infection and Immunity vol 57 no 12 pp3778ndash3782 1989
[39] N Blumenkrantz and G A Hansen ldquoNew method for quanti-tative determination of uronic acidsrdquo Analytical Biochemistryvol 54 no 2 pp 484ndash489 1973
[40] J Lin F Chang C Fung et al ldquoHigh prevalence of phagocytic-resistant capsular serotypes of Klebsiella pneumoniae in liverabscessrdquo Microbes and Infection vol 6 no 13 pp 1191ndash11982004
[41] Y Arakawa R Wacharotayankun T Nagatsuka H Ito NKato and M Ohta ldquoGenomic organization of the Klebsiellapneumoniae cps region responsible for serotype K2 capsularpolysaccharide synthesis in the virulent strain chedidrdquo Journalof Bacteriology vol 177 no 7 pp 1788ndash1796 1995
[42] KWuN Li J Yan et al ldquoGenome sequencing and comparativeanalysis of Klebsiella pneumoniae NTUH-K2044 a strain caus-ing liver abscess and meningitisrdquo Journal of Bacteriology vol191 no 14 pp 4492ndash4501 2009
[43] H N Yeowell and J R White ldquoIron requirement in thebactericidal mechanism of streptonigrinrdquo Antimicrobial Agentsand Chemotherapy vol 22 no 6 pp 961ndash968 1982
[44] Y Keynan and E Rubinstein ldquoThe changing face of Klebsiellapneumoniae infections in the communityrdquo International Journalof Antimicrobial Agents vol 30 no 5 pp 385ndash389 2007
[45] R Colodner R Raz B Chazan and W Sakran ldquoSusceptibilitypattern of extended-spectrum 120573-lactamase producing bacteriaisolated from inpatients to five antimicrobial drugs in a com-munity hospital in Northern Israelrdquo International Journal ofAntimicrobial Agents vol 24 no 4 pp 409ndash410 2004
[46] E B Hirsch and V H Tam ldquoDetection and treatment optionsfor Klebsiella pneumoniae carbapenemases (KPCs) an emerg-ing cause of multidrug-resistant infectionrdquo Journal of Antimi-crobial Chemotherapy vol 65 no 6 pp 1119ndash1125 2010
[47] K K Kumarasamy M A Toleman T R Walsh et al ldquoEmer-gence of a new antibiotic resistance mechanism in India Pak-istan and the UK a molecular biological and epidemiologicalstudyrdquoThe Lancet Infectious Diseases vol 10 no 9 pp 597ndash6022010
[48] P Nordmann G Cuzon and T Naas ldquoThe real threat ofKlebsiella pneumoniae carbapenemase-producing bacteriardquoTheLancet Infectious Diseases vol 9 no 4 pp 228ndash236 2009
[49] D Yong M A Toleman C G Giske et al ldquoCharacterizationof a new metallo-120573-lactamase gene bla NDM-1 and a novelerythromycin esterase gene carried on a unique genetic struc-ture in Klebsiella pneumoniae sequence type 14 from IndiardquoAntimicrobial Agents and Chemotherapy vol 53 no 12 pp5046ndash5054 2009
[50] V Regueiro M A Campos J Pons S Albertı and J ABengoechea ldquoThe uptake of a Klebsiella pneumoniae capsulepolysaccharide mutant triggers an inflammatory response byhuman airway epithelial cellsrdquoMicrobiology vol 152 part 2 pp555ndash566 2006
[51] X Nassif N Honore T Vasselon S T Cole and P J SansonettildquoPositive control of colanic acid synthesis in Escherichia coliby rmpA and rmpB two virulence-plasmid genes of Klebsiellapneumoniaerdquo Molecular Microbiology vol 3 no 10 pp 1349ndash1359 1989
[52] X Nassif and P J Sansonetti ldquoCorrelation of the virulence ofKlebsiella pneumoniaeK1 and K2 with the presence of a plasmid
encoding aerobactinrdquo Infection and Immunity vol 54 no 3 pp603ndash608 1986
[53] K Mizuta M Ohta and M Mori ldquoVirulence for mice ofKlebsiella strains belonging to the O1 group relationship totheir capsular (K) typesrdquo Infection and Immunity vol 40 no1 pp 56ndash61 1983
[54] I Ofek K Kabha A Athamna et al ldquoGenetic exchange ofdeterminants for capsular polysaccharide biosynthesis betweenKlebsiella pneumoniae strains expressing serotypes K2 andK21ardquo Infection and Immunity vol 61 no 10 pp 4208ndash42161993
[55] A M Simoons-Smit A M J J Verwey-van Vught I Y RKanis and D M MacLaren ldquoVirulence of Klebsiella strains inexperimentally induced skin lesions in the mouserdquo Journal ofMedical Microbiology vol 17 no 1 pp 67ndash77 1984
[56] C Lee H Leu T Wu L Su and J Liu ldquoRisk factors for sponta-neous rupture of liver abscess caused byKlebsiella pneumoniaerdquoDiagnosticMicrobiology and Infectious Disease vol 52 no 2 pp79ndash84 2005
[57] C De Champs M P Sauvant C Chanal et al ldquoProspectivesurvey of colonization and infection caused by expanded-spectrum-120573-lactamase-producing members of the familyEnterobacteriaceae in an intensive care unitrdquo Journal of ClinicalMicrobiology vol 27 no 12 pp 2887ndash2890 1989
[58] S MMarkowitz J M Veazey Jr and F L Macrina ldquoSequentialoutbreaks of infection due to Klebsiella pneumoniae in a neona-tal intensive care unit implication of a conjugative R plasmidrdquoJournal of Infectious Diseases vol 142 no 1 pp 106ndash112 1980
[59] A M Stock V L Robinson and P N Goudreau ldquoTwo-component signal transductionrdquo Annual Review of Biochem-istry vol 69 pp 183ndash215 2000
[60] C Fuqua and E P Greenberg ldquoSelf perception in bacteriaquorum sensing with acylated homoserine lactonesrdquo CurrentOpinion in Microbiology vol 1 no 2 pp 183ndash189 1998
[61] P Romby F Vandenesch and E G H Wagner ldquoThe role ofRNAs in the regulation of virulence-gene expressionrdquo CurrentOpinion in Microbiology vol 9 no 2 pp 229ndash236 2006
[62] B L Bassler ldquoHow bacteria talk to each other regulationof gene expression by quorum sensingrdquo Current Opinion inMicrobiology vol 2 no 6 pp 582ndash587 1999
[63] H Y Cheng Y S Chen C YWu H Y Chang Y C Lai andHL Peng ldquoRmpA regulation of capsular polysaccharide biosyn-thesis in Klebsiella pneumoniae CG43rdquo Journal of Bacteriologyvol 192 no 12 pp 3144ndash3158 2010
[64] D Touati ldquoIron and oxidative stress in bacteriardquo Archives ofBiochemistry and Biophysics vol 373 no 1 pp 1ndash6 2000
4 Evidence-Based Complementary and Alternative Medicine
0 20105NTUH-K2044FM
(mgmL)
(a)
CG43S3FM
(mgmL) 0 20105
(b)
Figure 2 Fructus mume reduces K pneumoniae mucoviscosity Different concentrations of Fructus mume extract (FM) as indicated wereadded to LB broth inoculated with K pneumoniae NTUH-K2044 (a) or CG43S3 (b) After overnight incubation at 37∘C the bacterialmucoviscosity was assessed by a low speed centrifugation LB broth only inoculated with the bacteria serves as a negative control
Surv
ival
rate
in n
orm
al h
uman
seru
m (
)
0
5
10
15
20
25
30
35
0 5 10FM(mgmL) NTUH-K2044
20CG43S3
0 5 10 20
lowast lowastlowast
lowastlowast lowast lowast
Figure 3 Effect of Fructus mume on K pneumoniae susceptibilityto normal human serum Different concentrations of Fructus mumeextract (FM)were added to LB broth inoculatedwithK pneumoniaeNTUH-K2044 (a) or CG43S3 (b) as indicated in the margin Afterovernight incubation at 37∘C the bacterial serum resistance wasdetermined LB broth only inoculated with the bacteria serves as anegative control lowast 119875 lt 005 compared to the indicated group
consent documents were approved by the Ethics Committeeof the China Medical University Hospital Taichung TaiwanAll healthy volunteers provided written informed consent
3 Results
31 Fructus mume Inhibits the Growth of K pneumoniaeTo examine the antibacterial activity of Fructus mume Kpneumoniae NTUH-K2044 and CG43S3 were coculturedwith increasing amounts of Fructus mume extract andbacterial growth was monitored by plate counting As shownin Figure 1 compared to the results for the control groupsaddition of 5mgmL Fructus mume extract to LB broth didnot obviously influence the growth of the 2 strains at any timeinterval while the addition of 10 or 20mgmL Fructus mumeextract caused significant growth reduction after 6 and 24 hincubationsThis inhibitory effect of Fructus mume extract is
Table 2 Quantification of CPS amount of K pneumoniae strainscocultured with Fructus mume extract
Fructus mume(mgmL)
CPS amounta ( relative to the control group)NTUH-K2044 CG43S3
aglucuronic acid content (120583g109 cfu)bND not determined
dose dependent Besides Fructus mume extract appeared toexert a stronger growth inhibitory effect in the case ofNTUH-K2044 than in the case of CG43S3 Bactericidal activity of the20mgmL Fructus mume extract was observed for NTUH-K2044 but not CG43S3 Additionally the pH values of LBbroth supplemented with 5 10 and 20mgmL FM extractwere sim50 44 and 36 respectively
32 Fructus mume Reduces the Biosynthesis of CPS In thecase of K pneumoniae strains high mucoviscosity resultingfrom a large amount of surface CPS has been correlatedwith increased pathogenicity [8 40] To investigate whetherFructus mume affects this mucoviscosity NTUH-K2044and CG43S3 were respectively cocultured with increasingamounts of Fructus mume extract After 24 h of incubationthe sedimentation test revealed that the addition of Fructusmume extract to LB broth obviously decreasedmucoviscosityin the case of 2 K pneumoniae strains K pneumoniaecocultured with Fructus mume extract formed a compactpellet after centrifugation while the control group could notbe pelleted down (Figure 2) Since the addition of 5mgmLFructus mume extract did not influence bacterial growth(Figure 1) we suggest that Fructus mume affected the muco-viscosity by regulating the biosynthesis of CPS As shown inTable 2 in comparisonwith the control groupNTUH-K2044produced a larger amount of CPS approximately 155 foldthan that of CG43S3 The addition of Fructus mume extractreduced CPS production in both strains in a dose-dependent
Evidence-Based Complementary and Alternative Medicine 5
Relat
ive a
mou
nt o
f mRN
A
00
02
04
06
08
10
12
LB alone10 mgmL FM in LB
lowast lowast
lowastlowast
K1cps mRNA
orf1 orf3 orf7
(a) NTUH-K2044
Relat
ive a
mou
nt o
f mRN
A
00
02
04
06
08
10
12
LB alone10 mgmL FM in LB
lowast
lowast
lowastlowast
K2cps mRNA
orf1 998400 orf3 998400 orf16 998400
(b) CG43S3
Figure 4 Fructus mume downregulates cps transcription qRT-PCR analyses of the expression of the K1 cps genes (orf1 orf3 and orf7) inNTUH-K2044 (a) or K2 cps genes (orf11015840 orf31015840 and orf161015840) in CG43S3 (b) in LB or LB broth supplemented with 10mgmL Fructus mumeextract (FM) lowast 119875 lt 005 and lowastlowast 119875 lt 001 compared to LB alone
manner Moreover Fructus mume extract appeared to exert astronger inhibitory effect on NTUH-K2044 than on CG43S3(Table 2)
33 Fructus mume Reduces the Serum Resistance Activity ofK pneumoniae CPS plays a crucial role in the resistanceof K pneumoniae to serum killing Since the Fructus mumeextract decreased the CPS production of K pneumoniaethe effect of the extract on bacterial serum resistance wasfurther analyzedNTUH-K2044 orCG43S3was respectivelycocultured with 5 10 or 20mgmL Fructus mume extractand the bacteria were then collected washed and subjectedto incubation with pooled human sera After 15min ofincubation the survival rate of the bacteria was determinedby plate counting As shown in Figure 3 Fructus mumeextract obviously decreased the serum resistance activity ofNTUH-K2044 and CG43S3 in a dose-dependent mannerpossibly due to reduced CPS production by the bacteria
34 Effect of Fructus mume on cps Transcription The biosyn-thesis of K pneumoniae K1 and K2 CPS is controlled by 20and 17 genes respectively [41 42] Both the K1 and K2 cpsgene clusters contain 3 transcriptional units orf1-2 orf3-6
and orf7-20 in the K1 cps gene cluster and orf11015840-21015840 orf31015840-151015840 and orf161015840-171015840 in the K2 cps gene cluster [41 42] Toinvestigate how Fructus mume extract affects the biosynthesisof K pneumoniae CPS NTUH-K2044 and CG43S3 werecocultured with 10mgmL Fructus mume extract and themRNA levels of the 3 transcripts belonging to the K1 orK2 cps gene cluster were measured by qRT-PCR As shownin Figure 4 compared to the control group the additionof 10mgmL Fructus mume extract obviously reduced themRNA levels of all the cps transcripts suggesting that Fructusmume regulated CPS biosynthesis at the transcriptional level
35 Fructus mume Reduces CPS Biosynthesis by RegulatingK pneumoniae Intracellular Iron Concentration We havepreviously demonstrated that iron depletion activated CPSproduction in K pneumoniae at the transcriptional level[18] To analyze whether iron is involved in Fructus mume-regulated CPS production we assessed intracellular ironlevels in K pneumoniae cocultured with increasing amountsof Fructus mume extract using the iron-activated antibioticstreptonigrin which requires iron for its bactericidal actionthat causes DNA degradation [43] As shown in Figure 5when NTUH-K2044 or CG43S3 was grown in LB broth onlythe bacteria exhibited a streptonigrin-resistant phenotype
6 Evidence-Based Complementary and Alternative Medicine
LB alone FM
(mgmL)
FM(mgmL)
0
20
10
5
0
20
10
5
10minus1 10
minus210
minus310
minus410
minus510
minus6
10minus1 10
minus210
minus310
minus410
minus5
LB with SNG (2 120583gmL)
100
(a) NTUH-K2044
LB alone FM
(mgmL)
FM(mgmL)
0
20
10
5
0
20
10
5
10minus1 10
minus210
minus310
minus410
minus510
minus6
10minus1 10
minus210
minus310
minus410
minus5
LB with SNG (2 120583gmL)
100
(b) CG43S3
Figure 5 Fructus mume increasesK pneumoniae susceptibility to streptonigrinK pneumoniaeNTUH-K2044 (a) or CG43S3 (b) coculturedwith different concentrations of Fructus mume extract (FM) were grown in LB alone or LB that supplemented with 2120583gmL streptonigrin(SNG) incubated for 2 h Then tenfold serial dilutions were spotted onto an LB agar to observe the colony formation
However the streptonigrin susceptibility of the bacteriaincreased upon coculturing with increasing amounts of Fruc-tusmume extract suggesting thatFructusmume increased theintracellular level of free iron in a dose-dependent manner inK pneumoniae
36 Citric Acid Inhibits K pneumoniae Growth and CPSBiosynthesis Citric acid has been demonstrated to be themain organic acid in Fructus mume extract [35] To examineif citric acid plays a role in the inhibitory effects of Fructusmume extract onK pneumoniae growth andCPS productionNTUH-K2044 and CG43S3 were cocultured with variousconcentrations of citric acid and then the growth curvesof the bacteria were monitored The result showed thatcitric acid obviously reduced the growth of NTUH-K2044and CG43S3 in a dose-dependent manner (Figure 6(a))Furthermore CPS production in the 2 K pneumoniae strainsalso decreased when citric acid was added to the growthmedium (Figure 6(b)) These results indicated that citric acidis an active component of Fructus mume extract that has
bactericidal activity and downregulates CPS biosynthesis inK pneumoniae
4 Discussion
Since the 1980s K pneumoniae is emerging as an importantpathogen in both community and hospital settings [44]In the hospital environment due to the extensive use ofantibiotics multiple drug resistance has been increasinglyobserved in K pneumoniae especially in ESBL-producingstrains Carbapenems are considered to be the preferredagents for the treatment of serious infections caused by ESBL-producing K pneumoniae because of their high stabilitywith respect to 120573-lactamase hydrolysis and the observedretained susceptibility of ESBL producers [45] HoweverK pneumoniae isolates resistant to carbapenems have beenreported worldwide since the 2000s [46ndash49] The emergenceof carbapenem-resistant enterobacteria is worrisome becausethe option for antimicrobial treatment is further restricted Inthis study we screened a series of TCMs for the identification
Evidence-Based Complementary and Alternative Medicine 7
NTUH-K2044
0 100 200 300 400 500 600 700
OD
600
00
05
10
15
20
25 CG43S3
(min)(min)0 100 200 300 400 500 600 700
OD
600
00
05
10
15
20
25
LB alone1 mgmL citric acid2 mgmL citric acid
3 mgmL citric acid4 mgmL citric acid
LB alone1 mgmL citric acid2 mgmL citric acid
3 mgmL citric acid4 mgmL citric acid
(a)
0
5
10
15
20
25
30
35
Citric acid(mgmL)
1 20 210
NTUH-K2044 CG43S3
Glu
curo
nic a
cid
(120583g109
cfu)
lowastlowast
lowast
(b)
Figure 6 Citric acid inhibits K pneumoniae growth and CPS levels K pneumoniae NTUH-K204 or CG43S3 cocultured with differentconcentrations of citric acid as indicated and the growth curve (a) as well as the CPS levels (b) were measured Bacteria were grown in LBbroth at 37∘C with agitation lowast 119875 lt 005 compared to the indicated group
of new antibacterial agents (data not shown) and then focusedon Fructus mume the smoked fruit of Prunus mume whichhas been demonstrated to efficiently inhibit H pylori andother oral bacteria [33ndash36] As shown in Figure 1 Fructusmume extract was found to have antibacterial activity againstclinically isolated K pneumoniae strains
Clinically isolated K pneumoniae strains usually producea large amount of CPS which confers not only a mucoidphenotype to the bacteria but also resistance to engulfmentby phagocytes and to serum bactericidal factors [40 50] Thedegree of mucoviscosity has also been positively correlated
with the successful establishment of infection [51 52] Amongthe 77 described capsular types of K pneumoniae K1 andK2 serotypes are highly virulent in experimental infectionin mice and are often associated with severe infections inhumans and animals [52ndash55] particularly with the tightassociation between the 2 serotypes and liver abscess [11 56]As shown in Figure 2 and Table 2 in K pneumoniae strainsof both the K1 and K2 serotypes Fructus mume extractsignificantly reduced bacterial hypermucoviscosity and CPSlevels and thus may result in the decreased resistance ofK pneumoniae to serum killing (Figure 3) On the other
8 Evidence-Based Complementary and Alternative Medicine
hand we also found that heat inactivated serum did nothave obvious bactericidal effects on K pneumoniae (data notshown) suggesting an importance of the complement system
Both prokaryotic and eukaryotic cells in natural envi-ronments are constantly challenged by various environ-mental stresses K pneumoniae like many gastrointestinalpathogens needs to penetrate the gastric acid barrier facethe challenge of the immune system and cope with thelimited supply of oxygen and nutrition to effect colonizationand infection [57 58] Therefore bacteria activate or repressthe expression of virulence genes to adapt to environmentalstimuli [59ndash62] In K pneumoniae CPS biosynthesis isregulated by multiple environmental stimuli and proteinregulators Our previous studies have shown that ferricions can repress K pneumoniae CPS production throughFur regulation [18 63] Under iron-repletion conditionsFur-Fe(II) can tightly repress cps transcription resulting inlowered CPS production in K pneumoniae [18] To furtherinvestigate how Fructus mume reduces CPS levels in Kpneumoniae we performed qRT-PCR analyses and foundthat CPS reduction was regulated at the transcriptionallevel (Figure 4) All 3 transcripts of K1 or K2 cps geneswere obviously downregulated especially orf1orf11015840 encodingGalF a putative UDP-glucose pyrophosphatase (Figure 4)In addition the streptonigrin sensitivity assay also indicatedthat Fructus mume could increase the intracellular iron levelsofK pneumoniae (Figure 5) implying that ferric iron and Furparticipate in Fructus mume-mediated CPS reduction Ironis essential to most bacteria for growth and reproductionbut iron overloading would lead to the formation of unde-sired reactive oxygen species (ROS) by the Fenton reactionto damage DNA or other biological macromolecules [64]Although how Fructus mume affects bacterial iron-uptakeremains unknown the increase in intracellular iron leadingto the formation of undesired ROS may account for part ofits bactericidal activity
The ingredients of Prunus mume extract are organicacids including citric acid (the main ingredient) tartaricacid oxalic acid and other unknown components [35 36]Although the acidic components of Prunus mume showedsome antibacterial activity it is less compared to that ofthe original extract implying that other active componentspossess considerable antibacterial activity [36] As seen inFigure 6 we also showed that citric acid could inhibit growthand CPS production in K pneumoniae The acidic propertymay be one of the antibacterialmechanisms of Fructusmumehowever there should be other active components since LBbroth supplemented with 20mgmL Fructus mume pHsim36 has stronger bactericidal activity than LB broth adjustedto pH 35 using HCl (data not shown) For future clinicalapplication more studies are required to determine the activecomponents of Fructus mume and its mechanism of action
5 Conclusion
To our knowledge this study is the first to report theantibacterial activity of Fructus mume against highly virulentK pneumoniae isolates Moreover we found that Fructus
mume reduced K pneumoniae CPS biosynthesis at thetranscriptional level possibly by regulating the intracellulariron concentration of the bacteria thereby helping the hostimmune system eliminate the pathogen
Conflict of Interests
The authors declare no conflict of interests in this work
Authorsrsquo Contribution
T-H Lin S-H Huang and C-C Wu contributed equally tothis work
Acknowledgments
The authors thank Professor Hwei-Ling Peng from NationalChiao Tung University Taiwan for providing theK pneumo-niae CG43S3 and Dr Jin-Town Wang from National TaiwanUniversity Hospital for providing K pneumoniae NTUH-K2044 The authors thank Yi-Ming Hong and Jing-Ciao Linfor their technical assistance during the study The workis supported by the Grants from National Science Council(NSC 99-2320-B-039-002-MY3) China Medical University(CMU98-ASIA-01) and Buddhist Tzu Chi general hospital(TTCRD101-17)
References
[1] F Chou and H Kou ldquoEndogenous endophthalmitis associatedwith pyogenic hepatic abscessrdquo Journal of the American Collegeof Surgeons vol 182 no 1 pp 33ndash36 1996
[2] S-H B Han ldquoReview of hepatic abscess from Klebsiellapneumoniaemdashan association with diabetes mellitus and septicendophthalmitisrdquo Western Journal of Medicine vol 162 no 3pp 220ndash224 1995
[3] Y Lau B Hu W Wu Y Lin H Chang and Z Shi ldquoIden-tification of a major cluster of Klebsiella pneumoniae isolatesfrom patients with liver abscess in Taiwanrdquo Journal of ClinicalMicrobiology vol 38 no 1 pp 412ndash414 2000
[4] H L Peng P Y Wang J L Wu C T Chiu and H Y ChangldquoMolecular epidemiology of Klebsiella pneumoniaerdquo ZhonghuaMin GuoWei ShengWu Ji Mian Yi Xue Za Zhi vol 24 no 3 pp264ndash271 1991
[5] Y Yang L K Siu K Yeh et al ldquoRecurrent Klebsiella pneumo-niae liver abscess clinical and microbiological characteristicsrdquoJournal of Clinical Microbiology vol 47 no 10 pp 3336ndash33392009
[6] L K Siu K M Yeh J C Lin C P Fung and F Y ChangldquoKlebsiella pneumoniae liver abscess a new invasive syndromerdquoThe Lancet Infectious Diseases vol 12 no 11 pp 881ndash887 2012
[7] E R Lederman and N F Crum ldquoPyogenic liver abscess witha focus on Klebsiella pneumoniae as a primary pathogen anemerging disease with unique clinical characteristicsrdquo Amer-ican Journal of Gastroenterology vol 100 no 2 pp 322ndash3312005
[8] H Sahly R Podschun T A Oelschlaeger et al ldquoCapsuleimpedes adhesion to and invasion of epithelial cells byKlebsiellapneumoniaerdquo Infection and Immunity vol 68 no 12 pp 6744ndash6749 2000
Evidence-Based Complementary and Alternative Medicine 9
[9] C Fung B Hu F Chang et al ldquoA 5-year study of the ser-oepidemiology of Klebsiella pneumoniae high prevalence ofcapsular serotype K1 in Taiwan and implication for vaccineefficacyrdquo Journal of Infectious Diseases vol 181 no 6 pp 2075ndash2079 2000
[10] Y Pan H Fang H Yang et al ldquoCapsular polysaccharide syn-thesis regions in Klebsiella pneumoniae serotype K57 and a newcapsular serotyperdquo Journal of Clinical Microbiology vol 46 no7 pp 2231ndash2240 2008
[11] C-P Fung F-Y Chang S-C Lee et al ldquoA global emergingdisease of Klebsiella pneumoniae liver abscess is serotype K1 animportant factor for complicated endophthalmitisrdquo Gut vol50 no 3 pp 420ndash424 2002
[12] D L Paterson ldquoResistance in gram-negative bacteria enter-obacteriaceaerdquo American Journal of Medicine vol 119 supple-ment 1 no 6 pp S20ndashS28 S60ndashS70 2006
[13] C Lin T Huang W Liang and H Peng ldquoHomologousresponse regulators KvgA KvhA and KvhR regulate the synthe-sis of capsular polysaccharide inKlebsiella pneumoniaeCG43 ina coordinated mannerrdquo Journal of Biochemistry vol 140 no 3pp 429ndash438 2006
[14] N Majdalani and S Gottesman ldquoThe Rcs phosphorelay acomplex signal transduction systemrdquo Annual Review of Micro-biology vol 59 pp 379ndash405 2005
[15] S Gottesman and V Stout ldquoRegulation of capsular polysaccha-ride synthesis in Escherichia coli K12rdquo Molecular Microbiologyvol 5 no 7 pp 1599ndash1606 1991
[16] V Stout ldquoRegulation of capsule synthesis includes interactionsof the RcsCRcsB regulatory pairrdquoResearch inMicrobiology vol145 no 5-6 pp 389ndash392 1994
[17] C T Lin Y C Chen T R Jinn C C Wu Y M Hong andW H Wu ldquoRole of the cAMP-dependent carbon cataboliterepression in capsular polysaccharide biosynthesis in Klebsiellapneumoniaerdquo PLoS ONE vol 8 no 2 Article ID e54430 2013
[18] C Lin C Wu Y Chen et al ldquoFur regulation of the capsularpolysaccharide biosynthesis and iron-acquisition systems inKlebsiella pneumoniae CG43rdquoMicrobiology vol 157 part 2 pp419ndash429 2010
[19] D J Hassett P A Sokol M L Howell et al ldquoFerric uptakeregulator (Fur) mutants of Pseudomonas aeruginosa demon-strate defective siderophore-mediated iron uptake altered aer-obic growth and decreased superoxide dismutase and catalaseactivitiesrdquo Journal of Bacteriology vol 178 no 14 pp 3996ndash4003 1996
[20] U A Ochsner and M L Vasil ldquoGene repression by the ferricuptake regulator in Pseudomonas aeruginosa cycle selection ofiron-regulated genesrdquo Proceedings of the National Academy ofSciences of the United States of America vol 93 no 9 pp 4409ndash4414 1996
[21] J J E Bijlsma B Waidner A H M Van Vliet et al ldquoTheHelicobacter pylori homologue of the ferric uptake regulator isinvolved in acid resistancerdquo Infection and Immunity vol 70 no2 pp 606ndash611 2002
[22] A H M van Vliet J Stoof S W Poppelaars et al ldquoDifferentialregulation of amidase- and formamidase-mediated ammoniaproduction by theHelicobacter pylori fur repressorrdquoThe Journalof Biological Chemistry vol 278 no 11 pp 9052ndash9057 2003
[23] M Baga M Goransson S Normark and B E Uhlin ldquoTran-scriptional activation of a pap pilus virulence operon fromuropathogenic Escherichia colirdquo The EMBO Journal vol 4 no13 pp 3887ndash3893 1985
[24] S Lory MWolfgang V Lee and R Smith ldquoThemulti-talentedbacterial adenylate cyclasesrdquo International Journal of MedicalMicrobiology vol 293 no 7-8 pp 479ndash482 2004
[25] K Skorupski and R K Taylor ldquoCyclic AMP and its receptorprotein negatively regulate the coordinate expression of choleratoxin and toxin-coregulated pilus in Vibrio choleraerdquo Proceed-ings of the National Academy of Sciences of the United States ofAmerica vol 94 no 1 pp 265ndash270 1997
[26] S E H West A K Sample and L J Runyen-Janecky ldquoThe vfrgene product required for Pseudomonas aeruginosa exotoxin Aand protease production belongs to the cyclic AMP receptorprotein familyrdquo Journal of Bacteriology vol 176 no 24 pp 7532ndash7542 1994
[27] M Mendez I-H Huang K Ohtani R Grau T Shimizuand M R Sarker ldquoCarbon catabolite repression of type IVpilus-dependent gliding motility in the anaerobic pathogenClostridium perfringensrdquo Journal of Bacteriology vol 190 no 1pp 48ndash60 2008
[28] E J Kalivoda N A Stella D M OrsquoDee G J Nau and R M QShanks ldquoThe cyclic AMP-dependent catabolite repression sys-tem of Serratia marcescensmediates biofilm formation throughregulation of type 1 fimbriaerdquo Applied and EnvironmentalMicrobiology vol 74 no 11 pp 3461ndash3470 2008
[29] C M Muller A Aberg J Straseviciene L Emody B E Uhlinand C Balsalobre ldquoType 1 fimbriae a colonization factor ofuropathogenic Escherichia coli are controlled by the metabolicsensor CRP-cAMPrdquo PLoS Pathogens vol 5 no 2 Article IDe1000303 2009
[30] E L Fuchs E D Brutinel E R Klem A R Fehr T L Yahrand M C Wolfgang ldquoIn vitro and in vivo characterization ofthe Pseudomonas aeruginosa cyclic AMP (cAMP) phosphodi-esterase CpdA required for cAMP homeostasis and virulencefactor regulationrdquo Journal of Bacteriology vol 192 no 11 pp2779ndash2790 2010
[31] T Endoh and J N Engel ldquoCbpA a polarly localized novel cyclicAMP-binding protein in Pseudomonas aeruginosardquo Journal ofBacteriology vol 191 no 23 pp 7193ndash7205 2009
[32] N A Stella E J Kalivoda D M OrsquoDee G J Nau and R M QShanks ldquoCatabolite repression control of flagellum productionby Serratia marcescensrdquo Research in Microbiology vol 159 no7-8 pp 562ndash568 2008
[33] S Enomoto K Yanaoka H Utsunomiya et al ldquoInhibitoryeffects of Japanese apricot (Prunus mume Siebold et ZuccUme) onHelicobacter pylori-related chronic gastritisrdquo EuropeanJournal of Clinical Nutrition vol 64 no 7 pp 714ndash719 2010
[34] R W K Wong U Hagg L Samaranayake M K Z Yuen CJ Seneviratne and R Kao ldquoAntimicrobial activity of Chinesemedicine herbs against common bacteria in oral biofilmA pilotstudyrdquo International Journal of Oral and Maxillofacial Surgeryvol 39 no 6 pp 599ndash605 2010
[35] C J Seneviratne R W K Wong U Hagg et al ldquoPrunus mumeextract exhibits antimicrobial activity against pathogenic oralbacteriardquo International Journal of Paediatric Dentistry vol 21no 4 pp 299ndash305 2011
[36] Y Chen RW KWong C J Seneviratne et al ldquoThe antimicro-bial efficacy of Fructus mume extract on orthodontic bracketa monospecies-biofilm model study in vitrordquo Archives of OralBiology vol 56 no 1 pp 16ndash21 2011
[37] Y Lai H Peng and H Chang ldquoRmpA2 an activator ofcapsule biosynthesis in Klebsiella pneumoniae CG43 regulatesK2 cps gene expression at the transcriptional levelrdquo Journal ofBacteriology vol 185 no 3 pp 788ndash800 2003
10 Evidence-Based Complementary and Alternative Medicine
[38] P Domenico S Schwartz and B A Cunha ldquoReduction ofcapsular polysaccharide production inKlebsiella pneumoniae bysodium salicylaterdquo Infection and Immunity vol 57 no 12 pp3778ndash3782 1989
[39] N Blumenkrantz and G A Hansen ldquoNew method for quanti-tative determination of uronic acidsrdquo Analytical Biochemistryvol 54 no 2 pp 484ndash489 1973
[40] J Lin F Chang C Fung et al ldquoHigh prevalence of phagocytic-resistant capsular serotypes of Klebsiella pneumoniae in liverabscessrdquo Microbes and Infection vol 6 no 13 pp 1191ndash11982004
[41] Y Arakawa R Wacharotayankun T Nagatsuka H Ito NKato and M Ohta ldquoGenomic organization of the Klebsiellapneumoniae cps region responsible for serotype K2 capsularpolysaccharide synthesis in the virulent strain chedidrdquo Journalof Bacteriology vol 177 no 7 pp 1788ndash1796 1995
[42] KWuN Li J Yan et al ldquoGenome sequencing and comparativeanalysis of Klebsiella pneumoniae NTUH-K2044 a strain caus-ing liver abscess and meningitisrdquo Journal of Bacteriology vol191 no 14 pp 4492ndash4501 2009
[43] H N Yeowell and J R White ldquoIron requirement in thebactericidal mechanism of streptonigrinrdquo Antimicrobial Agentsand Chemotherapy vol 22 no 6 pp 961ndash968 1982
[44] Y Keynan and E Rubinstein ldquoThe changing face of Klebsiellapneumoniae infections in the communityrdquo International Journalof Antimicrobial Agents vol 30 no 5 pp 385ndash389 2007
[45] R Colodner R Raz B Chazan and W Sakran ldquoSusceptibilitypattern of extended-spectrum 120573-lactamase producing bacteriaisolated from inpatients to five antimicrobial drugs in a com-munity hospital in Northern Israelrdquo International Journal ofAntimicrobial Agents vol 24 no 4 pp 409ndash410 2004
[46] E B Hirsch and V H Tam ldquoDetection and treatment optionsfor Klebsiella pneumoniae carbapenemases (KPCs) an emerg-ing cause of multidrug-resistant infectionrdquo Journal of Antimi-crobial Chemotherapy vol 65 no 6 pp 1119ndash1125 2010
[47] K K Kumarasamy M A Toleman T R Walsh et al ldquoEmer-gence of a new antibiotic resistance mechanism in India Pak-istan and the UK a molecular biological and epidemiologicalstudyrdquoThe Lancet Infectious Diseases vol 10 no 9 pp 597ndash6022010
[48] P Nordmann G Cuzon and T Naas ldquoThe real threat ofKlebsiella pneumoniae carbapenemase-producing bacteriardquoTheLancet Infectious Diseases vol 9 no 4 pp 228ndash236 2009
[49] D Yong M A Toleman C G Giske et al ldquoCharacterizationof a new metallo-120573-lactamase gene bla NDM-1 and a novelerythromycin esterase gene carried on a unique genetic struc-ture in Klebsiella pneumoniae sequence type 14 from IndiardquoAntimicrobial Agents and Chemotherapy vol 53 no 12 pp5046ndash5054 2009
[50] V Regueiro M A Campos J Pons S Albertı and J ABengoechea ldquoThe uptake of a Klebsiella pneumoniae capsulepolysaccharide mutant triggers an inflammatory response byhuman airway epithelial cellsrdquoMicrobiology vol 152 part 2 pp555ndash566 2006
[51] X Nassif N Honore T Vasselon S T Cole and P J SansonettildquoPositive control of colanic acid synthesis in Escherichia coliby rmpA and rmpB two virulence-plasmid genes of Klebsiellapneumoniaerdquo Molecular Microbiology vol 3 no 10 pp 1349ndash1359 1989
[52] X Nassif and P J Sansonetti ldquoCorrelation of the virulence ofKlebsiella pneumoniaeK1 and K2 with the presence of a plasmid
encoding aerobactinrdquo Infection and Immunity vol 54 no 3 pp603ndash608 1986
[53] K Mizuta M Ohta and M Mori ldquoVirulence for mice ofKlebsiella strains belonging to the O1 group relationship totheir capsular (K) typesrdquo Infection and Immunity vol 40 no1 pp 56ndash61 1983
[54] I Ofek K Kabha A Athamna et al ldquoGenetic exchange ofdeterminants for capsular polysaccharide biosynthesis betweenKlebsiella pneumoniae strains expressing serotypes K2 andK21ardquo Infection and Immunity vol 61 no 10 pp 4208ndash42161993
[55] A M Simoons-Smit A M J J Verwey-van Vught I Y RKanis and D M MacLaren ldquoVirulence of Klebsiella strains inexperimentally induced skin lesions in the mouserdquo Journal ofMedical Microbiology vol 17 no 1 pp 67ndash77 1984
[56] C Lee H Leu T Wu L Su and J Liu ldquoRisk factors for sponta-neous rupture of liver abscess caused byKlebsiella pneumoniaerdquoDiagnosticMicrobiology and Infectious Disease vol 52 no 2 pp79ndash84 2005
[57] C De Champs M P Sauvant C Chanal et al ldquoProspectivesurvey of colonization and infection caused by expanded-spectrum-120573-lactamase-producing members of the familyEnterobacteriaceae in an intensive care unitrdquo Journal of ClinicalMicrobiology vol 27 no 12 pp 2887ndash2890 1989
[58] S MMarkowitz J M Veazey Jr and F L Macrina ldquoSequentialoutbreaks of infection due to Klebsiella pneumoniae in a neona-tal intensive care unit implication of a conjugative R plasmidrdquoJournal of Infectious Diseases vol 142 no 1 pp 106ndash112 1980
[59] A M Stock V L Robinson and P N Goudreau ldquoTwo-component signal transductionrdquo Annual Review of Biochem-istry vol 69 pp 183ndash215 2000
[60] C Fuqua and E P Greenberg ldquoSelf perception in bacteriaquorum sensing with acylated homoserine lactonesrdquo CurrentOpinion in Microbiology vol 1 no 2 pp 183ndash189 1998
[61] P Romby F Vandenesch and E G H Wagner ldquoThe role ofRNAs in the regulation of virulence-gene expressionrdquo CurrentOpinion in Microbiology vol 9 no 2 pp 229ndash236 2006
[62] B L Bassler ldquoHow bacteria talk to each other regulationof gene expression by quorum sensingrdquo Current Opinion inMicrobiology vol 2 no 6 pp 582ndash587 1999
[63] H Y Cheng Y S Chen C YWu H Y Chang Y C Lai andHL Peng ldquoRmpA regulation of capsular polysaccharide biosyn-thesis in Klebsiella pneumoniae CG43rdquo Journal of Bacteriologyvol 192 no 12 pp 3144ndash3158 2010
[64] D Touati ldquoIron and oxidative stress in bacteriardquo Archives ofBiochemistry and Biophysics vol 373 no 1 pp 1ndash6 2000
Evidence-Based Complementary and Alternative Medicine 5
Relat
ive a
mou
nt o
f mRN
A
00
02
04
06
08
10
12
LB alone10 mgmL FM in LB
lowast lowast
lowastlowast
K1cps mRNA
orf1 orf3 orf7
(a) NTUH-K2044
Relat
ive a
mou
nt o
f mRN
A
00
02
04
06
08
10
12
LB alone10 mgmL FM in LB
lowast
lowast
lowastlowast
K2cps mRNA
orf1 998400 orf3 998400 orf16 998400
(b) CG43S3
Figure 4 Fructus mume downregulates cps transcription qRT-PCR analyses of the expression of the K1 cps genes (orf1 orf3 and orf7) inNTUH-K2044 (a) or K2 cps genes (orf11015840 orf31015840 and orf161015840) in CG43S3 (b) in LB or LB broth supplemented with 10mgmL Fructus mumeextract (FM) lowast 119875 lt 005 and lowastlowast 119875 lt 001 compared to LB alone
manner Moreover Fructus mume extract appeared to exert astronger inhibitory effect on NTUH-K2044 than on CG43S3(Table 2)
33 Fructus mume Reduces the Serum Resistance Activity ofK pneumoniae CPS plays a crucial role in the resistanceof K pneumoniae to serum killing Since the Fructus mumeextract decreased the CPS production of K pneumoniaethe effect of the extract on bacterial serum resistance wasfurther analyzedNTUH-K2044 orCG43S3was respectivelycocultured with 5 10 or 20mgmL Fructus mume extractand the bacteria were then collected washed and subjectedto incubation with pooled human sera After 15min ofincubation the survival rate of the bacteria was determinedby plate counting As shown in Figure 3 Fructus mumeextract obviously decreased the serum resistance activity ofNTUH-K2044 and CG43S3 in a dose-dependent mannerpossibly due to reduced CPS production by the bacteria
34 Effect of Fructus mume on cps Transcription The biosyn-thesis of K pneumoniae K1 and K2 CPS is controlled by 20and 17 genes respectively [41 42] Both the K1 and K2 cpsgene clusters contain 3 transcriptional units orf1-2 orf3-6
and orf7-20 in the K1 cps gene cluster and orf11015840-21015840 orf31015840-151015840 and orf161015840-171015840 in the K2 cps gene cluster [41 42] Toinvestigate how Fructus mume extract affects the biosynthesisof K pneumoniae CPS NTUH-K2044 and CG43S3 werecocultured with 10mgmL Fructus mume extract and themRNA levels of the 3 transcripts belonging to the K1 orK2 cps gene cluster were measured by qRT-PCR As shownin Figure 4 compared to the control group the additionof 10mgmL Fructus mume extract obviously reduced themRNA levels of all the cps transcripts suggesting that Fructusmume regulated CPS biosynthesis at the transcriptional level
35 Fructus mume Reduces CPS Biosynthesis by RegulatingK pneumoniae Intracellular Iron Concentration We havepreviously demonstrated that iron depletion activated CPSproduction in K pneumoniae at the transcriptional level[18] To analyze whether iron is involved in Fructus mume-regulated CPS production we assessed intracellular ironlevels in K pneumoniae cocultured with increasing amountsof Fructus mume extract using the iron-activated antibioticstreptonigrin which requires iron for its bactericidal actionthat causes DNA degradation [43] As shown in Figure 5when NTUH-K2044 or CG43S3 was grown in LB broth onlythe bacteria exhibited a streptonigrin-resistant phenotype
6 Evidence-Based Complementary and Alternative Medicine
LB alone FM
(mgmL)
FM(mgmL)
0
20
10
5
0
20
10
5
10minus1 10
minus210
minus310
minus410
minus510
minus6
10minus1 10
minus210
minus310
minus410
minus5
LB with SNG (2 120583gmL)
100
(a) NTUH-K2044
LB alone FM
(mgmL)
FM(mgmL)
0
20
10
5
0
20
10
5
10minus1 10
minus210
minus310
minus410
minus510
minus6
10minus1 10
minus210
minus310
minus410
minus5
LB with SNG (2 120583gmL)
100
(b) CG43S3
Figure 5 Fructus mume increasesK pneumoniae susceptibility to streptonigrinK pneumoniaeNTUH-K2044 (a) or CG43S3 (b) coculturedwith different concentrations of Fructus mume extract (FM) were grown in LB alone or LB that supplemented with 2120583gmL streptonigrin(SNG) incubated for 2 h Then tenfold serial dilutions were spotted onto an LB agar to observe the colony formation
However the streptonigrin susceptibility of the bacteriaincreased upon coculturing with increasing amounts of Fruc-tusmume extract suggesting thatFructusmume increased theintracellular level of free iron in a dose-dependent manner inK pneumoniae
36 Citric Acid Inhibits K pneumoniae Growth and CPSBiosynthesis Citric acid has been demonstrated to be themain organic acid in Fructus mume extract [35] To examineif citric acid plays a role in the inhibitory effects of Fructusmume extract onK pneumoniae growth andCPS productionNTUH-K2044 and CG43S3 were cocultured with variousconcentrations of citric acid and then the growth curvesof the bacteria were monitored The result showed thatcitric acid obviously reduced the growth of NTUH-K2044and CG43S3 in a dose-dependent manner (Figure 6(a))Furthermore CPS production in the 2 K pneumoniae strainsalso decreased when citric acid was added to the growthmedium (Figure 6(b)) These results indicated that citric acidis an active component of Fructus mume extract that has
bactericidal activity and downregulates CPS biosynthesis inK pneumoniae
4 Discussion
Since the 1980s K pneumoniae is emerging as an importantpathogen in both community and hospital settings [44]In the hospital environment due to the extensive use ofantibiotics multiple drug resistance has been increasinglyobserved in K pneumoniae especially in ESBL-producingstrains Carbapenems are considered to be the preferredagents for the treatment of serious infections caused by ESBL-producing K pneumoniae because of their high stabilitywith respect to 120573-lactamase hydrolysis and the observedretained susceptibility of ESBL producers [45] HoweverK pneumoniae isolates resistant to carbapenems have beenreported worldwide since the 2000s [46ndash49] The emergenceof carbapenem-resistant enterobacteria is worrisome becausethe option for antimicrobial treatment is further restricted Inthis study we screened a series of TCMs for the identification
Evidence-Based Complementary and Alternative Medicine 7
NTUH-K2044
0 100 200 300 400 500 600 700
OD
600
00
05
10
15
20
25 CG43S3
(min)(min)0 100 200 300 400 500 600 700
OD
600
00
05
10
15
20
25
LB alone1 mgmL citric acid2 mgmL citric acid
3 mgmL citric acid4 mgmL citric acid
LB alone1 mgmL citric acid2 mgmL citric acid
3 mgmL citric acid4 mgmL citric acid
(a)
0
5
10
15
20
25
30
35
Citric acid(mgmL)
1 20 210
NTUH-K2044 CG43S3
Glu
curo
nic a
cid
(120583g109
cfu)
lowastlowast
lowast
(b)
Figure 6 Citric acid inhibits K pneumoniae growth and CPS levels K pneumoniae NTUH-K204 or CG43S3 cocultured with differentconcentrations of citric acid as indicated and the growth curve (a) as well as the CPS levels (b) were measured Bacteria were grown in LBbroth at 37∘C with agitation lowast 119875 lt 005 compared to the indicated group
of new antibacterial agents (data not shown) and then focusedon Fructus mume the smoked fruit of Prunus mume whichhas been demonstrated to efficiently inhibit H pylori andother oral bacteria [33ndash36] As shown in Figure 1 Fructusmume extract was found to have antibacterial activity againstclinically isolated K pneumoniae strains
Clinically isolated K pneumoniae strains usually producea large amount of CPS which confers not only a mucoidphenotype to the bacteria but also resistance to engulfmentby phagocytes and to serum bactericidal factors [40 50] Thedegree of mucoviscosity has also been positively correlated
with the successful establishment of infection [51 52] Amongthe 77 described capsular types of K pneumoniae K1 andK2 serotypes are highly virulent in experimental infectionin mice and are often associated with severe infections inhumans and animals [52ndash55] particularly with the tightassociation between the 2 serotypes and liver abscess [11 56]As shown in Figure 2 and Table 2 in K pneumoniae strainsof both the K1 and K2 serotypes Fructus mume extractsignificantly reduced bacterial hypermucoviscosity and CPSlevels and thus may result in the decreased resistance ofK pneumoniae to serum killing (Figure 3) On the other
8 Evidence-Based Complementary and Alternative Medicine
hand we also found that heat inactivated serum did nothave obvious bactericidal effects on K pneumoniae (data notshown) suggesting an importance of the complement system
Both prokaryotic and eukaryotic cells in natural envi-ronments are constantly challenged by various environ-mental stresses K pneumoniae like many gastrointestinalpathogens needs to penetrate the gastric acid barrier facethe challenge of the immune system and cope with thelimited supply of oxygen and nutrition to effect colonizationand infection [57 58] Therefore bacteria activate or repressthe expression of virulence genes to adapt to environmentalstimuli [59ndash62] In K pneumoniae CPS biosynthesis isregulated by multiple environmental stimuli and proteinregulators Our previous studies have shown that ferricions can repress K pneumoniae CPS production throughFur regulation [18 63] Under iron-repletion conditionsFur-Fe(II) can tightly repress cps transcription resulting inlowered CPS production in K pneumoniae [18] To furtherinvestigate how Fructus mume reduces CPS levels in Kpneumoniae we performed qRT-PCR analyses and foundthat CPS reduction was regulated at the transcriptionallevel (Figure 4) All 3 transcripts of K1 or K2 cps geneswere obviously downregulated especially orf1orf11015840 encodingGalF a putative UDP-glucose pyrophosphatase (Figure 4)In addition the streptonigrin sensitivity assay also indicatedthat Fructus mume could increase the intracellular iron levelsofK pneumoniae (Figure 5) implying that ferric iron and Furparticipate in Fructus mume-mediated CPS reduction Ironis essential to most bacteria for growth and reproductionbut iron overloading would lead to the formation of unde-sired reactive oxygen species (ROS) by the Fenton reactionto damage DNA or other biological macromolecules [64]Although how Fructus mume affects bacterial iron-uptakeremains unknown the increase in intracellular iron leadingto the formation of undesired ROS may account for part ofits bactericidal activity
The ingredients of Prunus mume extract are organicacids including citric acid (the main ingredient) tartaricacid oxalic acid and other unknown components [35 36]Although the acidic components of Prunus mume showedsome antibacterial activity it is less compared to that ofthe original extract implying that other active componentspossess considerable antibacterial activity [36] As seen inFigure 6 we also showed that citric acid could inhibit growthand CPS production in K pneumoniae The acidic propertymay be one of the antibacterialmechanisms of Fructusmumehowever there should be other active components since LBbroth supplemented with 20mgmL Fructus mume pHsim36 has stronger bactericidal activity than LB broth adjustedto pH 35 using HCl (data not shown) For future clinicalapplication more studies are required to determine the activecomponents of Fructus mume and its mechanism of action
5 Conclusion
To our knowledge this study is the first to report theantibacterial activity of Fructus mume against highly virulentK pneumoniae isolates Moreover we found that Fructus
mume reduced K pneumoniae CPS biosynthesis at thetranscriptional level possibly by regulating the intracellulariron concentration of the bacteria thereby helping the hostimmune system eliminate the pathogen
Conflict of Interests
The authors declare no conflict of interests in this work
Authorsrsquo Contribution
T-H Lin S-H Huang and C-C Wu contributed equally tothis work
Acknowledgments
The authors thank Professor Hwei-Ling Peng from NationalChiao Tung University Taiwan for providing theK pneumo-niae CG43S3 and Dr Jin-Town Wang from National TaiwanUniversity Hospital for providing K pneumoniae NTUH-K2044 The authors thank Yi-Ming Hong and Jing-Ciao Linfor their technical assistance during the study The workis supported by the Grants from National Science Council(NSC 99-2320-B-039-002-MY3) China Medical University(CMU98-ASIA-01) and Buddhist Tzu Chi general hospital(TTCRD101-17)
References
[1] F Chou and H Kou ldquoEndogenous endophthalmitis associatedwith pyogenic hepatic abscessrdquo Journal of the American Collegeof Surgeons vol 182 no 1 pp 33ndash36 1996
[2] S-H B Han ldquoReview of hepatic abscess from Klebsiellapneumoniaemdashan association with diabetes mellitus and septicendophthalmitisrdquo Western Journal of Medicine vol 162 no 3pp 220ndash224 1995
[3] Y Lau B Hu W Wu Y Lin H Chang and Z Shi ldquoIden-tification of a major cluster of Klebsiella pneumoniae isolatesfrom patients with liver abscess in Taiwanrdquo Journal of ClinicalMicrobiology vol 38 no 1 pp 412ndash414 2000
[4] H L Peng P Y Wang J L Wu C T Chiu and H Y ChangldquoMolecular epidemiology of Klebsiella pneumoniaerdquo ZhonghuaMin GuoWei ShengWu Ji Mian Yi Xue Za Zhi vol 24 no 3 pp264ndash271 1991
[5] Y Yang L K Siu K Yeh et al ldquoRecurrent Klebsiella pneumo-niae liver abscess clinical and microbiological characteristicsrdquoJournal of Clinical Microbiology vol 47 no 10 pp 3336ndash33392009
[6] L K Siu K M Yeh J C Lin C P Fung and F Y ChangldquoKlebsiella pneumoniae liver abscess a new invasive syndromerdquoThe Lancet Infectious Diseases vol 12 no 11 pp 881ndash887 2012
[7] E R Lederman and N F Crum ldquoPyogenic liver abscess witha focus on Klebsiella pneumoniae as a primary pathogen anemerging disease with unique clinical characteristicsrdquo Amer-ican Journal of Gastroenterology vol 100 no 2 pp 322ndash3312005
[8] H Sahly R Podschun T A Oelschlaeger et al ldquoCapsuleimpedes adhesion to and invasion of epithelial cells byKlebsiellapneumoniaerdquo Infection and Immunity vol 68 no 12 pp 6744ndash6749 2000
Evidence-Based Complementary and Alternative Medicine 9
[9] C Fung B Hu F Chang et al ldquoA 5-year study of the ser-oepidemiology of Klebsiella pneumoniae high prevalence ofcapsular serotype K1 in Taiwan and implication for vaccineefficacyrdquo Journal of Infectious Diseases vol 181 no 6 pp 2075ndash2079 2000
[10] Y Pan H Fang H Yang et al ldquoCapsular polysaccharide syn-thesis regions in Klebsiella pneumoniae serotype K57 and a newcapsular serotyperdquo Journal of Clinical Microbiology vol 46 no7 pp 2231ndash2240 2008
[11] C-P Fung F-Y Chang S-C Lee et al ldquoA global emergingdisease of Klebsiella pneumoniae liver abscess is serotype K1 animportant factor for complicated endophthalmitisrdquo Gut vol50 no 3 pp 420ndash424 2002
[12] D L Paterson ldquoResistance in gram-negative bacteria enter-obacteriaceaerdquo American Journal of Medicine vol 119 supple-ment 1 no 6 pp S20ndashS28 S60ndashS70 2006
[13] C Lin T Huang W Liang and H Peng ldquoHomologousresponse regulators KvgA KvhA and KvhR regulate the synthe-sis of capsular polysaccharide inKlebsiella pneumoniaeCG43 ina coordinated mannerrdquo Journal of Biochemistry vol 140 no 3pp 429ndash438 2006
[14] N Majdalani and S Gottesman ldquoThe Rcs phosphorelay acomplex signal transduction systemrdquo Annual Review of Micro-biology vol 59 pp 379ndash405 2005
[15] S Gottesman and V Stout ldquoRegulation of capsular polysaccha-ride synthesis in Escherichia coli K12rdquo Molecular Microbiologyvol 5 no 7 pp 1599ndash1606 1991
[16] V Stout ldquoRegulation of capsule synthesis includes interactionsof the RcsCRcsB regulatory pairrdquoResearch inMicrobiology vol145 no 5-6 pp 389ndash392 1994
[17] C T Lin Y C Chen T R Jinn C C Wu Y M Hong andW H Wu ldquoRole of the cAMP-dependent carbon cataboliterepression in capsular polysaccharide biosynthesis in Klebsiellapneumoniaerdquo PLoS ONE vol 8 no 2 Article ID e54430 2013
[18] C Lin C Wu Y Chen et al ldquoFur regulation of the capsularpolysaccharide biosynthesis and iron-acquisition systems inKlebsiella pneumoniae CG43rdquoMicrobiology vol 157 part 2 pp419ndash429 2010
[19] D J Hassett P A Sokol M L Howell et al ldquoFerric uptakeregulator (Fur) mutants of Pseudomonas aeruginosa demon-strate defective siderophore-mediated iron uptake altered aer-obic growth and decreased superoxide dismutase and catalaseactivitiesrdquo Journal of Bacteriology vol 178 no 14 pp 3996ndash4003 1996
[20] U A Ochsner and M L Vasil ldquoGene repression by the ferricuptake regulator in Pseudomonas aeruginosa cycle selection ofiron-regulated genesrdquo Proceedings of the National Academy ofSciences of the United States of America vol 93 no 9 pp 4409ndash4414 1996
[21] J J E Bijlsma B Waidner A H M Van Vliet et al ldquoTheHelicobacter pylori homologue of the ferric uptake regulator isinvolved in acid resistancerdquo Infection and Immunity vol 70 no2 pp 606ndash611 2002
[22] A H M van Vliet J Stoof S W Poppelaars et al ldquoDifferentialregulation of amidase- and formamidase-mediated ammoniaproduction by theHelicobacter pylori fur repressorrdquoThe Journalof Biological Chemistry vol 278 no 11 pp 9052ndash9057 2003
[23] M Baga M Goransson S Normark and B E Uhlin ldquoTran-scriptional activation of a pap pilus virulence operon fromuropathogenic Escherichia colirdquo The EMBO Journal vol 4 no13 pp 3887ndash3893 1985
[24] S Lory MWolfgang V Lee and R Smith ldquoThemulti-talentedbacterial adenylate cyclasesrdquo International Journal of MedicalMicrobiology vol 293 no 7-8 pp 479ndash482 2004
[25] K Skorupski and R K Taylor ldquoCyclic AMP and its receptorprotein negatively regulate the coordinate expression of choleratoxin and toxin-coregulated pilus in Vibrio choleraerdquo Proceed-ings of the National Academy of Sciences of the United States ofAmerica vol 94 no 1 pp 265ndash270 1997
[26] S E H West A K Sample and L J Runyen-Janecky ldquoThe vfrgene product required for Pseudomonas aeruginosa exotoxin Aand protease production belongs to the cyclic AMP receptorprotein familyrdquo Journal of Bacteriology vol 176 no 24 pp 7532ndash7542 1994
[27] M Mendez I-H Huang K Ohtani R Grau T Shimizuand M R Sarker ldquoCarbon catabolite repression of type IVpilus-dependent gliding motility in the anaerobic pathogenClostridium perfringensrdquo Journal of Bacteriology vol 190 no 1pp 48ndash60 2008
[28] E J Kalivoda N A Stella D M OrsquoDee G J Nau and R M QShanks ldquoThe cyclic AMP-dependent catabolite repression sys-tem of Serratia marcescensmediates biofilm formation throughregulation of type 1 fimbriaerdquo Applied and EnvironmentalMicrobiology vol 74 no 11 pp 3461ndash3470 2008
[29] C M Muller A Aberg J Straseviciene L Emody B E Uhlinand C Balsalobre ldquoType 1 fimbriae a colonization factor ofuropathogenic Escherichia coli are controlled by the metabolicsensor CRP-cAMPrdquo PLoS Pathogens vol 5 no 2 Article IDe1000303 2009
[30] E L Fuchs E D Brutinel E R Klem A R Fehr T L Yahrand M C Wolfgang ldquoIn vitro and in vivo characterization ofthe Pseudomonas aeruginosa cyclic AMP (cAMP) phosphodi-esterase CpdA required for cAMP homeostasis and virulencefactor regulationrdquo Journal of Bacteriology vol 192 no 11 pp2779ndash2790 2010
[31] T Endoh and J N Engel ldquoCbpA a polarly localized novel cyclicAMP-binding protein in Pseudomonas aeruginosardquo Journal ofBacteriology vol 191 no 23 pp 7193ndash7205 2009
[32] N A Stella E J Kalivoda D M OrsquoDee G J Nau and R M QShanks ldquoCatabolite repression control of flagellum productionby Serratia marcescensrdquo Research in Microbiology vol 159 no7-8 pp 562ndash568 2008
[33] S Enomoto K Yanaoka H Utsunomiya et al ldquoInhibitoryeffects of Japanese apricot (Prunus mume Siebold et ZuccUme) onHelicobacter pylori-related chronic gastritisrdquo EuropeanJournal of Clinical Nutrition vol 64 no 7 pp 714ndash719 2010
[34] R W K Wong U Hagg L Samaranayake M K Z Yuen CJ Seneviratne and R Kao ldquoAntimicrobial activity of Chinesemedicine herbs against common bacteria in oral biofilmA pilotstudyrdquo International Journal of Oral and Maxillofacial Surgeryvol 39 no 6 pp 599ndash605 2010
[35] C J Seneviratne R W K Wong U Hagg et al ldquoPrunus mumeextract exhibits antimicrobial activity against pathogenic oralbacteriardquo International Journal of Paediatric Dentistry vol 21no 4 pp 299ndash305 2011
[36] Y Chen RW KWong C J Seneviratne et al ldquoThe antimicro-bial efficacy of Fructus mume extract on orthodontic bracketa monospecies-biofilm model study in vitrordquo Archives of OralBiology vol 56 no 1 pp 16ndash21 2011
[37] Y Lai H Peng and H Chang ldquoRmpA2 an activator ofcapsule biosynthesis in Klebsiella pneumoniae CG43 regulatesK2 cps gene expression at the transcriptional levelrdquo Journal ofBacteriology vol 185 no 3 pp 788ndash800 2003
10 Evidence-Based Complementary and Alternative Medicine
[38] P Domenico S Schwartz and B A Cunha ldquoReduction ofcapsular polysaccharide production inKlebsiella pneumoniae bysodium salicylaterdquo Infection and Immunity vol 57 no 12 pp3778ndash3782 1989
[39] N Blumenkrantz and G A Hansen ldquoNew method for quanti-tative determination of uronic acidsrdquo Analytical Biochemistryvol 54 no 2 pp 484ndash489 1973
[40] J Lin F Chang C Fung et al ldquoHigh prevalence of phagocytic-resistant capsular serotypes of Klebsiella pneumoniae in liverabscessrdquo Microbes and Infection vol 6 no 13 pp 1191ndash11982004
[41] Y Arakawa R Wacharotayankun T Nagatsuka H Ito NKato and M Ohta ldquoGenomic organization of the Klebsiellapneumoniae cps region responsible for serotype K2 capsularpolysaccharide synthesis in the virulent strain chedidrdquo Journalof Bacteriology vol 177 no 7 pp 1788ndash1796 1995
[42] KWuN Li J Yan et al ldquoGenome sequencing and comparativeanalysis of Klebsiella pneumoniae NTUH-K2044 a strain caus-ing liver abscess and meningitisrdquo Journal of Bacteriology vol191 no 14 pp 4492ndash4501 2009
[43] H N Yeowell and J R White ldquoIron requirement in thebactericidal mechanism of streptonigrinrdquo Antimicrobial Agentsand Chemotherapy vol 22 no 6 pp 961ndash968 1982
[44] Y Keynan and E Rubinstein ldquoThe changing face of Klebsiellapneumoniae infections in the communityrdquo International Journalof Antimicrobial Agents vol 30 no 5 pp 385ndash389 2007
[45] R Colodner R Raz B Chazan and W Sakran ldquoSusceptibilitypattern of extended-spectrum 120573-lactamase producing bacteriaisolated from inpatients to five antimicrobial drugs in a com-munity hospital in Northern Israelrdquo International Journal ofAntimicrobial Agents vol 24 no 4 pp 409ndash410 2004
[46] E B Hirsch and V H Tam ldquoDetection and treatment optionsfor Klebsiella pneumoniae carbapenemases (KPCs) an emerg-ing cause of multidrug-resistant infectionrdquo Journal of Antimi-crobial Chemotherapy vol 65 no 6 pp 1119ndash1125 2010
[47] K K Kumarasamy M A Toleman T R Walsh et al ldquoEmer-gence of a new antibiotic resistance mechanism in India Pak-istan and the UK a molecular biological and epidemiologicalstudyrdquoThe Lancet Infectious Diseases vol 10 no 9 pp 597ndash6022010
[48] P Nordmann G Cuzon and T Naas ldquoThe real threat ofKlebsiella pneumoniae carbapenemase-producing bacteriardquoTheLancet Infectious Diseases vol 9 no 4 pp 228ndash236 2009
[49] D Yong M A Toleman C G Giske et al ldquoCharacterizationof a new metallo-120573-lactamase gene bla NDM-1 and a novelerythromycin esterase gene carried on a unique genetic struc-ture in Klebsiella pneumoniae sequence type 14 from IndiardquoAntimicrobial Agents and Chemotherapy vol 53 no 12 pp5046ndash5054 2009
[50] V Regueiro M A Campos J Pons S Albertı and J ABengoechea ldquoThe uptake of a Klebsiella pneumoniae capsulepolysaccharide mutant triggers an inflammatory response byhuman airway epithelial cellsrdquoMicrobiology vol 152 part 2 pp555ndash566 2006
[51] X Nassif N Honore T Vasselon S T Cole and P J SansonettildquoPositive control of colanic acid synthesis in Escherichia coliby rmpA and rmpB two virulence-plasmid genes of Klebsiellapneumoniaerdquo Molecular Microbiology vol 3 no 10 pp 1349ndash1359 1989
[52] X Nassif and P J Sansonetti ldquoCorrelation of the virulence ofKlebsiella pneumoniaeK1 and K2 with the presence of a plasmid
encoding aerobactinrdquo Infection and Immunity vol 54 no 3 pp603ndash608 1986
[53] K Mizuta M Ohta and M Mori ldquoVirulence for mice ofKlebsiella strains belonging to the O1 group relationship totheir capsular (K) typesrdquo Infection and Immunity vol 40 no1 pp 56ndash61 1983
[54] I Ofek K Kabha A Athamna et al ldquoGenetic exchange ofdeterminants for capsular polysaccharide biosynthesis betweenKlebsiella pneumoniae strains expressing serotypes K2 andK21ardquo Infection and Immunity vol 61 no 10 pp 4208ndash42161993
[55] A M Simoons-Smit A M J J Verwey-van Vught I Y RKanis and D M MacLaren ldquoVirulence of Klebsiella strains inexperimentally induced skin lesions in the mouserdquo Journal ofMedical Microbiology vol 17 no 1 pp 67ndash77 1984
[56] C Lee H Leu T Wu L Su and J Liu ldquoRisk factors for sponta-neous rupture of liver abscess caused byKlebsiella pneumoniaerdquoDiagnosticMicrobiology and Infectious Disease vol 52 no 2 pp79ndash84 2005
[57] C De Champs M P Sauvant C Chanal et al ldquoProspectivesurvey of colonization and infection caused by expanded-spectrum-120573-lactamase-producing members of the familyEnterobacteriaceae in an intensive care unitrdquo Journal of ClinicalMicrobiology vol 27 no 12 pp 2887ndash2890 1989
[58] S MMarkowitz J M Veazey Jr and F L Macrina ldquoSequentialoutbreaks of infection due to Klebsiella pneumoniae in a neona-tal intensive care unit implication of a conjugative R plasmidrdquoJournal of Infectious Diseases vol 142 no 1 pp 106ndash112 1980
[59] A M Stock V L Robinson and P N Goudreau ldquoTwo-component signal transductionrdquo Annual Review of Biochem-istry vol 69 pp 183ndash215 2000
[60] C Fuqua and E P Greenberg ldquoSelf perception in bacteriaquorum sensing with acylated homoserine lactonesrdquo CurrentOpinion in Microbiology vol 1 no 2 pp 183ndash189 1998
[61] P Romby F Vandenesch and E G H Wagner ldquoThe role ofRNAs in the regulation of virulence-gene expressionrdquo CurrentOpinion in Microbiology vol 9 no 2 pp 229ndash236 2006
[62] B L Bassler ldquoHow bacteria talk to each other regulationof gene expression by quorum sensingrdquo Current Opinion inMicrobiology vol 2 no 6 pp 582ndash587 1999
[63] H Y Cheng Y S Chen C YWu H Y Chang Y C Lai andHL Peng ldquoRmpA regulation of capsular polysaccharide biosyn-thesis in Klebsiella pneumoniae CG43rdquo Journal of Bacteriologyvol 192 no 12 pp 3144ndash3158 2010
[64] D Touati ldquoIron and oxidative stress in bacteriardquo Archives ofBiochemistry and Biophysics vol 373 no 1 pp 1ndash6 2000
6 Evidence-Based Complementary and Alternative Medicine
LB alone FM
(mgmL)
FM(mgmL)
0
20
10
5
0
20
10
5
10minus1 10
minus210
minus310
minus410
minus510
minus6
10minus1 10
minus210
minus310
minus410
minus5
LB with SNG (2 120583gmL)
100
(a) NTUH-K2044
LB alone FM
(mgmL)
FM(mgmL)
0
20
10
5
0
20
10
5
10minus1 10
minus210
minus310
minus410
minus510
minus6
10minus1 10
minus210
minus310
minus410
minus5
LB with SNG (2 120583gmL)
100
(b) CG43S3
Figure 5 Fructus mume increasesK pneumoniae susceptibility to streptonigrinK pneumoniaeNTUH-K2044 (a) or CG43S3 (b) coculturedwith different concentrations of Fructus mume extract (FM) were grown in LB alone or LB that supplemented with 2120583gmL streptonigrin(SNG) incubated for 2 h Then tenfold serial dilutions were spotted onto an LB agar to observe the colony formation
However the streptonigrin susceptibility of the bacteriaincreased upon coculturing with increasing amounts of Fruc-tusmume extract suggesting thatFructusmume increased theintracellular level of free iron in a dose-dependent manner inK pneumoniae
36 Citric Acid Inhibits K pneumoniae Growth and CPSBiosynthesis Citric acid has been demonstrated to be themain organic acid in Fructus mume extract [35] To examineif citric acid plays a role in the inhibitory effects of Fructusmume extract onK pneumoniae growth andCPS productionNTUH-K2044 and CG43S3 were cocultured with variousconcentrations of citric acid and then the growth curvesof the bacteria were monitored The result showed thatcitric acid obviously reduced the growth of NTUH-K2044and CG43S3 in a dose-dependent manner (Figure 6(a))Furthermore CPS production in the 2 K pneumoniae strainsalso decreased when citric acid was added to the growthmedium (Figure 6(b)) These results indicated that citric acidis an active component of Fructus mume extract that has
bactericidal activity and downregulates CPS biosynthesis inK pneumoniae
4 Discussion
Since the 1980s K pneumoniae is emerging as an importantpathogen in both community and hospital settings [44]In the hospital environment due to the extensive use ofantibiotics multiple drug resistance has been increasinglyobserved in K pneumoniae especially in ESBL-producingstrains Carbapenems are considered to be the preferredagents for the treatment of serious infections caused by ESBL-producing K pneumoniae because of their high stabilitywith respect to 120573-lactamase hydrolysis and the observedretained susceptibility of ESBL producers [45] HoweverK pneumoniae isolates resistant to carbapenems have beenreported worldwide since the 2000s [46ndash49] The emergenceof carbapenem-resistant enterobacteria is worrisome becausethe option for antimicrobial treatment is further restricted Inthis study we screened a series of TCMs for the identification
Evidence-Based Complementary and Alternative Medicine 7
NTUH-K2044
0 100 200 300 400 500 600 700
OD
600
00
05
10
15
20
25 CG43S3
(min)(min)0 100 200 300 400 500 600 700
OD
600
00
05
10
15
20
25
LB alone1 mgmL citric acid2 mgmL citric acid
3 mgmL citric acid4 mgmL citric acid
LB alone1 mgmL citric acid2 mgmL citric acid
3 mgmL citric acid4 mgmL citric acid
(a)
0
5
10
15
20
25
30
35
Citric acid(mgmL)
1 20 210
NTUH-K2044 CG43S3
Glu
curo
nic a
cid
(120583g109
cfu)
lowastlowast
lowast
(b)
Figure 6 Citric acid inhibits K pneumoniae growth and CPS levels K pneumoniae NTUH-K204 or CG43S3 cocultured with differentconcentrations of citric acid as indicated and the growth curve (a) as well as the CPS levels (b) were measured Bacteria were grown in LBbroth at 37∘C with agitation lowast 119875 lt 005 compared to the indicated group
of new antibacterial agents (data not shown) and then focusedon Fructus mume the smoked fruit of Prunus mume whichhas been demonstrated to efficiently inhibit H pylori andother oral bacteria [33ndash36] As shown in Figure 1 Fructusmume extract was found to have antibacterial activity againstclinically isolated K pneumoniae strains
Clinically isolated K pneumoniae strains usually producea large amount of CPS which confers not only a mucoidphenotype to the bacteria but also resistance to engulfmentby phagocytes and to serum bactericidal factors [40 50] Thedegree of mucoviscosity has also been positively correlated
with the successful establishment of infection [51 52] Amongthe 77 described capsular types of K pneumoniae K1 andK2 serotypes are highly virulent in experimental infectionin mice and are often associated with severe infections inhumans and animals [52ndash55] particularly with the tightassociation between the 2 serotypes and liver abscess [11 56]As shown in Figure 2 and Table 2 in K pneumoniae strainsof both the K1 and K2 serotypes Fructus mume extractsignificantly reduced bacterial hypermucoviscosity and CPSlevels and thus may result in the decreased resistance ofK pneumoniae to serum killing (Figure 3) On the other
8 Evidence-Based Complementary and Alternative Medicine
hand we also found that heat inactivated serum did nothave obvious bactericidal effects on K pneumoniae (data notshown) suggesting an importance of the complement system
Both prokaryotic and eukaryotic cells in natural envi-ronments are constantly challenged by various environ-mental stresses K pneumoniae like many gastrointestinalpathogens needs to penetrate the gastric acid barrier facethe challenge of the immune system and cope with thelimited supply of oxygen and nutrition to effect colonizationand infection [57 58] Therefore bacteria activate or repressthe expression of virulence genes to adapt to environmentalstimuli [59ndash62] In K pneumoniae CPS biosynthesis isregulated by multiple environmental stimuli and proteinregulators Our previous studies have shown that ferricions can repress K pneumoniae CPS production throughFur regulation [18 63] Under iron-repletion conditionsFur-Fe(II) can tightly repress cps transcription resulting inlowered CPS production in K pneumoniae [18] To furtherinvestigate how Fructus mume reduces CPS levels in Kpneumoniae we performed qRT-PCR analyses and foundthat CPS reduction was regulated at the transcriptionallevel (Figure 4) All 3 transcripts of K1 or K2 cps geneswere obviously downregulated especially orf1orf11015840 encodingGalF a putative UDP-glucose pyrophosphatase (Figure 4)In addition the streptonigrin sensitivity assay also indicatedthat Fructus mume could increase the intracellular iron levelsofK pneumoniae (Figure 5) implying that ferric iron and Furparticipate in Fructus mume-mediated CPS reduction Ironis essential to most bacteria for growth and reproductionbut iron overloading would lead to the formation of unde-sired reactive oxygen species (ROS) by the Fenton reactionto damage DNA or other biological macromolecules [64]Although how Fructus mume affects bacterial iron-uptakeremains unknown the increase in intracellular iron leadingto the formation of undesired ROS may account for part ofits bactericidal activity
The ingredients of Prunus mume extract are organicacids including citric acid (the main ingredient) tartaricacid oxalic acid and other unknown components [35 36]Although the acidic components of Prunus mume showedsome antibacterial activity it is less compared to that ofthe original extract implying that other active componentspossess considerable antibacterial activity [36] As seen inFigure 6 we also showed that citric acid could inhibit growthand CPS production in K pneumoniae The acidic propertymay be one of the antibacterialmechanisms of Fructusmumehowever there should be other active components since LBbroth supplemented with 20mgmL Fructus mume pHsim36 has stronger bactericidal activity than LB broth adjustedto pH 35 using HCl (data not shown) For future clinicalapplication more studies are required to determine the activecomponents of Fructus mume and its mechanism of action
5 Conclusion
To our knowledge this study is the first to report theantibacterial activity of Fructus mume against highly virulentK pneumoniae isolates Moreover we found that Fructus
mume reduced K pneumoniae CPS biosynthesis at thetranscriptional level possibly by regulating the intracellulariron concentration of the bacteria thereby helping the hostimmune system eliminate the pathogen
Conflict of Interests
The authors declare no conflict of interests in this work
Authorsrsquo Contribution
T-H Lin S-H Huang and C-C Wu contributed equally tothis work
Acknowledgments
The authors thank Professor Hwei-Ling Peng from NationalChiao Tung University Taiwan for providing theK pneumo-niae CG43S3 and Dr Jin-Town Wang from National TaiwanUniversity Hospital for providing K pneumoniae NTUH-K2044 The authors thank Yi-Ming Hong and Jing-Ciao Linfor their technical assistance during the study The workis supported by the Grants from National Science Council(NSC 99-2320-B-039-002-MY3) China Medical University(CMU98-ASIA-01) and Buddhist Tzu Chi general hospital(TTCRD101-17)
References
[1] F Chou and H Kou ldquoEndogenous endophthalmitis associatedwith pyogenic hepatic abscessrdquo Journal of the American Collegeof Surgeons vol 182 no 1 pp 33ndash36 1996
[2] S-H B Han ldquoReview of hepatic abscess from Klebsiellapneumoniaemdashan association with diabetes mellitus and septicendophthalmitisrdquo Western Journal of Medicine vol 162 no 3pp 220ndash224 1995
[3] Y Lau B Hu W Wu Y Lin H Chang and Z Shi ldquoIden-tification of a major cluster of Klebsiella pneumoniae isolatesfrom patients with liver abscess in Taiwanrdquo Journal of ClinicalMicrobiology vol 38 no 1 pp 412ndash414 2000
[4] H L Peng P Y Wang J L Wu C T Chiu and H Y ChangldquoMolecular epidemiology of Klebsiella pneumoniaerdquo ZhonghuaMin GuoWei ShengWu Ji Mian Yi Xue Za Zhi vol 24 no 3 pp264ndash271 1991
[5] Y Yang L K Siu K Yeh et al ldquoRecurrent Klebsiella pneumo-niae liver abscess clinical and microbiological characteristicsrdquoJournal of Clinical Microbiology vol 47 no 10 pp 3336ndash33392009
[6] L K Siu K M Yeh J C Lin C P Fung and F Y ChangldquoKlebsiella pneumoniae liver abscess a new invasive syndromerdquoThe Lancet Infectious Diseases vol 12 no 11 pp 881ndash887 2012
[7] E R Lederman and N F Crum ldquoPyogenic liver abscess witha focus on Klebsiella pneumoniae as a primary pathogen anemerging disease with unique clinical characteristicsrdquo Amer-ican Journal of Gastroenterology vol 100 no 2 pp 322ndash3312005
[8] H Sahly R Podschun T A Oelschlaeger et al ldquoCapsuleimpedes adhesion to and invasion of epithelial cells byKlebsiellapneumoniaerdquo Infection and Immunity vol 68 no 12 pp 6744ndash6749 2000
Evidence-Based Complementary and Alternative Medicine 9
[9] C Fung B Hu F Chang et al ldquoA 5-year study of the ser-oepidemiology of Klebsiella pneumoniae high prevalence ofcapsular serotype K1 in Taiwan and implication for vaccineefficacyrdquo Journal of Infectious Diseases vol 181 no 6 pp 2075ndash2079 2000
[10] Y Pan H Fang H Yang et al ldquoCapsular polysaccharide syn-thesis regions in Klebsiella pneumoniae serotype K57 and a newcapsular serotyperdquo Journal of Clinical Microbiology vol 46 no7 pp 2231ndash2240 2008
[11] C-P Fung F-Y Chang S-C Lee et al ldquoA global emergingdisease of Klebsiella pneumoniae liver abscess is serotype K1 animportant factor for complicated endophthalmitisrdquo Gut vol50 no 3 pp 420ndash424 2002
[12] D L Paterson ldquoResistance in gram-negative bacteria enter-obacteriaceaerdquo American Journal of Medicine vol 119 supple-ment 1 no 6 pp S20ndashS28 S60ndashS70 2006
[13] C Lin T Huang W Liang and H Peng ldquoHomologousresponse regulators KvgA KvhA and KvhR regulate the synthe-sis of capsular polysaccharide inKlebsiella pneumoniaeCG43 ina coordinated mannerrdquo Journal of Biochemistry vol 140 no 3pp 429ndash438 2006
[14] N Majdalani and S Gottesman ldquoThe Rcs phosphorelay acomplex signal transduction systemrdquo Annual Review of Micro-biology vol 59 pp 379ndash405 2005
[15] S Gottesman and V Stout ldquoRegulation of capsular polysaccha-ride synthesis in Escherichia coli K12rdquo Molecular Microbiologyvol 5 no 7 pp 1599ndash1606 1991
[16] V Stout ldquoRegulation of capsule synthesis includes interactionsof the RcsCRcsB regulatory pairrdquoResearch inMicrobiology vol145 no 5-6 pp 389ndash392 1994
[17] C T Lin Y C Chen T R Jinn C C Wu Y M Hong andW H Wu ldquoRole of the cAMP-dependent carbon cataboliterepression in capsular polysaccharide biosynthesis in Klebsiellapneumoniaerdquo PLoS ONE vol 8 no 2 Article ID e54430 2013
[18] C Lin C Wu Y Chen et al ldquoFur regulation of the capsularpolysaccharide biosynthesis and iron-acquisition systems inKlebsiella pneumoniae CG43rdquoMicrobiology vol 157 part 2 pp419ndash429 2010
[19] D J Hassett P A Sokol M L Howell et al ldquoFerric uptakeregulator (Fur) mutants of Pseudomonas aeruginosa demon-strate defective siderophore-mediated iron uptake altered aer-obic growth and decreased superoxide dismutase and catalaseactivitiesrdquo Journal of Bacteriology vol 178 no 14 pp 3996ndash4003 1996
[20] U A Ochsner and M L Vasil ldquoGene repression by the ferricuptake regulator in Pseudomonas aeruginosa cycle selection ofiron-regulated genesrdquo Proceedings of the National Academy ofSciences of the United States of America vol 93 no 9 pp 4409ndash4414 1996
[21] J J E Bijlsma B Waidner A H M Van Vliet et al ldquoTheHelicobacter pylori homologue of the ferric uptake regulator isinvolved in acid resistancerdquo Infection and Immunity vol 70 no2 pp 606ndash611 2002
[22] A H M van Vliet J Stoof S W Poppelaars et al ldquoDifferentialregulation of amidase- and formamidase-mediated ammoniaproduction by theHelicobacter pylori fur repressorrdquoThe Journalof Biological Chemistry vol 278 no 11 pp 9052ndash9057 2003
[23] M Baga M Goransson S Normark and B E Uhlin ldquoTran-scriptional activation of a pap pilus virulence operon fromuropathogenic Escherichia colirdquo The EMBO Journal vol 4 no13 pp 3887ndash3893 1985
[24] S Lory MWolfgang V Lee and R Smith ldquoThemulti-talentedbacterial adenylate cyclasesrdquo International Journal of MedicalMicrobiology vol 293 no 7-8 pp 479ndash482 2004
[25] K Skorupski and R K Taylor ldquoCyclic AMP and its receptorprotein negatively regulate the coordinate expression of choleratoxin and toxin-coregulated pilus in Vibrio choleraerdquo Proceed-ings of the National Academy of Sciences of the United States ofAmerica vol 94 no 1 pp 265ndash270 1997
[26] S E H West A K Sample and L J Runyen-Janecky ldquoThe vfrgene product required for Pseudomonas aeruginosa exotoxin Aand protease production belongs to the cyclic AMP receptorprotein familyrdquo Journal of Bacteriology vol 176 no 24 pp 7532ndash7542 1994
[27] M Mendez I-H Huang K Ohtani R Grau T Shimizuand M R Sarker ldquoCarbon catabolite repression of type IVpilus-dependent gliding motility in the anaerobic pathogenClostridium perfringensrdquo Journal of Bacteriology vol 190 no 1pp 48ndash60 2008
[28] E J Kalivoda N A Stella D M OrsquoDee G J Nau and R M QShanks ldquoThe cyclic AMP-dependent catabolite repression sys-tem of Serratia marcescensmediates biofilm formation throughregulation of type 1 fimbriaerdquo Applied and EnvironmentalMicrobiology vol 74 no 11 pp 3461ndash3470 2008
[29] C M Muller A Aberg J Straseviciene L Emody B E Uhlinand C Balsalobre ldquoType 1 fimbriae a colonization factor ofuropathogenic Escherichia coli are controlled by the metabolicsensor CRP-cAMPrdquo PLoS Pathogens vol 5 no 2 Article IDe1000303 2009
[30] E L Fuchs E D Brutinel E R Klem A R Fehr T L Yahrand M C Wolfgang ldquoIn vitro and in vivo characterization ofthe Pseudomonas aeruginosa cyclic AMP (cAMP) phosphodi-esterase CpdA required for cAMP homeostasis and virulencefactor regulationrdquo Journal of Bacteriology vol 192 no 11 pp2779ndash2790 2010
[31] T Endoh and J N Engel ldquoCbpA a polarly localized novel cyclicAMP-binding protein in Pseudomonas aeruginosardquo Journal ofBacteriology vol 191 no 23 pp 7193ndash7205 2009
[32] N A Stella E J Kalivoda D M OrsquoDee G J Nau and R M QShanks ldquoCatabolite repression control of flagellum productionby Serratia marcescensrdquo Research in Microbiology vol 159 no7-8 pp 562ndash568 2008
[33] S Enomoto K Yanaoka H Utsunomiya et al ldquoInhibitoryeffects of Japanese apricot (Prunus mume Siebold et ZuccUme) onHelicobacter pylori-related chronic gastritisrdquo EuropeanJournal of Clinical Nutrition vol 64 no 7 pp 714ndash719 2010
[34] R W K Wong U Hagg L Samaranayake M K Z Yuen CJ Seneviratne and R Kao ldquoAntimicrobial activity of Chinesemedicine herbs against common bacteria in oral biofilmA pilotstudyrdquo International Journal of Oral and Maxillofacial Surgeryvol 39 no 6 pp 599ndash605 2010
[35] C J Seneviratne R W K Wong U Hagg et al ldquoPrunus mumeextract exhibits antimicrobial activity against pathogenic oralbacteriardquo International Journal of Paediatric Dentistry vol 21no 4 pp 299ndash305 2011
[36] Y Chen RW KWong C J Seneviratne et al ldquoThe antimicro-bial efficacy of Fructus mume extract on orthodontic bracketa monospecies-biofilm model study in vitrordquo Archives of OralBiology vol 56 no 1 pp 16ndash21 2011
[37] Y Lai H Peng and H Chang ldquoRmpA2 an activator ofcapsule biosynthesis in Klebsiella pneumoniae CG43 regulatesK2 cps gene expression at the transcriptional levelrdquo Journal ofBacteriology vol 185 no 3 pp 788ndash800 2003
10 Evidence-Based Complementary and Alternative Medicine
[38] P Domenico S Schwartz and B A Cunha ldquoReduction ofcapsular polysaccharide production inKlebsiella pneumoniae bysodium salicylaterdquo Infection and Immunity vol 57 no 12 pp3778ndash3782 1989
[39] N Blumenkrantz and G A Hansen ldquoNew method for quanti-tative determination of uronic acidsrdquo Analytical Biochemistryvol 54 no 2 pp 484ndash489 1973
[40] J Lin F Chang C Fung et al ldquoHigh prevalence of phagocytic-resistant capsular serotypes of Klebsiella pneumoniae in liverabscessrdquo Microbes and Infection vol 6 no 13 pp 1191ndash11982004
[41] Y Arakawa R Wacharotayankun T Nagatsuka H Ito NKato and M Ohta ldquoGenomic organization of the Klebsiellapneumoniae cps region responsible for serotype K2 capsularpolysaccharide synthesis in the virulent strain chedidrdquo Journalof Bacteriology vol 177 no 7 pp 1788ndash1796 1995
[42] KWuN Li J Yan et al ldquoGenome sequencing and comparativeanalysis of Klebsiella pneumoniae NTUH-K2044 a strain caus-ing liver abscess and meningitisrdquo Journal of Bacteriology vol191 no 14 pp 4492ndash4501 2009
[43] H N Yeowell and J R White ldquoIron requirement in thebactericidal mechanism of streptonigrinrdquo Antimicrobial Agentsand Chemotherapy vol 22 no 6 pp 961ndash968 1982
[44] Y Keynan and E Rubinstein ldquoThe changing face of Klebsiellapneumoniae infections in the communityrdquo International Journalof Antimicrobial Agents vol 30 no 5 pp 385ndash389 2007
[45] R Colodner R Raz B Chazan and W Sakran ldquoSusceptibilitypattern of extended-spectrum 120573-lactamase producing bacteriaisolated from inpatients to five antimicrobial drugs in a com-munity hospital in Northern Israelrdquo International Journal ofAntimicrobial Agents vol 24 no 4 pp 409ndash410 2004
[46] E B Hirsch and V H Tam ldquoDetection and treatment optionsfor Klebsiella pneumoniae carbapenemases (KPCs) an emerg-ing cause of multidrug-resistant infectionrdquo Journal of Antimi-crobial Chemotherapy vol 65 no 6 pp 1119ndash1125 2010
[47] K K Kumarasamy M A Toleman T R Walsh et al ldquoEmer-gence of a new antibiotic resistance mechanism in India Pak-istan and the UK a molecular biological and epidemiologicalstudyrdquoThe Lancet Infectious Diseases vol 10 no 9 pp 597ndash6022010
[48] P Nordmann G Cuzon and T Naas ldquoThe real threat ofKlebsiella pneumoniae carbapenemase-producing bacteriardquoTheLancet Infectious Diseases vol 9 no 4 pp 228ndash236 2009
[49] D Yong M A Toleman C G Giske et al ldquoCharacterizationof a new metallo-120573-lactamase gene bla NDM-1 and a novelerythromycin esterase gene carried on a unique genetic struc-ture in Klebsiella pneumoniae sequence type 14 from IndiardquoAntimicrobial Agents and Chemotherapy vol 53 no 12 pp5046ndash5054 2009
[50] V Regueiro M A Campos J Pons S Albertı and J ABengoechea ldquoThe uptake of a Klebsiella pneumoniae capsulepolysaccharide mutant triggers an inflammatory response byhuman airway epithelial cellsrdquoMicrobiology vol 152 part 2 pp555ndash566 2006
[51] X Nassif N Honore T Vasselon S T Cole and P J SansonettildquoPositive control of colanic acid synthesis in Escherichia coliby rmpA and rmpB two virulence-plasmid genes of Klebsiellapneumoniaerdquo Molecular Microbiology vol 3 no 10 pp 1349ndash1359 1989
[52] X Nassif and P J Sansonetti ldquoCorrelation of the virulence ofKlebsiella pneumoniaeK1 and K2 with the presence of a plasmid
encoding aerobactinrdquo Infection and Immunity vol 54 no 3 pp603ndash608 1986
[53] K Mizuta M Ohta and M Mori ldquoVirulence for mice ofKlebsiella strains belonging to the O1 group relationship totheir capsular (K) typesrdquo Infection and Immunity vol 40 no1 pp 56ndash61 1983
[54] I Ofek K Kabha A Athamna et al ldquoGenetic exchange ofdeterminants for capsular polysaccharide biosynthesis betweenKlebsiella pneumoniae strains expressing serotypes K2 andK21ardquo Infection and Immunity vol 61 no 10 pp 4208ndash42161993
[55] A M Simoons-Smit A M J J Verwey-van Vught I Y RKanis and D M MacLaren ldquoVirulence of Klebsiella strains inexperimentally induced skin lesions in the mouserdquo Journal ofMedical Microbiology vol 17 no 1 pp 67ndash77 1984
[56] C Lee H Leu T Wu L Su and J Liu ldquoRisk factors for sponta-neous rupture of liver abscess caused byKlebsiella pneumoniaerdquoDiagnosticMicrobiology and Infectious Disease vol 52 no 2 pp79ndash84 2005
[57] C De Champs M P Sauvant C Chanal et al ldquoProspectivesurvey of colonization and infection caused by expanded-spectrum-120573-lactamase-producing members of the familyEnterobacteriaceae in an intensive care unitrdquo Journal of ClinicalMicrobiology vol 27 no 12 pp 2887ndash2890 1989
[58] S MMarkowitz J M Veazey Jr and F L Macrina ldquoSequentialoutbreaks of infection due to Klebsiella pneumoniae in a neona-tal intensive care unit implication of a conjugative R plasmidrdquoJournal of Infectious Diseases vol 142 no 1 pp 106ndash112 1980
[59] A M Stock V L Robinson and P N Goudreau ldquoTwo-component signal transductionrdquo Annual Review of Biochem-istry vol 69 pp 183ndash215 2000
[60] C Fuqua and E P Greenberg ldquoSelf perception in bacteriaquorum sensing with acylated homoserine lactonesrdquo CurrentOpinion in Microbiology vol 1 no 2 pp 183ndash189 1998
[61] P Romby F Vandenesch and E G H Wagner ldquoThe role ofRNAs in the regulation of virulence-gene expressionrdquo CurrentOpinion in Microbiology vol 9 no 2 pp 229ndash236 2006
[62] B L Bassler ldquoHow bacteria talk to each other regulationof gene expression by quorum sensingrdquo Current Opinion inMicrobiology vol 2 no 6 pp 582ndash587 1999
[63] H Y Cheng Y S Chen C YWu H Y Chang Y C Lai andHL Peng ldquoRmpA regulation of capsular polysaccharide biosyn-thesis in Klebsiella pneumoniae CG43rdquo Journal of Bacteriologyvol 192 no 12 pp 3144ndash3158 2010
[64] D Touati ldquoIron and oxidative stress in bacteriardquo Archives ofBiochemistry and Biophysics vol 373 no 1 pp 1ndash6 2000
Evidence-Based Complementary and Alternative Medicine 7
NTUH-K2044
0 100 200 300 400 500 600 700
OD
600
00
05
10
15
20
25 CG43S3
(min)(min)0 100 200 300 400 500 600 700
OD
600
00
05
10
15
20
25
LB alone1 mgmL citric acid2 mgmL citric acid
3 mgmL citric acid4 mgmL citric acid
LB alone1 mgmL citric acid2 mgmL citric acid
3 mgmL citric acid4 mgmL citric acid
(a)
0
5
10
15
20
25
30
35
Citric acid(mgmL)
1 20 210
NTUH-K2044 CG43S3
Glu
curo
nic a
cid
(120583g109
cfu)
lowastlowast
lowast
(b)
Figure 6 Citric acid inhibits K pneumoniae growth and CPS levels K pneumoniae NTUH-K204 or CG43S3 cocultured with differentconcentrations of citric acid as indicated and the growth curve (a) as well as the CPS levels (b) were measured Bacteria were grown in LBbroth at 37∘C with agitation lowast 119875 lt 005 compared to the indicated group
of new antibacterial agents (data not shown) and then focusedon Fructus mume the smoked fruit of Prunus mume whichhas been demonstrated to efficiently inhibit H pylori andother oral bacteria [33ndash36] As shown in Figure 1 Fructusmume extract was found to have antibacterial activity againstclinically isolated K pneumoniae strains
Clinically isolated K pneumoniae strains usually producea large amount of CPS which confers not only a mucoidphenotype to the bacteria but also resistance to engulfmentby phagocytes and to serum bactericidal factors [40 50] Thedegree of mucoviscosity has also been positively correlated
with the successful establishment of infection [51 52] Amongthe 77 described capsular types of K pneumoniae K1 andK2 serotypes are highly virulent in experimental infectionin mice and are often associated with severe infections inhumans and animals [52ndash55] particularly with the tightassociation between the 2 serotypes and liver abscess [11 56]As shown in Figure 2 and Table 2 in K pneumoniae strainsof both the K1 and K2 serotypes Fructus mume extractsignificantly reduced bacterial hypermucoviscosity and CPSlevels and thus may result in the decreased resistance ofK pneumoniae to serum killing (Figure 3) On the other
8 Evidence-Based Complementary and Alternative Medicine
hand we also found that heat inactivated serum did nothave obvious bactericidal effects on K pneumoniae (data notshown) suggesting an importance of the complement system
Both prokaryotic and eukaryotic cells in natural envi-ronments are constantly challenged by various environ-mental stresses K pneumoniae like many gastrointestinalpathogens needs to penetrate the gastric acid barrier facethe challenge of the immune system and cope with thelimited supply of oxygen and nutrition to effect colonizationand infection [57 58] Therefore bacteria activate or repressthe expression of virulence genes to adapt to environmentalstimuli [59ndash62] In K pneumoniae CPS biosynthesis isregulated by multiple environmental stimuli and proteinregulators Our previous studies have shown that ferricions can repress K pneumoniae CPS production throughFur regulation [18 63] Under iron-repletion conditionsFur-Fe(II) can tightly repress cps transcription resulting inlowered CPS production in K pneumoniae [18] To furtherinvestigate how Fructus mume reduces CPS levels in Kpneumoniae we performed qRT-PCR analyses and foundthat CPS reduction was regulated at the transcriptionallevel (Figure 4) All 3 transcripts of K1 or K2 cps geneswere obviously downregulated especially orf1orf11015840 encodingGalF a putative UDP-glucose pyrophosphatase (Figure 4)In addition the streptonigrin sensitivity assay also indicatedthat Fructus mume could increase the intracellular iron levelsofK pneumoniae (Figure 5) implying that ferric iron and Furparticipate in Fructus mume-mediated CPS reduction Ironis essential to most bacteria for growth and reproductionbut iron overloading would lead to the formation of unde-sired reactive oxygen species (ROS) by the Fenton reactionto damage DNA or other biological macromolecules [64]Although how Fructus mume affects bacterial iron-uptakeremains unknown the increase in intracellular iron leadingto the formation of undesired ROS may account for part ofits bactericidal activity
The ingredients of Prunus mume extract are organicacids including citric acid (the main ingredient) tartaricacid oxalic acid and other unknown components [35 36]Although the acidic components of Prunus mume showedsome antibacterial activity it is less compared to that ofthe original extract implying that other active componentspossess considerable antibacterial activity [36] As seen inFigure 6 we also showed that citric acid could inhibit growthand CPS production in K pneumoniae The acidic propertymay be one of the antibacterialmechanisms of Fructusmumehowever there should be other active components since LBbroth supplemented with 20mgmL Fructus mume pHsim36 has stronger bactericidal activity than LB broth adjustedto pH 35 using HCl (data not shown) For future clinicalapplication more studies are required to determine the activecomponents of Fructus mume and its mechanism of action
5 Conclusion
To our knowledge this study is the first to report theantibacterial activity of Fructus mume against highly virulentK pneumoniae isolates Moreover we found that Fructus
mume reduced K pneumoniae CPS biosynthesis at thetranscriptional level possibly by regulating the intracellulariron concentration of the bacteria thereby helping the hostimmune system eliminate the pathogen
Conflict of Interests
The authors declare no conflict of interests in this work
Authorsrsquo Contribution
T-H Lin S-H Huang and C-C Wu contributed equally tothis work
Acknowledgments
The authors thank Professor Hwei-Ling Peng from NationalChiao Tung University Taiwan for providing theK pneumo-niae CG43S3 and Dr Jin-Town Wang from National TaiwanUniversity Hospital for providing K pneumoniae NTUH-K2044 The authors thank Yi-Ming Hong and Jing-Ciao Linfor their technical assistance during the study The workis supported by the Grants from National Science Council(NSC 99-2320-B-039-002-MY3) China Medical University(CMU98-ASIA-01) and Buddhist Tzu Chi general hospital(TTCRD101-17)
References
[1] F Chou and H Kou ldquoEndogenous endophthalmitis associatedwith pyogenic hepatic abscessrdquo Journal of the American Collegeof Surgeons vol 182 no 1 pp 33ndash36 1996
[2] S-H B Han ldquoReview of hepatic abscess from Klebsiellapneumoniaemdashan association with diabetes mellitus and septicendophthalmitisrdquo Western Journal of Medicine vol 162 no 3pp 220ndash224 1995
[3] Y Lau B Hu W Wu Y Lin H Chang and Z Shi ldquoIden-tification of a major cluster of Klebsiella pneumoniae isolatesfrom patients with liver abscess in Taiwanrdquo Journal of ClinicalMicrobiology vol 38 no 1 pp 412ndash414 2000
[4] H L Peng P Y Wang J L Wu C T Chiu and H Y ChangldquoMolecular epidemiology of Klebsiella pneumoniaerdquo ZhonghuaMin GuoWei ShengWu Ji Mian Yi Xue Za Zhi vol 24 no 3 pp264ndash271 1991
[5] Y Yang L K Siu K Yeh et al ldquoRecurrent Klebsiella pneumo-niae liver abscess clinical and microbiological characteristicsrdquoJournal of Clinical Microbiology vol 47 no 10 pp 3336ndash33392009
[6] L K Siu K M Yeh J C Lin C P Fung and F Y ChangldquoKlebsiella pneumoniae liver abscess a new invasive syndromerdquoThe Lancet Infectious Diseases vol 12 no 11 pp 881ndash887 2012
[7] E R Lederman and N F Crum ldquoPyogenic liver abscess witha focus on Klebsiella pneumoniae as a primary pathogen anemerging disease with unique clinical characteristicsrdquo Amer-ican Journal of Gastroenterology vol 100 no 2 pp 322ndash3312005
[8] H Sahly R Podschun T A Oelschlaeger et al ldquoCapsuleimpedes adhesion to and invasion of epithelial cells byKlebsiellapneumoniaerdquo Infection and Immunity vol 68 no 12 pp 6744ndash6749 2000
Evidence-Based Complementary and Alternative Medicine 9
[9] C Fung B Hu F Chang et al ldquoA 5-year study of the ser-oepidemiology of Klebsiella pneumoniae high prevalence ofcapsular serotype K1 in Taiwan and implication for vaccineefficacyrdquo Journal of Infectious Diseases vol 181 no 6 pp 2075ndash2079 2000
[10] Y Pan H Fang H Yang et al ldquoCapsular polysaccharide syn-thesis regions in Klebsiella pneumoniae serotype K57 and a newcapsular serotyperdquo Journal of Clinical Microbiology vol 46 no7 pp 2231ndash2240 2008
[11] C-P Fung F-Y Chang S-C Lee et al ldquoA global emergingdisease of Klebsiella pneumoniae liver abscess is serotype K1 animportant factor for complicated endophthalmitisrdquo Gut vol50 no 3 pp 420ndash424 2002
[12] D L Paterson ldquoResistance in gram-negative bacteria enter-obacteriaceaerdquo American Journal of Medicine vol 119 supple-ment 1 no 6 pp S20ndashS28 S60ndashS70 2006
[13] C Lin T Huang W Liang and H Peng ldquoHomologousresponse regulators KvgA KvhA and KvhR regulate the synthe-sis of capsular polysaccharide inKlebsiella pneumoniaeCG43 ina coordinated mannerrdquo Journal of Biochemistry vol 140 no 3pp 429ndash438 2006
[14] N Majdalani and S Gottesman ldquoThe Rcs phosphorelay acomplex signal transduction systemrdquo Annual Review of Micro-biology vol 59 pp 379ndash405 2005
[15] S Gottesman and V Stout ldquoRegulation of capsular polysaccha-ride synthesis in Escherichia coli K12rdquo Molecular Microbiologyvol 5 no 7 pp 1599ndash1606 1991
[16] V Stout ldquoRegulation of capsule synthesis includes interactionsof the RcsCRcsB regulatory pairrdquoResearch inMicrobiology vol145 no 5-6 pp 389ndash392 1994
[17] C T Lin Y C Chen T R Jinn C C Wu Y M Hong andW H Wu ldquoRole of the cAMP-dependent carbon cataboliterepression in capsular polysaccharide biosynthesis in Klebsiellapneumoniaerdquo PLoS ONE vol 8 no 2 Article ID e54430 2013
[18] C Lin C Wu Y Chen et al ldquoFur regulation of the capsularpolysaccharide biosynthesis and iron-acquisition systems inKlebsiella pneumoniae CG43rdquoMicrobiology vol 157 part 2 pp419ndash429 2010
[19] D J Hassett P A Sokol M L Howell et al ldquoFerric uptakeregulator (Fur) mutants of Pseudomonas aeruginosa demon-strate defective siderophore-mediated iron uptake altered aer-obic growth and decreased superoxide dismutase and catalaseactivitiesrdquo Journal of Bacteriology vol 178 no 14 pp 3996ndash4003 1996
[20] U A Ochsner and M L Vasil ldquoGene repression by the ferricuptake regulator in Pseudomonas aeruginosa cycle selection ofiron-regulated genesrdquo Proceedings of the National Academy ofSciences of the United States of America vol 93 no 9 pp 4409ndash4414 1996
[21] J J E Bijlsma B Waidner A H M Van Vliet et al ldquoTheHelicobacter pylori homologue of the ferric uptake regulator isinvolved in acid resistancerdquo Infection and Immunity vol 70 no2 pp 606ndash611 2002
[22] A H M van Vliet J Stoof S W Poppelaars et al ldquoDifferentialregulation of amidase- and formamidase-mediated ammoniaproduction by theHelicobacter pylori fur repressorrdquoThe Journalof Biological Chemistry vol 278 no 11 pp 9052ndash9057 2003
[23] M Baga M Goransson S Normark and B E Uhlin ldquoTran-scriptional activation of a pap pilus virulence operon fromuropathogenic Escherichia colirdquo The EMBO Journal vol 4 no13 pp 3887ndash3893 1985
[24] S Lory MWolfgang V Lee and R Smith ldquoThemulti-talentedbacterial adenylate cyclasesrdquo International Journal of MedicalMicrobiology vol 293 no 7-8 pp 479ndash482 2004
[25] K Skorupski and R K Taylor ldquoCyclic AMP and its receptorprotein negatively regulate the coordinate expression of choleratoxin and toxin-coregulated pilus in Vibrio choleraerdquo Proceed-ings of the National Academy of Sciences of the United States ofAmerica vol 94 no 1 pp 265ndash270 1997
[26] S E H West A K Sample and L J Runyen-Janecky ldquoThe vfrgene product required for Pseudomonas aeruginosa exotoxin Aand protease production belongs to the cyclic AMP receptorprotein familyrdquo Journal of Bacteriology vol 176 no 24 pp 7532ndash7542 1994
[27] M Mendez I-H Huang K Ohtani R Grau T Shimizuand M R Sarker ldquoCarbon catabolite repression of type IVpilus-dependent gliding motility in the anaerobic pathogenClostridium perfringensrdquo Journal of Bacteriology vol 190 no 1pp 48ndash60 2008
[28] E J Kalivoda N A Stella D M OrsquoDee G J Nau and R M QShanks ldquoThe cyclic AMP-dependent catabolite repression sys-tem of Serratia marcescensmediates biofilm formation throughregulation of type 1 fimbriaerdquo Applied and EnvironmentalMicrobiology vol 74 no 11 pp 3461ndash3470 2008
[29] C M Muller A Aberg J Straseviciene L Emody B E Uhlinand C Balsalobre ldquoType 1 fimbriae a colonization factor ofuropathogenic Escherichia coli are controlled by the metabolicsensor CRP-cAMPrdquo PLoS Pathogens vol 5 no 2 Article IDe1000303 2009
[30] E L Fuchs E D Brutinel E R Klem A R Fehr T L Yahrand M C Wolfgang ldquoIn vitro and in vivo characterization ofthe Pseudomonas aeruginosa cyclic AMP (cAMP) phosphodi-esterase CpdA required for cAMP homeostasis and virulencefactor regulationrdquo Journal of Bacteriology vol 192 no 11 pp2779ndash2790 2010
[31] T Endoh and J N Engel ldquoCbpA a polarly localized novel cyclicAMP-binding protein in Pseudomonas aeruginosardquo Journal ofBacteriology vol 191 no 23 pp 7193ndash7205 2009
[32] N A Stella E J Kalivoda D M OrsquoDee G J Nau and R M QShanks ldquoCatabolite repression control of flagellum productionby Serratia marcescensrdquo Research in Microbiology vol 159 no7-8 pp 562ndash568 2008
[33] S Enomoto K Yanaoka H Utsunomiya et al ldquoInhibitoryeffects of Japanese apricot (Prunus mume Siebold et ZuccUme) onHelicobacter pylori-related chronic gastritisrdquo EuropeanJournal of Clinical Nutrition vol 64 no 7 pp 714ndash719 2010
[34] R W K Wong U Hagg L Samaranayake M K Z Yuen CJ Seneviratne and R Kao ldquoAntimicrobial activity of Chinesemedicine herbs against common bacteria in oral biofilmA pilotstudyrdquo International Journal of Oral and Maxillofacial Surgeryvol 39 no 6 pp 599ndash605 2010
[35] C J Seneviratne R W K Wong U Hagg et al ldquoPrunus mumeextract exhibits antimicrobial activity against pathogenic oralbacteriardquo International Journal of Paediatric Dentistry vol 21no 4 pp 299ndash305 2011
[36] Y Chen RW KWong C J Seneviratne et al ldquoThe antimicro-bial efficacy of Fructus mume extract on orthodontic bracketa monospecies-biofilm model study in vitrordquo Archives of OralBiology vol 56 no 1 pp 16ndash21 2011
[37] Y Lai H Peng and H Chang ldquoRmpA2 an activator ofcapsule biosynthesis in Klebsiella pneumoniae CG43 regulatesK2 cps gene expression at the transcriptional levelrdquo Journal ofBacteriology vol 185 no 3 pp 788ndash800 2003
10 Evidence-Based Complementary and Alternative Medicine
[38] P Domenico S Schwartz and B A Cunha ldquoReduction ofcapsular polysaccharide production inKlebsiella pneumoniae bysodium salicylaterdquo Infection and Immunity vol 57 no 12 pp3778ndash3782 1989
[39] N Blumenkrantz and G A Hansen ldquoNew method for quanti-tative determination of uronic acidsrdquo Analytical Biochemistryvol 54 no 2 pp 484ndash489 1973
[40] J Lin F Chang C Fung et al ldquoHigh prevalence of phagocytic-resistant capsular serotypes of Klebsiella pneumoniae in liverabscessrdquo Microbes and Infection vol 6 no 13 pp 1191ndash11982004
[41] Y Arakawa R Wacharotayankun T Nagatsuka H Ito NKato and M Ohta ldquoGenomic organization of the Klebsiellapneumoniae cps region responsible for serotype K2 capsularpolysaccharide synthesis in the virulent strain chedidrdquo Journalof Bacteriology vol 177 no 7 pp 1788ndash1796 1995
[42] KWuN Li J Yan et al ldquoGenome sequencing and comparativeanalysis of Klebsiella pneumoniae NTUH-K2044 a strain caus-ing liver abscess and meningitisrdquo Journal of Bacteriology vol191 no 14 pp 4492ndash4501 2009
[43] H N Yeowell and J R White ldquoIron requirement in thebactericidal mechanism of streptonigrinrdquo Antimicrobial Agentsand Chemotherapy vol 22 no 6 pp 961ndash968 1982
[44] Y Keynan and E Rubinstein ldquoThe changing face of Klebsiellapneumoniae infections in the communityrdquo International Journalof Antimicrobial Agents vol 30 no 5 pp 385ndash389 2007
[45] R Colodner R Raz B Chazan and W Sakran ldquoSusceptibilitypattern of extended-spectrum 120573-lactamase producing bacteriaisolated from inpatients to five antimicrobial drugs in a com-munity hospital in Northern Israelrdquo International Journal ofAntimicrobial Agents vol 24 no 4 pp 409ndash410 2004
[46] E B Hirsch and V H Tam ldquoDetection and treatment optionsfor Klebsiella pneumoniae carbapenemases (KPCs) an emerg-ing cause of multidrug-resistant infectionrdquo Journal of Antimi-crobial Chemotherapy vol 65 no 6 pp 1119ndash1125 2010
[47] K K Kumarasamy M A Toleman T R Walsh et al ldquoEmer-gence of a new antibiotic resistance mechanism in India Pak-istan and the UK a molecular biological and epidemiologicalstudyrdquoThe Lancet Infectious Diseases vol 10 no 9 pp 597ndash6022010
[48] P Nordmann G Cuzon and T Naas ldquoThe real threat ofKlebsiella pneumoniae carbapenemase-producing bacteriardquoTheLancet Infectious Diseases vol 9 no 4 pp 228ndash236 2009
[49] D Yong M A Toleman C G Giske et al ldquoCharacterizationof a new metallo-120573-lactamase gene bla NDM-1 and a novelerythromycin esterase gene carried on a unique genetic struc-ture in Klebsiella pneumoniae sequence type 14 from IndiardquoAntimicrobial Agents and Chemotherapy vol 53 no 12 pp5046ndash5054 2009
[50] V Regueiro M A Campos J Pons S Albertı and J ABengoechea ldquoThe uptake of a Klebsiella pneumoniae capsulepolysaccharide mutant triggers an inflammatory response byhuman airway epithelial cellsrdquoMicrobiology vol 152 part 2 pp555ndash566 2006
[51] X Nassif N Honore T Vasselon S T Cole and P J SansonettildquoPositive control of colanic acid synthesis in Escherichia coliby rmpA and rmpB two virulence-plasmid genes of Klebsiellapneumoniaerdquo Molecular Microbiology vol 3 no 10 pp 1349ndash1359 1989
[52] X Nassif and P J Sansonetti ldquoCorrelation of the virulence ofKlebsiella pneumoniaeK1 and K2 with the presence of a plasmid
encoding aerobactinrdquo Infection and Immunity vol 54 no 3 pp603ndash608 1986
[53] K Mizuta M Ohta and M Mori ldquoVirulence for mice ofKlebsiella strains belonging to the O1 group relationship totheir capsular (K) typesrdquo Infection and Immunity vol 40 no1 pp 56ndash61 1983
[54] I Ofek K Kabha A Athamna et al ldquoGenetic exchange ofdeterminants for capsular polysaccharide biosynthesis betweenKlebsiella pneumoniae strains expressing serotypes K2 andK21ardquo Infection and Immunity vol 61 no 10 pp 4208ndash42161993
[55] A M Simoons-Smit A M J J Verwey-van Vught I Y RKanis and D M MacLaren ldquoVirulence of Klebsiella strains inexperimentally induced skin lesions in the mouserdquo Journal ofMedical Microbiology vol 17 no 1 pp 67ndash77 1984
[56] C Lee H Leu T Wu L Su and J Liu ldquoRisk factors for sponta-neous rupture of liver abscess caused byKlebsiella pneumoniaerdquoDiagnosticMicrobiology and Infectious Disease vol 52 no 2 pp79ndash84 2005
[57] C De Champs M P Sauvant C Chanal et al ldquoProspectivesurvey of colonization and infection caused by expanded-spectrum-120573-lactamase-producing members of the familyEnterobacteriaceae in an intensive care unitrdquo Journal of ClinicalMicrobiology vol 27 no 12 pp 2887ndash2890 1989
[58] S MMarkowitz J M Veazey Jr and F L Macrina ldquoSequentialoutbreaks of infection due to Klebsiella pneumoniae in a neona-tal intensive care unit implication of a conjugative R plasmidrdquoJournal of Infectious Diseases vol 142 no 1 pp 106ndash112 1980
[59] A M Stock V L Robinson and P N Goudreau ldquoTwo-component signal transductionrdquo Annual Review of Biochem-istry vol 69 pp 183ndash215 2000
[60] C Fuqua and E P Greenberg ldquoSelf perception in bacteriaquorum sensing with acylated homoserine lactonesrdquo CurrentOpinion in Microbiology vol 1 no 2 pp 183ndash189 1998
[61] P Romby F Vandenesch and E G H Wagner ldquoThe role ofRNAs in the regulation of virulence-gene expressionrdquo CurrentOpinion in Microbiology vol 9 no 2 pp 229ndash236 2006
[62] B L Bassler ldquoHow bacteria talk to each other regulationof gene expression by quorum sensingrdquo Current Opinion inMicrobiology vol 2 no 6 pp 582ndash587 1999
[63] H Y Cheng Y S Chen C YWu H Y Chang Y C Lai andHL Peng ldquoRmpA regulation of capsular polysaccharide biosyn-thesis in Klebsiella pneumoniae CG43rdquo Journal of Bacteriologyvol 192 no 12 pp 3144ndash3158 2010
[64] D Touati ldquoIron and oxidative stress in bacteriardquo Archives ofBiochemistry and Biophysics vol 373 no 1 pp 1ndash6 2000
8 Evidence-Based Complementary and Alternative Medicine
hand we also found that heat inactivated serum did nothave obvious bactericidal effects on K pneumoniae (data notshown) suggesting an importance of the complement system
Both prokaryotic and eukaryotic cells in natural envi-ronments are constantly challenged by various environ-mental stresses K pneumoniae like many gastrointestinalpathogens needs to penetrate the gastric acid barrier facethe challenge of the immune system and cope with thelimited supply of oxygen and nutrition to effect colonizationand infection [57 58] Therefore bacteria activate or repressthe expression of virulence genes to adapt to environmentalstimuli [59ndash62] In K pneumoniae CPS biosynthesis isregulated by multiple environmental stimuli and proteinregulators Our previous studies have shown that ferricions can repress K pneumoniae CPS production throughFur regulation [18 63] Under iron-repletion conditionsFur-Fe(II) can tightly repress cps transcription resulting inlowered CPS production in K pneumoniae [18] To furtherinvestigate how Fructus mume reduces CPS levels in Kpneumoniae we performed qRT-PCR analyses and foundthat CPS reduction was regulated at the transcriptionallevel (Figure 4) All 3 transcripts of K1 or K2 cps geneswere obviously downregulated especially orf1orf11015840 encodingGalF a putative UDP-glucose pyrophosphatase (Figure 4)In addition the streptonigrin sensitivity assay also indicatedthat Fructus mume could increase the intracellular iron levelsofK pneumoniae (Figure 5) implying that ferric iron and Furparticipate in Fructus mume-mediated CPS reduction Ironis essential to most bacteria for growth and reproductionbut iron overloading would lead to the formation of unde-sired reactive oxygen species (ROS) by the Fenton reactionto damage DNA or other biological macromolecules [64]Although how Fructus mume affects bacterial iron-uptakeremains unknown the increase in intracellular iron leadingto the formation of undesired ROS may account for part ofits bactericidal activity
The ingredients of Prunus mume extract are organicacids including citric acid (the main ingredient) tartaricacid oxalic acid and other unknown components [35 36]Although the acidic components of Prunus mume showedsome antibacterial activity it is less compared to that ofthe original extract implying that other active componentspossess considerable antibacterial activity [36] As seen inFigure 6 we also showed that citric acid could inhibit growthand CPS production in K pneumoniae The acidic propertymay be one of the antibacterialmechanisms of Fructusmumehowever there should be other active components since LBbroth supplemented with 20mgmL Fructus mume pHsim36 has stronger bactericidal activity than LB broth adjustedto pH 35 using HCl (data not shown) For future clinicalapplication more studies are required to determine the activecomponents of Fructus mume and its mechanism of action
5 Conclusion
To our knowledge this study is the first to report theantibacterial activity of Fructus mume against highly virulentK pneumoniae isolates Moreover we found that Fructus
mume reduced K pneumoniae CPS biosynthesis at thetranscriptional level possibly by regulating the intracellulariron concentration of the bacteria thereby helping the hostimmune system eliminate the pathogen
Conflict of Interests
The authors declare no conflict of interests in this work
Authorsrsquo Contribution
T-H Lin S-H Huang and C-C Wu contributed equally tothis work
Acknowledgments
The authors thank Professor Hwei-Ling Peng from NationalChiao Tung University Taiwan for providing theK pneumo-niae CG43S3 and Dr Jin-Town Wang from National TaiwanUniversity Hospital for providing K pneumoniae NTUH-K2044 The authors thank Yi-Ming Hong and Jing-Ciao Linfor their technical assistance during the study The workis supported by the Grants from National Science Council(NSC 99-2320-B-039-002-MY3) China Medical University(CMU98-ASIA-01) and Buddhist Tzu Chi general hospital(TTCRD101-17)
References
[1] F Chou and H Kou ldquoEndogenous endophthalmitis associatedwith pyogenic hepatic abscessrdquo Journal of the American Collegeof Surgeons vol 182 no 1 pp 33ndash36 1996
[2] S-H B Han ldquoReview of hepatic abscess from Klebsiellapneumoniaemdashan association with diabetes mellitus and septicendophthalmitisrdquo Western Journal of Medicine vol 162 no 3pp 220ndash224 1995
[3] Y Lau B Hu W Wu Y Lin H Chang and Z Shi ldquoIden-tification of a major cluster of Klebsiella pneumoniae isolatesfrom patients with liver abscess in Taiwanrdquo Journal of ClinicalMicrobiology vol 38 no 1 pp 412ndash414 2000
[4] H L Peng P Y Wang J L Wu C T Chiu and H Y ChangldquoMolecular epidemiology of Klebsiella pneumoniaerdquo ZhonghuaMin GuoWei ShengWu Ji Mian Yi Xue Za Zhi vol 24 no 3 pp264ndash271 1991
[5] Y Yang L K Siu K Yeh et al ldquoRecurrent Klebsiella pneumo-niae liver abscess clinical and microbiological characteristicsrdquoJournal of Clinical Microbiology vol 47 no 10 pp 3336ndash33392009
[6] L K Siu K M Yeh J C Lin C P Fung and F Y ChangldquoKlebsiella pneumoniae liver abscess a new invasive syndromerdquoThe Lancet Infectious Diseases vol 12 no 11 pp 881ndash887 2012
[7] E R Lederman and N F Crum ldquoPyogenic liver abscess witha focus on Klebsiella pneumoniae as a primary pathogen anemerging disease with unique clinical characteristicsrdquo Amer-ican Journal of Gastroenterology vol 100 no 2 pp 322ndash3312005
[8] H Sahly R Podschun T A Oelschlaeger et al ldquoCapsuleimpedes adhesion to and invasion of epithelial cells byKlebsiellapneumoniaerdquo Infection and Immunity vol 68 no 12 pp 6744ndash6749 2000
Evidence-Based Complementary and Alternative Medicine 9
[9] C Fung B Hu F Chang et al ldquoA 5-year study of the ser-oepidemiology of Klebsiella pneumoniae high prevalence ofcapsular serotype K1 in Taiwan and implication for vaccineefficacyrdquo Journal of Infectious Diseases vol 181 no 6 pp 2075ndash2079 2000
[10] Y Pan H Fang H Yang et al ldquoCapsular polysaccharide syn-thesis regions in Klebsiella pneumoniae serotype K57 and a newcapsular serotyperdquo Journal of Clinical Microbiology vol 46 no7 pp 2231ndash2240 2008
[11] C-P Fung F-Y Chang S-C Lee et al ldquoA global emergingdisease of Klebsiella pneumoniae liver abscess is serotype K1 animportant factor for complicated endophthalmitisrdquo Gut vol50 no 3 pp 420ndash424 2002
[12] D L Paterson ldquoResistance in gram-negative bacteria enter-obacteriaceaerdquo American Journal of Medicine vol 119 supple-ment 1 no 6 pp S20ndashS28 S60ndashS70 2006
[13] C Lin T Huang W Liang and H Peng ldquoHomologousresponse regulators KvgA KvhA and KvhR regulate the synthe-sis of capsular polysaccharide inKlebsiella pneumoniaeCG43 ina coordinated mannerrdquo Journal of Biochemistry vol 140 no 3pp 429ndash438 2006
[14] N Majdalani and S Gottesman ldquoThe Rcs phosphorelay acomplex signal transduction systemrdquo Annual Review of Micro-biology vol 59 pp 379ndash405 2005
[15] S Gottesman and V Stout ldquoRegulation of capsular polysaccha-ride synthesis in Escherichia coli K12rdquo Molecular Microbiologyvol 5 no 7 pp 1599ndash1606 1991
[16] V Stout ldquoRegulation of capsule synthesis includes interactionsof the RcsCRcsB regulatory pairrdquoResearch inMicrobiology vol145 no 5-6 pp 389ndash392 1994
[17] C T Lin Y C Chen T R Jinn C C Wu Y M Hong andW H Wu ldquoRole of the cAMP-dependent carbon cataboliterepression in capsular polysaccharide biosynthesis in Klebsiellapneumoniaerdquo PLoS ONE vol 8 no 2 Article ID e54430 2013
[18] C Lin C Wu Y Chen et al ldquoFur regulation of the capsularpolysaccharide biosynthesis and iron-acquisition systems inKlebsiella pneumoniae CG43rdquoMicrobiology vol 157 part 2 pp419ndash429 2010
[19] D J Hassett P A Sokol M L Howell et al ldquoFerric uptakeregulator (Fur) mutants of Pseudomonas aeruginosa demon-strate defective siderophore-mediated iron uptake altered aer-obic growth and decreased superoxide dismutase and catalaseactivitiesrdquo Journal of Bacteriology vol 178 no 14 pp 3996ndash4003 1996
[20] U A Ochsner and M L Vasil ldquoGene repression by the ferricuptake regulator in Pseudomonas aeruginosa cycle selection ofiron-regulated genesrdquo Proceedings of the National Academy ofSciences of the United States of America vol 93 no 9 pp 4409ndash4414 1996
[21] J J E Bijlsma B Waidner A H M Van Vliet et al ldquoTheHelicobacter pylori homologue of the ferric uptake regulator isinvolved in acid resistancerdquo Infection and Immunity vol 70 no2 pp 606ndash611 2002
[22] A H M van Vliet J Stoof S W Poppelaars et al ldquoDifferentialregulation of amidase- and formamidase-mediated ammoniaproduction by theHelicobacter pylori fur repressorrdquoThe Journalof Biological Chemistry vol 278 no 11 pp 9052ndash9057 2003
[23] M Baga M Goransson S Normark and B E Uhlin ldquoTran-scriptional activation of a pap pilus virulence operon fromuropathogenic Escherichia colirdquo The EMBO Journal vol 4 no13 pp 3887ndash3893 1985
[24] S Lory MWolfgang V Lee and R Smith ldquoThemulti-talentedbacterial adenylate cyclasesrdquo International Journal of MedicalMicrobiology vol 293 no 7-8 pp 479ndash482 2004
[25] K Skorupski and R K Taylor ldquoCyclic AMP and its receptorprotein negatively regulate the coordinate expression of choleratoxin and toxin-coregulated pilus in Vibrio choleraerdquo Proceed-ings of the National Academy of Sciences of the United States ofAmerica vol 94 no 1 pp 265ndash270 1997
[26] S E H West A K Sample and L J Runyen-Janecky ldquoThe vfrgene product required for Pseudomonas aeruginosa exotoxin Aand protease production belongs to the cyclic AMP receptorprotein familyrdquo Journal of Bacteriology vol 176 no 24 pp 7532ndash7542 1994
[27] M Mendez I-H Huang K Ohtani R Grau T Shimizuand M R Sarker ldquoCarbon catabolite repression of type IVpilus-dependent gliding motility in the anaerobic pathogenClostridium perfringensrdquo Journal of Bacteriology vol 190 no 1pp 48ndash60 2008
[28] E J Kalivoda N A Stella D M OrsquoDee G J Nau and R M QShanks ldquoThe cyclic AMP-dependent catabolite repression sys-tem of Serratia marcescensmediates biofilm formation throughregulation of type 1 fimbriaerdquo Applied and EnvironmentalMicrobiology vol 74 no 11 pp 3461ndash3470 2008
[29] C M Muller A Aberg J Straseviciene L Emody B E Uhlinand C Balsalobre ldquoType 1 fimbriae a colonization factor ofuropathogenic Escherichia coli are controlled by the metabolicsensor CRP-cAMPrdquo PLoS Pathogens vol 5 no 2 Article IDe1000303 2009
[30] E L Fuchs E D Brutinel E R Klem A R Fehr T L Yahrand M C Wolfgang ldquoIn vitro and in vivo characterization ofthe Pseudomonas aeruginosa cyclic AMP (cAMP) phosphodi-esterase CpdA required for cAMP homeostasis and virulencefactor regulationrdquo Journal of Bacteriology vol 192 no 11 pp2779ndash2790 2010
[31] T Endoh and J N Engel ldquoCbpA a polarly localized novel cyclicAMP-binding protein in Pseudomonas aeruginosardquo Journal ofBacteriology vol 191 no 23 pp 7193ndash7205 2009
[32] N A Stella E J Kalivoda D M OrsquoDee G J Nau and R M QShanks ldquoCatabolite repression control of flagellum productionby Serratia marcescensrdquo Research in Microbiology vol 159 no7-8 pp 562ndash568 2008
[33] S Enomoto K Yanaoka H Utsunomiya et al ldquoInhibitoryeffects of Japanese apricot (Prunus mume Siebold et ZuccUme) onHelicobacter pylori-related chronic gastritisrdquo EuropeanJournal of Clinical Nutrition vol 64 no 7 pp 714ndash719 2010
[34] R W K Wong U Hagg L Samaranayake M K Z Yuen CJ Seneviratne and R Kao ldquoAntimicrobial activity of Chinesemedicine herbs against common bacteria in oral biofilmA pilotstudyrdquo International Journal of Oral and Maxillofacial Surgeryvol 39 no 6 pp 599ndash605 2010
[35] C J Seneviratne R W K Wong U Hagg et al ldquoPrunus mumeextract exhibits antimicrobial activity against pathogenic oralbacteriardquo International Journal of Paediatric Dentistry vol 21no 4 pp 299ndash305 2011
[36] Y Chen RW KWong C J Seneviratne et al ldquoThe antimicro-bial efficacy of Fructus mume extract on orthodontic bracketa monospecies-biofilm model study in vitrordquo Archives of OralBiology vol 56 no 1 pp 16ndash21 2011
[37] Y Lai H Peng and H Chang ldquoRmpA2 an activator ofcapsule biosynthesis in Klebsiella pneumoniae CG43 regulatesK2 cps gene expression at the transcriptional levelrdquo Journal ofBacteriology vol 185 no 3 pp 788ndash800 2003
10 Evidence-Based Complementary and Alternative Medicine
[38] P Domenico S Schwartz and B A Cunha ldquoReduction ofcapsular polysaccharide production inKlebsiella pneumoniae bysodium salicylaterdquo Infection and Immunity vol 57 no 12 pp3778ndash3782 1989
[39] N Blumenkrantz and G A Hansen ldquoNew method for quanti-tative determination of uronic acidsrdquo Analytical Biochemistryvol 54 no 2 pp 484ndash489 1973
[40] J Lin F Chang C Fung et al ldquoHigh prevalence of phagocytic-resistant capsular serotypes of Klebsiella pneumoniae in liverabscessrdquo Microbes and Infection vol 6 no 13 pp 1191ndash11982004
[41] Y Arakawa R Wacharotayankun T Nagatsuka H Ito NKato and M Ohta ldquoGenomic organization of the Klebsiellapneumoniae cps region responsible for serotype K2 capsularpolysaccharide synthesis in the virulent strain chedidrdquo Journalof Bacteriology vol 177 no 7 pp 1788ndash1796 1995
[42] KWuN Li J Yan et al ldquoGenome sequencing and comparativeanalysis of Klebsiella pneumoniae NTUH-K2044 a strain caus-ing liver abscess and meningitisrdquo Journal of Bacteriology vol191 no 14 pp 4492ndash4501 2009
[43] H N Yeowell and J R White ldquoIron requirement in thebactericidal mechanism of streptonigrinrdquo Antimicrobial Agentsand Chemotherapy vol 22 no 6 pp 961ndash968 1982
[44] Y Keynan and E Rubinstein ldquoThe changing face of Klebsiellapneumoniae infections in the communityrdquo International Journalof Antimicrobial Agents vol 30 no 5 pp 385ndash389 2007
[45] R Colodner R Raz B Chazan and W Sakran ldquoSusceptibilitypattern of extended-spectrum 120573-lactamase producing bacteriaisolated from inpatients to five antimicrobial drugs in a com-munity hospital in Northern Israelrdquo International Journal ofAntimicrobial Agents vol 24 no 4 pp 409ndash410 2004
[46] E B Hirsch and V H Tam ldquoDetection and treatment optionsfor Klebsiella pneumoniae carbapenemases (KPCs) an emerg-ing cause of multidrug-resistant infectionrdquo Journal of Antimi-crobial Chemotherapy vol 65 no 6 pp 1119ndash1125 2010
[47] K K Kumarasamy M A Toleman T R Walsh et al ldquoEmer-gence of a new antibiotic resistance mechanism in India Pak-istan and the UK a molecular biological and epidemiologicalstudyrdquoThe Lancet Infectious Diseases vol 10 no 9 pp 597ndash6022010
[48] P Nordmann G Cuzon and T Naas ldquoThe real threat ofKlebsiella pneumoniae carbapenemase-producing bacteriardquoTheLancet Infectious Diseases vol 9 no 4 pp 228ndash236 2009
[49] D Yong M A Toleman C G Giske et al ldquoCharacterizationof a new metallo-120573-lactamase gene bla NDM-1 and a novelerythromycin esterase gene carried on a unique genetic struc-ture in Klebsiella pneumoniae sequence type 14 from IndiardquoAntimicrobial Agents and Chemotherapy vol 53 no 12 pp5046ndash5054 2009
[50] V Regueiro M A Campos J Pons S Albertı and J ABengoechea ldquoThe uptake of a Klebsiella pneumoniae capsulepolysaccharide mutant triggers an inflammatory response byhuman airway epithelial cellsrdquoMicrobiology vol 152 part 2 pp555ndash566 2006
[51] X Nassif N Honore T Vasselon S T Cole and P J SansonettildquoPositive control of colanic acid synthesis in Escherichia coliby rmpA and rmpB two virulence-plasmid genes of Klebsiellapneumoniaerdquo Molecular Microbiology vol 3 no 10 pp 1349ndash1359 1989
[52] X Nassif and P J Sansonetti ldquoCorrelation of the virulence ofKlebsiella pneumoniaeK1 and K2 with the presence of a plasmid
encoding aerobactinrdquo Infection and Immunity vol 54 no 3 pp603ndash608 1986
[53] K Mizuta M Ohta and M Mori ldquoVirulence for mice ofKlebsiella strains belonging to the O1 group relationship totheir capsular (K) typesrdquo Infection and Immunity vol 40 no1 pp 56ndash61 1983
[54] I Ofek K Kabha A Athamna et al ldquoGenetic exchange ofdeterminants for capsular polysaccharide biosynthesis betweenKlebsiella pneumoniae strains expressing serotypes K2 andK21ardquo Infection and Immunity vol 61 no 10 pp 4208ndash42161993
[55] A M Simoons-Smit A M J J Verwey-van Vught I Y RKanis and D M MacLaren ldquoVirulence of Klebsiella strains inexperimentally induced skin lesions in the mouserdquo Journal ofMedical Microbiology vol 17 no 1 pp 67ndash77 1984
[56] C Lee H Leu T Wu L Su and J Liu ldquoRisk factors for sponta-neous rupture of liver abscess caused byKlebsiella pneumoniaerdquoDiagnosticMicrobiology and Infectious Disease vol 52 no 2 pp79ndash84 2005
[57] C De Champs M P Sauvant C Chanal et al ldquoProspectivesurvey of colonization and infection caused by expanded-spectrum-120573-lactamase-producing members of the familyEnterobacteriaceae in an intensive care unitrdquo Journal of ClinicalMicrobiology vol 27 no 12 pp 2887ndash2890 1989
[58] S MMarkowitz J M Veazey Jr and F L Macrina ldquoSequentialoutbreaks of infection due to Klebsiella pneumoniae in a neona-tal intensive care unit implication of a conjugative R plasmidrdquoJournal of Infectious Diseases vol 142 no 1 pp 106ndash112 1980
[59] A M Stock V L Robinson and P N Goudreau ldquoTwo-component signal transductionrdquo Annual Review of Biochem-istry vol 69 pp 183ndash215 2000
[60] C Fuqua and E P Greenberg ldquoSelf perception in bacteriaquorum sensing with acylated homoserine lactonesrdquo CurrentOpinion in Microbiology vol 1 no 2 pp 183ndash189 1998
[61] P Romby F Vandenesch and E G H Wagner ldquoThe role ofRNAs in the regulation of virulence-gene expressionrdquo CurrentOpinion in Microbiology vol 9 no 2 pp 229ndash236 2006
[62] B L Bassler ldquoHow bacteria talk to each other regulationof gene expression by quorum sensingrdquo Current Opinion inMicrobiology vol 2 no 6 pp 582ndash587 1999
[63] H Y Cheng Y S Chen C YWu H Y Chang Y C Lai andHL Peng ldquoRmpA regulation of capsular polysaccharide biosyn-thesis in Klebsiella pneumoniae CG43rdquo Journal of Bacteriologyvol 192 no 12 pp 3144ndash3158 2010
[64] D Touati ldquoIron and oxidative stress in bacteriardquo Archives ofBiochemistry and Biophysics vol 373 no 1 pp 1ndash6 2000
Evidence-Based Complementary and Alternative Medicine 9
[9] C Fung B Hu F Chang et al ldquoA 5-year study of the ser-oepidemiology of Klebsiella pneumoniae high prevalence ofcapsular serotype K1 in Taiwan and implication for vaccineefficacyrdquo Journal of Infectious Diseases vol 181 no 6 pp 2075ndash2079 2000
[10] Y Pan H Fang H Yang et al ldquoCapsular polysaccharide syn-thesis regions in Klebsiella pneumoniae serotype K57 and a newcapsular serotyperdquo Journal of Clinical Microbiology vol 46 no7 pp 2231ndash2240 2008
[11] C-P Fung F-Y Chang S-C Lee et al ldquoA global emergingdisease of Klebsiella pneumoniae liver abscess is serotype K1 animportant factor for complicated endophthalmitisrdquo Gut vol50 no 3 pp 420ndash424 2002
[12] D L Paterson ldquoResistance in gram-negative bacteria enter-obacteriaceaerdquo American Journal of Medicine vol 119 supple-ment 1 no 6 pp S20ndashS28 S60ndashS70 2006
[13] C Lin T Huang W Liang and H Peng ldquoHomologousresponse regulators KvgA KvhA and KvhR regulate the synthe-sis of capsular polysaccharide inKlebsiella pneumoniaeCG43 ina coordinated mannerrdquo Journal of Biochemistry vol 140 no 3pp 429ndash438 2006
[14] N Majdalani and S Gottesman ldquoThe Rcs phosphorelay acomplex signal transduction systemrdquo Annual Review of Micro-biology vol 59 pp 379ndash405 2005
[15] S Gottesman and V Stout ldquoRegulation of capsular polysaccha-ride synthesis in Escherichia coli K12rdquo Molecular Microbiologyvol 5 no 7 pp 1599ndash1606 1991
[16] V Stout ldquoRegulation of capsule synthesis includes interactionsof the RcsCRcsB regulatory pairrdquoResearch inMicrobiology vol145 no 5-6 pp 389ndash392 1994
[17] C T Lin Y C Chen T R Jinn C C Wu Y M Hong andW H Wu ldquoRole of the cAMP-dependent carbon cataboliterepression in capsular polysaccharide biosynthesis in Klebsiellapneumoniaerdquo PLoS ONE vol 8 no 2 Article ID e54430 2013
[18] C Lin C Wu Y Chen et al ldquoFur regulation of the capsularpolysaccharide biosynthesis and iron-acquisition systems inKlebsiella pneumoniae CG43rdquoMicrobiology vol 157 part 2 pp419ndash429 2010
[19] D J Hassett P A Sokol M L Howell et al ldquoFerric uptakeregulator (Fur) mutants of Pseudomonas aeruginosa demon-strate defective siderophore-mediated iron uptake altered aer-obic growth and decreased superoxide dismutase and catalaseactivitiesrdquo Journal of Bacteriology vol 178 no 14 pp 3996ndash4003 1996
[20] U A Ochsner and M L Vasil ldquoGene repression by the ferricuptake regulator in Pseudomonas aeruginosa cycle selection ofiron-regulated genesrdquo Proceedings of the National Academy ofSciences of the United States of America vol 93 no 9 pp 4409ndash4414 1996
[21] J J E Bijlsma B Waidner A H M Van Vliet et al ldquoTheHelicobacter pylori homologue of the ferric uptake regulator isinvolved in acid resistancerdquo Infection and Immunity vol 70 no2 pp 606ndash611 2002
[22] A H M van Vliet J Stoof S W Poppelaars et al ldquoDifferentialregulation of amidase- and formamidase-mediated ammoniaproduction by theHelicobacter pylori fur repressorrdquoThe Journalof Biological Chemistry vol 278 no 11 pp 9052ndash9057 2003
[23] M Baga M Goransson S Normark and B E Uhlin ldquoTran-scriptional activation of a pap pilus virulence operon fromuropathogenic Escherichia colirdquo The EMBO Journal vol 4 no13 pp 3887ndash3893 1985
[24] S Lory MWolfgang V Lee and R Smith ldquoThemulti-talentedbacterial adenylate cyclasesrdquo International Journal of MedicalMicrobiology vol 293 no 7-8 pp 479ndash482 2004
[25] K Skorupski and R K Taylor ldquoCyclic AMP and its receptorprotein negatively regulate the coordinate expression of choleratoxin and toxin-coregulated pilus in Vibrio choleraerdquo Proceed-ings of the National Academy of Sciences of the United States ofAmerica vol 94 no 1 pp 265ndash270 1997
[26] S E H West A K Sample and L J Runyen-Janecky ldquoThe vfrgene product required for Pseudomonas aeruginosa exotoxin Aand protease production belongs to the cyclic AMP receptorprotein familyrdquo Journal of Bacteriology vol 176 no 24 pp 7532ndash7542 1994
[27] M Mendez I-H Huang K Ohtani R Grau T Shimizuand M R Sarker ldquoCarbon catabolite repression of type IVpilus-dependent gliding motility in the anaerobic pathogenClostridium perfringensrdquo Journal of Bacteriology vol 190 no 1pp 48ndash60 2008
[28] E J Kalivoda N A Stella D M OrsquoDee G J Nau and R M QShanks ldquoThe cyclic AMP-dependent catabolite repression sys-tem of Serratia marcescensmediates biofilm formation throughregulation of type 1 fimbriaerdquo Applied and EnvironmentalMicrobiology vol 74 no 11 pp 3461ndash3470 2008
[29] C M Muller A Aberg J Straseviciene L Emody B E Uhlinand C Balsalobre ldquoType 1 fimbriae a colonization factor ofuropathogenic Escherichia coli are controlled by the metabolicsensor CRP-cAMPrdquo PLoS Pathogens vol 5 no 2 Article IDe1000303 2009
[30] E L Fuchs E D Brutinel E R Klem A R Fehr T L Yahrand M C Wolfgang ldquoIn vitro and in vivo characterization ofthe Pseudomonas aeruginosa cyclic AMP (cAMP) phosphodi-esterase CpdA required for cAMP homeostasis and virulencefactor regulationrdquo Journal of Bacteriology vol 192 no 11 pp2779ndash2790 2010
[31] T Endoh and J N Engel ldquoCbpA a polarly localized novel cyclicAMP-binding protein in Pseudomonas aeruginosardquo Journal ofBacteriology vol 191 no 23 pp 7193ndash7205 2009
[32] N A Stella E J Kalivoda D M OrsquoDee G J Nau and R M QShanks ldquoCatabolite repression control of flagellum productionby Serratia marcescensrdquo Research in Microbiology vol 159 no7-8 pp 562ndash568 2008
[33] S Enomoto K Yanaoka H Utsunomiya et al ldquoInhibitoryeffects of Japanese apricot (Prunus mume Siebold et ZuccUme) onHelicobacter pylori-related chronic gastritisrdquo EuropeanJournal of Clinical Nutrition vol 64 no 7 pp 714ndash719 2010
[34] R W K Wong U Hagg L Samaranayake M K Z Yuen CJ Seneviratne and R Kao ldquoAntimicrobial activity of Chinesemedicine herbs against common bacteria in oral biofilmA pilotstudyrdquo International Journal of Oral and Maxillofacial Surgeryvol 39 no 6 pp 599ndash605 2010
[35] C J Seneviratne R W K Wong U Hagg et al ldquoPrunus mumeextract exhibits antimicrobial activity against pathogenic oralbacteriardquo International Journal of Paediatric Dentistry vol 21no 4 pp 299ndash305 2011
[36] Y Chen RW KWong C J Seneviratne et al ldquoThe antimicro-bial efficacy of Fructus mume extract on orthodontic bracketa monospecies-biofilm model study in vitrordquo Archives of OralBiology vol 56 no 1 pp 16ndash21 2011
[37] Y Lai H Peng and H Chang ldquoRmpA2 an activator ofcapsule biosynthesis in Klebsiella pneumoniae CG43 regulatesK2 cps gene expression at the transcriptional levelrdquo Journal ofBacteriology vol 185 no 3 pp 788ndash800 2003
10 Evidence-Based Complementary and Alternative Medicine
[38] P Domenico S Schwartz and B A Cunha ldquoReduction ofcapsular polysaccharide production inKlebsiella pneumoniae bysodium salicylaterdquo Infection and Immunity vol 57 no 12 pp3778ndash3782 1989
[39] N Blumenkrantz and G A Hansen ldquoNew method for quanti-tative determination of uronic acidsrdquo Analytical Biochemistryvol 54 no 2 pp 484ndash489 1973
[40] J Lin F Chang C Fung et al ldquoHigh prevalence of phagocytic-resistant capsular serotypes of Klebsiella pneumoniae in liverabscessrdquo Microbes and Infection vol 6 no 13 pp 1191ndash11982004
[41] Y Arakawa R Wacharotayankun T Nagatsuka H Ito NKato and M Ohta ldquoGenomic organization of the Klebsiellapneumoniae cps region responsible for serotype K2 capsularpolysaccharide synthesis in the virulent strain chedidrdquo Journalof Bacteriology vol 177 no 7 pp 1788ndash1796 1995
[42] KWuN Li J Yan et al ldquoGenome sequencing and comparativeanalysis of Klebsiella pneumoniae NTUH-K2044 a strain caus-ing liver abscess and meningitisrdquo Journal of Bacteriology vol191 no 14 pp 4492ndash4501 2009
[43] H N Yeowell and J R White ldquoIron requirement in thebactericidal mechanism of streptonigrinrdquo Antimicrobial Agentsand Chemotherapy vol 22 no 6 pp 961ndash968 1982
[44] Y Keynan and E Rubinstein ldquoThe changing face of Klebsiellapneumoniae infections in the communityrdquo International Journalof Antimicrobial Agents vol 30 no 5 pp 385ndash389 2007
[45] R Colodner R Raz B Chazan and W Sakran ldquoSusceptibilitypattern of extended-spectrum 120573-lactamase producing bacteriaisolated from inpatients to five antimicrobial drugs in a com-munity hospital in Northern Israelrdquo International Journal ofAntimicrobial Agents vol 24 no 4 pp 409ndash410 2004
[46] E B Hirsch and V H Tam ldquoDetection and treatment optionsfor Klebsiella pneumoniae carbapenemases (KPCs) an emerg-ing cause of multidrug-resistant infectionrdquo Journal of Antimi-crobial Chemotherapy vol 65 no 6 pp 1119ndash1125 2010
[47] K K Kumarasamy M A Toleman T R Walsh et al ldquoEmer-gence of a new antibiotic resistance mechanism in India Pak-istan and the UK a molecular biological and epidemiologicalstudyrdquoThe Lancet Infectious Diseases vol 10 no 9 pp 597ndash6022010
[48] P Nordmann G Cuzon and T Naas ldquoThe real threat ofKlebsiella pneumoniae carbapenemase-producing bacteriardquoTheLancet Infectious Diseases vol 9 no 4 pp 228ndash236 2009
[49] D Yong M A Toleman C G Giske et al ldquoCharacterizationof a new metallo-120573-lactamase gene bla NDM-1 and a novelerythromycin esterase gene carried on a unique genetic struc-ture in Klebsiella pneumoniae sequence type 14 from IndiardquoAntimicrobial Agents and Chemotherapy vol 53 no 12 pp5046ndash5054 2009
[50] V Regueiro M A Campos J Pons S Albertı and J ABengoechea ldquoThe uptake of a Klebsiella pneumoniae capsulepolysaccharide mutant triggers an inflammatory response byhuman airway epithelial cellsrdquoMicrobiology vol 152 part 2 pp555ndash566 2006
[51] X Nassif N Honore T Vasselon S T Cole and P J SansonettildquoPositive control of colanic acid synthesis in Escherichia coliby rmpA and rmpB two virulence-plasmid genes of Klebsiellapneumoniaerdquo Molecular Microbiology vol 3 no 10 pp 1349ndash1359 1989
[52] X Nassif and P J Sansonetti ldquoCorrelation of the virulence ofKlebsiella pneumoniaeK1 and K2 with the presence of a plasmid
encoding aerobactinrdquo Infection and Immunity vol 54 no 3 pp603ndash608 1986
[53] K Mizuta M Ohta and M Mori ldquoVirulence for mice ofKlebsiella strains belonging to the O1 group relationship totheir capsular (K) typesrdquo Infection and Immunity vol 40 no1 pp 56ndash61 1983
[54] I Ofek K Kabha A Athamna et al ldquoGenetic exchange ofdeterminants for capsular polysaccharide biosynthesis betweenKlebsiella pneumoniae strains expressing serotypes K2 andK21ardquo Infection and Immunity vol 61 no 10 pp 4208ndash42161993
[55] A M Simoons-Smit A M J J Verwey-van Vught I Y RKanis and D M MacLaren ldquoVirulence of Klebsiella strains inexperimentally induced skin lesions in the mouserdquo Journal ofMedical Microbiology vol 17 no 1 pp 67ndash77 1984
[56] C Lee H Leu T Wu L Su and J Liu ldquoRisk factors for sponta-neous rupture of liver abscess caused byKlebsiella pneumoniaerdquoDiagnosticMicrobiology and Infectious Disease vol 52 no 2 pp79ndash84 2005
[57] C De Champs M P Sauvant C Chanal et al ldquoProspectivesurvey of colonization and infection caused by expanded-spectrum-120573-lactamase-producing members of the familyEnterobacteriaceae in an intensive care unitrdquo Journal of ClinicalMicrobiology vol 27 no 12 pp 2887ndash2890 1989
[58] S MMarkowitz J M Veazey Jr and F L Macrina ldquoSequentialoutbreaks of infection due to Klebsiella pneumoniae in a neona-tal intensive care unit implication of a conjugative R plasmidrdquoJournal of Infectious Diseases vol 142 no 1 pp 106ndash112 1980
[59] A M Stock V L Robinson and P N Goudreau ldquoTwo-component signal transductionrdquo Annual Review of Biochem-istry vol 69 pp 183ndash215 2000
[60] C Fuqua and E P Greenberg ldquoSelf perception in bacteriaquorum sensing with acylated homoserine lactonesrdquo CurrentOpinion in Microbiology vol 1 no 2 pp 183ndash189 1998
[61] P Romby F Vandenesch and E G H Wagner ldquoThe role ofRNAs in the regulation of virulence-gene expressionrdquo CurrentOpinion in Microbiology vol 9 no 2 pp 229ndash236 2006
[62] B L Bassler ldquoHow bacteria talk to each other regulationof gene expression by quorum sensingrdquo Current Opinion inMicrobiology vol 2 no 6 pp 582ndash587 1999
[63] H Y Cheng Y S Chen C YWu H Y Chang Y C Lai andHL Peng ldquoRmpA regulation of capsular polysaccharide biosyn-thesis in Klebsiella pneumoniae CG43rdquo Journal of Bacteriologyvol 192 no 12 pp 3144ndash3158 2010
[64] D Touati ldquoIron and oxidative stress in bacteriardquo Archives ofBiochemistry and Biophysics vol 373 no 1 pp 1ndash6 2000
10 Evidence-Based Complementary and Alternative Medicine
[38] P Domenico S Schwartz and B A Cunha ldquoReduction ofcapsular polysaccharide production inKlebsiella pneumoniae bysodium salicylaterdquo Infection and Immunity vol 57 no 12 pp3778ndash3782 1989
[39] N Blumenkrantz and G A Hansen ldquoNew method for quanti-tative determination of uronic acidsrdquo Analytical Biochemistryvol 54 no 2 pp 484ndash489 1973
[40] J Lin F Chang C Fung et al ldquoHigh prevalence of phagocytic-resistant capsular serotypes of Klebsiella pneumoniae in liverabscessrdquo Microbes and Infection vol 6 no 13 pp 1191ndash11982004
[41] Y Arakawa R Wacharotayankun T Nagatsuka H Ito NKato and M Ohta ldquoGenomic organization of the Klebsiellapneumoniae cps region responsible for serotype K2 capsularpolysaccharide synthesis in the virulent strain chedidrdquo Journalof Bacteriology vol 177 no 7 pp 1788ndash1796 1995
[42] KWuN Li J Yan et al ldquoGenome sequencing and comparativeanalysis of Klebsiella pneumoniae NTUH-K2044 a strain caus-ing liver abscess and meningitisrdquo Journal of Bacteriology vol191 no 14 pp 4492ndash4501 2009
[43] H N Yeowell and J R White ldquoIron requirement in thebactericidal mechanism of streptonigrinrdquo Antimicrobial Agentsand Chemotherapy vol 22 no 6 pp 961ndash968 1982
[44] Y Keynan and E Rubinstein ldquoThe changing face of Klebsiellapneumoniae infections in the communityrdquo International Journalof Antimicrobial Agents vol 30 no 5 pp 385ndash389 2007
[45] R Colodner R Raz B Chazan and W Sakran ldquoSusceptibilitypattern of extended-spectrum 120573-lactamase producing bacteriaisolated from inpatients to five antimicrobial drugs in a com-munity hospital in Northern Israelrdquo International Journal ofAntimicrobial Agents vol 24 no 4 pp 409ndash410 2004
[46] E B Hirsch and V H Tam ldquoDetection and treatment optionsfor Klebsiella pneumoniae carbapenemases (KPCs) an emerg-ing cause of multidrug-resistant infectionrdquo Journal of Antimi-crobial Chemotherapy vol 65 no 6 pp 1119ndash1125 2010
[47] K K Kumarasamy M A Toleman T R Walsh et al ldquoEmer-gence of a new antibiotic resistance mechanism in India Pak-istan and the UK a molecular biological and epidemiologicalstudyrdquoThe Lancet Infectious Diseases vol 10 no 9 pp 597ndash6022010
[48] P Nordmann G Cuzon and T Naas ldquoThe real threat ofKlebsiella pneumoniae carbapenemase-producing bacteriardquoTheLancet Infectious Diseases vol 9 no 4 pp 228ndash236 2009
[49] D Yong M A Toleman C G Giske et al ldquoCharacterizationof a new metallo-120573-lactamase gene bla NDM-1 and a novelerythromycin esterase gene carried on a unique genetic struc-ture in Klebsiella pneumoniae sequence type 14 from IndiardquoAntimicrobial Agents and Chemotherapy vol 53 no 12 pp5046ndash5054 2009
[50] V Regueiro M A Campos J Pons S Albertı and J ABengoechea ldquoThe uptake of a Klebsiella pneumoniae capsulepolysaccharide mutant triggers an inflammatory response byhuman airway epithelial cellsrdquoMicrobiology vol 152 part 2 pp555ndash566 2006
[51] X Nassif N Honore T Vasselon S T Cole and P J SansonettildquoPositive control of colanic acid synthesis in Escherichia coliby rmpA and rmpB two virulence-plasmid genes of Klebsiellapneumoniaerdquo Molecular Microbiology vol 3 no 10 pp 1349ndash1359 1989
[52] X Nassif and P J Sansonetti ldquoCorrelation of the virulence ofKlebsiella pneumoniaeK1 and K2 with the presence of a plasmid
encoding aerobactinrdquo Infection and Immunity vol 54 no 3 pp603ndash608 1986
[53] K Mizuta M Ohta and M Mori ldquoVirulence for mice ofKlebsiella strains belonging to the O1 group relationship totheir capsular (K) typesrdquo Infection and Immunity vol 40 no1 pp 56ndash61 1983
[54] I Ofek K Kabha A Athamna et al ldquoGenetic exchange ofdeterminants for capsular polysaccharide biosynthesis betweenKlebsiella pneumoniae strains expressing serotypes K2 andK21ardquo Infection and Immunity vol 61 no 10 pp 4208ndash42161993
[55] A M Simoons-Smit A M J J Verwey-van Vught I Y RKanis and D M MacLaren ldquoVirulence of Klebsiella strains inexperimentally induced skin lesions in the mouserdquo Journal ofMedical Microbiology vol 17 no 1 pp 67ndash77 1984
[56] C Lee H Leu T Wu L Su and J Liu ldquoRisk factors for sponta-neous rupture of liver abscess caused byKlebsiella pneumoniaerdquoDiagnosticMicrobiology and Infectious Disease vol 52 no 2 pp79ndash84 2005
[57] C De Champs M P Sauvant C Chanal et al ldquoProspectivesurvey of colonization and infection caused by expanded-spectrum-120573-lactamase-producing members of the familyEnterobacteriaceae in an intensive care unitrdquo Journal of ClinicalMicrobiology vol 27 no 12 pp 2887ndash2890 1989
[58] S MMarkowitz J M Veazey Jr and F L Macrina ldquoSequentialoutbreaks of infection due to Klebsiella pneumoniae in a neona-tal intensive care unit implication of a conjugative R plasmidrdquoJournal of Infectious Diseases vol 142 no 1 pp 106ndash112 1980
[59] A M Stock V L Robinson and P N Goudreau ldquoTwo-component signal transductionrdquo Annual Review of Biochem-istry vol 69 pp 183ndash215 2000
[60] C Fuqua and E P Greenberg ldquoSelf perception in bacteriaquorum sensing with acylated homoserine lactonesrdquo CurrentOpinion in Microbiology vol 1 no 2 pp 183ndash189 1998
[61] P Romby F Vandenesch and E G H Wagner ldquoThe role ofRNAs in the regulation of virulence-gene expressionrdquo CurrentOpinion in Microbiology vol 9 no 2 pp 229ndash236 2006
[62] B L Bassler ldquoHow bacteria talk to each other regulationof gene expression by quorum sensingrdquo Current Opinion inMicrobiology vol 2 no 6 pp 582ndash587 1999
[63] H Y Cheng Y S Chen C YWu H Y Chang Y C Lai andHL Peng ldquoRmpA regulation of capsular polysaccharide biosyn-thesis in Klebsiella pneumoniae CG43rdquo Journal of Bacteriologyvol 192 no 12 pp 3144ndash3158 2010
[64] D Touati ldquoIron and oxidative stress in bacteriardquo Archives ofBiochemistry and Biophysics vol 373 no 1 pp 1ndash6 2000
