Research ArticleIsolation and Characterisation of PRSV-P Resistance Genes inCarica and Vasconcellea
M R Razean Haireen12 and R A Drew2
1 Malaysian Agricultural Research and Development Institute Persiaran MARDI-UPM 43400 Serdang Selangor Malaysia2 Griffith University Nathan Campus 170 Kessels Road QLD 4111 Australia
Correspondence should be addressed to M R Razean Haireen aireenmrmardigovmy
Received 24 March 2014 Accepted 20 July 2014 Published 11 August 2014
Academic Editor Ferenc Olasz
Copyright copy 2014 M R Razean Haireen and R A Drew This is an open access article distributed under the Creative CommonsAttribution License which permits unrestricted use distribution and reproduction in any medium provided the original work isproperly cited
Papaya (Carica papaya L) is one of the major tropical fruit crops worldwide but it is limited throughout its range by papayaringspot virus type P (PRSV-P) Previous genetic studies identified a functional PRSV-P resistancemarker in amapping populationof F2plants of Vasconcellea pubescens (resistant to PRSV-P) times Vasconcellea parviflora (susceptible to PRSV-P) and showed that the
marker exhibited homology to a serine threonine protein kinase (STK) gene Full length cDNAs of putative PRSV-P resistance genesdesignated CP STK from C papaya and VP STK1 and VP STK2 from V pubescens were cloned by rapid amplification of cDNAends (RACE) Due to a frame-shift mutation the two homologous sequences are transcribed and edited differently such that thegene product in V pubescens is two separate transcripts whereas in C papaya they are fused into a single message A peroxisomaltargeting signal (PTS2) present in VP STK2 but absent in the other transcripts may be the functional source of PRSV resistance inV pubescens The STK gene fromV pubescensmay have been derived from an alternative splicing to confer resistanceThe putativeresistance gene VP STK2 that was identified in this study is a potential new source of PRSV-P resistance for papaya genotypes
1 Introduction
Papaya ringspot virus type P (PRSV-P) is a devastating dis-ease of papaya that affects tree vigour fruit set and quality [1]Once infected the fruit yield and plantrsquos productive life arereduced from three years to one year or less [2] In AustraliaPRSV-P is considered a serious threat to the Australia papayaindustry even though it has not occurred in the major grow-ing region of North Queensland [3]
Breeding for resistance to PRSV-P in papaya has resultedin tolerant varieties only [4 5] because no resistance toPRSV has been discovered within the Carica genus Inpractical plant breeding programs genes for plant diseaseresistance are frequently identified in noncommercial wildplant relatives and introgressed into commercially acceptablecultivars Introgression of resistance genes from Vasconcel-lea quercifolia to C papaya is an example of intergenerichybridization that has been used to develop partial resistanceto PRSV-P in C papaya [6]
Dillon et al [7] identified a potential functionalsequenced characterised amplified region (SCAR) marker(Opa11 5r) for PRSV-P resistance which collocated withprsv-1 from a mapping population of wild relative of papayaF2V pubescens times V parviflora Dillon [8] characterized the
Opa11 5r marker in six Vasconcellea species (V pubescensV stipulata V goudotiana V cauliflora V parviflora andV quercifolia) as well as in C papaya genotype 2001 Themarker had homology to a serine threonine protein kinase(STK) STK is one of the important proteins responsible fordefence signal transduction related to resistance of a rangeof plant pathogens including viruses and was reported to beinvolved in disease resistance in other crops [9]
Peroxisome targeted protein kinase is suspected to medi-ate signal transduction across the membrane
Proteins destined for peroxisomes are known to besynthesized with a peroxisomal targeting signal (PTS) Thereis two peroxisomal targeting signals PTS1 as a 9-amino acidsequence at the N-terminal of the protein and PTS 2 as atripeptide at the C-terminal
Hindawi Publishing CorporationInternational Journal of GenomicsVolume 2014 Article ID 145403 8 pageshttpdxdoiorg1011552014145403
2 International Journal of Genomics
Table 1 Primer sequence used in RACE-PCR and nested-PCR
Primer Forward-primer Reverse-primer Targeted genesto be amplifiedgsp2 AATCGCCGTAGAGGAGGAGG
In the disease resistance study signal transduction com-prises the transmission of extracellular signals to intracellularresponses An extracellular domain could be required tobind several ligands Ligand binding induces a conformationchange in the extracellular domain which is hypothesizedto result in dimerization and bringing the intracellularkinase domains into close proximity [10] That multifactorbinding event is followed by transmission of secondarysignals through the plasma membrane The accumulation ofintracellular signalling from the receptor causes the inductionof specific phosphorylation cascades Phosphorylation ofprotein kinases can be involved in either direct interactionwith the pathogen or downstream signaling leading to expres-sion of defence-related genes [11]
In studies on plant viruses viral-encoded proteins arereported to suppress plant kinase activity through specificbinding to a kinase domain and enhance the pathogenicityof the virus Protein-protein interaction of AL2 from tomatogolden mosaic virus (TGMV) and L2 from beet curly topvirus (BCTV) is amongst those reported to inhibit sucrosenonfermenting 1- (SNF1-) related kinase activity in plants[12] However signalling through phosphorylation of cellularand virus protein has been shown to modulate symptomsexpression and pathogenicity [13] Protein signalling throughphosphorylation of viral-encoded protein promotes translo-cation of the ribosomal protein to the nucleus where it maynegatively impact virus infection [13]
There has been considerable speculation about the plantcomponent of a gene-for-gene interaction and the products ofnatural resistance genes [14 15] in plant resistance Genomicanalysis and characterization of papayarsquos resistance genes[16] and those of its wild relatives are important to provideadditional sources of resistance for C papaya improvementWe postulated that Opa11 5r marker could be a sequenceregion in a complete STK gene of C papaya and V pubescensand thus important to determine the polymorphism betweenC papaya andV pubescensThis study characterizes the tran-scripts from the orthologous STK genes in PRSV-susceptibleC papaya and PRSV-resistant V pubescens to determinewhether structural differences exist and if so how they mayrelate to the difference in virus disease resistance
2 Materials and Methods
21 Plant Materials C papaya (genotype 2001) and Vpubescens plants were maintained in tissue culture at GriffithUniversity Nathan campus Plants which grew from shoot
tips of plants maintained in tissue-culture were microprop-agated in vitro using methods described by [17] Plantswere incubated under lightdark conditions of 16-hour photoperiod illuminated by white fluorescent lamps and eighthours of darkness at 25∘C plusmn 1∘C
22 First Strand RACE cDNA Synthesis and Amplificationof STK Full Length cDNA from C papaya and V pubescensTotal RNA was extracted from the leaves using a NucleospinRNA plant kit (Macherey-Nagel) according to themanufacturerrsquos protocol The two genes amplified in thisstudy are labelled here as ldquo106rdquo and ldquo105rdquo according to appli-cation of automated gene prediction models to the C papayawhole genome sequence that is available in ftpasgpbmhpcchawaiiedupapaya For synthesis of 51015840-RACEcDNA a 100 ng of total RNA was reverse-transcribed with51015840-RACE CDS primer A and 12 120583M SMARTER II Aoligonucleotide by a 10U SMARTScrib Reverse Transcriptase(Clontech) For synthesis of 31015840-RACE 100 ng of total RNAwas reverse transcribed with 31015840-RACE CDS primer by a 10 USMARTScrib Reverse Transcriptase (Clontech)
The 51015840-RACE and 31015840-RACEPCR reactionwere conductedto amplify the STK106 gene of C papaya and V pubescens inaccordance with the protocol provided by the manufacturerof an Advantage 2 PCR Kit (Clontech) with Universal primerA Mix and 02 120583M gene-specific primer gsp1 and gsp2 in 51015840and 31015840-RACE PCR respectively (Table 1)The PCR procedurewas conducted under the following conditions 4min at 94∘C5 cycles (30 s at 94∘C 3min at 72∘C) 25 cycles (30 s at 94∘C30 s at 60∘C 3min at 72∘C) and 5min at 72∘C
Nested-PCR reaction was performed as a secondaryreaction in cases where the primary PCR failed to givethe distinct band of interest or produced a smear In thisstudy nested-PCR was further performed for STK106 geneamplification fromC papaya andV pubescens using a diluted31015840-RACE-PCRand 51015840-RACE-PCRproductwith gene-specificprimer ngsp2 106 and ngsp1 106 respectively (Table 1)
Similar to STK106 gene the first strand cDNA synthesisand amplification of STK105 gene of C papaya and Vpubescens were conducted in accordance with the protocolprovided by the manufacturer of an Advantage 2 PCR Kit(Clontech) The RACE-PCR procedure was the same asthat described for the STK106 amplification except that thespecific primer gsp1 105 and gsp2 105 was used in 51015840 and31015840-RACE PCR respectively (Table 1) The amplified productof C papaya and V pubescens was purified and clonedinto pCR8GWTOPO vector (Invitrogen) according to the
International Journal of Genomics 3
Table 2 Physicochemical properties of whole protein
manufacturerrsquos protocol Plasmid DNA was extracted usingPureLinkQuick PlasmidMiniprep kit (Invitrogen) accordingto the manufacturerrsquos protocol and sequenced by the dideoxychain termination method of [18] using the BigDye version31 sequencing system (Applied Biosystem) The sequencingproducts of 51015840 and 31015840 RACE were then aligned and assembledto deduce the full length cDNA
23 Characterization of the STK Gene in C papaya andV pubescens Sequence alignments ORF translation andpredicted protein were carried out using Expasy translatetools (httpwebexpasyorgtranslate) Sequences homol-ogy were identified from the sequence database usingBasic Local Alignment Tool [19] supported on the website(httpwwwncbinlmnihgov) of the National Centre forBiotechnology Information (NCBI) Searches for regionslocally similar to nucleotide and protein were initiated usingBLASTn and BLASTx tools respectively
Protein subcellular localization prediction was carriedout using Wolf psort (httpwolfpsortorg) Protein subcel-lular localization prediction was carried out usingWolf psort(httpwolfpsortorg) Transmembrane prediction usingHiddenMarkovModels (TMHMM) in a protein was derivedusing httpwwwcbsdtudkservicesTMHMM-20 A pre-diction of membrane spanning regions and their orientationwas carried out using TMPred (httpwwwchembnetorg)Identification of the protein domains families amp functionalsites and associated patterns amp profiles were carried out usingExpasy-prosite (httpprositeexpasyorg)
3 Results
31 Isolation and Analysis of STK Full Length cDNA ofC papaya The nested-PCR performed using a diluted Cpapaya 31015840-RACE-PCR product with nested universal primer(Clontech) and gene-specific primer ngsp2 106 [8] produceda 1014 bp fragment This fragment was sequenced and usedto design a gene-specific primer ngsp1 106 Nested-PCRwas performed using a diluted C papaya 51015840-RACE-PCRproduct with nested universal primer (Clontech) and gene-specific primer ngsp1 106 produced an 843 bp fragmentThe amplified forward and backward fragments of nested-PCR were cloned and assembled to determine the full lengthcDNA which was named c28106
Alignment of the open reading frame (ORF) to the onlineC papaya ORF (ftpasgpbmhpcchawaiiedupapaya)showed that c28106 was homologous to gene 106 in super-contig 28 (28106) sized 1016 bp and encodes for a serinethreonine protein kinase (STK) gene Nevertheless the
deduced amino acid sequence in c28106 or 28106 revealedno stop codon in the C-terminal region
When aligned 28106 showed a high homology in theupstream coding region of c28106 The downstream regionof c28106 was homologous to an adjacent gene 105 insupercontig 28 28105 (online C papaya ORF ftpasgpbmhpcchawaiiedupapaya) which also encodes for a STKgene Therefore the sequence 28105 was used to designspecific primers gsp2 105 in 31015840-RACE-PCR and gsp1 105 in51015840-RACE-PCR The amplification with universal primer Amix (Clontech) and gene-specific primer gsp2 105 in 31015840-RACE-PCR revealed a 998 bp fragment Amplification withuniversal primer Amix (Clontech) and gene-specific primergsp1 105 in 51015840-RACE-PCR revealed a 480 bp fragment Theamplified forward and backward fragments of RACE-PCRwere cloned and assembled to determine the nucleotidesequence of the full length cDNA which was named c28105The full length sequence (which is verified by the presence ofstart and stop codons) of c28105 showed a 100 similarityin the 31015840 flanking region to c28106 This result suggested thatc28106 and c28105 existed as one gene that encodes for a STKin C papaya rather than being two different genes
The full length cDNA sequence which is characterizedwith polyadenylation signal AATATA in the 31015840 flankingregion at the position 219 nucleotides from the TGA termi-nation signal was determined and designated as CP STKIt has been registered in National Centre for Biotechnol-ogy Information (NCBI) with Accession number KC310466CP STK sized 2520 bp containing a 1617 bp open readingframe (ORF) encodes for 539 amino acids a 51015840-untranslatedregion of 371 bp and a 31015840-untranslated region of 532 bp Thephysicochemical properties of CP STK whole protein areshown in Table 2 BLASTp analysis showed that CP STK hadhomology to STK in other species Glycine max (Accessionnumber XP003547484) Ricinus communis (Accession num-ber XP002514097) and Vitis vinifera (Accession numberXP002279199)
The amino acid sequence analysis showed that CP STKof papaya had a protein kinase domain in the upstreamregion at position 114 to 421 and an AGC kinase C terminaldomain in the downstream region at position 422 to 494Analysis for the transmembrane showed that CP STK didnot have transmembrane helices The protein subcellularlocalization prediction analysis showed that CP STK had anendoplasmic reticulum (ER) signal DKRA which describedthat the protein synthesized by ribosomes remains suspendedin cytosol Rather than that CP STK did not have a secondperoxisomal targeting signal in its sequence to explain that itis not destined for peroxisomes
4 International Journal of Genomics
32 Isolation and Analysis of STK Full Length cDNA of Vpubescens The mRNA transcript region sequences in Vpubescens cDNA clones were confirmedwith the primers thatwere used in C papaya The nested-PCR performed usinga diluted V pubescens 31015840-RACE-PCR with nested universalprimer (Clontech) and gene-specific primer ngsp2 106 [8]produced a 1770 bp fragment The nested-PCR performed bydiluted 51015840-RACE-PCR product with nested universal primer(Clontech) and gene-specific primer ngsp1 106 produceda 1059 bp fragment The amplified forward and backwardfragments of nested-PCR were cloned and assembled toobtain the full length cDNA that was 2524 bp long and wasdesignated as VP STK1 The V pubescens cDNA containeda 921 bp ORF with a 51015840-untranslated region of 587 bp and a31015840-untranslated region of 1016 bp A polyadenylation signalAATATA was present 920 nucleotides from the TGA termi-nation signal
Subsequently the same gene-specific primers as used forC papaya were used in the amplification of gene 28105in V pubescens The amplification with universal primer Amix (Clontech) and gene-specific primer gsp2 105 in 31015840-RACE-PCR revealed a 1601 bp fragment Amplification withuniversal primer Amix (Clontech) and gene-specific primergsp1 105 in 51015840-RACE-PCR revealed a 1059 bp fragment Theamplified forward and backward fragments of RACE-PCRwere cloned and assembled to obtain the full length cDNAwhich was designated as VP STK2 The gene was 1664 bp inlength contained a 582 bp open reading frame that encodedfor 194 amino acids and had a 51015840-untranslated region of389 bp and a 31015840-untranslated region of 693 bp Polyadenyla-tion signal AATATA was present 218 nucleotides from theTGA termination signal The physicochemical properties ofVP STK1 and VP STK2 whole protein are shown in Table 2
The full length cDNA sequence for VP STK1 andVP STK2 was not identical when they were aligned In con-trast to the homologous C papaya gene a stop codon (TAA)was identified at position 1506 to 1508 bp in VP STK1 Thisresulted from one nucleotide deletion at position 1495 bpThegene was predicted to be spliced and encode for two STKgenesThis result confirmed thatVP STK1 andVP STK2wereseparate as adjacent transcripts in V pubescens and differentfrom the orthologous gene in C papaya Both VP STK1and VP STK2 have been registered in NCBI with accessionnumbers KJ489312 and KJ 489313 respectively
VP STK1 and VP STK2 had homology to STK inother species Ricinus communis (Accession numberXP002514097) Glycine max (Accession numberXP003547484) Medicago truncatula (Accession numberXP003595251) and Vitis vinifera (Accession numberXP002279199)
The amino acid sequence analysis revealed a proteinkinase domain in VP STK1 at the amino acid position 109to 306 and an AGC kinase C terminal domain in VP STK2at the amino acid position 74 to 144 TMHMM analysis forthe transmembrane showed that VP STK1 and VP STK2 didnot have transmembrane helices Nevertheless VP STK2 didhave signal peptide putative cleavage site after amino acidposition 13 The protein subcellular localization predictionanalysis showed that VP STK1 had an endoplasmic reticulum
(ER) signal DKRA and did not have a second peroxisomaltargeting signal similar to CP STK By contrast VP STK2 didnot have an endoplasmic reticulum (ER) signal but did havethe second peroxisomal targeting signal (KIVHWRHHL) atamino acid position 22
Alignment of deduced amino acid sequences of CP STKVP STK1 and VP STK2 to the sequences of STK Ricinuscommunis (XP002514097) Glycine max (XP003547484) andVitis vinifera (XP002279199) is shown in Figure 1 Uncon-served to conserved regions are coloured in scale of 0 to 10The amino acid sequences are highly conserved in themiddleregion of the sequence VP STK1 is conserved at the upstreamregionwhileVP STK2 is conserved at the downstream regionwhen compared to the other clones and species
4 Discussion
The upstream coding region of cDNA transcript CP STKfrom papaya genotype 2001 was 100 similar to papayagenomic sequence 28106 Nevertheless CP STK was longerthan 28106 in that the downstream region ofCP STK showedsimilarity to another kinase gene in the C papaya genomesequence 28105 A structural difference is evident betweenthe cDNA and genomic sequences A longer STK gene inC papaya genotype 2001 was expected as no stop codonwas found in the nucleic acid sequence of 28106 available inftpasgpbmhpcchawaiiedupapaya Based on this resulta new STK gene in C papaya has been registered in NCBIunder accession number KC310466
TMHMM analysis for the transmembrane proteinshowed that CP STK VPSTK 1 and VP STK2 did nothave transmembrane helices Nevertheless the amino acidsequence analysis showed that CP STK and VP STK2 had anAGC kinase C terminal domain in the downstream regionThe AGC (cAMP-dependent cGMP-dependent and proteinkinase C) is known as AGC kinase C terminal The AGCin the protein kinase family contains a collection of proteinkinases that display a high degree of sequence similaritywithin their respective kinase domains with phosphorylationsites
Although CP STK and VP STK2 could be phosphory-lated but the presence of signal peptide in VP STK2 targetsit for secretion and a C-terminal extensionThis is supportedby a report on Arabidopsis thaliana that showed the RPP5gene is cytoplasmically localized as it hadno signal peptide ormembrane spanning region in its gene sequence ldquoas reviewedby [20]rdquo
Sequencing of mRNA from the STK gene of the resistantparent V pubescens revealed two discrete transcripts of thesame gene These two transcripts represent the first andlast sections in the STK gene of C papayaR communis(Accession number XM 002514051) which are separated inC papaya by a 20 kb intron Sequence differences betweenthe orthologous genes from C papaya and V pubescenswere expected to encode for a different protein functionand expression These differences may be the reason that Vpubescens is resistant to PRSV-Pwhen compared toC papayathat is susceptible The isolated 106 gene in V pubescens
International Journal of Genomics 5
10 20 30 40 50
- - - - - - M E N Q K V G E S V H V R E E E D D V A V E K E E D H G D V G S S M T L E R V A A A K K
- - - - - - - - - - - - M E N H G E D G R G K G L K E G K G E E E E V M G S S L T M E R V A A A K Q
K D K R A M E N N S C K V V E E K E G E E E E V G P I A V D E E E G Q V G S S L T M E R V A A A K Q
- - - - - M E N K E A E E E Q E E V A G E - - - - - - - - A E E E G E V G S S L T L E R V A A A K L
- - - - - M E N N S C K V V E E K E G E E E E V G P I A V E E E E G E V G S S L T M E R V A A A K Q
Figure 1 Alignment of deduced amino acid sequences of CP STK VP STK1 and VP STK2 with the sequences of STK Ricinus communis(XP002514097) Glycine max (XP003547484) and Vitis vinifera (XP002279199) Unconserved to conserved region is coloured in scale from0 to 10 and shown on the last line in each paragraph
named VP STK1 was orthologous to the STK gene and had9566 similarity to 28106 in C papaya The conservedregion was found mostly at the 51015840-end An ldquoactivation looprdquois located in exon 5 and the start of exon 6 prior to thepremature truncation of the VP STK1 gene Kinase activitycould be increased when a residue on the activation loop
close to the catalytic center is phosphorylated The isolated105 gene named VP STK2 was orthologous to the STK genein C papaya The predicted start of the VP STK2 gene isat a start codon (Met) that truncates six codons from theseventh exon of the C papaya gene This was supported byan alignment result of nucleotide sequences of c28106 of C
International Journal of Genomics 7
papaya with VP STK1 of V pubescens A deletion of one basepair of nucleotides in VP STK1 of V pubescens was observedwhen compared to the sequence in C papaya
Based on supercontig 28 of the C papaya genomesequence there are very large introns in the gene whichwould probably encourage alternative splicing These genesare adjacent in V pubescens and the orthologous gene inC papayaR communis spans both of these V pubescensgenes The VP STK1 gene is predicted to be separated fromVP STK2 because the sequence has a STOP codon in what isotherwise the middle of one of the exons of the C papayaRcommunis gene The predicted end of the VP STK1 geneis a stop codon that is not found in the C papaya or Rcommunis genes truncating 39 bp (13 codons) from the sixthexon
Inside the nucleus splicing takes place in a process calledposttranscription modification before the mRNA can bedecoded by ribosomes to produce a protein whilst in alter-native splicing two or more different mature mRNAs aredecoded by ribosome to produce multiple proteins Alterna-tive splicing predicted in this study is strongly supported bythe result of [8] who found anothermarker Opk4 1r that wasclose to the prsv-1 resistance gene in V pubescens but not inC papaya Opk4 1r has homology to a gene that codes fora small nuclear ribonuclear class of protein (snRNP) whichhas a motif known as a RNA binding domain (RBD) orribonucleoprotein (RNP)This class of proteins is involved inthe posttranscriptional gene expression processes includingmRNA and rRNA Spliceosome a large ribonucleoprotein(RNP) complex that contains small nuclear RNP particlessnRNP and other numerous protein factors including RNAhelicases and protein kinases are involved in the splicingprocess in plants [21 22] Products of alternative splicing aresignificant in cellular functions including signal transduc-tion immunity disease resistance transport regulation anddevelopment [23]
In this study VP STK2 that presumed as a protein var-iants produced by an alternative splicing in V pubescenscould be imported and ultimately resides within peroxisomeas a second peroxisomal targeting signal (PTS2) signal wasfound in the N terminus of VP STK2 but not in CP STK orVP STK1 PTS is a region of the peroxisomal protein thatrecognises and binds to the receptor This is supported by afew peroxisomal membrane proteins such as plant APX anda viral protein that are known to be delivered to peroxisomesvia distinct ER subdomains [24 25] Reference [26] in 2007reported their proteome data that support the functionof plant peroxisomes against pathogens Furthermore theexistence of protein kinases and phosphatases in plant per-oxisomes has been reported by [27] Different from CP STKand VP STK1 their mRNA is presumed to move through thenuclear pore into the cytoplasm and code into a protein Theproteins synthesized by ribosomes then become attached tothe membranes of the endoplasmic reticulum (ER) This issupported by the presence of endoplasmic reticulum (ER)membrane retention signal and the absence of PTS2 signalin both of the proteins
5 Conclusion
The findings in this study confirmed and fully supported thathypothesis of the variations of the gene (from resistant tosusceptible) was due to structural differences of the serinethreonine protein kinase sequence An alternative splicingthat occurs in V pubescens mRNA and the presence of aperoxisomal targeting signal (PTS2) in VP STK2 are hypoth-esised to be an important factor in contributing to the PRSV-P resistance in V pubescens Nevertheless a further biochem-ical analysis and gene transformation studies in the futurewill enable clarification and confirmation of the involvementof VP STK2 in transferring the PRSV-P resistance from Vpubescens to C papaya
Conflict of Interests
The authors declare that there is no conflict of interestsregarding the publication of this paper
Acknowledgments
The authors would like to thank Griffith University andMalaysian Agricultural Research and Development Institutefor the research funding and scholarship provided in thisstudy
References
[1] D Gonsalves ldquoControl of papaya ringspot virus in papaya acase studyrdquo Annual Review of Phytopathology vol 36 pp 415ndash437 1998
[2] R M Manshardt ldquoPapayardquo in Biotechnology of Perennial FruitCrops F A Hammerschlag and and R E Litz Eds pp 489ndash511Cambridge University Press Oxford UK 1992
[3] R A Drew S V Siar C M OrsquoBrien P M Magdalita and AG C Sajise ldquoBreeding for papaya ringspot virus resistance inCarica papaya L via hybridisation with Vasconcellea quercifo-liardquo Australian Journal of Experimental Agriculture vol 46 no3 pp 413ndash418 2006
[4] R A Conover andR E Litz ldquoProgress in breeding papayaswithtolerant to papaya ringspot virusrdquo Proceedings of the FloridaState Horticultural Society vol 91 pp 182ndash184 1978
[5] R A Conover ldquoA program for development of papayas tolerantto the distortion ringspot virusrdquo Proceedings of the Florida StateHorticultural Society vol 89 pp 229ndash231 1976
[6] S V Siar G A Beligan A J C Sajise V N Villegas and RA Drew ldquoPapaya ringspot virus resistance in Carica papaya viaintrogression from Vasconcellea quercifoliardquo Euphytica vol 181no 2 pp 159ndash168 2011
[7] S Dillon C Ramage R Drew and S Ashmore ldquoGeneticmapping of a PRSV-P resistance gene in ldquohighland papayardquobased on inheritance of RAF markersrdquo Euphytica vol 145 no1-2 pp 11ndash23 2005
[8] S DillonCharacterisation genetic mapping and development ofmarker selection strategies for resistance to the Papaya ringspotvirus type P (PRSV) in highland papaya [Dissertation thesis]School of Biomolecular Biomedical Science Griffith UniversityQueensland Australia 2006
8 International Journal of Genomics
[9] Q Xu and X Deng ldquoCloning and phylogenetic analyses ofserinethreonine kinase class defense-related genes in a wildfruit crop lsquochestnut rosersquordquoBMCResearchNotes vol 3 article 2022010
[10] A J Afzal A J Wood and D A Lightfoot ldquoPlant receptor-likeserine threonine kinases roles in signaling and plant defenserdquoMolecular Plant-Microbe Interactions vol 21 no 5 pp 507ndash5172008
[11] T Romeis ldquoProtein kinases in the plant defence responserdquoCurrent Opinion in Plant Biology vol 4 no 5 pp 407ndash414 2001
[12] LHaoHWangG Sunter andDMBisaro ldquoGeminivirusAL2and L2 proteins interact with and inactivate SNF1 kinaserdquo PlantCell vol 15 no 4 pp 1034ndash1048 2003
[13] A A Santos K V G Lopes J A C Apfata and E P B FontesldquoNSP-interacting kinase NIK a transducer of plant defencesignallingrdquo Journal of Experimental Botany vol 61 no 14 pp3839ndash3845 2010
[14] D W Gabriel and B G Rolfe ldquoWorking models of specificrecognition in plant-microbe interactionsrdquo Annual ReviewPhytophatology vol 28 pp 365ndash391 1990
[15] N T Keen ldquoGene-for-gene complementarity in plant-pathogeninteractionsrdquo Annual Review of Genetics vol 24 pp 447ndash4631990
[16] BW PorterM Paidi RMingMAlamWTNishijima andYJ Zhu ldquoGenome-wide analysis of Carica papaya reveals a smallNBS resistance gene familyrdquoMolecular Genetics and Genomicsvol 281 no 6 pp 609ndash626 2009
[17] R A Drew ldquoImproved techniques for in vitro propagation andgermplasm storage of papayardquo HortScience vol 27 pp 1122ndash1124 1992
[18] F Sanger S Nicklen and A R Coulson ldquoDNA sequencingwith chain-terminating inhibitorsrdquo Proceedings of the NationalAcademy of Sciences of the United States of America vol 74 no12 pp 5463ndash5467 1977
[19] S F AltschulW GishWMiller EWMyers and D J LipmanldquoBasic local alignment search toolrdquo Journal ofMolecular Biologyvol 215 no 3 pp 403ndash410 1990
[20] K E Hammond-Kosack and J D G Jones ldquoPlant diseaseresistance genesrdquo Annual Review of Plant Biology vol 48 pp575ndash607 1997
[21] G Xiao-Qin Z Hong-Zhi and L De-Bao ldquoAlternative splicingof the pre-mRNA in plantsrdquo Journal of Agricultural Biotechnol-ogy vol 14 no 5 pp 809ndash815 2005
[22] Z J Lorkovic D AWieczorek Kirk M H L Lambermon andW Filipowicz ldquoPre-mRNA splicing in higher plantsrdquo Trends inPlant Science vol 5 no 4 pp 160ndash167 2000
[23] K Iida M Seki T Sakurai et al ldquoGenome wide analysis ofalternative pre-mRNA splicing inArabidopsis thaliana based onfull length cDNA sequencesrdquoNucleic Acids Research vol 32 pp5096ndash5103 2004
[24] C S Lisenbee M J Lingard and R N Trelease ldquoArabidopsisperoxisomes possess functionally redundant membrane andmatrix isoforms of monodehydroascorbate reductaserdquo PlantJournal vol 43 no 6 pp 900ndash914 2005
[25] A W McCartney J S Greenwood M R Fabian K A Whiteand R T Mullen ldquoLocalization of the tomato bushy stunt virusreplication protein p33 reveals a peroxisome-to-endoplasmicreticulum sorting pathwayrdquo Plant Cell vol 17 no 12 pp 3513ndash3531 2005
[26] S Reumann L Babujee M Changle et al ldquoProteome analysisof Arabidopsis leaf peroxisomes reveals novel targeting pep-tides metabolic pathways and defensemechanismsrdquo Plant Cellvol 19 no 10 pp 3170ndash3193 2007
[27] C Dammann A Ichida B Hong et al ldquoSubcellular targetingof nine calcium-dependent protein kinase isoforms from Ara-bidopsisrdquo Plant Physiology vol 132 no 4 pp 1840ndash1848 2003
In the disease resistance study signal transduction com-prises the transmission of extracellular signals to intracellularresponses An extracellular domain could be required tobind several ligands Ligand binding induces a conformationchange in the extracellular domain which is hypothesizedto result in dimerization and bringing the intracellularkinase domains into close proximity [10] That multifactorbinding event is followed by transmission of secondarysignals through the plasma membrane The accumulation ofintracellular signalling from the receptor causes the inductionof specific phosphorylation cascades Phosphorylation ofprotein kinases can be involved in either direct interactionwith the pathogen or downstream signaling leading to expres-sion of defence-related genes [11]
In studies on plant viruses viral-encoded proteins arereported to suppress plant kinase activity through specificbinding to a kinase domain and enhance the pathogenicityof the virus Protein-protein interaction of AL2 from tomatogolden mosaic virus (TGMV) and L2 from beet curly topvirus (BCTV) is amongst those reported to inhibit sucrosenonfermenting 1- (SNF1-) related kinase activity in plants[12] However signalling through phosphorylation of cellularand virus protein has been shown to modulate symptomsexpression and pathogenicity [13] Protein signalling throughphosphorylation of viral-encoded protein promotes translo-cation of the ribosomal protein to the nucleus where it maynegatively impact virus infection [13]
There has been considerable speculation about the plantcomponent of a gene-for-gene interaction and the products ofnatural resistance genes [14 15] in plant resistance Genomicanalysis and characterization of papayarsquos resistance genes[16] and those of its wild relatives are important to provideadditional sources of resistance for C papaya improvementWe postulated that Opa11 5r marker could be a sequenceregion in a complete STK gene of C papaya and V pubescensand thus important to determine the polymorphism betweenC papaya andV pubescensThis study characterizes the tran-scripts from the orthologous STK genes in PRSV-susceptibleC papaya and PRSV-resistant V pubescens to determinewhether structural differences exist and if so how they mayrelate to the difference in virus disease resistance
2 Materials and Methods
21 Plant Materials C papaya (genotype 2001) and Vpubescens plants were maintained in tissue culture at GriffithUniversity Nathan campus Plants which grew from shoot
tips of plants maintained in tissue-culture were microprop-agated in vitro using methods described by [17] Plantswere incubated under lightdark conditions of 16-hour photoperiod illuminated by white fluorescent lamps and eighthours of darkness at 25∘C plusmn 1∘C
22 First Strand RACE cDNA Synthesis and Amplificationof STK Full Length cDNA from C papaya and V pubescensTotal RNA was extracted from the leaves using a NucleospinRNA plant kit (Macherey-Nagel) according to themanufacturerrsquos protocol The two genes amplified in thisstudy are labelled here as ldquo106rdquo and ldquo105rdquo according to appli-cation of automated gene prediction models to the C papayawhole genome sequence that is available in ftpasgpbmhpcchawaiiedupapaya For synthesis of 51015840-RACEcDNA a 100 ng of total RNA was reverse-transcribed with51015840-RACE CDS primer A and 12 120583M SMARTER II Aoligonucleotide by a 10U SMARTScrib Reverse Transcriptase(Clontech) For synthesis of 31015840-RACE 100 ng of total RNAwas reverse transcribed with 31015840-RACE CDS primer by a 10 USMARTScrib Reverse Transcriptase (Clontech)
The 51015840-RACE and 31015840-RACEPCR reactionwere conductedto amplify the STK106 gene of C papaya and V pubescens inaccordance with the protocol provided by the manufacturerof an Advantage 2 PCR Kit (Clontech) with Universal primerA Mix and 02 120583M gene-specific primer gsp1 and gsp2 in 51015840and 31015840-RACE PCR respectively (Table 1)The PCR procedurewas conducted under the following conditions 4min at 94∘C5 cycles (30 s at 94∘C 3min at 72∘C) 25 cycles (30 s at 94∘C30 s at 60∘C 3min at 72∘C) and 5min at 72∘C
Nested-PCR reaction was performed as a secondaryreaction in cases where the primary PCR failed to givethe distinct band of interest or produced a smear In thisstudy nested-PCR was further performed for STK106 geneamplification fromC papaya andV pubescens using a diluted31015840-RACE-PCRand 51015840-RACE-PCRproductwith gene-specificprimer ngsp2 106 and ngsp1 106 respectively (Table 1)
Similar to STK106 gene the first strand cDNA synthesisand amplification of STK105 gene of C papaya and Vpubescens were conducted in accordance with the protocolprovided by the manufacturer of an Advantage 2 PCR Kit(Clontech) The RACE-PCR procedure was the same asthat described for the STK106 amplification except that thespecific primer gsp1 105 and gsp2 105 was used in 51015840 and31015840-RACE PCR respectively (Table 1) The amplified productof C papaya and V pubescens was purified and clonedinto pCR8GWTOPO vector (Invitrogen) according to the
International Journal of Genomics 3
Table 2 Physicochemical properties of whole protein
manufacturerrsquos protocol Plasmid DNA was extracted usingPureLinkQuick PlasmidMiniprep kit (Invitrogen) accordingto the manufacturerrsquos protocol and sequenced by the dideoxychain termination method of [18] using the BigDye version31 sequencing system (Applied Biosystem) The sequencingproducts of 51015840 and 31015840 RACE were then aligned and assembledto deduce the full length cDNA
23 Characterization of the STK Gene in C papaya andV pubescens Sequence alignments ORF translation andpredicted protein were carried out using Expasy translatetools (httpwebexpasyorgtranslate) Sequences homol-ogy were identified from the sequence database usingBasic Local Alignment Tool [19] supported on the website(httpwwwncbinlmnihgov) of the National Centre forBiotechnology Information (NCBI) Searches for regionslocally similar to nucleotide and protein were initiated usingBLASTn and BLASTx tools respectively
Protein subcellular localization prediction was carriedout using Wolf psort (httpwolfpsortorg) Protein subcel-lular localization prediction was carried out usingWolf psort(httpwolfpsortorg) Transmembrane prediction usingHiddenMarkovModels (TMHMM) in a protein was derivedusing httpwwwcbsdtudkservicesTMHMM-20 A pre-diction of membrane spanning regions and their orientationwas carried out using TMPred (httpwwwchembnetorg)Identification of the protein domains families amp functionalsites and associated patterns amp profiles were carried out usingExpasy-prosite (httpprositeexpasyorg)
3 Results
31 Isolation and Analysis of STK Full Length cDNA ofC papaya The nested-PCR performed using a diluted Cpapaya 31015840-RACE-PCR product with nested universal primer(Clontech) and gene-specific primer ngsp2 106 [8] produceda 1014 bp fragment This fragment was sequenced and usedto design a gene-specific primer ngsp1 106 Nested-PCRwas performed using a diluted C papaya 51015840-RACE-PCRproduct with nested universal primer (Clontech) and gene-specific primer ngsp1 106 produced an 843 bp fragmentThe amplified forward and backward fragments of nested-PCR were cloned and assembled to determine the full lengthcDNA which was named c28106
Alignment of the open reading frame (ORF) to the onlineC papaya ORF (ftpasgpbmhpcchawaiiedupapaya)showed that c28106 was homologous to gene 106 in super-contig 28 (28106) sized 1016 bp and encodes for a serinethreonine protein kinase (STK) gene Nevertheless the
deduced amino acid sequence in c28106 or 28106 revealedno stop codon in the C-terminal region
When aligned 28106 showed a high homology in theupstream coding region of c28106 The downstream regionof c28106 was homologous to an adjacent gene 105 insupercontig 28 28105 (online C papaya ORF ftpasgpbmhpcchawaiiedupapaya) which also encodes for a STKgene Therefore the sequence 28105 was used to designspecific primers gsp2 105 in 31015840-RACE-PCR and gsp1 105 in51015840-RACE-PCR The amplification with universal primer Amix (Clontech) and gene-specific primer gsp2 105 in 31015840-RACE-PCR revealed a 998 bp fragment Amplification withuniversal primer Amix (Clontech) and gene-specific primergsp1 105 in 51015840-RACE-PCR revealed a 480 bp fragment Theamplified forward and backward fragments of RACE-PCRwere cloned and assembled to determine the nucleotidesequence of the full length cDNA which was named c28105The full length sequence (which is verified by the presence ofstart and stop codons) of c28105 showed a 100 similarityin the 31015840 flanking region to c28106 This result suggested thatc28106 and c28105 existed as one gene that encodes for a STKin C papaya rather than being two different genes
The full length cDNA sequence which is characterizedwith polyadenylation signal AATATA in the 31015840 flankingregion at the position 219 nucleotides from the TGA termi-nation signal was determined and designated as CP STKIt has been registered in National Centre for Biotechnol-ogy Information (NCBI) with Accession number KC310466CP STK sized 2520 bp containing a 1617 bp open readingframe (ORF) encodes for 539 amino acids a 51015840-untranslatedregion of 371 bp and a 31015840-untranslated region of 532 bp Thephysicochemical properties of CP STK whole protein areshown in Table 2 BLASTp analysis showed that CP STK hadhomology to STK in other species Glycine max (Accessionnumber XP003547484) Ricinus communis (Accession num-ber XP002514097) and Vitis vinifera (Accession numberXP002279199)
The amino acid sequence analysis showed that CP STKof papaya had a protein kinase domain in the upstreamregion at position 114 to 421 and an AGC kinase C terminaldomain in the downstream region at position 422 to 494Analysis for the transmembrane showed that CP STK didnot have transmembrane helices The protein subcellularlocalization prediction analysis showed that CP STK had anendoplasmic reticulum (ER) signal DKRA which describedthat the protein synthesized by ribosomes remains suspendedin cytosol Rather than that CP STK did not have a secondperoxisomal targeting signal in its sequence to explain that itis not destined for peroxisomes
4 International Journal of Genomics
32 Isolation and Analysis of STK Full Length cDNA of Vpubescens The mRNA transcript region sequences in Vpubescens cDNA clones were confirmedwith the primers thatwere used in C papaya The nested-PCR performed usinga diluted V pubescens 31015840-RACE-PCR with nested universalprimer (Clontech) and gene-specific primer ngsp2 106 [8]produced a 1770 bp fragment The nested-PCR performed bydiluted 51015840-RACE-PCR product with nested universal primer(Clontech) and gene-specific primer ngsp1 106 produceda 1059 bp fragment The amplified forward and backwardfragments of nested-PCR were cloned and assembled toobtain the full length cDNA that was 2524 bp long and wasdesignated as VP STK1 The V pubescens cDNA containeda 921 bp ORF with a 51015840-untranslated region of 587 bp and a31015840-untranslated region of 1016 bp A polyadenylation signalAATATA was present 920 nucleotides from the TGA termi-nation signal
Subsequently the same gene-specific primers as used forC papaya were used in the amplification of gene 28105in V pubescens The amplification with universal primer Amix (Clontech) and gene-specific primer gsp2 105 in 31015840-RACE-PCR revealed a 1601 bp fragment Amplification withuniversal primer Amix (Clontech) and gene-specific primergsp1 105 in 51015840-RACE-PCR revealed a 1059 bp fragment Theamplified forward and backward fragments of RACE-PCRwere cloned and assembled to obtain the full length cDNAwhich was designated as VP STK2 The gene was 1664 bp inlength contained a 582 bp open reading frame that encodedfor 194 amino acids and had a 51015840-untranslated region of389 bp and a 31015840-untranslated region of 693 bp Polyadenyla-tion signal AATATA was present 218 nucleotides from theTGA termination signal The physicochemical properties ofVP STK1 and VP STK2 whole protein are shown in Table 2
The full length cDNA sequence for VP STK1 andVP STK2 was not identical when they were aligned In con-trast to the homologous C papaya gene a stop codon (TAA)was identified at position 1506 to 1508 bp in VP STK1 Thisresulted from one nucleotide deletion at position 1495 bpThegene was predicted to be spliced and encode for two STKgenesThis result confirmed thatVP STK1 andVP STK2wereseparate as adjacent transcripts in V pubescens and differentfrom the orthologous gene in C papaya Both VP STK1and VP STK2 have been registered in NCBI with accessionnumbers KJ489312 and KJ 489313 respectively
VP STK1 and VP STK2 had homology to STK inother species Ricinus communis (Accession numberXP002514097) Glycine max (Accession numberXP003547484) Medicago truncatula (Accession numberXP003595251) and Vitis vinifera (Accession numberXP002279199)
The amino acid sequence analysis revealed a proteinkinase domain in VP STK1 at the amino acid position 109to 306 and an AGC kinase C terminal domain in VP STK2at the amino acid position 74 to 144 TMHMM analysis forthe transmembrane showed that VP STK1 and VP STK2 didnot have transmembrane helices Nevertheless VP STK2 didhave signal peptide putative cleavage site after amino acidposition 13 The protein subcellular localization predictionanalysis showed that VP STK1 had an endoplasmic reticulum
(ER) signal DKRA and did not have a second peroxisomaltargeting signal similar to CP STK By contrast VP STK2 didnot have an endoplasmic reticulum (ER) signal but did havethe second peroxisomal targeting signal (KIVHWRHHL) atamino acid position 22
Alignment of deduced amino acid sequences of CP STKVP STK1 and VP STK2 to the sequences of STK Ricinuscommunis (XP002514097) Glycine max (XP003547484) andVitis vinifera (XP002279199) is shown in Figure 1 Uncon-served to conserved regions are coloured in scale of 0 to 10The amino acid sequences are highly conserved in themiddleregion of the sequence VP STK1 is conserved at the upstreamregionwhileVP STK2 is conserved at the downstream regionwhen compared to the other clones and species
4 Discussion
The upstream coding region of cDNA transcript CP STKfrom papaya genotype 2001 was 100 similar to papayagenomic sequence 28106 Nevertheless CP STK was longerthan 28106 in that the downstream region ofCP STK showedsimilarity to another kinase gene in the C papaya genomesequence 28105 A structural difference is evident betweenthe cDNA and genomic sequences A longer STK gene inC papaya genotype 2001 was expected as no stop codonwas found in the nucleic acid sequence of 28106 available inftpasgpbmhpcchawaiiedupapaya Based on this resulta new STK gene in C papaya has been registered in NCBIunder accession number KC310466
TMHMM analysis for the transmembrane proteinshowed that CP STK VPSTK 1 and VP STK2 did nothave transmembrane helices Nevertheless the amino acidsequence analysis showed that CP STK and VP STK2 had anAGC kinase C terminal domain in the downstream regionThe AGC (cAMP-dependent cGMP-dependent and proteinkinase C) is known as AGC kinase C terminal The AGCin the protein kinase family contains a collection of proteinkinases that display a high degree of sequence similaritywithin their respective kinase domains with phosphorylationsites
Although CP STK and VP STK2 could be phosphory-lated but the presence of signal peptide in VP STK2 targetsit for secretion and a C-terminal extensionThis is supportedby a report on Arabidopsis thaliana that showed the RPP5gene is cytoplasmically localized as it hadno signal peptide ormembrane spanning region in its gene sequence ldquoas reviewedby [20]rdquo
Sequencing of mRNA from the STK gene of the resistantparent V pubescens revealed two discrete transcripts of thesame gene These two transcripts represent the first andlast sections in the STK gene of C papayaR communis(Accession number XM 002514051) which are separated inC papaya by a 20 kb intron Sequence differences betweenthe orthologous genes from C papaya and V pubescenswere expected to encode for a different protein functionand expression These differences may be the reason that Vpubescens is resistant to PRSV-Pwhen compared toC papayathat is susceptible The isolated 106 gene in V pubescens
International Journal of Genomics 5
10 20 30 40 50
- - - - - - M E N Q K V G E S V H V R E E E D D V A V E K E E D H G D V G S S M T L E R V A A A K K
- - - - - - - - - - - - M E N H G E D G R G K G L K E G K G E E E E V M G S S L T M E R V A A A K Q
K D K R A M E N N S C K V V E E K E G E E E E V G P I A V D E E E G Q V G S S L T M E R V A A A K Q
- - - - - M E N K E A E E E Q E E V A G E - - - - - - - - A E E E G E V G S S L T L E R V A A A K L
- - - - - M E N N S C K V V E E K E G E E E E V G P I A V E E E E G E V G S S L T M E R V A A A K Q
Figure 1 Alignment of deduced amino acid sequences of CP STK VP STK1 and VP STK2 with the sequences of STK Ricinus communis(XP002514097) Glycine max (XP003547484) and Vitis vinifera (XP002279199) Unconserved to conserved region is coloured in scale from0 to 10 and shown on the last line in each paragraph
named VP STK1 was orthologous to the STK gene and had9566 similarity to 28106 in C papaya The conservedregion was found mostly at the 51015840-end An ldquoactivation looprdquois located in exon 5 and the start of exon 6 prior to thepremature truncation of the VP STK1 gene Kinase activitycould be increased when a residue on the activation loop
close to the catalytic center is phosphorylated The isolated105 gene named VP STK2 was orthologous to the STK genein C papaya The predicted start of the VP STK2 gene isat a start codon (Met) that truncates six codons from theseventh exon of the C papaya gene This was supported byan alignment result of nucleotide sequences of c28106 of C
International Journal of Genomics 7
papaya with VP STK1 of V pubescens A deletion of one basepair of nucleotides in VP STK1 of V pubescens was observedwhen compared to the sequence in C papaya
Based on supercontig 28 of the C papaya genomesequence there are very large introns in the gene whichwould probably encourage alternative splicing These genesare adjacent in V pubescens and the orthologous gene inC papayaR communis spans both of these V pubescensgenes The VP STK1 gene is predicted to be separated fromVP STK2 because the sequence has a STOP codon in what isotherwise the middle of one of the exons of the C papayaRcommunis gene The predicted end of the VP STK1 geneis a stop codon that is not found in the C papaya or Rcommunis genes truncating 39 bp (13 codons) from the sixthexon
Inside the nucleus splicing takes place in a process calledposttranscription modification before the mRNA can bedecoded by ribosomes to produce a protein whilst in alter-native splicing two or more different mature mRNAs aredecoded by ribosome to produce multiple proteins Alterna-tive splicing predicted in this study is strongly supported bythe result of [8] who found anothermarker Opk4 1r that wasclose to the prsv-1 resistance gene in V pubescens but not inC papaya Opk4 1r has homology to a gene that codes fora small nuclear ribonuclear class of protein (snRNP) whichhas a motif known as a RNA binding domain (RBD) orribonucleoprotein (RNP)This class of proteins is involved inthe posttranscriptional gene expression processes includingmRNA and rRNA Spliceosome a large ribonucleoprotein(RNP) complex that contains small nuclear RNP particlessnRNP and other numerous protein factors including RNAhelicases and protein kinases are involved in the splicingprocess in plants [21 22] Products of alternative splicing aresignificant in cellular functions including signal transduc-tion immunity disease resistance transport regulation anddevelopment [23]
In this study VP STK2 that presumed as a protein var-iants produced by an alternative splicing in V pubescenscould be imported and ultimately resides within peroxisomeas a second peroxisomal targeting signal (PTS2) signal wasfound in the N terminus of VP STK2 but not in CP STK orVP STK1 PTS is a region of the peroxisomal protein thatrecognises and binds to the receptor This is supported by afew peroxisomal membrane proteins such as plant APX anda viral protein that are known to be delivered to peroxisomesvia distinct ER subdomains [24 25] Reference [26] in 2007reported their proteome data that support the functionof plant peroxisomes against pathogens Furthermore theexistence of protein kinases and phosphatases in plant per-oxisomes has been reported by [27] Different from CP STKand VP STK1 their mRNA is presumed to move through thenuclear pore into the cytoplasm and code into a protein Theproteins synthesized by ribosomes then become attached tothe membranes of the endoplasmic reticulum (ER) This issupported by the presence of endoplasmic reticulum (ER)membrane retention signal and the absence of PTS2 signalin both of the proteins
5 Conclusion
The findings in this study confirmed and fully supported thathypothesis of the variations of the gene (from resistant tosusceptible) was due to structural differences of the serinethreonine protein kinase sequence An alternative splicingthat occurs in V pubescens mRNA and the presence of aperoxisomal targeting signal (PTS2) in VP STK2 are hypoth-esised to be an important factor in contributing to the PRSV-P resistance in V pubescens Nevertheless a further biochem-ical analysis and gene transformation studies in the futurewill enable clarification and confirmation of the involvementof VP STK2 in transferring the PRSV-P resistance from Vpubescens to C papaya
Conflict of Interests
The authors declare that there is no conflict of interestsregarding the publication of this paper
Acknowledgments
The authors would like to thank Griffith University andMalaysian Agricultural Research and Development Institutefor the research funding and scholarship provided in thisstudy
References
[1] D Gonsalves ldquoControl of papaya ringspot virus in papaya acase studyrdquo Annual Review of Phytopathology vol 36 pp 415ndash437 1998
[2] R M Manshardt ldquoPapayardquo in Biotechnology of Perennial FruitCrops F A Hammerschlag and and R E Litz Eds pp 489ndash511Cambridge University Press Oxford UK 1992
[3] R A Drew S V Siar C M OrsquoBrien P M Magdalita and AG C Sajise ldquoBreeding for papaya ringspot virus resistance inCarica papaya L via hybridisation with Vasconcellea quercifo-liardquo Australian Journal of Experimental Agriculture vol 46 no3 pp 413ndash418 2006
[4] R A Conover andR E Litz ldquoProgress in breeding papayaswithtolerant to papaya ringspot virusrdquo Proceedings of the FloridaState Horticultural Society vol 91 pp 182ndash184 1978
[5] R A Conover ldquoA program for development of papayas tolerantto the distortion ringspot virusrdquo Proceedings of the Florida StateHorticultural Society vol 89 pp 229ndash231 1976
[6] S V Siar G A Beligan A J C Sajise V N Villegas and RA Drew ldquoPapaya ringspot virus resistance in Carica papaya viaintrogression from Vasconcellea quercifoliardquo Euphytica vol 181no 2 pp 159ndash168 2011
[7] S Dillon C Ramage R Drew and S Ashmore ldquoGeneticmapping of a PRSV-P resistance gene in ldquohighland papayardquobased on inheritance of RAF markersrdquo Euphytica vol 145 no1-2 pp 11ndash23 2005
[8] S DillonCharacterisation genetic mapping and development ofmarker selection strategies for resistance to the Papaya ringspotvirus type P (PRSV) in highland papaya [Dissertation thesis]School of Biomolecular Biomedical Science Griffith UniversityQueensland Australia 2006
8 International Journal of Genomics
[9] Q Xu and X Deng ldquoCloning and phylogenetic analyses ofserinethreonine kinase class defense-related genes in a wildfruit crop lsquochestnut rosersquordquoBMCResearchNotes vol 3 article 2022010
[10] A J Afzal A J Wood and D A Lightfoot ldquoPlant receptor-likeserine threonine kinases roles in signaling and plant defenserdquoMolecular Plant-Microbe Interactions vol 21 no 5 pp 507ndash5172008
[11] T Romeis ldquoProtein kinases in the plant defence responserdquoCurrent Opinion in Plant Biology vol 4 no 5 pp 407ndash414 2001
[12] LHaoHWangG Sunter andDMBisaro ldquoGeminivirusAL2and L2 proteins interact with and inactivate SNF1 kinaserdquo PlantCell vol 15 no 4 pp 1034ndash1048 2003
[13] A A Santos K V G Lopes J A C Apfata and E P B FontesldquoNSP-interacting kinase NIK a transducer of plant defencesignallingrdquo Journal of Experimental Botany vol 61 no 14 pp3839ndash3845 2010
[14] D W Gabriel and B G Rolfe ldquoWorking models of specificrecognition in plant-microbe interactionsrdquo Annual ReviewPhytophatology vol 28 pp 365ndash391 1990
[15] N T Keen ldquoGene-for-gene complementarity in plant-pathogeninteractionsrdquo Annual Review of Genetics vol 24 pp 447ndash4631990
[16] BW PorterM Paidi RMingMAlamWTNishijima andYJ Zhu ldquoGenome-wide analysis of Carica papaya reveals a smallNBS resistance gene familyrdquoMolecular Genetics and Genomicsvol 281 no 6 pp 609ndash626 2009
[17] R A Drew ldquoImproved techniques for in vitro propagation andgermplasm storage of papayardquo HortScience vol 27 pp 1122ndash1124 1992
[18] F Sanger S Nicklen and A R Coulson ldquoDNA sequencingwith chain-terminating inhibitorsrdquo Proceedings of the NationalAcademy of Sciences of the United States of America vol 74 no12 pp 5463ndash5467 1977
[19] S F AltschulW GishWMiller EWMyers and D J LipmanldquoBasic local alignment search toolrdquo Journal ofMolecular Biologyvol 215 no 3 pp 403ndash410 1990
[20] K E Hammond-Kosack and J D G Jones ldquoPlant diseaseresistance genesrdquo Annual Review of Plant Biology vol 48 pp575ndash607 1997
[21] G Xiao-Qin Z Hong-Zhi and L De-Bao ldquoAlternative splicingof the pre-mRNA in plantsrdquo Journal of Agricultural Biotechnol-ogy vol 14 no 5 pp 809ndash815 2005
[22] Z J Lorkovic D AWieczorek Kirk M H L Lambermon andW Filipowicz ldquoPre-mRNA splicing in higher plantsrdquo Trends inPlant Science vol 5 no 4 pp 160ndash167 2000
[23] K Iida M Seki T Sakurai et al ldquoGenome wide analysis ofalternative pre-mRNA splicing inArabidopsis thaliana based onfull length cDNA sequencesrdquoNucleic Acids Research vol 32 pp5096ndash5103 2004
[24] C S Lisenbee M J Lingard and R N Trelease ldquoArabidopsisperoxisomes possess functionally redundant membrane andmatrix isoforms of monodehydroascorbate reductaserdquo PlantJournal vol 43 no 6 pp 900ndash914 2005
[25] A W McCartney J S Greenwood M R Fabian K A Whiteand R T Mullen ldquoLocalization of the tomato bushy stunt virusreplication protein p33 reveals a peroxisome-to-endoplasmicreticulum sorting pathwayrdquo Plant Cell vol 17 no 12 pp 3513ndash3531 2005
[26] S Reumann L Babujee M Changle et al ldquoProteome analysisof Arabidopsis leaf peroxisomes reveals novel targeting pep-tides metabolic pathways and defensemechanismsrdquo Plant Cellvol 19 no 10 pp 3170ndash3193 2007
[27] C Dammann A Ichida B Hong et al ldquoSubcellular targetingof nine calcium-dependent protein kinase isoforms from Ara-bidopsisrdquo Plant Physiology vol 132 no 4 pp 1840ndash1848 2003
manufacturerrsquos protocol Plasmid DNA was extracted usingPureLinkQuick PlasmidMiniprep kit (Invitrogen) accordingto the manufacturerrsquos protocol and sequenced by the dideoxychain termination method of [18] using the BigDye version31 sequencing system (Applied Biosystem) The sequencingproducts of 51015840 and 31015840 RACE were then aligned and assembledto deduce the full length cDNA
23 Characterization of the STK Gene in C papaya andV pubescens Sequence alignments ORF translation andpredicted protein were carried out using Expasy translatetools (httpwebexpasyorgtranslate) Sequences homol-ogy were identified from the sequence database usingBasic Local Alignment Tool [19] supported on the website(httpwwwncbinlmnihgov) of the National Centre forBiotechnology Information (NCBI) Searches for regionslocally similar to nucleotide and protein were initiated usingBLASTn and BLASTx tools respectively
Protein subcellular localization prediction was carriedout using Wolf psort (httpwolfpsortorg) Protein subcel-lular localization prediction was carried out usingWolf psort(httpwolfpsortorg) Transmembrane prediction usingHiddenMarkovModels (TMHMM) in a protein was derivedusing httpwwwcbsdtudkservicesTMHMM-20 A pre-diction of membrane spanning regions and their orientationwas carried out using TMPred (httpwwwchembnetorg)Identification of the protein domains families amp functionalsites and associated patterns amp profiles were carried out usingExpasy-prosite (httpprositeexpasyorg)
3 Results
31 Isolation and Analysis of STK Full Length cDNA ofC papaya The nested-PCR performed using a diluted Cpapaya 31015840-RACE-PCR product with nested universal primer(Clontech) and gene-specific primer ngsp2 106 [8] produceda 1014 bp fragment This fragment was sequenced and usedto design a gene-specific primer ngsp1 106 Nested-PCRwas performed using a diluted C papaya 51015840-RACE-PCRproduct with nested universal primer (Clontech) and gene-specific primer ngsp1 106 produced an 843 bp fragmentThe amplified forward and backward fragments of nested-PCR were cloned and assembled to determine the full lengthcDNA which was named c28106
Alignment of the open reading frame (ORF) to the onlineC papaya ORF (ftpasgpbmhpcchawaiiedupapaya)showed that c28106 was homologous to gene 106 in super-contig 28 (28106) sized 1016 bp and encodes for a serinethreonine protein kinase (STK) gene Nevertheless the
deduced amino acid sequence in c28106 or 28106 revealedno stop codon in the C-terminal region
When aligned 28106 showed a high homology in theupstream coding region of c28106 The downstream regionof c28106 was homologous to an adjacent gene 105 insupercontig 28 28105 (online C papaya ORF ftpasgpbmhpcchawaiiedupapaya) which also encodes for a STKgene Therefore the sequence 28105 was used to designspecific primers gsp2 105 in 31015840-RACE-PCR and gsp1 105 in51015840-RACE-PCR The amplification with universal primer Amix (Clontech) and gene-specific primer gsp2 105 in 31015840-RACE-PCR revealed a 998 bp fragment Amplification withuniversal primer Amix (Clontech) and gene-specific primergsp1 105 in 51015840-RACE-PCR revealed a 480 bp fragment Theamplified forward and backward fragments of RACE-PCRwere cloned and assembled to determine the nucleotidesequence of the full length cDNA which was named c28105The full length sequence (which is verified by the presence ofstart and stop codons) of c28105 showed a 100 similarityin the 31015840 flanking region to c28106 This result suggested thatc28106 and c28105 existed as one gene that encodes for a STKin C papaya rather than being two different genes
The full length cDNA sequence which is characterizedwith polyadenylation signal AATATA in the 31015840 flankingregion at the position 219 nucleotides from the TGA termi-nation signal was determined and designated as CP STKIt has been registered in National Centre for Biotechnol-ogy Information (NCBI) with Accession number KC310466CP STK sized 2520 bp containing a 1617 bp open readingframe (ORF) encodes for 539 amino acids a 51015840-untranslatedregion of 371 bp and a 31015840-untranslated region of 532 bp Thephysicochemical properties of CP STK whole protein areshown in Table 2 BLASTp analysis showed that CP STK hadhomology to STK in other species Glycine max (Accessionnumber XP003547484) Ricinus communis (Accession num-ber XP002514097) and Vitis vinifera (Accession numberXP002279199)
The amino acid sequence analysis showed that CP STKof papaya had a protein kinase domain in the upstreamregion at position 114 to 421 and an AGC kinase C terminaldomain in the downstream region at position 422 to 494Analysis for the transmembrane showed that CP STK didnot have transmembrane helices The protein subcellularlocalization prediction analysis showed that CP STK had anendoplasmic reticulum (ER) signal DKRA which describedthat the protein synthesized by ribosomes remains suspendedin cytosol Rather than that CP STK did not have a secondperoxisomal targeting signal in its sequence to explain that itis not destined for peroxisomes
4 International Journal of Genomics
32 Isolation and Analysis of STK Full Length cDNA of Vpubescens The mRNA transcript region sequences in Vpubescens cDNA clones were confirmedwith the primers thatwere used in C papaya The nested-PCR performed usinga diluted V pubescens 31015840-RACE-PCR with nested universalprimer (Clontech) and gene-specific primer ngsp2 106 [8]produced a 1770 bp fragment The nested-PCR performed bydiluted 51015840-RACE-PCR product with nested universal primer(Clontech) and gene-specific primer ngsp1 106 produceda 1059 bp fragment The amplified forward and backwardfragments of nested-PCR were cloned and assembled toobtain the full length cDNA that was 2524 bp long and wasdesignated as VP STK1 The V pubescens cDNA containeda 921 bp ORF with a 51015840-untranslated region of 587 bp and a31015840-untranslated region of 1016 bp A polyadenylation signalAATATA was present 920 nucleotides from the TGA termi-nation signal
Subsequently the same gene-specific primers as used forC papaya were used in the amplification of gene 28105in V pubescens The amplification with universal primer Amix (Clontech) and gene-specific primer gsp2 105 in 31015840-RACE-PCR revealed a 1601 bp fragment Amplification withuniversal primer Amix (Clontech) and gene-specific primergsp1 105 in 51015840-RACE-PCR revealed a 1059 bp fragment Theamplified forward and backward fragments of RACE-PCRwere cloned and assembled to obtain the full length cDNAwhich was designated as VP STK2 The gene was 1664 bp inlength contained a 582 bp open reading frame that encodedfor 194 amino acids and had a 51015840-untranslated region of389 bp and a 31015840-untranslated region of 693 bp Polyadenyla-tion signal AATATA was present 218 nucleotides from theTGA termination signal The physicochemical properties ofVP STK1 and VP STK2 whole protein are shown in Table 2
The full length cDNA sequence for VP STK1 andVP STK2 was not identical when they were aligned In con-trast to the homologous C papaya gene a stop codon (TAA)was identified at position 1506 to 1508 bp in VP STK1 Thisresulted from one nucleotide deletion at position 1495 bpThegene was predicted to be spliced and encode for two STKgenesThis result confirmed thatVP STK1 andVP STK2wereseparate as adjacent transcripts in V pubescens and differentfrom the orthologous gene in C papaya Both VP STK1and VP STK2 have been registered in NCBI with accessionnumbers KJ489312 and KJ 489313 respectively
VP STK1 and VP STK2 had homology to STK inother species Ricinus communis (Accession numberXP002514097) Glycine max (Accession numberXP003547484) Medicago truncatula (Accession numberXP003595251) and Vitis vinifera (Accession numberXP002279199)
The amino acid sequence analysis revealed a proteinkinase domain in VP STK1 at the amino acid position 109to 306 and an AGC kinase C terminal domain in VP STK2at the amino acid position 74 to 144 TMHMM analysis forthe transmembrane showed that VP STK1 and VP STK2 didnot have transmembrane helices Nevertheless VP STK2 didhave signal peptide putative cleavage site after amino acidposition 13 The protein subcellular localization predictionanalysis showed that VP STK1 had an endoplasmic reticulum
(ER) signal DKRA and did not have a second peroxisomaltargeting signal similar to CP STK By contrast VP STK2 didnot have an endoplasmic reticulum (ER) signal but did havethe second peroxisomal targeting signal (KIVHWRHHL) atamino acid position 22
Alignment of deduced amino acid sequences of CP STKVP STK1 and VP STK2 to the sequences of STK Ricinuscommunis (XP002514097) Glycine max (XP003547484) andVitis vinifera (XP002279199) is shown in Figure 1 Uncon-served to conserved regions are coloured in scale of 0 to 10The amino acid sequences are highly conserved in themiddleregion of the sequence VP STK1 is conserved at the upstreamregionwhileVP STK2 is conserved at the downstream regionwhen compared to the other clones and species
4 Discussion
The upstream coding region of cDNA transcript CP STKfrom papaya genotype 2001 was 100 similar to papayagenomic sequence 28106 Nevertheless CP STK was longerthan 28106 in that the downstream region ofCP STK showedsimilarity to another kinase gene in the C papaya genomesequence 28105 A structural difference is evident betweenthe cDNA and genomic sequences A longer STK gene inC papaya genotype 2001 was expected as no stop codonwas found in the nucleic acid sequence of 28106 available inftpasgpbmhpcchawaiiedupapaya Based on this resulta new STK gene in C papaya has been registered in NCBIunder accession number KC310466
TMHMM analysis for the transmembrane proteinshowed that CP STK VPSTK 1 and VP STK2 did nothave transmembrane helices Nevertheless the amino acidsequence analysis showed that CP STK and VP STK2 had anAGC kinase C terminal domain in the downstream regionThe AGC (cAMP-dependent cGMP-dependent and proteinkinase C) is known as AGC kinase C terminal The AGCin the protein kinase family contains a collection of proteinkinases that display a high degree of sequence similaritywithin their respective kinase domains with phosphorylationsites
Although CP STK and VP STK2 could be phosphory-lated but the presence of signal peptide in VP STK2 targetsit for secretion and a C-terminal extensionThis is supportedby a report on Arabidopsis thaliana that showed the RPP5gene is cytoplasmically localized as it hadno signal peptide ormembrane spanning region in its gene sequence ldquoas reviewedby [20]rdquo
Sequencing of mRNA from the STK gene of the resistantparent V pubescens revealed two discrete transcripts of thesame gene These two transcripts represent the first andlast sections in the STK gene of C papayaR communis(Accession number XM 002514051) which are separated inC papaya by a 20 kb intron Sequence differences betweenthe orthologous genes from C papaya and V pubescenswere expected to encode for a different protein functionand expression These differences may be the reason that Vpubescens is resistant to PRSV-Pwhen compared toC papayathat is susceptible The isolated 106 gene in V pubescens
International Journal of Genomics 5
10 20 30 40 50
- - - - - - M E N Q K V G E S V H V R E E E D D V A V E K E E D H G D V G S S M T L E R V A A A K K
- - - - - - - - - - - - M E N H G E D G R G K G L K E G K G E E E E V M G S S L T M E R V A A A K Q
K D K R A M E N N S C K V V E E K E G E E E E V G P I A V D E E E G Q V G S S L T M E R V A A A K Q
- - - - - M E N K E A E E E Q E E V A G E - - - - - - - - A E E E G E V G S S L T L E R V A A A K L
- - - - - M E N N S C K V V E E K E G E E E E V G P I A V E E E E G E V G S S L T M E R V A A A K Q
Figure 1 Alignment of deduced amino acid sequences of CP STK VP STK1 and VP STK2 with the sequences of STK Ricinus communis(XP002514097) Glycine max (XP003547484) and Vitis vinifera (XP002279199) Unconserved to conserved region is coloured in scale from0 to 10 and shown on the last line in each paragraph
named VP STK1 was orthologous to the STK gene and had9566 similarity to 28106 in C papaya The conservedregion was found mostly at the 51015840-end An ldquoactivation looprdquois located in exon 5 and the start of exon 6 prior to thepremature truncation of the VP STK1 gene Kinase activitycould be increased when a residue on the activation loop
close to the catalytic center is phosphorylated The isolated105 gene named VP STK2 was orthologous to the STK genein C papaya The predicted start of the VP STK2 gene isat a start codon (Met) that truncates six codons from theseventh exon of the C papaya gene This was supported byan alignment result of nucleotide sequences of c28106 of C
International Journal of Genomics 7
papaya with VP STK1 of V pubescens A deletion of one basepair of nucleotides in VP STK1 of V pubescens was observedwhen compared to the sequence in C papaya
Based on supercontig 28 of the C papaya genomesequence there are very large introns in the gene whichwould probably encourage alternative splicing These genesare adjacent in V pubescens and the orthologous gene inC papayaR communis spans both of these V pubescensgenes The VP STK1 gene is predicted to be separated fromVP STK2 because the sequence has a STOP codon in what isotherwise the middle of one of the exons of the C papayaRcommunis gene The predicted end of the VP STK1 geneis a stop codon that is not found in the C papaya or Rcommunis genes truncating 39 bp (13 codons) from the sixthexon
Inside the nucleus splicing takes place in a process calledposttranscription modification before the mRNA can bedecoded by ribosomes to produce a protein whilst in alter-native splicing two or more different mature mRNAs aredecoded by ribosome to produce multiple proteins Alterna-tive splicing predicted in this study is strongly supported bythe result of [8] who found anothermarker Opk4 1r that wasclose to the prsv-1 resistance gene in V pubescens but not inC papaya Opk4 1r has homology to a gene that codes fora small nuclear ribonuclear class of protein (snRNP) whichhas a motif known as a RNA binding domain (RBD) orribonucleoprotein (RNP)This class of proteins is involved inthe posttranscriptional gene expression processes includingmRNA and rRNA Spliceosome a large ribonucleoprotein(RNP) complex that contains small nuclear RNP particlessnRNP and other numerous protein factors including RNAhelicases and protein kinases are involved in the splicingprocess in plants [21 22] Products of alternative splicing aresignificant in cellular functions including signal transduc-tion immunity disease resistance transport regulation anddevelopment [23]
In this study VP STK2 that presumed as a protein var-iants produced by an alternative splicing in V pubescenscould be imported and ultimately resides within peroxisomeas a second peroxisomal targeting signal (PTS2) signal wasfound in the N terminus of VP STK2 but not in CP STK orVP STK1 PTS is a region of the peroxisomal protein thatrecognises and binds to the receptor This is supported by afew peroxisomal membrane proteins such as plant APX anda viral protein that are known to be delivered to peroxisomesvia distinct ER subdomains [24 25] Reference [26] in 2007reported their proteome data that support the functionof plant peroxisomes against pathogens Furthermore theexistence of protein kinases and phosphatases in plant per-oxisomes has been reported by [27] Different from CP STKand VP STK1 their mRNA is presumed to move through thenuclear pore into the cytoplasm and code into a protein Theproteins synthesized by ribosomes then become attached tothe membranes of the endoplasmic reticulum (ER) This issupported by the presence of endoplasmic reticulum (ER)membrane retention signal and the absence of PTS2 signalin both of the proteins
5 Conclusion
The findings in this study confirmed and fully supported thathypothesis of the variations of the gene (from resistant tosusceptible) was due to structural differences of the serinethreonine protein kinase sequence An alternative splicingthat occurs in V pubescens mRNA and the presence of aperoxisomal targeting signal (PTS2) in VP STK2 are hypoth-esised to be an important factor in contributing to the PRSV-P resistance in V pubescens Nevertheless a further biochem-ical analysis and gene transformation studies in the futurewill enable clarification and confirmation of the involvementof VP STK2 in transferring the PRSV-P resistance from Vpubescens to C papaya
Conflict of Interests
The authors declare that there is no conflict of interestsregarding the publication of this paper
Acknowledgments
The authors would like to thank Griffith University andMalaysian Agricultural Research and Development Institutefor the research funding and scholarship provided in thisstudy
References
[1] D Gonsalves ldquoControl of papaya ringspot virus in papaya acase studyrdquo Annual Review of Phytopathology vol 36 pp 415ndash437 1998
[2] R M Manshardt ldquoPapayardquo in Biotechnology of Perennial FruitCrops F A Hammerschlag and and R E Litz Eds pp 489ndash511Cambridge University Press Oxford UK 1992
[3] R A Drew S V Siar C M OrsquoBrien P M Magdalita and AG C Sajise ldquoBreeding for papaya ringspot virus resistance inCarica papaya L via hybridisation with Vasconcellea quercifo-liardquo Australian Journal of Experimental Agriculture vol 46 no3 pp 413ndash418 2006
[4] R A Conover andR E Litz ldquoProgress in breeding papayaswithtolerant to papaya ringspot virusrdquo Proceedings of the FloridaState Horticultural Society vol 91 pp 182ndash184 1978
[5] R A Conover ldquoA program for development of papayas tolerantto the distortion ringspot virusrdquo Proceedings of the Florida StateHorticultural Society vol 89 pp 229ndash231 1976
[6] S V Siar G A Beligan A J C Sajise V N Villegas and RA Drew ldquoPapaya ringspot virus resistance in Carica papaya viaintrogression from Vasconcellea quercifoliardquo Euphytica vol 181no 2 pp 159ndash168 2011
[7] S Dillon C Ramage R Drew and S Ashmore ldquoGeneticmapping of a PRSV-P resistance gene in ldquohighland papayardquobased on inheritance of RAF markersrdquo Euphytica vol 145 no1-2 pp 11ndash23 2005
[8] S DillonCharacterisation genetic mapping and development ofmarker selection strategies for resistance to the Papaya ringspotvirus type P (PRSV) in highland papaya [Dissertation thesis]School of Biomolecular Biomedical Science Griffith UniversityQueensland Australia 2006
8 International Journal of Genomics
[9] Q Xu and X Deng ldquoCloning and phylogenetic analyses ofserinethreonine kinase class defense-related genes in a wildfruit crop lsquochestnut rosersquordquoBMCResearchNotes vol 3 article 2022010
[10] A J Afzal A J Wood and D A Lightfoot ldquoPlant receptor-likeserine threonine kinases roles in signaling and plant defenserdquoMolecular Plant-Microbe Interactions vol 21 no 5 pp 507ndash5172008
[11] T Romeis ldquoProtein kinases in the plant defence responserdquoCurrent Opinion in Plant Biology vol 4 no 5 pp 407ndash414 2001
[12] LHaoHWangG Sunter andDMBisaro ldquoGeminivirusAL2and L2 proteins interact with and inactivate SNF1 kinaserdquo PlantCell vol 15 no 4 pp 1034ndash1048 2003
[13] A A Santos K V G Lopes J A C Apfata and E P B FontesldquoNSP-interacting kinase NIK a transducer of plant defencesignallingrdquo Journal of Experimental Botany vol 61 no 14 pp3839ndash3845 2010
[14] D W Gabriel and B G Rolfe ldquoWorking models of specificrecognition in plant-microbe interactionsrdquo Annual ReviewPhytophatology vol 28 pp 365ndash391 1990
[15] N T Keen ldquoGene-for-gene complementarity in plant-pathogeninteractionsrdquo Annual Review of Genetics vol 24 pp 447ndash4631990
[16] BW PorterM Paidi RMingMAlamWTNishijima andYJ Zhu ldquoGenome-wide analysis of Carica papaya reveals a smallNBS resistance gene familyrdquoMolecular Genetics and Genomicsvol 281 no 6 pp 609ndash626 2009
[17] R A Drew ldquoImproved techniques for in vitro propagation andgermplasm storage of papayardquo HortScience vol 27 pp 1122ndash1124 1992
[18] F Sanger S Nicklen and A R Coulson ldquoDNA sequencingwith chain-terminating inhibitorsrdquo Proceedings of the NationalAcademy of Sciences of the United States of America vol 74 no12 pp 5463ndash5467 1977
[19] S F AltschulW GishWMiller EWMyers and D J LipmanldquoBasic local alignment search toolrdquo Journal ofMolecular Biologyvol 215 no 3 pp 403ndash410 1990
[20] K E Hammond-Kosack and J D G Jones ldquoPlant diseaseresistance genesrdquo Annual Review of Plant Biology vol 48 pp575ndash607 1997
[21] G Xiao-Qin Z Hong-Zhi and L De-Bao ldquoAlternative splicingof the pre-mRNA in plantsrdquo Journal of Agricultural Biotechnol-ogy vol 14 no 5 pp 809ndash815 2005
[22] Z J Lorkovic D AWieczorek Kirk M H L Lambermon andW Filipowicz ldquoPre-mRNA splicing in higher plantsrdquo Trends inPlant Science vol 5 no 4 pp 160ndash167 2000
[23] K Iida M Seki T Sakurai et al ldquoGenome wide analysis ofalternative pre-mRNA splicing inArabidopsis thaliana based onfull length cDNA sequencesrdquoNucleic Acids Research vol 32 pp5096ndash5103 2004
[24] C S Lisenbee M J Lingard and R N Trelease ldquoArabidopsisperoxisomes possess functionally redundant membrane andmatrix isoforms of monodehydroascorbate reductaserdquo PlantJournal vol 43 no 6 pp 900ndash914 2005
[25] A W McCartney J S Greenwood M R Fabian K A Whiteand R T Mullen ldquoLocalization of the tomato bushy stunt virusreplication protein p33 reveals a peroxisome-to-endoplasmicreticulum sorting pathwayrdquo Plant Cell vol 17 no 12 pp 3513ndash3531 2005
[26] S Reumann L Babujee M Changle et al ldquoProteome analysisof Arabidopsis leaf peroxisomes reveals novel targeting pep-tides metabolic pathways and defensemechanismsrdquo Plant Cellvol 19 no 10 pp 3170ndash3193 2007
[27] C Dammann A Ichida B Hong et al ldquoSubcellular targetingof nine calcium-dependent protein kinase isoforms from Ara-bidopsisrdquo Plant Physiology vol 132 no 4 pp 1840ndash1848 2003
32 Isolation and Analysis of STK Full Length cDNA of Vpubescens The mRNA transcript region sequences in Vpubescens cDNA clones were confirmedwith the primers thatwere used in C papaya The nested-PCR performed usinga diluted V pubescens 31015840-RACE-PCR with nested universalprimer (Clontech) and gene-specific primer ngsp2 106 [8]produced a 1770 bp fragment The nested-PCR performed bydiluted 51015840-RACE-PCR product with nested universal primer(Clontech) and gene-specific primer ngsp1 106 produceda 1059 bp fragment The amplified forward and backwardfragments of nested-PCR were cloned and assembled toobtain the full length cDNA that was 2524 bp long and wasdesignated as VP STK1 The V pubescens cDNA containeda 921 bp ORF with a 51015840-untranslated region of 587 bp and a31015840-untranslated region of 1016 bp A polyadenylation signalAATATA was present 920 nucleotides from the TGA termi-nation signal
Subsequently the same gene-specific primers as used forC papaya were used in the amplification of gene 28105in V pubescens The amplification with universal primer Amix (Clontech) and gene-specific primer gsp2 105 in 31015840-RACE-PCR revealed a 1601 bp fragment Amplification withuniversal primer Amix (Clontech) and gene-specific primergsp1 105 in 51015840-RACE-PCR revealed a 1059 bp fragment Theamplified forward and backward fragments of RACE-PCRwere cloned and assembled to obtain the full length cDNAwhich was designated as VP STK2 The gene was 1664 bp inlength contained a 582 bp open reading frame that encodedfor 194 amino acids and had a 51015840-untranslated region of389 bp and a 31015840-untranslated region of 693 bp Polyadenyla-tion signal AATATA was present 218 nucleotides from theTGA termination signal The physicochemical properties ofVP STK1 and VP STK2 whole protein are shown in Table 2
The full length cDNA sequence for VP STK1 andVP STK2 was not identical when they were aligned In con-trast to the homologous C papaya gene a stop codon (TAA)was identified at position 1506 to 1508 bp in VP STK1 Thisresulted from one nucleotide deletion at position 1495 bpThegene was predicted to be spliced and encode for two STKgenesThis result confirmed thatVP STK1 andVP STK2wereseparate as adjacent transcripts in V pubescens and differentfrom the orthologous gene in C papaya Both VP STK1and VP STK2 have been registered in NCBI with accessionnumbers KJ489312 and KJ 489313 respectively
VP STK1 and VP STK2 had homology to STK inother species Ricinus communis (Accession numberXP002514097) Glycine max (Accession numberXP003547484) Medicago truncatula (Accession numberXP003595251) and Vitis vinifera (Accession numberXP002279199)
The amino acid sequence analysis revealed a proteinkinase domain in VP STK1 at the amino acid position 109to 306 and an AGC kinase C terminal domain in VP STK2at the amino acid position 74 to 144 TMHMM analysis forthe transmembrane showed that VP STK1 and VP STK2 didnot have transmembrane helices Nevertheless VP STK2 didhave signal peptide putative cleavage site after amino acidposition 13 The protein subcellular localization predictionanalysis showed that VP STK1 had an endoplasmic reticulum
(ER) signal DKRA and did not have a second peroxisomaltargeting signal similar to CP STK By contrast VP STK2 didnot have an endoplasmic reticulum (ER) signal but did havethe second peroxisomal targeting signal (KIVHWRHHL) atamino acid position 22
Alignment of deduced amino acid sequences of CP STKVP STK1 and VP STK2 to the sequences of STK Ricinuscommunis (XP002514097) Glycine max (XP003547484) andVitis vinifera (XP002279199) is shown in Figure 1 Uncon-served to conserved regions are coloured in scale of 0 to 10The amino acid sequences are highly conserved in themiddleregion of the sequence VP STK1 is conserved at the upstreamregionwhileVP STK2 is conserved at the downstream regionwhen compared to the other clones and species
4 Discussion
The upstream coding region of cDNA transcript CP STKfrom papaya genotype 2001 was 100 similar to papayagenomic sequence 28106 Nevertheless CP STK was longerthan 28106 in that the downstream region ofCP STK showedsimilarity to another kinase gene in the C papaya genomesequence 28105 A structural difference is evident betweenthe cDNA and genomic sequences A longer STK gene inC papaya genotype 2001 was expected as no stop codonwas found in the nucleic acid sequence of 28106 available inftpasgpbmhpcchawaiiedupapaya Based on this resulta new STK gene in C papaya has been registered in NCBIunder accession number KC310466
TMHMM analysis for the transmembrane proteinshowed that CP STK VPSTK 1 and VP STK2 did nothave transmembrane helices Nevertheless the amino acidsequence analysis showed that CP STK and VP STK2 had anAGC kinase C terminal domain in the downstream regionThe AGC (cAMP-dependent cGMP-dependent and proteinkinase C) is known as AGC kinase C terminal The AGCin the protein kinase family contains a collection of proteinkinases that display a high degree of sequence similaritywithin their respective kinase domains with phosphorylationsites
Although CP STK and VP STK2 could be phosphory-lated but the presence of signal peptide in VP STK2 targetsit for secretion and a C-terminal extensionThis is supportedby a report on Arabidopsis thaliana that showed the RPP5gene is cytoplasmically localized as it hadno signal peptide ormembrane spanning region in its gene sequence ldquoas reviewedby [20]rdquo
Sequencing of mRNA from the STK gene of the resistantparent V pubescens revealed two discrete transcripts of thesame gene These two transcripts represent the first andlast sections in the STK gene of C papayaR communis(Accession number XM 002514051) which are separated inC papaya by a 20 kb intron Sequence differences betweenthe orthologous genes from C papaya and V pubescenswere expected to encode for a different protein functionand expression These differences may be the reason that Vpubescens is resistant to PRSV-Pwhen compared toC papayathat is susceptible The isolated 106 gene in V pubescens
International Journal of Genomics 5
10 20 30 40 50
- - - - - - M E N Q K V G E S V H V R E E E D D V A V E K E E D H G D V G S S M T L E R V A A A K K
- - - - - - - - - - - - M E N H G E D G R G K G L K E G K G E E E E V M G S S L T M E R V A A A K Q
K D K R A M E N N S C K V V E E K E G E E E E V G P I A V D E E E G Q V G S S L T M E R V A A A K Q
- - - - - M E N K E A E E E Q E E V A G E - - - - - - - - A E E E G E V G S S L T L E R V A A A K L
- - - - - M E N N S C K V V E E K E G E E E E V G P I A V E E E E G E V G S S L T M E R V A A A K Q
Figure 1 Alignment of deduced amino acid sequences of CP STK VP STK1 and VP STK2 with the sequences of STK Ricinus communis(XP002514097) Glycine max (XP003547484) and Vitis vinifera (XP002279199) Unconserved to conserved region is coloured in scale from0 to 10 and shown on the last line in each paragraph
named VP STK1 was orthologous to the STK gene and had9566 similarity to 28106 in C papaya The conservedregion was found mostly at the 51015840-end An ldquoactivation looprdquois located in exon 5 and the start of exon 6 prior to thepremature truncation of the VP STK1 gene Kinase activitycould be increased when a residue on the activation loop
close to the catalytic center is phosphorylated The isolated105 gene named VP STK2 was orthologous to the STK genein C papaya The predicted start of the VP STK2 gene isat a start codon (Met) that truncates six codons from theseventh exon of the C papaya gene This was supported byan alignment result of nucleotide sequences of c28106 of C
International Journal of Genomics 7
papaya with VP STK1 of V pubescens A deletion of one basepair of nucleotides in VP STK1 of V pubescens was observedwhen compared to the sequence in C papaya
Based on supercontig 28 of the C papaya genomesequence there are very large introns in the gene whichwould probably encourage alternative splicing These genesare adjacent in V pubescens and the orthologous gene inC papayaR communis spans both of these V pubescensgenes The VP STK1 gene is predicted to be separated fromVP STK2 because the sequence has a STOP codon in what isotherwise the middle of one of the exons of the C papayaRcommunis gene The predicted end of the VP STK1 geneis a stop codon that is not found in the C papaya or Rcommunis genes truncating 39 bp (13 codons) from the sixthexon
Inside the nucleus splicing takes place in a process calledposttranscription modification before the mRNA can bedecoded by ribosomes to produce a protein whilst in alter-native splicing two or more different mature mRNAs aredecoded by ribosome to produce multiple proteins Alterna-tive splicing predicted in this study is strongly supported bythe result of [8] who found anothermarker Opk4 1r that wasclose to the prsv-1 resistance gene in V pubescens but not inC papaya Opk4 1r has homology to a gene that codes fora small nuclear ribonuclear class of protein (snRNP) whichhas a motif known as a RNA binding domain (RBD) orribonucleoprotein (RNP)This class of proteins is involved inthe posttranscriptional gene expression processes includingmRNA and rRNA Spliceosome a large ribonucleoprotein(RNP) complex that contains small nuclear RNP particlessnRNP and other numerous protein factors including RNAhelicases and protein kinases are involved in the splicingprocess in plants [21 22] Products of alternative splicing aresignificant in cellular functions including signal transduc-tion immunity disease resistance transport regulation anddevelopment [23]
In this study VP STK2 that presumed as a protein var-iants produced by an alternative splicing in V pubescenscould be imported and ultimately resides within peroxisomeas a second peroxisomal targeting signal (PTS2) signal wasfound in the N terminus of VP STK2 but not in CP STK orVP STK1 PTS is a region of the peroxisomal protein thatrecognises and binds to the receptor This is supported by afew peroxisomal membrane proteins such as plant APX anda viral protein that are known to be delivered to peroxisomesvia distinct ER subdomains [24 25] Reference [26] in 2007reported their proteome data that support the functionof plant peroxisomes against pathogens Furthermore theexistence of protein kinases and phosphatases in plant per-oxisomes has been reported by [27] Different from CP STKand VP STK1 their mRNA is presumed to move through thenuclear pore into the cytoplasm and code into a protein Theproteins synthesized by ribosomes then become attached tothe membranes of the endoplasmic reticulum (ER) This issupported by the presence of endoplasmic reticulum (ER)membrane retention signal and the absence of PTS2 signalin both of the proteins
5 Conclusion
The findings in this study confirmed and fully supported thathypothesis of the variations of the gene (from resistant tosusceptible) was due to structural differences of the serinethreonine protein kinase sequence An alternative splicingthat occurs in V pubescens mRNA and the presence of aperoxisomal targeting signal (PTS2) in VP STK2 are hypoth-esised to be an important factor in contributing to the PRSV-P resistance in V pubescens Nevertheless a further biochem-ical analysis and gene transformation studies in the futurewill enable clarification and confirmation of the involvementof VP STK2 in transferring the PRSV-P resistance from Vpubescens to C papaya
Conflict of Interests
The authors declare that there is no conflict of interestsregarding the publication of this paper
Acknowledgments
The authors would like to thank Griffith University andMalaysian Agricultural Research and Development Institutefor the research funding and scholarship provided in thisstudy
References
[1] D Gonsalves ldquoControl of papaya ringspot virus in papaya acase studyrdquo Annual Review of Phytopathology vol 36 pp 415ndash437 1998
[2] R M Manshardt ldquoPapayardquo in Biotechnology of Perennial FruitCrops F A Hammerschlag and and R E Litz Eds pp 489ndash511Cambridge University Press Oxford UK 1992
[3] R A Drew S V Siar C M OrsquoBrien P M Magdalita and AG C Sajise ldquoBreeding for papaya ringspot virus resistance inCarica papaya L via hybridisation with Vasconcellea quercifo-liardquo Australian Journal of Experimental Agriculture vol 46 no3 pp 413ndash418 2006
[4] R A Conover andR E Litz ldquoProgress in breeding papayaswithtolerant to papaya ringspot virusrdquo Proceedings of the FloridaState Horticultural Society vol 91 pp 182ndash184 1978
[5] R A Conover ldquoA program for development of papayas tolerantto the distortion ringspot virusrdquo Proceedings of the Florida StateHorticultural Society vol 89 pp 229ndash231 1976
[6] S V Siar G A Beligan A J C Sajise V N Villegas and RA Drew ldquoPapaya ringspot virus resistance in Carica papaya viaintrogression from Vasconcellea quercifoliardquo Euphytica vol 181no 2 pp 159ndash168 2011
[7] S Dillon C Ramage R Drew and S Ashmore ldquoGeneticmapping of a PRSV-P resistance gene in ldquohighland papayardquobased on inheritance of RAF markersrdquo Euphytica vol 145 no1-2 pp 11ndash23 2005
[8] S DillonCharacterisation genetic mapping and development ofmarker selection strategies for resistance to the Papaya ringspotvirus type P (PRSV) in highland papaya [Dissertation thesis]School of Biomolecular Biomedical Science Griffith UniversityQueensland Australia 2006
8 International Journal of Genomics
[9] Q Xu and X Deng ldquoCloning and phylogenetic analyses ofserinethreonine kinase class defense-related genes in a wildfruit crop lsquochestnut rosersquordquoBMCResearchNotes vol 3 article 2022010
[10] A J Afzal A J Wood and D A Lightfoot ldquoPlant receptor-likeserine threonine kinases roles in signaling and plant defenserdquoMolecular Plant-Microbe Interactions vol 21 no 5 pp 507ndash5172008
[11] T Romeis ldquoProtein kinases in the plant defence responserdquoCurrent Opinion in Plant Biology vol 4 no 5 pp 407ndash414 2001
[12] LHaoHWangG Sunter andDMBisaro ldquoGeminivirusAL2and L2 proteins interact with and inactivate SNF1 kinaserdquo PlantCell vol 15 no 4 pp 1034ndash1048 2003
[13] A A Santos K V G Lopes J A C Apfata and E P B FontesldquoNSP-interacting kinase NIK a transducer of plant defencesignallingrdquo Journal of Experimental Botany vol 61 no 14 pp3839ndash3845 2010
[14] D W Gabriel and B G Rolfe ldquoWorking models of specificrecognition in plant-microbe interactionsrdquo Annual ReviewPhytophatology vol 28 pp 365ndash391 1990
[15] N T Keen ldquoGene-for-gene complementarity in plant-pathogeninteractionsrdquo Annual Review of Genetics vol 24 pp 447ndash4631990
[16] BW PorterM Paidi RMingMAlamWTNishijima andYJ Zhu ldquoGenome-wide analysis of Carica papaya reveals a smallNBS resistance gene familyrdquoMolecular Genetics and Genomicsvol 281 no 6 pp 609ndash626 2009
[17] R A Drew ldquoImproved techniques for in vitro propagation andgermplasm storage of papayardquo HortScience vol 27 pp 1122ndash1124 1992
[18] F Sanger S Nicklen and A R Coulson ldquoDNA sequencingwith chain-terminating inhibitorsrdquo Proceedings of the NationalAcademy of Sciences of the United States of America vol 74 no12 pp 5463ndash5467 1977
[19] S F AltschulW GishWMiller EWMyers and D J LipmanldquoBasic local alignment search toolrdquo Journal ofMolecular Biologyvol 215 no 3 pp 403ndash410 1990
[20] K E Hammond-Kosack and J D G Jones ldquoPlant diseaseresistance genesrdquo Annual Review of Plant Biology vol 48 pp575ndash607 1997
[21] G Xiao-Qin Z Hong-Zhi and L De-Bao ldquoAlternative splicingof the pre-mRNA in plantsrdquo Journal of Agricultural Biotechnol-ogy vol 14 no 5 pp 809ndash815 2005
[22] Z J Lorkovic D AWieczorek Kirk M H L Lambermon andW Filipowicz ldquoPre-mRNA splicing in higher plantsrdquo Trends inPlant Science vol 5 no 4 pp 160ndash167 2000
[23] K Iida M Seki T Sakurai et al ldquoGenome wide analysis ofalternative pre-mRNA splicing inArabidopsis thaliana based onfull length cDNA sequencesrdquoNucleic Acids Research vol 32 pp5096ndash5103 2004
[24] C S Lisenbee M J Lingard and R N Trelease ldquoArabidopsisperoxisomes possess functionally redundant membrane andmatrix isoforms of monodehydroascorbate reductaserdquo PlantJournal vol 43 no 6 pp 900ndash914 2005
[25] A W McCartney J S Greenwood M R Fabian K A Whiteand R T Mullen ldquoLocalization of the tomato bushy stunt virusreplication protein p33 reveals a peroxisome-to-endoplasmicreticulum sorting pathwayrdquo Plant Cell vol 17 no 12 pp 3513ndash3531 2005
[26] S Reumann L Babujee M Changle et al ldquoProteome analysisof Arabidopsis leaf peroxisomes reveals novel targeting pep-tides metabolic pathways and defensemechanismsrdquo Plant Cellvol 19 no 10 pp 3170ndash3193 2007
[27] C Dammann A Ichida B Hong et al ldquoSubcellular targetingof nine calcium-dependent protein kinase isoforms from Ara-bidopsisrdquo Plant Physiology vol 132 no 4 pp 1840ndash1848 2003
Figure 1 Alignment of deduced amino acid sequences of CP STK VP STK1 and VP STK2 with the sequences of STK Ricinus communis(XP002514097) Glycine max (XP003547484) and Vitis vinifera (XP002279199) Unconserved to conserved region is coloured in scale from0 to 10 and shown on the last line in each paragraph
named VP STK1 was orthologous to the STK gene and had9566 similarity to 28106 in C papaya The conservedregion was found mostly at the 51015840-end An ldquoactivation looprdquois located in exon 5 and the start of exon 6 prior to thepremature truncation of the VP STK1 gene Kinase activitycould be increased when a residue on the activation loop
close to the catalytic center is phosphorylated The isolated105 gene named VP STK2 was orthologous to the STK genein C papaya The predicted start of the VP STK2 gene isat a start codon (Met) that truncates six codons from theseventh exon of the C papaya gene This was supported byan alignment result of nucleotide sequences of c28106 of C
International Journal of Genomics 7
papaya with VP STK1 of V pubescens A deletion of one basepair of nucleotides in VP STK1 of V pubescens was observedwhen compared to the sequence in C papaya
Based on supercontig 28 of the C papaya genomesequence there are very large introns in the gene whichwould probably encourage alternative splicing These genesare adjacent in V pubescens and the orthologous gene inC papayaR communis spans both of these V pubescensgenes The VP STK1 gene is predicted to be separated fromVP STK2 because the sequence has a STOP codon in what isotherwise the middle of one of the exons of the C papayaRcommunis gene The predicted end of the VP STK1 geneis a stop codon that is not found in the C papaya or Rcommunis genes truncating 39 bp (13 codons) from the sixthexon
Inside the nucleus splicing takes place in a process calledposttranscription modification before the mRNA can bedecoded by ribosomes to produce a protein whilst in alter-native splicing two or more different mature mRNAs aredecoded by ribosome to produce multiple proteins Alterna-tive splicing predicted in this study is strongly supported bythe result of [8] who found anothermarker Opk4 1r that wasclose to the prsv-1 resistance gene in V pubescens but not inC papaya Opk4 1r has homology to a gene that codes fora small nuclear ribonuclear class of protein (snRNP) whichhas a motif known as a RNA binding domain (RBD) orribonucleoprotein (RNP)This class of proteins is involved inthe posttranscriptional gene expression processes includingmRNA and rRNA Spliceosome a large ribonucleoprotein(RNP) complex that contains small nuclear RNP particlessnRNP and other numerous protein factors including RNAhelicases and protein kinases are involved in the splicingprocess in plants [21 22] Products of alternative splicing aresignificant in cellular functions including signal transduc-tion immunity disease resistance transport regulation anddevelopment [23]
In this study VP STK2 that presumed as a protein var-iants produced by an alternative splicing in V pubescenscould be imported and ultimately resides within peroxisomeas a second peroxisomal targeting signal (PTS2) signal wasfound in the N terminus of VP STK2 but not in CP STK orVP STK1 PTS is a region of the peroxisomal protein thatrecognises and binds to the receptor This is supported by afew peroxisomal membrane proteins such as plant APX anda viral protein that are known to be delivered to peroxisomesvia distinct ER subdomains [24 25] Reference [26] in 2007reported their proteome data that support the functionof plant peroxisomes against pathogens Furthermore theexistence of protein kinases and phosphatases in plant per-oxisomes has been reported by [27] Different from CP STKand VP STK1 their mRNA is presumed to move through thenuclear pore into the cytoplasm and code into a protein Theproteins synthesized by ribosomes then become attached tothe membranes of the endoplasmic reticulum (ER) This issupported by the presence of endoplasmic reticulum (ER)membrane retention signal and the absence of PTS2 signalin both of the proteins
5 Conclusion
The findings in this study confirmed and fully supported thathypothesis of the variations of the gene (from resistant tosusceptible) was due to structural differences of the serinethreonine protein kinase sequence An alternative splicingthat occurs in V pubescens mRNA and the presence of aperoxisomal targeting signal (PTS2) in VP STK2 are hypoth-esised to be an important factor in contributing to the PRSV-P resistance in V pubescens Nevertheless a further biochem-ical analysis and gene transformation studies in the futurewill enable clarification and confirmation of the involvementof VP STK2 in transferring the PRSV-P resistance from Vpubescens to C papaya
Conflict of Interests
The authors declare that there is no conflict of interestsregarding the publication of this paper
Acknowledgments
The authors would like to thank Griffith University andMalaysian Agricultural Research and Development Institutefor the research funding and scholarship provided in thisstudy
References
[1] D Gonsalves ldquoControl of papaya ringspot virus in papaya acase studyrdquo Annual Review of Phytopathology vol 36 pp 415ndash437 1998
[2] R M Manshardt ldquoPapayardquo in Biotechnology of Perennial FruitCrops F A Hammerschlag and and R E Litz Eds pp 489ndash511Cambridge University Press Oxford UK 1992
[3] R A Drew S V Siar C M OrsquoBrien P M Magdalita and AG C Sajise ldquoBreeding for papaya ringspot virus resistance inCarica papaya L via hybridisation with Vasconcellea quercifo-liardquo Australian Journal of Experimental Agriculture vol 46 no3 pp 413ndash418 2006
[4] R A Conover andR E Litz ldquoProgress in breeding papayaswithtolerant to papaya ringspot virusrdquo Proceedings of the FloridaState Horticultural Society vol 91 pp 182ndash184 1978
[5] R A Conover ldquoA program for development of papayas tolerantto the distortion ringspot virusrdquo Proceedings of the Florida StateHorticultural Society vol 89 pp 229ndash231 1976
[6] S V Siar G A Beligan A J C Sajise V N Villegas and RA Drew ldquoPapaya ringspot virus resistance in Carica papaya viaintrogression from Vasconcellea quercifoliardquo Euphytica vol 181no 2 pp 159ndash168 2011
[7] S Dillon C Ramage R Drew and S Ashmore ldquoGeneticmapping of a PRSV-P resistance gene in ldquohighland papayardquobased on inheritance of RAF markersrdquo Euphytica vol 145 no1-2 pp 11ndash23 2005
[8] S DillonCharacterisation genetic mapping and development ofmarker selection strategies for resistance to the Papaya ringspotvirus type P (PRSV) in highland papaya [Dissertation thesis]School of Biomolecular Biomedical Science Griffith UniversityQueensland Australia 2006
8 International Journal of Genomics
[9] Q Xu and X Deng ldquoCloning and phylogenetic analyses ofserinethreonine kinase class defense-related genes in a wildfruit crop lsquochestnut rosersquordquoBMCResearchNotes vol 3 article 2022010
[10] A J Afzal A J Wood and D A Lightfoot ldquoPlant receptor-likeserine threonine kinases roles in signaling and plant defenserdquoMolecular Plant-Microbe Interactions vol 21 no 5 pp 507ndash5172008
[11] T Romeis ldquoProtein kinases in the plant defence responserdquoCurrent Opinion in Plant Biology vol 4 no 5 pp 407ndash414 2001
[12] LHaoHWangG Sunter andDMBisaro ldquoGeminivirusAL2and L2 proteins interact with and inactivate SNF1 kinaserdquo PlantCell vol 15 no 4 pp 1034ndash1048 2003
[13] A A Santos K V G Lopes J A C Apfata and E P B FontesldquoNSP-interacting kinase NIK a transducer of plant defencesignallingrdquo Journal of Experimental Botany vol 61 no 14 pp3839ndash3845 2010
[14] D W Gabriel and B G Rolfe ldquoWorking models of specificrecognition in plant-microbe interactionsrdquo Annual ReviewPhytophatology vol 28 pp 365ndash391 1990
[15] N T Keen ldquoGene-for-gene complementarity in plant-pathogeninteractionsrdquo Annual Review of Genetics vol 24 pp 447ndash4631990
[16] BW PorterM Paidi RMingMAlamWTNishijima andYJ Zhu ldquoGenome-wide analysis of Carica papaya reveals a smallNBS resistance gene familyrdquoMolecular Genetics and Genomicsvol 281 no 6 pp 609ndash626 2009
[17] R A Drew ldquoImproved techniques for in vitro propagation andgermplasm storage of papayardquo HortScience vol 27 pp 1122ndash1124 1992
[18] F Sanger S Nicklen and A R Coulson ldquoDNA sequencingwith chain-terminating inhibitorsrdquo Proceedings of the NationalAcademy of Sciences of the United States of America vol 74 no12 pp 5463ndash5467 1977
[19] S F AltschulW GishWMiller EWMyers and D J LipmanldquoBasic local alignment search toolrdquo Journal ofMolecular Biologyvol 215 no 3 pp 403ndash410 1990
[20] K E Hammond-Kosack and J D G Jones ldquoPlant diseaseresistance genesrdquo Annual Review of Plant Biology vol 48 pp575ndash607 1997
[21] G Xiao-Qin Z Hong-Zhi and L De-Bao ldquoAlternative splicingof the pre-mRNA in plantsrdquo Journal of Agricultural Biotechnol-ogy vol 14 no 5 pp 809ndash815 2005
[22] Z J Lorkovic D AWieczorek Kirk M H L Lambermon andW Filipowicz ldquoPre-mRNA splicing in higher plantsrdquo Trends inPlant Science vol 5 no 4 pp 160ndash167 2000
[23] K Iida M Seki T Sakurai et al ldquoGenome wide analysis ofalternative pre-mRNA splicing inArabidopsis thaliana based onfull length cDNA sequencesrdquoNucleic Acids Research vol 32 pp5096ndash5103 2004
[24] C S Lisenbee M J Lingard and R N Trelease ldquoArabidopsisperoxisomes possess functionally redundant membrane andmatrix isoforms of monodehydroascorbate reductaserdquo PlantJournal vol 43 no 6 pp 900ndash914 2005
[25] A W McCartney J S Greenwood M R Fabian K A Whiteand R T Mullen ldquoLocalization of the tomato bushy stunt virusreplication protein p33 reveals a peroxisome-to-endoplasmicreticulum sorting pathwayrdquo Plant Cell vol 17 no 12 pp 3513ndash3531 2005
[26] S Reumann L Babujee M Changle et al ldquoProteome analysisof Arabidopsis leaf peroxisomes reveals novel targeting pep-tides metabolic pathways and defensemechanismsrdquo Plant Cellvol 19 no 10 pp 3170ndash3193 2007
[27] C Dammann A Ichida B Hong et al ldquoSubcellular targetingof nine calcium-dependent protein kinase isoforms from Ara-bidopsisrdquo Plant Physiology vol 132 no 4 pp 1840ndash1848 2003
Figure 1 Alignment of deduced amino acid sequences of CP STK VP STK1 and VP STK2 with the sequences of STK Ricinus communis(XP002514097) Glycine max (XP003547484) and Vitis vinifera (XP002279199) Unconserved to conserved region is coloured in scale from0 to 10 and shown on the last line in each paragraph
named VP STK1 was orthologous to the STK gene and had9566 similarity to 28106 in C papaya The conservedregion was found mostly at the 51015840-end An ldquoactivation looprdquois located in exon 5 and the start of exon 6 prior to thepremature truncation of the VP STK1 gene Kinase activitycould be increased when a residue on the activation loop
close to the catalytic center is phosphorylated The isolated105 gene named VP STK2 was orthologous to the STK genein C papaya The predicted start of the VP STK2 gene isat a start codon (Met) that truncates six codons from theseventh exon of the C papaya gene This was supported byan alignment result of nucleotide sequences of c28106 of C
International Journal of Genomics 7
papaya with VP STK1 of V pubescens A deletion of one basepair of nucleotides in VP STK1 of V pubescens was observedwhen compared to the sequence in C papaya
Based on supercontig 28 of the C papaya genomesequence there are very large introns in the gene whichwould probably encourage alternative splicing These genesare adjacent in V pubescens and the orthologous gene inC papayaR communis spans both of these V pubescensgenes The VP STK1 gene is predicted to be separated fromVP STK2 because the sequence has a STOP codon in what isotherwise the middle of one of the exons of the C papayaRcommunis gene The predicted end of the VP STK1 geneis a stop codon that is not found in the C papaya or Rcommunis genes truncating 39 bp (13 codons) from the sixthexon
Inside the nucleus splicing takes place in a process calledposttranscription modification before the mRNA can bedecoded by ribosomes to produce a protein whilst in alter-native splicing two or more different mature mRNAs aredecoded by ribosome to produce multiple proteins Alterna-tive splicing predicted in this study is strongly supported bythe result of [8] who found anothermarker Opk4 1r that wasclose to the prsv-1 resistance gene in V pubescens but not inC papaya Opk4 1r has homology to a gene that codes fora small nuclear ribonuclear class of protein (snRNP) whichhas a motif known as a RNA binding domain (RBD) orribonucleoprotein (RNP)This class of proteins is involved inthe posttranscriptional gene expression processes includingmRNA and rRNA Spliceosome a large ribonucleoprotein(RNP) complex that contains small nuclear RNP particlessnRNP and other numerous protein factors including RNAhelicases and protein kinases are involved in the splicingprocess in plants [21 22] Products of alternative splicing aresignificant in cellular functions including signal transduc-tion immunity disease resistance transport regulation anddevelopment [23]
In this study VP STK2 that presumed as a protein var-iants produced by an alternative splicing in V pubescenscould be imported and ultimately resides within peroxisomeas a second peroxisomal targeting signal (PTS2) signal wasfound in the N terminus of VP STK2 but not in CP STK orVP STK1 PTS is a region of the peroxisomal protein thatrecognises and binds to the receptor This is supported by afew peroxisomal membrane proteins such as plant APX anda viral protein that are known to be delivered to peroxisomesvia distinct ER subdomains [24 25] Reference [26] in 2007reported their proteome data that support the functionof plant peroxisomes against pathogens Furthermore theexistence of protein kinases and phosphatases in plant per-oxisomes has been reported by [27] Different from CP STKand VP STK1 their mRNA is presumed to move through thenuclear pore into the cytoplasm and code into a protein Theproteins synthesized by ribosomes then become attached tothe membranes of the endoplasmic reticulum (ER) This issupported by the presence of endoplasmic reticulum (ER)membrane retention signal and the absence of PTS2 signalin both of the proteins
5 Conclusion
The findings in this study confirmed and fully supported thathypothesis of the variations of the gene (from resistant tosusceptible) was due to structural differences of the serinethreonine protein kinase sequence An alternative splicingthat occurs in V pubescens mRNA and the presence of aperoxisomal targeting signal (PTS2) in VP STK2 are hypoth-esised to be an important factor in contributing to the PRSV-P resistance in V pubescens Nevertheless a further biochem-ical analysis and gene transformation studies in the futurewill enable clarification and confirmation of the involvementof VP STK2 in transferring the PRSV-P resistance from Vpubescens to C papaya
Conflict of Interests
The authors declare that there is no conflict of interestsregarding the publication of this paper
Acknowledgments
The authors would like to thank Griffith University andMalaysian Agricultural Research and Development Institutefor the research funding and scholarship provided in thisstudy
References
[1] D Gonsalves ldquoControl of papaya ringspot virus in papaya acase studyrdquo Annual Review of Phytopathology vol 36 pp 415ndash437 1998
[2] R M Manshardt ldquoPapayardquo in Biotechnology of Perennial FruitCrops F A Hammerschlag and and R E Litz Eds pp 489ndash511Cambridge University Press Oxford UK 1992
[3] R A Drew S V Siar C M OrsquoBrien P M Magdalita and AG C Sajise ldquoBreeding for papaya ringspot virus resistance inCarica papaya L via hybridisation with Vasconcellea quercifo-liardquo Australian Journal of Experimental Agriculture vol 46 no3 pp 413ndash418 2006
[4] R A Conover andR E Litz ldquoProgress in breeding papayaswithtolerant to papaya ringspot virusrdquo Proceedings of the FloridaState Horticultural Society vol 91 pp 182ndash184 1978
[5] R A Conover ldquoA program for development of papayas tolerantto the distortion ringspot virusrdquo Proceedings of the Florida StateHorticultural Society vol 89 pp 229ndash231 1976
[6] S V Siar G A Beligan A J C Sajise V N Villegas and RA Drew ldquoPapaya ringspot virus resistance in Carica papaya viaintrogression from Vasconcellea quercifoliardquo Euphytica vol 181no 2 pp 159ndash168 2011
[7] S Dillon C Ramage R Drew and S Ashmore ldquoGeneticmapping of a PRSV-P resistance gene in ldquohighland papayardquobased on inheritance of RAF markersrdquo Euphytica vol 145 no1-2 pp 11ndash23 2005
[8] S DillonCharacterisation genetic mapping and development ofmarker selection strategies for resistance to the Papaya ringspotvirus type P (PRSV) in highland papaya [Dissertation thesis]School of Biomolecular Biomedical Science Griffith UniversityQueensland Australia 2006
8 International Journal of Genomics
[9] Q Xu and X Deng ldquoCloning and phylogenetic analyses ofserinethreonine kinase class defense-related genes in a wildfruit crop lsquochestnut rosersquordquoBMCResearchNotes vol 3 article 2022010
[10] A J Afzal A J Wood and D A Lightfoot ldquoPlant receptor-likeserine threonine kinases roles in signaling and plant defenserdquoMolecular Plant-Microbe Interactions vol 21 no 5 pp 507ndash5172008
[11] T Romeis ldquoProtein kinases in the plant defence responserdquoCurrent Opinion in Plant Biology vol 4 no 5 pp 407ndash414 2001
[12] LHaoHWangG Sunter andDMBisaro ldquoGeminivirusAL2and L2 proteins interact with and inactivate SNF1 kinaserdquo PlantCell vol 15 no 4 pp 1034ndash1048 2003
[13] A A Santos K V G Lopes J A C Apfata and E P B FontesldquoNSP-interacting kinase NIK a transducer of plant defencesignallingrdquo Journal of Experimental Botany vol 61 no 14 pp3839ndash3845 2010
[14] D W Gabriel and B G Rolfe ldquoWorking models of specificrecognition in plant-microbe interactionsrdquo Annual ReviewPhytophatology vol 28 pp 365ndash391 1990
[15] N T Keen ldquoGene-for-gene complementarity in plant-pathogeninteractionsrdquo Annual Review of Genetics vol 24 pp 447ndash4631990
[16] BW PorterM Paidi RMingMAlamWTNishijima andYJ Zhu ldquoGenome-wide analysis of Carica papaya reveals a smallNBS resistance gene familyrdquoMolecular Genetics and Genomicsvol 281 no 6 pp 609ndash626 2009
[17] R A Drew ldquoImproved techniques for in vitro propagation andgermplasm storage of papayardquo HortScience vol 27 pp 1122ndash1124 1992
[18] F Sanger S Nicklen and A R Coulson ldquoDNA sequencingwith chain-terminating inhibitorsrdquo Proceedings of the NationalAcademy of Sciences of the United States of America vol 74 no12 pp 5463ndash5467 1977
[19] S F AltschulW GishWMiller EWMyers and D J LipmanldquoBasic local alignment search toolrdquo Journal ofMolecular Biologyvol 215 no 3 pp 403ndash410 1990
[20] K E Hammond-Kosack and J D G Jones ldquoPlant diseaseresistance genesrdquo Annual Review of Plant Biology vol 48 pp575ndash607 1997
[21] G Xiao-Qin Z Hong-Zhi and L De-Bao ldquoAlternative splicingof the pre-mRNA in plantsrdquo Journal of Agricultural Biotechnol-ogy vol 14 no 5 pp 809ndash815 2005
[22] Z J Lorkovic D AWieczorek Kirk M H L Lambermon andW Filipowicz ldquoPre-mRNA splicing in higher plantsrdquo Trends inPlant Science vol 5 no 4 pp 160ndash167 2000
[23] K Iida M Seki T Sakurai et al ldquoGenome wide analysis ofalternative pre-mRNA splicing inArabidopsis thaliana based onfull length cDNA sequencesrdquoNucleic Acids Research vol 32 pp5096ndash5103 2004
[24] C S Lisenbee M J Lingard and R N Trelease ldquoArabidopsisperoxisomes possess functionally redundant membrane andmatrix isoforms of monodehydroascorbate reductaserdquo PlantJournal vol 43 no 6 pp 900ndash914 2005
[25] A W McCartney J S Greenwood M R Fabian K A Whiteand R T Mullen ldquoLocalization of the tomato bushy stunt virusreplication protein p33 reveals a peroxisome-to-endoplasmicreticulum sorting pathwayrdquo Plant Cell vol 17 no 12 pp 3513ndash3531 2005
[26] S Reumann L Babujee M Changle et al ldquoProteome analysisof Arabidopsis leaf peroxisomes reveals novel targeting pep-tides metabolic pathways and defensemechanismsrdquo Plant Cellvol 19 no 10 pp 3170ndash3193 2007
[27] C Dammann A Ichida B Hong et al ldquoSubcellular targetingof nine calcium-dependent protein kinase isoforms from Ara-bidopsisrdquo Plant Physiology vol 132 no 4 pp 1840ndash1848 2003
papaya with VP STK1 of V pubescens A deletion of one basepair of nucleotides in VP STK1 of V pubescens was observedwhen compared to the sequence in C papaya
Based on supercontig 28 of the C papaya genomesequence there are very large introns in the gene whichwould probably encourage alternative splicing These genesare adjacent in V pubescens and the orthologous gene inC papayaR communis spans both of these V pubescensgenes The VP STK1 gene is predicted to be separated fromVP STK2 because the sequence has a STOP codon in what isotherwise the middle of one of the exons of the C papayaRcommunis gene The predicted end of the VP STK1 geneis a stop codon that is not found in the C papaya or Rcommunis genes truncating 39 bp (13 codons) from the sixthexon
Inside the nucleus splicing takes place in a process calledposttranscription modification before the mRNA can bedecoded by ribosomes to produce a protein whilst in alter-native splicing two or more different mature mRNAs aredecoded by ribosome to produce multiple proteins Alterna-tive splicing predicted in this study is strongly supported bythe result of [8] who found anothermarker Opk4 1r that wasclose to the prsv-1 resistance gene in V pubescens but not inC papaya Opk4 1r has homology to a gene that codes fora small nuclear ribonuclear class of protein (snRNP) whichhas a motif known as a RNA binding domain (RBD) orribonucleoprotein (RNP)This class of proteins is involved inthe posttranscriptional gene expression processes includingmRNA and rRNA Spliceosome a large ribonucleoprotein(RNP) complex that contains small nuclear RNP particlessnRNP and other numerous protein factors including RNAhelicases and protein kinases are involved in the splicingprocess in plants [21 22] Products of alternative splicing aresignificant in cellular functions including signal transduc-tion immunity disease resistance transport regulation anddevelopment [23]
In this study VP STK2 that presumed as a protein var-iants produced by an alternative splicing in V pubescenscould be imported and ultimately resides within peroxisomeas a second peroxisomal targeting signal (PTS2) signal wasfound in the N terminus of VP STK2 but not in CP STK orVP STK1 PTS is a region of the peroxisomal protein thatrecognises and binds to the receptor This is supported by afew peroxisomal membrane proteins such as plant APX anda viral protein that are known to be delivered to peroxisomesvia distinct ER subdomains [24 25] Reference [26] in 2007reported their proteome data that support the functionof plant peroxisomes against pathogens Furthermore theexistence of protein kinases and phosphatases in plant per-oxisomes has been reported by [27] Different from CP STKand VP STK1 their mRNA is presumed to move through thenuclear pore into the cytoplasm and code into a protein Theproteins synthesized by ribosomes then become attached tothe membranes of the endoplasmic reticulum (ER) This issupported by the presence of endoplasmic reticulum (ER)membrane retention signal and the absence of PTS2 signalin both of the proteins
5 Conclusion
The findings in this study confirmed and fully supported thathypothesis of the variations of the gene (from resistant tosusceptible) was due to structural differences of the serinethreonine protein kinase sequence An alternative splicingthat occurs in V pubescens mRNA and the presence of aperoxisomal targeting signal (PTS2) in VP STK2 are hypoth-esised to be an important factor in contributing to the PRSV-P resistance in V pubescens Nevertheless a further biochem-ical analysis and gene transformation studies in the futurewill enable clarification and confirmation of the involvementof VP STK2 in transferring the PRSV-P resistance from Vpubescens to C papaya
Conflict of Interests
The authors declare that there is no conflict of interestsregarding the publication of this paper
Acknowledgments
The authors would like to thank Griffith University andMalaysian Agricultural Research and Development Institutefor the research funding and scholarship provided in thisstudy
References
[1] D Gonsalves ldquoControl of papaya ringspot virus in papaya acase studyrdquo Annual Review of Phytopathology vol 36 pp 415ndash437 1998
[2] R M Manshardt ldquoPapayardquo in Biotechnology of Perennial FruitCrops F A Hammerschlag and and R E Litz Eds pp 489ndash511Cambridge University Press Oxford UK 1992
[3] R A Drew S V Siar C M OrsquoBrien P M Magdalita and AG C Sajise ldquoBreeding for papaya ringspot virus resistance inCarica papaya L via hybridisation with Vasconcellea quercifo-liardquo Australian Journal of Experimental Agriculture vol 46 no3 pp 413ndash418 2006
[4] R A Conover andR E Litz ldquoProgress in breeding papayaswithtolerant to papaya ringspot virusrdquo Proceedings of the FloridaState Horticultural Society vol 91 pp 182ndash184 1978
[5] R A Conover ldquoA program for development of papayas tolerantto the distortion ringspot virusrdquo Proceedings of the Florida StateHorticultural Society vol 89 pp 229ndash231 1976
[6] S V Siar G A Beligan A J C Sajise V N Villegas and RA Drew ldquoPapaya ringspot virus resistance in Carica papaya viaintrogression from Vasconcellea quercifoliardquo Euphytica vol 181no 2 pp 159ndash168 2011
[7] S Dillon C Ramage R Drew and S Ashmore ldquoGeneticmapping of a PRSV-P resistance gene in ldquohighland papayardquobased on inheritance of RAF markersrdquo Euphytica vol 145 no1-2 pp 11ndash23 2005
[8] S DillonCharacterisation genetic mapping and development ofmarker selection strategies for resistance to the Papaya ringspotvirus type P (PRSV) in highland papaya [Dissertation thesis]School of Biomolecular Biomedical Science Griffith UniversityQueensland Australia 2006
8 International Journal of Genomics
[9] Q Xu and X Deng ldquoCloning and phylogenetic analyses ofserinethreonine kinase class defense-related genes in a wildfruit crop lsquochestnut rosersquordquoBMCResearchNotes vol 3 article 2022010
[10] A J Afzal A J Wood and D A Lightfoot ldquoPlant receptor-likeserine threonine kinases roles in signaling and plant defenserdquoMolecular Plant-Microbe Interactions vol 21 no 5 pp 507ndash5172008
[11] T Romeis ldquoProtein kinases in the plant defence responserdquoCurrent Opinion in Plant Biology vol 4 no 5 pp 407ndash414 2001
[12] LHaoHWangG Sunter andDMBisaro ldquoGeminivirusAL2and L2 proteins interact with and inactivate SNF1 kinaserdquo PlantCell vol 15 no 4 pp 1034ndash1048 2003
[13] A A Santos K V G Lopes J A C Apfata and E P B FontesldquoNSP-interacting kinase NIK a transducer of plant defencesignallingrdquo Journal of Experimental Botany vol 61 no 14 pp3839ndash3845 2010
[14] D W Gabriel and B G Rolfe ldquoWorking models of specificrecognition in plant-microbe interactionsrdquo Annual ReviewPhytophatology vol 28 pp 365ndash391 1990
[15] N T Keen ldquoGene-for-gene complementarity in plant-pathogeninteractionsrdquo Annual Review of Genetics vol 24 pp 447ndash4631990
[16] BW PorterM Paidi RMingMAlamWTNishijima andYJ Zhu ldquoGenome-wide analysis of Carica papaya reveals a smallNBS resistance gene familyrdquoMolecular Genetics and Genomicsvol 281 no 6 pp 609ndash626 2009
[17] R A Drew ldquoImproved techniques for in vitro propagation andgermplasm storage of papayardquo HortScience vol 27 pp 1122ndash1124 1992
[18] F Sanger S Nicklen and A R Coulson ldquoDNA sequencingwith chain-terminating inhibitorsrdquo Proceedings of the NationalAcademy of Sciences of the United States of America vol 74 no12 pp 5463ndash5467 1977
[19] S F AltschulW GishWMiller EWMyers and D J LipmanldquoBasic local alignment search toolrdquo Journal ofMolecular Biologyvol 215 no 3 pp 403ndash410 1990
[20] K E Hammond-Kosack and J D G Jones ldquoPlant diseaseresistance genesrdquo Annual Review of Plant Biology vol 48 pp575ndash607 1997
[21] G Xiao-Qin Z Hong-Zhi and L De-Bao ldquoAlternative splicingof the pre-mRNA in plantsrdquo Journal of Agricultural Biotechnol-ogy vol 14 no 5 pp 809ndash815 2005
[22] Z J Lorkovic D AWieczorek Kirk M H L Lambermon andW Filipowicz ldquoPre-mRNA splicing in higher plantsrdquo Trends inPlant Science vol 5 no 4 pp 160ndash167 2000
[23] K Iida M Seki T Sakurai et al ldquoGenome wide analysis ofalternative pre-mRNA splicing inArabidopsis thaliana based onfull length cDNA sequencesrdquoNucleic Acids Research vol 32 pp5096ndash5103 2004
[24] C S Lisenbee M J Lingard and R N Trelease ldquoArabidopsisperoxisomes possess functionally redundant membrane andmatrix isoforms of monodehydroascorbate reductaserdquo PlantJournal vol 43 no 6 pp 900ndash914 2005
[25] A W McCartney J S Greenwood M R Fabian K A Whiteand R T Mullen ldquoLocalization of the tomato bushy stunt virusreplication protein p33 reveals a peroxisome-to-endoplasmicreticulum sorting pathwayrdquo Plant Cell vol 17 no 12 pp 3513ndash3531 2005
[26] S Reumann L Babujee M Changle et al ldquoProteome analysisof Arabidopsis leaf peroxisomes reveals novel targeting pep-tides metabolic pathways and defensemechanismsrdquo Plant Cellvol 19 no 10 pp 3170ndash3193 2007
[27] C Dammann A Ichida B Hong et al ldquoSubcellular targetingof nine calcium-dependent protein kinase isoforms from Ara-bidopsisrdquo Plant Physiology vol 132 no 4 pp 1840ndash1848 2003
[9] Q Xu and X Deng ldquoCloning and phylogenetic analyses ofserinethreonine kinase class defense-related genes in a wildfruit crop lsquochestnut rosersquordquoBMCResearchNotes vol 3 article 2022010
[10] A J Afzal A J Wood and D A Lightfoot ldquoPlant receptor-likeserine threonine kinases roles in signaling and plant defenserdquoMolecular Plant-Microbe Interactions vol 21 no 5 pp 507ndash5172008
[11] T Romeis ldquoProtein kinases in the plant defence responserdquoCurrent Opinion in Plant Biology vol 4 no 5 pp 407ndash414 2001
[12] LHaoHWangG Sunter andDMBisaro ldquoGeminivirusAL2and L2 proteins interact with and inactivate SNF1 kinaserdquo PlantCell vol 15 no 4 pp 1034ndash1048 2003
[13] A A Santos K V G Lopes J A C Apfata and E P B FontesldquoNSP-interacting kinase NIK a transducer of plant defencesignallingrdquo Journal of Experimental Botany vol 61 no 14 pp3839ndash3845 2010
[14] D W Gabriel and B G Rolfe ldquoWorking models of specificrecognition in plant-microbe interactionsrdquo Annual ReviewPhytophatology vol 28 pp 365ndash391 1990
[15] N T Keen ldquoGene-for-gene complementarity in plant-pathogeninteractionsrdquo Annual Review of Genetics vol 24 pp 447ndash4631990
[16] BW PorterM Paidi RMingMAlamWTNishijima andYJ Zhu ldquoGenome-wide analysis of Carica papaya reveals a smallNBS resistance gene familyrdquoMolecular Genetics and Genomicsvol 281 no 6 pp 609ndash626 2009
[17] R A Drew ldquoImproved techniques for in vitro propagation andgermplasm storage of papayardquo HortScience vol 27 pp 1122ndash1124 1992
[18] F Sanger S Nicklen and A R Coulson ldquoDNA sequencingwith chain-terminating inhibitorsrdquo Proceedings of the NationalAcademy of Sciences of the United States of America vol 74 no12 pp 5463ndash5467 1977
[19] S F AltschulW GishWMiller EWMyers and D J LipmanldquoBasic local alignment search toolrdquo Journal ofMolecular Biologyvol 215 no 3 pp 403ndash410 1990
[20] K E Hammond-Kosack and J D G Jones ldquoPlant diseaseresistance genesrdquo Annual Review of Plant Biology vol 48 pp575ndash607 1997
[21] G Xiao-Qin Z Hong-Zhi and L De-Bao ldquoAlternative splicingof the pre-mRNA in plantsrdquo Journal of Agricultural Biotechnol-ogy vol 14 no 5 pp 809ndash815 2005
[22] Z J Lorkovic D AWieczorek Kirk M H L Lambermon andW Filipowicz ldquoPre-mRNA splicing in higher plantsrdquo Trends inPlant Science vol 5 no 4 pp 160ndash167 2000
[23] K Iida M Seki T Sakurai et al ldquoGenome wide analysis ofalternative pre-mRNA splicing inArabidopsis thaliana based onfull length cDNA sequencesrdquoNucleic Acids Research vol 32 pp5096ndash5103 2004
[24] C S Lisenbee M J Lingard and R N Trelease ldquoArabidopsisperoxisomes possess functionally redundant membrane andmatrix isoforms of monodehydroascorbate reductaserdquo PlantJournal vol 43 no 6 pp 900ndash914 2005
[25] A W McCartney J S Greenwood M R Fabian K A Whiteand R T Mullen ldquoLocalization of the tomato bushy stunt virusreplication protein p33 reveals a peroxisome-to-endoplasmicreticulum sorting pathwayrdquo Plant Cell vol 17 no 12 pp 3513ndash3531 2005
[26] S Reumann L Babujee M Changle et al ldquoProteome analysisof Arabidopsis leaf peroxisomes reveals novel targeting pep-tides metabolic pathways and defensemechanismsrdquo Plant Cellvol 19 no 10 pp 3170ndash3193 2007
[27] C Dammann A Ichida B Hong et al ldquoSubcellular targetingof nine calcium-dependent protein kinase isoforms from Ara-bidopsisrdquo Plant Physiology vol 132 no 4 pp 1840ndash1848 2003
