ROLE OF AQUAPORINS IN THE IMPROVEMENT OF ......I would like to thank the University of Navarra and...

ROLE OF AQUAPORINS IN THE IMPROVEMENT OF

ADIPOSITY AND NON-ALCOHOLIC FATTY LIVER DISEASE

AFTER BARIATRIC SURGERY

Leire Méndez Giménez de los Galanes

SCHOOL OF SCIENCES

ROLE OF AQUAPORINS IN THE IMPROVEMENT OF

ADIPOSITY AND NON-ALCOHOLIC FATTY LIVER DISEASE

AFTER BARIATRIC SURGERY

Submitted by Leire Méndez Giménez de los Galanes in partial fulfillment of the

requirements for the Doctoral Degree in Biology of the University of Navarra

This dissertation has been written under our supervision at the Metabolic Research

Laboratory of the University of Navarra and we approved its submission to the Defense

Committee.

Signed on May, 2017

Prof. Gema Frühbeck Martínez Dr. Amaia Rodríguez Murueta-Goyena

- I -

ACKNOWLEDGEMENTS

I would like to thank the University of Navarra and the CIBER Fisiopatología de

la Obesidad y Nutrición (CIBEROBN) of the Instituto de Salud Carlos III for the

financial support of this thesis (PI12/00515) and their grants for the International PhD

programme. In addition, this work has been financially supported by Fondo de

Investigación Sanitaria-FEDER (PI10/01677, PI13/01430 and PI16/01217) of the

Instituto de Salud Carlos III, the Department of Health of the Gobierno de Navarra

(61/2014) and the PIUNA project of the University of Navarra (PIUNA 2011-2014).

First and foremost, I would like to express my warmest gratitude and

appreciation to my supervisors. Prof. Gema Frühbeck, who trusted in me for the first

time, for her inestimable help in carrying out this work encouraging me to go even

further with her constant intellectual support and enthusiasm for science. She is an

epitome of the hard work towards perfection in research and effort. I also want to thank

Dr. Amaia Rodríguez, for her patience and total availability to help me in the

achievement of this thesis. She has provided invaluable guidance through this entire

scientific assignment. I thank her for the logistical support and for being a great

motivation. Furthermore, I am always going to be grateful for her suggestions,

conversations, and wisdom that she provides me on a daily basis. I appreciate all of her

time and ideas that made my PhD experience productive and stimulating. Without the

support of these two scientific titans, the present thesis would never have seen the light

of day.

I would further like to thank my current and former-colleagues of the Metabolic

Research Laboratory of the Clínica Universidad de Navarra, an awesome team with

whom I am proud to work with. I owe you my gratitude for your friendship, support and

expertise during my learning process. My deepest recognition to each and every

member of the team, I wish you all a fruitful future in this wonderful laboratory. It has

been also a pleasure to meet the students of the School of Medicine and international

PhD exchanges working in our lab during these years. Thank you for all the nice things

that we have learned together. We are lucky to have you.

I am also grateful to all the staff of the breeding house of the Centro de

Investigación Farmacológica Aplicada (CIFA) of the University of Navarra for their

invaluable work and help with the experimental animals.

- II -

I would also like to specially thank the researchers that I met at the Faculty of

Pharmacy of the University of Lisbon, a city that became my home during my

international PhD exchange. I would like to deeply thank Dr. Graça Soveral for giving

me the opportunity to learn new and interesting techniques in her research group as well

as for her continuous encouragement and guidance. I would further like to thank her

research team for the help, advice and invaluable support during the experiments. Thank

you all for your kindness, sympathy and the hospitality, making me to feel part of your

group. Thank you, for science and above all, for humanity.

In summary, I would like to point out that although only my name appears on

the cover of this work, many people have contributed to its elaboration. I owe my

gratitude to all those who made this thesis possible and have offered an unforgettable

experience to me.

Finally, to life and science, for inspiring us to learn more and more.

- III -

ABBREVIATIONS

Adipo-IR: adipose tissue insulin resistance index

AQP: aquaporin

ATGL: adipose triglyceride lipase

BAT: brown adipose tissue

BMI: body mass index

CD36: fatty acid translocase

DBP: diastolic blood pressure

DEXA: dual-energy X-ray absorptiometry

EWAT: epididymal white adipose tissue

EWL: excess weight loss

FABP: fatty acid binding protein

FATP: fatty acid transporter protein

FFA: free fatty acids

FGF: fibroblast growth factor

FXR: farnesoid X receptor

G6Pase: glucose-6-phosphatase

GH: growth hormone

GHS-R: growth hormone secretagogue receptor

GIP: gastric inhibitory peptide

GK: glycerol kinase

GLP-1: glucagon-like peptide-1

GOAT: ghrelin O-acyltransferase

HFD: high-fat diet

HOMA: homeostasis model assessment

HSL: hormone-sensitive lipase

- IV -

IL: interleukin

IPITT: intraperitoneal insulin tolerance test

IRE: insulin response element

IRS: insulin receptor substrate

HFD: high-fat diet

LPL: lipoprotein lipase

mTOR: mechanistic target of rapamycin

NAFLD: non-alcoholic fatty liver disease

NASH: non-alcoholic steatohepatitis

ND: normal diet

NO: nitric oxide

NPA: asparagine-proline-alanine motif

OGTT: oral glucose tolerance test

PEPCK: phosphoenolpyruvate carboxykinase

Pf: water permeability

Pgly: glycerol permeability

PI3K: phosphatidylinositol 3-kinase

PKA: protein kinase A

PP: pancreatic polypeptide

PPAR: peroxisome proliferator-activated receptor

PPRE: peroxisome proliferator-activated receptor response element

PRWAT: perirenal white adipose tissue

PYY: peptide YY

RYGB: Roux-en-Y gastric bypass

SBP: systolic blood pressure

SCWAT: subcutaneous white adipose tissue

- V -

SREBF1: sterol regulatory element-binding transcription factor 1

SVFC: stroma-vascular fraction cells

TGR5: G-protein-coupled receptor bile acid receptor 5

T2D: type 2 diabetes

TG: triacylglycerols

TNF- : tumor necrosis factor

UCP1: uncoupling protein 1

VLDL: very-low density lipoprotein

VRAC: volume-regulated anion channel

WAT: white adipose tissue

WHO: World Health Organization

INTRODUCTION 1

1. OBESITY 3

1.1. Classification and prevalence of obesity 3

1.2. Obesity as a health problem 4

1.3. Biological and morphological adipose tissue changes in obesity 6

1.3.1. Hypertrophy and hyperplasia of adipocytes 7

1.3.2. Alterations in adipocyte lipolysis 7

1.3.3. Adipose tissue inflammation and fibrosis 8

1.3.4. Altered secretion of adipokines 9

1.3.5. Reduced BAT mass and/or activity 10

2. BARIATRIC SURGERY 11

2.1. Types of bariatric surgery procedures 13

2.1.1. Sleeve gastrectomy 14

2.1.2. Gastric plication 16

2.1.3. Roux-en-Y gastric bypass 17

2.2. Mechanisms involved in the metabolic effects of bariatric surgery 19

2.2.1. Foregut hypothesis 19

2.2.2. Midgut hypothesis 21

2.2.3. Hindgut hypothesis 22

2.2.4. Gastric center or ghrelin hypothesis 24

3. AQUAPORINS 26

3.1. Types of aquaporins 26

3.1.1. Orthodox aquaporins 28

3.1.2. Aquaglyceroporins 28

3.1.3. Superaquaporins 30

3.2. Role of aquaglyceroporins in the onset of obesity and its associated

comorbidities 31

3.2.1. Aquaglyceroporins in lipogenesis and lipolysis 31

3.2.2. Aquaglyceroporins in hepatic gluconeogenesis and steatosis 34

3.2.3. Aquaglyceroporins in pancreatic insulin secretion 35

HYPOTHESIS AND SPECIFIC AIMS 39

ARTICLES 43

1. Role of aquaglyceroporins and caveolins in energy and metabolic

homeostasis 45

2. Sleeve gastrectomy reduces hepatic steatosis by improving the coordinated

regulation of aquaglyceroporins in adipose tissue and liver in obese rats 47

3. Role of aquaporin-7 in ghrelin- and GLP-1-induced improvement of

pancreatic -cell function after sleeve gastrectomy in obese rats 49

4. Gastric plication improves glycaemia partly by restoring the altered

expression of aquaglyceroporins in adipose tissue and liver in obese rats 51

DISCUSSION 53

1. Summary of the main findings 55

2. Effect of sleeve gastrectomy and gastric plication on body weight, whole-

body adiposity and metabolic profile in obese rats 56

3. Role of aquaglyceroporins in the improvement of adiposity after bariatric

surgery 58

4. Impact of sleeve gastrectomy and gastric plication on hepatosteatosis in

diet-induced obese rats 60

5. Role of aquaglyceroporins in the amelioration of non-alcoholic fatty liver

disease after bariatric surgery 63

6. Influence of sleeve gastrectomy on -pancreatic function in diet-induced

obese rats 66

7. Role of aquaglyceroporins in the restoration of -pancreatic function after

bariatric surgery 68

CONCLUSIONS 73

BIBLIOGRAPHY 77

OTHER RELATED PUBLICATIONS 107

1. Regulation of adipocyte lipolysis 109

2. Reduced hepatic aquaporin-9 and glycerol permeability are related to

insulin resistance in non-alcoholic fatty liver disease 111

3. Leptin administration restores the altered adipose and hepatic expression of

aquaglyceroporins improving the non-alcoholic fatty liver of ob/ob mice 113

4. Aquaporins in health and disease: new molecular targets for drug discovery 115

1

- 3 -

1. OBESITY

1.1. Classification and prevalence of obesity

Obesity has become one of the leading causes of disability and death in the last

decades (Frühbeck et al, 2013a). In this regard, the American Medical Association

declared obesity as a disease in 2013 (Atkinson, 2014). Obesity is a complex

multifactorial disorder characterized by the accumulation of excess body fat due to a

chronic imbalance between energy intake and energy expenditure (Kopelman, 2000).

Body mass index (BMI) is the most commonly used tool to define the ponderal

categories of the individuals in the clinical practice. The BMI was initially described by

Quetelet in 1869 and it is calculated as the weight (in kilograms) divided by the height

(in meters) squared. According to the cut-off points established by the World Health

Organization (WHO), overweight is defined as a BMI ranging from 25.0 to 29.9 kg/m2,

whereas obesity is diagnosed with a BMI ≥ 30.0 kg/m2 (Table 1).

Table 1. Classification of ponderal categories according to BMI cut-off points.

Classification BMI (kg/m

2)

Principal cut-off points Additional cut-off points

Underweight <18.5 <18.5

Severe thinness <16.0 <16.0

Moderate thinness 16.0-16.9 16.0-16.9

Mild thinness 17.0-18.4 17.0-18.4

Normal range 18.5-24.9 18.5-22.9

23.0-24.9

Overweight ≥25.0 ≥25.0

Pre-obese 25.0-29.9 25.0-27.4

27.5-29.9

Obese ≥30.0 ≥30.0

Obese class I 30.0-34.9 30.0-32.4

32.5-34.9

Obese class II 35.0-39.9 35.0-37.4

37.5-39.9

Obese class III ≥40.0 ≥40.0

- 4 -

Despite its wide use, BMI is only a surrogate measure of body fat and does not

provide an accurate measurement of body composition (Blundell et al, 2014) having a

high rate of misclassification of obesity (Gómez-Ambrosi et al, 2012). In this regard,

the direct measurement of body fat with precise techniques including dual-energy X-ray

absorptiometry (DEXA), air-displacement plethysmography or bioimpedance, has

enabled the classification of individuals according to the degree of their real adiposity

(Gallagher et al, 2000). The cut-off points according to the percentage of body fat have

been established between 20.1-24.9% for men and 30.1-34.9%

for women for

overweight, and ≥25.0% for men and ≥35.0% for women for obesity (Gómez-Ambrosi

et al, 2012).

During the past few decades the prevalence of obesity and overweight has

reached epidemic proportions worldwide with this condition being a major contributor

to the global burden of disease (Ng et al, 2014). The prevalence of obesity is increasing

not only in industrialized countries, but also in non-industrialized ones, particularly in

those undergoing economic transition (Scully, 2014). Globally, more than 2.1 million

adults are overweight with 671 million of them being obese (Ng et al, 2014). Based on

the latest estimates from the WHO in the European Union countries, the prevalence of

obesity has tripled since the 1980s with overweight and obesity affecting 50% of the

European population (Frühbeck et al, 2013a). The prevalence of childhood obesity is

also rising in low-income and middle-income countries with the global number of

overweight children under the age of 5 years being 42 million, 31 million of them living

in developing countries in 2014 (Farpour-Lambert et al, 2015). In Spain, the world's

fifty-second and Europe's fourth largest country, the prevalence of obesity in the adult

population is estimated in 22.9% (22.4% men and 21.4% women) while that of

overweight is 39.4% (46.4% in men and 32.5% in women) according to the data of the

ENRICA study (Gutiérrez-Fisac et al, 2012).

1.2. Obesity as a health problem

Overweight and obesity are the 5th

leading risk for global deaths according to the

WHO and, hence, the prevention of obesity has been declared as a major public health

priority in many countries (Uerlich et al, 2016). In this regard, obesity is commonly

associated with the onset of several pathologies, including insulin resistance,

cardiovascular diseases, sleep apnea and several types of cancer, among others (Figure

1) (Kopelman, 2000, Kanneganti et al, 2012). Upper-body or visceral obesity,

https://en.wikipedia.org/wiki/List_of_countries_and_outlying_territories_by_area

https://en.wikipedia.org/wiki/Area_and_population_of_European_countries

- 5 -

characterized by the accumulation of fat in the abdominal region, is a major contributor

to the development of hypertension, insulin resistance, dyslipidemia and premature

death (Yusuf et al, 2005, Kuk et al, 2006). By contrast, individuals with lower-body or

gynoid obesity, characterized by the accumulation of fat in the subcutaneous gluteo-

femoral depots, exhibit a lower morbidity and mortality risk than subjects with visceral

obesity (Rodríguez et al, 2007a). Obesity increases the risk of cardiovascular disease

(Rimm et al, 1995) as a result of obesity-related dyslipidemia and atherosclerosis

(Grundy, 2004).

Figure 1. Diagram of some of the co-morbidities associated with obesity.

Excess adiposity is particularly associated with increased risk of developing type

2 diabetes (T2D) with overweight and obesity probably accounting for about 80-90% of

T2D cases (Astrup et al, 2000). This disorder is determined by two main alterations: i)

insulin resistance in target peripheral tissues such as liver, skeletal muscle and adipose

tissue; and, ii) a dysfunction of β-cells in the pancreas leading to insufficient insulin

production (Catalán et al, 2009). Obesity is characterized by elevated fasting plasma

insulin, exaggerated insulin response to an oral glucose load as well as impaired insulin

sensitivity (Kopelman, 2000). Moreover, the incidence of macrovascular (coronary

artery disease, peripheral arterial disease, and stroke) and microvascular complications

- 6 -

(diabetic nephropathy, neuropathy, and retinopathy) of T2D is aggravated in the obese

state (Sjöstrom et al, 2014).

Non-alcoholic fatty liver disease (NAFLD) is a pathology characterized by

intrahepatic triacylglycerol (TG) overaccumulation, which is commonly associated with

obesity, dyslipidemia, insulin resistance and T2D (Chalasani et al, 2012). NAFLD

encompasses a spectrum that ranges from simple steatosis to non-alcoholic

steatohepatitis (NASH), which can result ultimately in liver fibrosis and cirrhosis

(European Association for the Study of the Liver et al, 2016). The severity of steatosis

is closely associated with the amount of visceral fat, BMI and body fat percentage, but

is weakly associated with the amount of subcutaneous fat (Kelley et al, 2003).

Advanced forms of NAFLD appear more frequently in obese patients with associated

comorbidities such as insulin resistance and central obesity (Dixon et al, 2001). The

prevalence of NAFLD and NASH increases from around 20% and 3%, respectively, in

the general population, to 75% and 25-70%, respectively, in morbid obesity (Boza et

al, 2005, Machado et al, 2006).

1.3. Biological and morphological adipose tissue changes in obesity

The adipose tissue is mainly composed by adipocytes, but also contains

heterogeneous cell populations in the stroma-vascular fraction (SVF), such as

mesenchymal stem cells, preadipocytes, endothelial cells, pericytes or immune cells,

among others (Frühbeck, 2008). Traditionally, two types of adipose tissue have been

distinguished depending on their morphological and functional characteristics: white

(WAT) and brown (BAT) adipose tissue (Giralt et al, 2013). White adipocytes are

spherical cells of 20-200 m of diameter, formed by a large lipid droplet occupying

most of the cell that displaces the nucleus and the cytoplasm to the periphery (Frühbeck,

2008). The main functions of WAT are the storage of energy in the form of TG, thermal

insulation and secretion of adipocyte-derived factors termed “adipokines” that regulate

diverse biological processes in an autocrine, paracrine and endocrine fashion (Figure

2). WAT is located in different regions, including subcutaneous, abdominal or visceral,

retroperitoneal, inguinal and gonadal fat depots (Cinti, 2012). Brown adipocytes are

smaller cells (15-60 μm) with polygonal shape, multilocular lipid droplets, multiple

mitochondria and a central nucleus (Giordano et al, 2014). The main biological function

of BAT is adaptive thermogenesis by the activation of uncoupling protein 1 (UCP1), but

it can also act as a TG reservoir and secrete adipokines, although to a lesser extent than

- 7 -

WAT (Frühbeck et al, 2009). In 2010 the existence of a third type of fat cells, termed

beige adipocytes, was described, which have morphology of brown adipocytes inside

the WAT (Wu J. et al, 2012). The acquisition of this phenotype similar to brown

adipocytes occurs after the exposure to cold, stimulation of -adrenergic receptors or

treatment with peroxisome proliferator-activated receptor (PPAR ) agonists, in a

process called "fat browning" (Nedergaard et al, 2013).

The pathological expansion of the adipose tissue in obesity induces profound

biological and morphological changes in WAT and BAT, ultimately leading to obesity-

associated pathologies (Rodríguez et al, 2015b), as explained below.

1.3.1. Hypertrophy and hyperplasia of adipocytes

Adipose tissue growth is a strictly regulated process, since both excess adipose

tissue (overweight or obesity) and total or partial absence of adipose tissue (congenital

or acquired lipodystrophies) are associated with severe metabolic disorders (Arner E. et

al, 2010). The precursors of adipocytes originate in the prenatal period. During

childhood the adipose tissue is expanded mainly by increasing the number of adipocytes

with two peaks of hyperplasia, after birth and prepuberty. In adolescence the adipocyte

proliferation rate decreases and remains relatively constant in the adult period, a stage in

which adipose tissue grows by an increase in adipocyte size (Spalding et al, 2008, Arner

P. et al, 2013). In this sense, overweight individuals initially exhibit hypertrophy of

adipocytes with no relevant changes in the number of fat cells. However, a positive

energy balance condition perpetuated over time translates into an increase in both

number and size of adipocytes, leading to further hyperplasia in the obese state.

Adipocyte hypertrophy in obese patients is associated with alterations in mitochondrial

function, changes in membrane proteins, increased degree of apoptosis and

inflammation of adipose tissue, which contribute to the development of obesity-

associated pathologies (Heinonen et al, 2014). These alterations are more evident in

patients with visceral obesity.

1.3.2. Alterations in adipocyte lipolysis

In circumstances of negative energy balance such as fasting or exercise

adipocytes hydrolyze TG into free fatty acids (FFA) and glycerol to meet physiological

needs (Frühbeck et al, 2014). Adipocyte lipolysis is mainly controlled by

catecholamines, insulin and natriuretic peptides (Langin, 2006). Circulating FFA and

- 8 -

glycerol concentrations are elevated in obesity, suggesting an increase in overall

lipolysis during fasting (Rodríguez et al, 2011b). Several impairments in adipocyte

lipolysis have been reported in obese individuals, including an altered responsiveness to

catecholamines that regulate lipolysis via the lipolytic -receptors ( 1, 2 and 3) and

anti-lipolytic 2-receptors (Jocken et al, 2008). These abnormalities in catecholamine

function promote the release of FFA from the visceral adipocytes through the portal

system providing FFA as a substrate for hepatic lipoprotein metabolism or glucose

production (Unger, 2002). Moreover, the overload of FFA reduces hepatic degradation

of apolipoprotein B and insulin, which may contribute to the dyslipidemia,

hyperinsulinemia and insulin resistance observed in visceral obesity (Bergman et al,

2000, Després, 2006). The release of FFA is a limiting step for hepatic synthesis of

very-low density lipoproteins (VLDL) that may further contribute to the dyslipidemia of

visceral obesity (Carr et al, 2004). Therefore, regional variations in the lipolytic rate and

the production of FFA underlie, in part, the metabolic disorders (insulin resistance,

hyperinsulinemia and dyslipidemia) linked to an increased visceral adiposity (Rodríguez

et al, 2007a).

1.3.3. Adipose tissue inflammation and fibrosis

Obesity is a chronic low-grade inflammatory state. In this sense, the pathological

expansion of adipose tissue in obesity is associated with an increased recruitment of

macrophages and other immune cells, higher secretion of proinflammatory adipokines,

as well as alterations in extracellular matrix components of the adipose tissue, which

aggravate the systemic inflammation of obese individuals (Ouchi et al, 2011,

Kanneganti et al, 2012). In physiological conditions adipose tissue inflammation is

suppressed by anti-inflammatory interleukins (IL-4, 10 or 13) secreted by eosinophils

and Th2 and Treg cells embedded in the adipose tissue. However, excess adiposity

favors the infiltration of macrophages, neutrophils, foam cells, T and B lymphocytes,

mast and dendritic cells into adipose tissue (Weisberg et al, 2003, Elgazar-Carmon et al,

2008, Liu J. et al, 2009, Wu D. et al, 2011, Shapiro et al, 2013). A characteristic feature

of inflammation associated with obesity is the polarization of macrophages into a

proinflammatory M1 profile (Lumeng et al, 2007) as well as the transformation of anti-

inflammatory Th2 lymphocytes into Th1 and Th17 inflammatory cells, particularly in

visceral fat (Kintscher et al, 2008, Eljaafari et al, 2015). Another histological feature of

adipose tissue inflammation is an increased adipocyte apoptosis surrounded by

- 9 -

macrophages, forming “crown-like” structures (Cinti et al, 2005). Adipocytes

themselves favor this inflammatory microenvironment by the secretion of

proinflammatory cytokines, chemokines and alarmins (Catalán et al, 2007).

Obese subjects present a lower production of elastin and an increased synthesis

of collagen type I, III, V and VI, fibronectin and laminin in the adipose tissue, which

favors the appearance of fibrotic zones that are more abundant in visceral than

subcutaneous fat (Sun et al, 2013, Reggio et al, 2016). This alteration in extracellular

matrix remodeling decreases the flexibility of the adipose tissue contributing to its

dysfunction and inflammation (Henegar et al, 2008, Khan et al, 2009, Mutch et al,

2009). Likewise, fibrosis of adipose tissue limits its expansion capacity, which favors

the ectopic accumulation of lipids in peripheral tissues such as liver, pancreas, skeletal

muscle or heart, generating a phenomenon called lipotoxicity (Virtue et al, 2010). Thus,

adipose tissue fibrosis contributes indirectly to the development of hyperinsulinemia,

hyperglycemia and dyslipidemia associated with visceral obesity. In addition, adipose

tissue stiffness is associated with an increase in markers of hepatocellular damage as

well as higher liver steatosis and fibrosis (Abdennour et al, 2014).

1.3.4. Altered secretion of adipokines

In 1987, adipsin (or complement factor D) was identified as a highly

differentiation-dependent gene in 3T3-L1 adipocytes (Cook et al, 1987). In 1993, an

increased expression of tumor necrosis factor (TNF- was detected in the adipose

tissue from rodent models of obesity, providing a functional link between obesity and

inflammation (Hotamisligil et al, 1993). One year later, leptin was discovered as an

adipokine that regulates food intake and energy expenditure in an endocrine manner

(Zhang Y. et al, 1994). Nowadays, it is well known that adipose tissue produces a huge

variety of adipokines involved in the regulation of appetite, glucose and lipid

metabolism, cardiovascular homeostasis and reproduction, among other biological

functions (Frühbeck et al, 2013b, Rodríguez et al, 2015b). A further relevant group of

adipokines is represented by acute-phase reactants, cytokines, chemokines, damage-

associated molecular pattern molecules and pro- and anti-inflammatory factors (Figure

2). Obesity is associated with an altered secretion of adipokines with a special

upregulation in the secretion of pro-inflammatory adipokines and a downregulation of

the anti-inflammatory adiponectin caused by excess adiposity and adipocyte

- 10 -

dysfunction, that promote inflammatory responses and metabolic dysfunction (Ouchi et

al, 2011).

Figure 2. Factors secreted by white adipose tissue [modified from (Frühbeck et al, 2013b)].

1.3.5. Reduced BAT mass and/or activity

BAT represents a small fraction of total adiposity (~0.1%), but it has a great

ability to dissipate energy through the clearance of FFA, glucose consumption and the

generation of heat during the thermogenesis process (Frühbeck et al, 2009, Nedergaard

et al, 2011, Lee P. et al, 2015). BAT activity is induced in response to cold and by

activation of the sympathetic nervous system (Virtanen et al, 2009). Likewise, brown

fat activity is higher in women than in men, and shows a progressive decline with age

(Bauwens et al, 2014). In this sense, obese subjects present a reduction in the size

and/or activity of brown and beige fat depots, which could contribute to the

development of deleterious complications of obesity. An inverse correlation between

BAT and total adiposity, BMI and fasting glycemia has been observed (Cypess et al,

2009, Saito et al, 2009, Ouellet et al, 2011). Interestingly, the interscapular region

presents a greater expression of a classic marker of brown adipocytes, ZIC1 (Lidell et

- 11 -

al, 2013), whereas the supraclavicular zone presents a greater expression of the marker

of beige adipocytes TBX1 (Wu J. et al, 2012). Thus, the different populations of brown

and beige adipocytes in these anatomical regions respond differentially to external

stimuli thereby constituting different potential targets for therapeutic interventions. The

discovery of brown and beige fat in adult individuals has opened a wide field of

research focused on these tissues as a potential therapeutic target for developing anti-

obesity drugs, given the thermogenic capacity of both fat depots (Lidell et al, 2013).

2. BARIATRIC SURGERY

The management of overweight and obesity starts with lifestyle interventions

consisting of a high-quality diet accompanied by an exercise prescription describing

frequency, intensity, type, and time with a minimum of 150-minute moderate weekly

activity (Bray et al, 2016). The benefits of this approach include appreciable reductions

in visceral obesity and cardiometabolic risk factors (Ross et al, 2009). However,

lifestyle modification alone has failed to ameliorate the obesity epidemic due to longer-

term weight maintenance difficulty, needing the implementation of effective

pharmacological treatment (Anthes, 2014). The indications for adding pharmacotherapy

include a history of failure to achieve clinically meaningful weight loss (>5% of total

body weight) and to sustain lost weight, for patients with a BMI≥30 kg/m2 or a BMI

ranging from 27.0-29.9 kg/m2 with one major obesity-related comorbidity (i.e.

hypertension, diabetes, obstructive sleep apnea, among others) (Toplak et al, 2015).

Nowadays, approved medications for obesity treatment worldwide are orlistat,

naltrexone/bupropion, and liraglutide in Europe; in the USA, lorcaserin and

phentermine/topiramate are also available. Current treatments for weight loss with

lifestyle interventions (diet and exercise) and pharmacotherapy have a high failure rate

(Anthes, 2014, Toplak et al, 2015).

Bariatric surgery has been shown to be the most effective treatment to achieve

sustained weight loss and to improve the morbidity and mortality in severe obese

patients (Buchwald et al, 2009, Schauer et al, 2012, Sjöström, 2013). Most of the initial

evidence is derived from the non-randomized, prospective, controlled Swedish Obese

Subjects (SOS) study, which was the first long-term clinical trial to provide information

on the beneficial effects of bariatric surgery (Sjöström et al, 2004, Sjöström et al, 2007).

The SOS study started in 1987, enrolled 2,037 obese individuals, and is following them

- 12 -

up for over 20 years. Among the surgery group, patients underwent vertical banded

gastroplasty (69%), gastric banding (19%), or Roux-en-Y gastric bypass (RYGB) (12%)

(Figure 3). The SOS study was the first study to demonstrate a sustained long-term

weight loss of up to 40%, a 24% reduction in overall mortality, mainly because of the

reduced risk of myocardial infarction and cancer (in women), as well as a significant

improvement in T2D compared with an observational control group (Sjöström et al,

2004, Sjöström et al, 2007, Sjöström, 2008, Sjöström et al, 2012, Sjöström, 2013,

Sjöstrom et al, 2014). In 2006, the multicenter observational cohort study Longitudinal

Assessment of Bariatric Surgery (LABS) enrolled 2,458 patients undergoing bariatric

surgery for the first time and largely included mixed surgical procedures (70.7%

RYGB, 24.8% gastric banding and 4.5% other procedures) compared with the SOS

study (Courcoulas et al, 2013, Courcoulas et al, 2015). Three years after the surgical

interventions, percentages of weight loss from baseline were 31.5% and 15.9% for

RYGB and gastric banding, respectively.

Figure 3. Long-term weight loss according to the bariatric surgery technique in the SOS study [modified

from (Sjöström et al, 2007)].

Currently, the selection criteria for bariatric surgery for morbid obese patients

between 18-60 years include a BMI≥40 kg/m2

or BMI≥35 kg/m2 with associated

comorbidities susceptible to improve with weight loss (Fried et al, 2013, Fried et al,

- 13 -

2014). These BMI thresholds should be reduced by 2.5 points for individuals of Asian

genetic background (Fried et al, 2014). Moreover, the positive effects of bariatric

surgery, especially with respect to improvements in T2D have expanded the eligibility

criteria for metabolic surgery to obese patients with T2D and a BMI of 30-35 kg/m2

(Moncada et al, 2016b, Rubino et al, 2016).

Given the global obesity burden it is not surprising that bariatric surgery has

increased in popularity due to its ability to produce long-term weight loss that is

superior to traditional weight loss treatments in both magnitude and durability

(Frühbeck, 2015).

2.1. Types of bariatric surgery procedures

Traditionally, surgical procedures are classified in three major categories:

restrictive, malabsorptive and mixed techniques (Figure 4). Restrictive procedures limit

food intake by reducing the size or capacity of the stomach, and include adjustable

gastric banding, sleeve gastrectomy and gastric plication techniques. Malabsorptive

procedures, such as duodenal-jejunal bypass or jejuno-ileal bypass, are based on the

removal of portions of small intestine, thereby decreasing nutrient absorption (Tack et

al, 2014) and require the supplementation with vitamins and minerals in order to avoid

deficiency diseases, such as anemia or osteoporosis (Alvarez-Leite, 2004). Finally,

mixed techniques are a combination of restrictive and malabsorptive techniques and

include the RYGB, biliopancreatic diversion and duodenal switch (DeMaria, 2007).

- 14 -

Figure 4. Types of bariatric surgery [modified from (Algahtani et al, 2016)].

Nowadays, the most commonly used bariatric surgery techniques are sleeve

gastrectomy and RYGB, while gastric plication constitutes a relatively recent restrictive

bariatric surgery procedure to induce weight loss in morbid obesity (Talebpour et al,

2012). The type of bariatric procedure performed depends on patient characteristics and

surgeon’s preferences.

2.1.1. Sleeve gastrectomy

Sleeve gastrectomy is a restrictive procedure that leaves a tube-like portion after

excising the fundus and greater curvature of the stomach (Deitel et al, 2008, Katz et al,

2011) (Figure 5). In recent years, it has emerged as a widely applied technique due to

simplicity of the surgical technique and improvement of obesity and its associated

comorbidities. Sleeve gastrectomy constitutes an effective technique for weight loss in

humans (Deitel et al, 2008, Gagner et al, 2013) and in experimental models of genetic

and diet-induced obesity (de Bona Castelan et al, 2007, Valentí et al, 2011, Rodríguez

et al, 2012b, Rodríguez et al, 2012a) as well as for the improvement of -cell

dysfunction, insulin resistance and remission of T2D after weight loss (Eickhoff et al,

2015).

- 15 -

Figure 5. Diagram of the sleeve gastrectomy procedure [modified from (Scott et al, 2011)]. Red lines

indicate surgical manipulations, and green arrows indicate nutrient flow. The stomach is

transected from the greater curvature (A) in a cephalad direction in parallel to the sleeve until the

angle of His is reached.

The percentage of excess weight loss (%EWL) is around 63-75% within the first

year being supposedly similar to that achieved after RYGB (Scott et al, 2011) not only

in the first year, but also beyond 5 years (Braghetto et al, 2012). It also has a low

complication rate with leaks, suture-line hemorrhage, post-operation gastroesophageal

reflux, vomiting and dumping syndrome being the most common associated

disturbances (Deitel et al, 2008, Scott et al, 2011, Tack et al, 2014). The mortality rate

of this bariatric surgery technique in experimented hands is typically of 0.1-0.5%,

similar to cholecystectomy and hysterectomy (Rubino et al, 2016). Growing evidence

suggests that proficiency of the operating surgeon is an important factor determining

mortality, complications, reoperations, and readmissions (Birkmeyer et al, 2013).

Sleeve gastrectomy can offer a durable solution for the control of T2D with the

improvement and resolution of T2D being 75% and 47%, respectively (Frühbeck,

2015). Sleeve gastrectomy elicits an improvement in insulin sensitivity comparable to

that observed after RYGB (Ribaric et al, 2014, Schauer et al, 2014). More specifically,

changes in fasting blood glucose and homeostasis model assessment (HOMA) index are

comparable as early as 1 week and persist for at least 52 weeks after sleeve gastrectomy

and RYGB (Woelnerhanssen et al, 2011). Sleeve gastrectomy also improves liver

morphology as well as the spectrum of liver diseases of NAFLD (including NASH)

(Mattar et al, 2005, Stratopoulos et al, 2005, Mathurin et al, 2009, Taitano et al, 2015).

Sleeve gastrectomy also induces an improvement in hyperlipidemia of 44% leading to a

- 16 -

reduced risk of cardiovascular disease in obese patients. In line with these observations,

sleeve gastrectomy reduces systolic (SBP) as well as diastolic (DBP) blood pressure

with a resolution of hypertension of 66% (Sjöström et al, 2004, Vidal et al, 2008,

Iannelli et al, 2011, Sjöström et al, 2012, Frühbeck, 2015). The beneficial effects of

sleeve gastrectomy on insulin sensitivity and blood pressure values are independent of

surgical trauma, aging and food intake reduction as evidenced in experimental models

of genetic and diet-induced obesity (Rodríguez et al, 2012b, Rodríguez et al, 2012a,

Moncada et al, 2016c).

2.1.2. Gastric plication

Gastric plication resembles sleeve gastrectomy without gastric resection, since it

is performed by invagination of the greater gastric curvature creating a narrow gastric

tube (Ramos et al, 2010, Brethauer et al, 2011, Broderick et al, 2014, Ji et al, 2014)

(Figure 6). After gastric plication, obese patients experience appetite reduction, food

intake restriction and early satiety with relatively rapid weight loss (Talebpour et al,

2007, Ramos et al, 2010, Brethauer et al, 2011, Huang et al, 2012). Gastric plication

induces weight loss in morbid obese patients (Talebpour et al, 2012, Niazi et al, 2013,

Verdi et al, 2015, Chouillard et al, 2016) and animal models of obesity (Fusco et al,

2006, Guimarães et al, 2013), with all authors reporting a significant %EWL around

50% the first 6 months and 60-65% in the first year (Kourkoulos et al, 2012). New

studies with longer follow-up periods indicate a durable result for up to 36 months

(Talebpour et al, 2007). As compared to laparoscopic sleeve gastrectomy, gastric

plication could offer advantages including technical simplicity, low complication rate

such as gastric perforation and bleeding, similar weight loss patterns, preservation of the

integrity of the stomach, potential reversibility and lower operative cost (Talebpour et

al, 2007, Ramos et al, 2010). Recent reports demonstrate that gastric plication is

associated with a 30-day mortality of 0% in morbid obese patients (Kourkoulos et al,

2012, Talebpour et al, 2012). The disadvantages include higher risk of post-operative

nausea and vomiting, a non-zero risk of perforation and bleeding, and likely

unsustainable weight loss (Broderick et al, 2014).

- 17 -

Figure 6. Diagram of gastric plication procedure [modified from (Ramos et al, 2010)]. External view (A)

and cross-section (B) of the stomach. The dotted line indicates the cut-off point.

The remission rate of T2D after gastric plication is 57% (Buchwald et al, 2009).

However, a recent study (Talebpour et al, 2015) showed that gastric plication achieved

T2D remission in 92% of the studied patients, with improvement of blood glucose

levels in the remaining 8%. The observed improvement in glycemia was also

accompanied by substantial improvements in hypertension and dyslipidemia. Due to its

recent appearance, more studies are needed in order to demonstrate the tissue impact of

gastric plication in long-term weight loss and improvement of obesity-related diseases.

2.1.3. Roux-en-Y gastric bypass

RYGB involves the reduction of the gastric size by creating a 15-30 mL stomach

pouch and bypassing the duodenum and part of the jejunum, therefore, decreasing the

absorption of nutrients (DeMaria, 2007, Scott et al, 2011) (Figure 7). It constitutes one

of the most frequently used bariatric surgery techniques, given its effectiveness for

weight loss and improvement of obesity-related comorbidities, such as T2D (Dirksen et

al, 2012). The weight loss induced by RYGB is, on average, 25–30% of total body

weight at 12–18 months post-operatively, and is maintained for at least 10 years after

surgery in most patients (Sjöström et al, 2007). Studies of body composition with

DEXA and air-displacement plethysmography have demonstrated a reduction of total

body fat, especially visceral adipose tissue, following RYGB (Olbers et al, 2006,

Gómez-Ambrosi et al, 2015). The major complications of RYGB include bowel

obstructions, cholelithiasis, leakage of enteric contents, internal hernia and gastric

fistulas (Higa et al, 2000, Blachar et al, 2002). In addition, one important disadvantage

of RYGB constitutes the chronic malabsoption of calcium, iron, folate and vitamin D,

- 18 -

among others, that can lead to nutrient deficiency-related diseases, such as anemia or

osteoporosis (DeMaria, 2007). In this sense, the European Guidelines on metabolic and

bariatric surgery recommend the prescription of daily oral vitamin and micronutrient

supplements to compensate for their possible reduced intake and absorption (Fried,

2013). Wound or respiratory infections also constitute minor complications of RYGB

(Blachar et al, 2002). Nowadays, the perioperative mortality of laparoscopic RYGB has

decreased to 0.2% (Longitudinal Assessment of Bariatric Surgery et al, 2009).

Figure 7. Diagram of Roux-en-Y gastric bypass technique [modified from (Scott et al, 2011)]. Red lines

indicate surgical manipulations, and green arrows indicate nutrient flow. Small gastric pouch is

created by division of the stomach at (A). The jejunum is divided 30-75 cm from the ligament of

Treitz, and the distal end is anastomosed to the gastric pouch (B), creating the roux limb. The

incongruent proximal end is reanastomosed to the alimentary limb 75-150 cm from the

gastrojejunostomy (C).

RYGB results in a significant and rapid improvement of glycemia in patients

with impaired glucose tolerance or T2D with an 80-95% remission of hyperglycemia

and an 80% T2D resolution, which allows the discontinuation of anti-diabetic

medications (Pories et al, 1995, Schauer et al, 2003, Buchwald et al, 2009). The

reversal of hyperglycemia is superior to diet alone (Laferrère et al, 2008) and,

remarkably, this improvement can be seen within days after the operation, prior to any

significant weight loss (Rubino et al, 2004). In addition, RYGB restores the pancreatic

-cell responsiveness to glucose at short-term (Kashyap et al, 2010) and 2 years after

surgery (Kashyap et al, 2013).

- 19 -

RYGB ameliorates all the characteristic morphological features of NAFLD-

NASH, namely steatosis, ballooning, necroinflammation, and fibrosis, after significant

weight reduction (Clark et al, 2005, Barker et al, 2006). These beneficial changes

occurred despite significant NAFLD histopathology at baseline and significant weight

loss, a combination that has been shown in some studies to worsen hepatic

inflammation and fibrosis. In line with this observation, RYGB can also correct plasma

lipid derangements associated with obesity (97% hyperlipidemia improvement)

(Frühbeck, 2015) leading to a reduced risk of cardiovascular disease in patients,

producing a reduction of SBP and DBP values (Sjöström et al, 2004, Iannelli et al,

2011) with a resolution of hypertension of 68% (Frühbeck, 2015).

2.2. Mechanisms involved in the metabolic effects of bariatric surgery

The precise mechanisms involved in the improvement of the beneficial effects of

bariatric surgery remain unclear (Frühbeck, 2015). The reduction of the gastric size and

the subsequent decrease in food intake contribute to the resolution of obesity-related

comorbidities (Ashrafian et al, 2011). However, changes in gastrointestinal hormones,

such as ghrelin, glucagon-like peptide 1 (GLP-1), gastric inhibitory peptide (GIP) or

peptide YY (PYY) also play a role in the rapid metabolic changes observed after

bariatric surgery (Zhu et al, 2016). In addition, growing evidence supports the important

contribution of: i) bile flow alterations; ii) vagal manipulation; iii) anatomical

rearrangement and altered flow of nutrients; iv) modifications of gut microbiota in the

resolution of diabetes and other pathologies associated to obesity (Ashrafian et al, 2011,

Frühbeck, 2015). These metabolic outcomes are achieved through weight-independent

and weight-dependent mechanisms. None of the currently available hypotheses (foregut,

midgut and hindgut hypotheses as well as gastric center hypothesis; all explained

below) is able to fully explain the improved whole-body metabolism achieved by

different bariatric surgical procedures (Ashrafian et al, 2011, Zhu et al, 2016). Further

research elucidating the precise metabolic mechanisms of diabetes resolution after

surgery can lead to improved operations and disease-specific procedures.

2.2.1. Foregut hypothesis

The foregut hypothesis (Figure 8) proposes that food bypassing the duodenum

and proximal jejunum leads to a weight-independent decrease in supposedly unknown

anti-incretin hormones, which improves insulin sensitivity (Rubino et al, 2006). In this

sense, the duodenal-jejunal bypass greatly improves diabetes in Goto-Kakizaki rats, a

- 20 -

non-obese animal model of T2D (Rubino et al, 2006). Analogously, strong support for

the foregut hypothesis has come from the use of the EndoBarrier, an endoluminal

device designed to mimic the duodenal-jejunal bypass achieved with RYGB, which

produces significant weight loss, resolution of T2D and improvement in the

cardiovascular risk factor profile (Patel et al, 2013). The major proposed mechanism

whereby bypass of the foregut improves glucose tolerance is via an enhanced incretin

response (Preitner et al, 2004). The two major incretins, GIP and GLP-1, enhance

glucose-dependent insulin release. GIP is mainly secreted from duodenal K-cells,

whereas GLP-1 is primarily secreted by L-cells of the ileum, although both incretins are

detected throughout the intestine (Mortensen et al, 2000). The exclusion of the foregut

with RYGB enables a rapid reach of ingested food to the hindgut, leading to an

increased postprandial secretion of GLP-1 and the subsequent insulin secretion (Salehi

et al, 2011). In addition to this “incretinic effect”, the passage of nutrients through the

intestinal foregut activates a negative feedback mechanism (“anti-incretin” or decretin)

to balance the effects of incretins aimed to prevent hypoglycemia (Rubino et al, 2004,

Alfa et al, 2015). Anti-incretins interfere with pathways of incretins to inhibit insulin

action. In predisposed individuals, chronic stimulation with particular nutrients may

create an imbalance between incretin and anti-incretin signals, resulting in insulin

resistance and T2D (Rubino et al, 2006, Kamvissi et al, 2015). However, the foregut

hypothesis cannot be the sole explanation for the marked weight loss and improvement

in glucose metabolism, since sleeve gastrectomy and gastric banding, two bariatric

procedures that reduce the volume of the stomach without bypassing of the small

intestine, also induce significant weight loss and sustained improvement in the control

of glycemia (Zhu et al, 2016).

- 21 -

Figure 8. Diagram of the foregut hypothesis postulating that, in addition to the well-known incretin

effect, nutrient passage through the proximal small intestine (duodenum and jejunum) could also

activate negative feedback mechanisms (anti-incretins) to balance the effects of incretins. An

imbalance between incretin and anti-incretin signals could result in insulin resistance and T2D

[modified from (Rubino et al, 2006)]. Dotted lines represent de inhibition of the pathway.

2.2.2. Midgut hypothesis

The “midgut hypothesis” or intestinal/hepatic regulation hypothesis (Figure 9)

proposes that the shunting of nutrients to the distal small intestine increases the

absorption of lipids by increasing bile flow (Pournaras et al, 2013). Both fasting and

postprandial serum bile acid concentrations increase significantly after RYGB

(Nakatani et al, 2009, Steinert et al, 2013). Bile acids are derived from cholesterol or

oxysterols in the liver and they are released postprandially into the duodenum to mix

with ingested nutrients. Bile acids promote fat absorption mainly in the ileum, although

the colon can contribute to further bile acid absorption. A small percentage of bile acids

are deconjugated by gut bacteria, forming secondary bile acids, which are reabsorbed or

excreted in the feces (Sayin et al, 2013). Over the past few years, bile acids have

evolved from being considered as simple lipid solubilizers to complex metabolic

integrators. Bile acids can act on the intestinal nuclear receptor FXR (farsenoid-X

receptor, also known as NR1H4) and the G-protein-coupled receptor TGR5 to reduce

body weight and improve glucose tolerance (Ryan et al, 2014). The transintestinal bile

acid flux activates intestinal FXR, inducing synthesis and secretion into the circulation

of the ileal-derived enterokine fibroblast growth factor (FGF)-19 (FGF-15 in mice),

which can improve glucose tolerance by regulating insulin-independent glucose efflux

and by repressing bile acid synthesis and gluconeogenesis in mice (Fang et al, 2015,

- 22 -

Penney et al, 2015). In addition, bile acids promote the secretion of GLP-1 and PYY

from intestinal L-cells via the activation of TGR5, which constitutes another mechanism

to improve insulin sensitivity and whole-body glucose metabolism (Katsuma et al,

2005).

Figure 9. Diagram of the midgut hypothesis proposing that the increase in bile acid secretion after

bariatric surgery not only increases the lipid absorption in the distal intestine (ileum), but also

exerts beneficial metabolic effects on binding bile acid receptors such as intestinal nuclear

receptor FXR or TGR5 (modified from [(Batterham et al, 2016)].

The small intestine can produce and release glucose through intestinal

gluconeogenesis and release it to the portal vein, leading to the activation of the hepato-

portal glucose signaling system, decreasing food intake and suppressing hepatic glucose

production (Troy et al, 2008). Fasting and the ingestion of proteins induce intestinal

gluconeogenesis by increasing the activity of glucose-6-phosphatase (G6Pase) and

phosphoenolpyruvate carboxykinase (PEPCK) gluconeogenic enzymes (Mithieux,

2009). RYGB, but not sleeve gastrectomy, induces the programming of intestinal

glucose metabolism, which renders the intestine an important tissue for glucose

disposal, contributing to the improvement in glycemic control after surgery in various

models of diabetes (Saeidi et al, 2013, Mumphrey et al, 2015).

2.2.3. Hindgut hypothesis

The hindgut hypothesis (Figure 10) states that early exposure of undigested food

to the hindgut (distal ileum, colon and rectum) leads to increased secretion of GLP-1

and PYY from intestinal L-cells with subsequent improvement in glycemic control

(Cummings B. P. et al, 2010). GLP-1 is one of the peptides yielded by post-translational

- 23 -

processing of pre-proglucagon (Dhanvantari et al, 1996). Other peptides arising from

this process are GLP-2, glucagon, glicentin and oxyntomodulin. GLP-1 promotes

postprandial glucose-induced insulin release (Orskov et al, 1996, Farilla et al, 2003) and

also exerts proliferative and anti-apoptotic effects on pancreatic β-cells, thereby

improving -cell function (Drucker, 2003). Interestingly, numerous neuronal

populations of the central nervous system express the GLP-1 receptor, including the

hypothalamus and the nucleus tractus solitarius, which are crucial for the regulation of

energy balance (Shimizu et al, 1987). In this regard, stimulation of the central GLP-1

system not only suppresses food intake, but also regulates glucose homeostasis and

activates BAT thermogenesis and browning (Sandoval et al, 2008, Seo et al, 2008,

Beiroa et al, 2014). Interestingly, it has been shown that sleeve gastrectomy induces

weight loss and improves glucose metabolism in two genetic animal models lacking

GLP-1 receptor, suggesting that GLP-1 receptor activity is not absolutely necessary for

the metabolic effects induced by sleeve gastrectomy (Wilson-Pérez et al, 2013a).

Figure 10. Diagram of the hindgut hypothesis suggesting that the altered anatomy after bariatric surgery

induces a rapid transit of nutrients to the distal ileum, colon and rectum that stimulates the

synthesis and secretion of GLP-1 and PYY [modified from (Ahima et al, 2010, Gigoux et al,

2013)]. These gastrointestinal hormones exert pleiotropic effects, including the reduction of food

intake and the increase in insulin secretion and sensitivity, thereby contributing to the beneficial

metabolic effect observed after bariatric surgery.

On the other hand, two main forms of the 36-amino acid peptide PYY have been

described: PYY1-36, the full-length peptide, and PYY3-36, the major circulating form that

arises from cleavage of the N-terminal Tyr-Pro residues from the full-length peptide by

the enzyme dipeptidyl-peptidase 4 (DPP4) (van den Hoek et al, 2004). PYY3-36

- 24 -

decreases food intake and increases thermogenesis, lipolysis, and increased postprandial

insulin and glucose responses (le Roux et al, 2006, Sloth et al, 2007). Thus, elevated

post-prandial levels of GLP-1 and PYY3-36 could contribute to the improved glucose

homeostasis observed after bariatric surgery (Strader et al, 2005).

2.2.4. Gastric center or ghrelin hypothesis

The gastric center hypothesis (Figure 11) proposes that the greater curvature of

the stomach produces several factors involved in the improvement of body weight and

whole-body metabolism observed after stomach surgery, such as sleeve gastrectomy,

RYGB and total gastrectomy (Zhu et al, 2016). In this sense, an obviously candidate is

ghrelin which is mainly synthesized by X/A-like cells of the oxyntic glands in the

mucosa of the gastric fundus (Frühbeck et al, 2004a, Frühbeck et al, 2004b). Ghrelin is

an orexigenic hormone that was first discovered as the endogenous ligand for the

growth hormone (GH) secretagogue receptor (GHS-R), which stimulates GH release

(Kojima et al, 1999). Circulating ghrelin exists in two main forms: desacyl ghrelin (95%

of total ghrelin) and acylated ghrelin (5% of total ghrelin) that carries an n-octanoyl

modification at Ser3 catalyzed by the ghrelin O-acyltransferase (GOAT) enzyme (Yang

J. et al, 2008). Ghrelin stimulates appetite and induces a positive energy balance,

leading to body weight gain (Tschöp et al, 2000, Wren et al, 2000, Nakazato et al,

2001, Wren et al, 2001). In this sense, administration of exogenous ghrelin stimulates

appetite and increases food intake by the stimulation of hypothalamic neuropeptide Y

(NPY)/agouti-related peptide (AgRP) neurons expressing its functional receptor, GHS-

R 1a (Toshinai et al, 2003, Chen et al, 2004, López et al, 2008). Moreover, ghrelin

isoforms can induce adipogenesis in the adipose tissue (Rodríguez et al, 2009,

Gurriarán-Rodríguez et al, 2011) and lipogenesis in the liver (Sangiao-Alvarellos et al,

2009, Porteiro et al, 2013, Ezquerro et al, 2016), further contributing to the increased

adiposity.

Circulating ghrelin concentrations are characterized by a preprandial rise and

postprandial fall supporting its role in meal initiation (Cummings D. E. et al, 2001).

Paradoxically, despite the orexigenic and adipogenic actions of ghrelin, obesity, insulin

resistance, T2D as well as metabolic syndrome are associated with a decrease in

circulating total ghrelin levels (Kojima et al, 1999, Tschöp et al, 2000, Pöykkö et al,

2005). Nevertheless, these pathologies are associated with a dramatic reduction of

- 25 -

plasma desacyl ghrelin levels, while plasma concentrations of acylated ghrelin remain

unchanged or increased (Rodríguez et al, 2009, Rodríguez et al, 2010).

Figure 11. Diagram of the gastric center hypothesis stating that the removal of the greater curvature of

the stomach with different techniques contributes to the metabolic effect of bariatric surgery.

Ghrelin is an orexigenic and lipogenic peptide hormone mainly produced in the gastric fundus,

and its circulating levels are drastically reduced after bariatric surgery [modified from (Müller et

al, 2015)].

The relationship between bariatric surgery and ghrelin levels is controversial.

Plasma ghrelin is markedly reduced after sleeve gastrectomy that removes 70-80% of

the stomach, and remained low after 1 year (Frühbeck et al, 2004a, Peterli et al, 2012).

By contrast, patients undergoing RYGB exhibit reduced ghrelin levels, but not as

pronounced as those observed with sleeve gastrectomy (Cummings D. E. et al, 2002,

Frühbeck et al, 2004a), with ghrelin levels approaching preoperative values 1 year after

surgery (Peterli et al, 2012, Malin et al, 2014). The decrease in ghrelin levels after

sleeve gastrectomy and RYGB depends on the degree to which the surgical technique

excludes the gastric fundus (Frühbeck et al, 2004a, Frühbeck et al, 2004b). Hence, the

changes in ghrelin contribute to the initial marked decrease in food intake and weight

loss that follow both surgical procedures. Moreover, genetic, immunological, and

pharmacological blockade of ghrelin signaling enhances glucose-stimulated insulin

secretion and improves peripheral insulin sensitivity (Alamri et al, 2016). Thus, it seems

plausible that ghrelin changes after stomach surgery also contribute, at least in part, to

the post-surgical improvement in insulin sensitivity.

- 26 -

3. AQUAPORINS

Aquaporins (AQPs) are channel-forming integral membrane proteins that belong

to the family of the major intrinsic proteins (Agre et al, 2003, King et al, 2004). AQPs

facilitate the rapid transport of water and other small solutes across the cell membranes

driven by osmotic or solute gradients (Carbrey et al, 2009). So far thirteen aquaporins

have been identified (AQP0-AQP12) in mammals, which are ubiquitously expressed in

tissues implicated in high rates of active fluid transport (Verkman et al, 2014). Within

the cellular membranes, AQPs assemble as a tetramer (Verbavatz et al, 1993) with each

monomer behaving as an independent pore (Jung et al, 1994, King et al, 2004). AQPs

share a common protein fold, with six membrane-spanning helices surrounding the

amphipathic channel plus two half-helices with their positive, N-terminal, ends located

at the center of the protein and their C-terminal ends pointing towards the intracellular

side of the membrane. AQPs also contain two conserved asparagine-proline-alanine

motifs (NPA) located at the N-terminal ends of the two half-helices, at the center of the

channel (Agre et al, 1993), which form a tridimensional “hourglass” structure that

allows the movement of solutes through the pore. The aromatic/arginine (ar/R)

constriction formed by four defined residues at the extracellular aqueous pore mouth

constitutes a major selectivity filter for permeability (Beitz et al, 2006, Azad et al,

2012).

3.1. Types of aquaporins

According to their permeability and structure characteristics, AQPs are

subclassified into three subgroups: orthodox aquaporins, aquaglyceroporins and

superaquaporins (King et al, 2004, Ishibashi et al, 2014). The functional importance of

AQPs has been revealed by the analysis of the phenotype of AQP-knockout mice and

from humans with loss-of-function mutations in AQPs (King et al, 2004, Rodríguez et

al, 2007b) (Table 2).

- 27 -

Table 2. Main phenotypic characteristics derived from aquaporin deficiency in mice and

humans.

Type AQP-knockout mice AQP-deficient humans References

AQP0 Cataracts Congenital cataracts Francis et al, 2000, Shiels et al, 2001

AQP1

Polydipsia, defective

proximal fluid absorption, impaired

angiogenesis and

vasodilation

Loss of Colton blood

group, decreased urine-concentrating mechanism

after water deprivation

Preston et al, 1994, King et

al, 2001, Saadoun et al, 2005, Herrera et al, 2007

AQP2 Severe urinary concentrating defect

Nephrogenic diabetes insipidus

Deen et al, 1994, Rojek A. et al, 2006

AQP3 Nephrogenic diabetes

insipidus, defective skin

hydration

Antibodies against GIL

blood group

Ma et al, 2000, Hara et al,

2002, Ma et al, 2002, Roudier

et al, 2002

AQP4 Reduced brain swelling, mild urine-concentrating

defect Not described

Ma et al, 1997, Manley et al, 2000, Papadopoulos et al,

2004

AQP5

Impaired saliva and sweat secretion,

hiperresponsive

bronchoconstriction

Non-epidermolytic palmoplantar keratoderma

Ma et al, 1999, Krane et al, 2001, Nejsum et al, 2002,

Blaydon et al, 2013

AQP6 Not described Not described -

AQP7

Adult-onset obesity, increased insulin

production and insulin

resistance

Impaired increase of serum glycerol during exercise

Kondo et al, 2002, Maeda et al, 2004, Hara-Chikuma et al,

2005, Hibuse et al, 2005,

Matsumura et al, 2007

AQP8 Larger testes Not described Yang B. et al, 2005

AQP9 Defective glycerol metabolism

Not described Rojek A. M. et al, 2007

AQP10 Murine Aqp10 is a

pseudogene Not described

Morinaga et al, 2002

AQP11 Renal failure with polycystic kidneys

Not described Ishibashi, 2006, Okada et al, 2008

AQP12 Higher susceptibility to

caerulein-induced acute

pancreatitis Not described

Ohta et al, 2009

- 28 -

3.1.1. Orthodox aquaporins

Aquaporins (AQP0, 1, 2, 4, 5, 6, 8) are considered orthodox or “pure”

aquaporins permeated only by water. Nonetheless, AQP1 and AQP4 can transport nitric

oxide (NO) (Herrera et al, 2006, Wang et al, 2010), AQP6 shows conductance to nitrate

and other inorganic anions (Yasui M. et al, 1999) and AQP8 features high permeability

to ammonia and H2O2 (Bienert et al, 2007, Soria et al, 2010). These water channels play

important functions in tissues with active fluid transport involved in processes such as

crystalline lens transparency (AQP0), angiogenesis and vasodilation (AQP1), urine

concentration and acid-base homeostasis in kidneys (AQP1, 2, 3, 6), cerebrospinal fluid

secretion (AQP4), saliva, sweat, tears and pulmonary secretions (AQP5),

gastrointestinal fluid secretion, hepatic bile formation and secretion, and

spermatogenesis (AQP8) (Herrera et al, 2007, Madeira et al, 2015, Direito et al, 2016).

In this regard, loss-of-function mutations in human AQPs cause congenital cataracts

(AQP0), defective urine concentration (AQP1), nephrogenic diabetes insipidus (AQP2)

while autoantibodies against AQP4 cause the autoimmune demyelinating disease

neuromyelitis optica (Table 2) (Verkman et al, 2014).

3.1.2. Aquaglyceroporins

Aquaglyceroporins (AQP3, 7, 9 and 10) are permeated by water and other small

solutes, such as glycerol, urea or nitric oxide (Oliva et al, 2010). It has been recently

demonstrated that aquaglyceroporins also have the ability to transport silicon as

orthosilicic acid (Carpentier et al, 2016).

AQP3 (also known as glycerol intrinsic protein, GLIP, based on its glycerol

transport function) was initially cloned from the rat kidney (Echevarría et al, 1994, Ma

et al, 1994). The principal physiological functions of AQP3 are urine concentration and

skin hydration (Echevarría et al, 1994, Ma et al, 1994), with Aqp3-knockout mice

showing a reduced skin hydration and elasticity, together with a protection against skin

tumorigenesis, impaired wound healing, and nephrogenic diabetes insipidus (Ma et al,

2000, Hara et al, 2002, Ma et al, 2002, Hara-Chikuma et al, 2008a, Hara-Chikuma et al,

2008b). Although extremely rare, there are cases of homozygous mutations in AQP3 in

humans with the development of antibodies against a new red-blood cell group named

GIL and it has been also associated with Menière’s disease and higher susceptibility to

gallbladder cancer (Roudier et al, 2002, Bahamontes-Rosa et al, 2008, Candreia et al,

2010).

- 29 -

AQP7 (originally named AQPap) was cloned from adipose tissue in 1997

(Ishibashi et al, 1997, Ishibashi et al, 1998). AQP7 facilitates the transport of water,

glycerol and arsenite (Liu Z. et al, 2002). Aqp7-deficient mice show adult onset obesity,

hyperinsulinemia and insulin resistance (Maeda et al, 2004, Hara-Chikuma et al, 2005,

Hibuse et al, 2005, Matsumura et al, 2007), highlighting the important role of this

aquaglyceroporin in the control of fat accumulation as well as glucose homeostasis

(Frühbeck, 2005). AQP7 constitutes the main glycerol channel facilitating glycerol

transport in adipocytes. The defective glycerol exit in fat cells from Aqp7-knockout

mice leads to an intracellular glycerol accumulation, resulting in an increased TG

biosynthesis and adipocyte hypertrophy (Hara-Chikuma et al, 2005, Hibuse et al, 2005).

In humans, the rare cases of individuals carrying homozygous mutations in the coding

region of the AQP7 gene do not exhibit obesity or diabetes (Kondo et al, 2002, Roudier

et al, 2002, Bahamontes-Rosa et al, 2008, Candreia et al, 2010). The only apparent

consequence of AQP7 deficiency in humans is an impaired glycerol increase in

response to exercise, reinforcing the role of this aquaglyceroporin in lipolysis (Kondo et

al, 2002).

AQP9 was first isolated from rat liver and can transport water, glycerol, urea and

arsenite into the hepatocytes (Tsukaguchi et al, 1998, Liu Z. et al, 2002). AQP9

represents the primary route for glycerol uptake into hepatocytes with transgenic Aqp9-

knockout mice showing a defective hepatic glycerol metabolism (Rojek A. M. et al,

2007). Glycerol is used as a substrate for hepatic gluconeogenesis and, in line with this

observation, Aqp9 deletion in obese diabetic db/db mice results in a reduction of 10-

40% of circulating glucose levels (Rojek A. M. et al, 2007). In human liver, AQP9 also

represents the main glycerol channel in hepatocytes, although AQP3, 7 and 10 also

facilitate glycerol uptake in these cells (Jelen et al, 2011, Lebeck, 2014, Rodríguez et al,

2014).

AQP10 is abundantly expressed in human duodenum, jejunum and ileum

contributing to intestinal water and glycerol absorption (Hatakeyama et al, 2001,

Mobasheri et al, 2004), although the murine Aqp10 gene is a pseudogene (Morinaga et

al, 2002). Two different isoforms are expressed in the human small intestine: i)

AQP10v, which is mainly expressed in the capillary endothelial cells of the small

intestinal villi to allow water absorption in the intestinal epithelium, and ii) AQP10,

- 30 -

localized in the cytoplasm of the gastro-entero-pancreatic endocrine cells suggesting a

role in the secretion of polypeptide hormones from these cells (Li et al, 2005).

3.1.3. Superaquaporins

Superaquaporins exhibit very low homology to orthodox aquaporins and

aquaglyceroporins due to their unique structure and subcellular localization (Ishibashi et

al, 2014). In contrast to conventional aquaporins that present two highly conserved

NPA (Asn-Pro-Ala) sequence motifs that allow the movement of water through the pore

(Agre et al, 1993), superaquaporins present a different sequence of the first NPA motif:

Asn-Pro-Cys (NPC) in AQP11 and Asn-Pro-Thr (NPT) in AQP12 (Yakata et al, 2007,

Calvanese et al, 2013). Moreover, superaquaporins localize in the membrane of

intracellular organelles instead of the plasma membrane (Ishibashi et al, 2009).

AQP11 (originally named AQPX1) is highly expressed in rat testis and, to a

lesser extent, in kidney, liver and brain (Gorelick et al, 2006). It has also been recently

described as a novel glycerol channel in human adipocytes being located in lipid

droplets (Madeira et al, 2014). Transgenic Aqp11-knockout mice die before weaning

with progressive vacuolization and cyst formation of the proximal tubule, leading to

polycystic kidney development (Morishita et al, 2005, Tchekneva et al, 2008). The

vacuoles are also observed in hepatocytes close to the central vein as well as in the

epithelium of intestinal villi where water is intensively absorbed (Rojek A. et al, 2013).

AQP11 seems to play a relevant role in renal intravesicular homeostasis, which is

essential for an adequate proximal tubule function.

AQP12 (originally known as AQPX2) is selectively expressed in the acinar cells

of the pancreas (Itoh et al, 2005) with an intracellular localization in the rough

endoplasmic reticulum (RER) and the membranes of zymogen granules near the RER

(Itoh et al, 2005, Ohta et al, 2009). Transgenic mice lacking Aqp12 gene showed more

severe pathological damage in the pancreas and revealed larger exocytotic vesicles

(vacuoles) in the pancreatic acini. Thus, AQP12 may participate in the control of the

proper maturation and secretion of pancreatic fluid following rapid and intense

stimulation (Ohta et al, 2009). The literature about AQP12 is scarce and more research

is necessary in order to discern further biological functions of this superaquaporin.

- 31 -

3.2. Role of aquaglyceroporins in the onset of obesity and its associated

comorbidities

Advances in determining the mechanisms that underlie obesity and obesity-

associated pathologies, such as insulin resistance, T2D and NAFLD, have been

provided by the discovery and characterization of aquaglyceroporins in the adipose

tissue, liver and pancreas (Frühbeck, 2005, Rodríguez et al, 2011a). Circulating glycerol

results from lipolysis, diet-derived glycerol absorbed in the intestine and glycerol

reabsorbed in the proximal tubules (Echevarría et al, 1994, Ramírez-Lorca et al, 1999,

Sohara et al, 2005). Glycerol constitutes a key metabolite for lipid accumulation as the

carbon backbone of TG (Reshef et al, 2003). During fasting hepatic glucose output

embodies the main source of plasma glucose, and plasma glycerol becomes the major

substrate for hepatic gluconeogenesis (Rojek A. M. et al, 2007). Finally, glycerol uptake

is accompanied by β-cell swelling, activation of the volume-regulated anion channel

(VRAC) and insulin release (Best et al, 2009). Thus, the regulation of glycerol transport

by aquaglyceroporins contributes to the control of fat accumulation, glucose

homeostasis and insulin secretion, among other biological functions.

3.2.1. Aquaglyceroporins in lipogenesis and lipolysis

Adipose tissue constitutes the main source of plasma glycerol (Reshef et al,

2003). AQP7 was considered the unique glycerol channel in adipose tissue, but

nowadays it has been demonstrated that AQP3, 9 and 10 represent additional pathways

for the transport of glycerol in human adipocytes (Miranda et al, 2010, Rodríguez et al,

2011b, Laforenza et al, 2013). In addition, AQP5 and 11 are expressed in adipocytes

and can transport glycerol across the biological membranes of fat cells (Madeira et al,

2014, Madeira et al, 2015). Under physiological circumstances, adipocytes adapt the

balance between TG synthesis (lipogenesis) and hydrolysis (lipolysis) in order to meet

body energy demands (Figure 12) (Rodríguez et al, 2007b, Frühbeck et al, 2014). In

this regard, aquaglyceroporins are necessary for the uptake and release of glycerol, a

metabolite that constitutes the carbon backbone of TG (Maeda et al, 2008).

Under lipogenic conditions, in a postprandial state, adipocytes synthesize TG

from the esterification of FFA and glycerol-3-phosphate. Fatty acid binding protein

(FABP), fatty acid translocase (FAT, CD36) or fatty acid transporter protein (FATP),

facilitate the FFA transport across the membrane of adipocytes (Kishida et al, 2001b,

Rodríguez et al, 2006). Moreover, lipoprotein lipase (LPL) (located on the surface of

- 32 -

adipocytes and capillaries) removes FFA from chylomicrons and VLDL (Gonzales et

al, 2007). Glycerol-3-phosphate is the other metabolite required for TG biosynthesis,

and derives from three different sources: i) glucose, since glycerol-3-phosphate

constitutes a secondary metabolite of glycolysis (Rodríguez et al, 2006, Maeda et al,

2008); ii) lipolysis-derived glycerol, which is phosphorylated by the glycerol kinase

(GK) enzyme (Guan et al, 2002); and iii) glycerol uptake mediated by

aquaglyceroporins (Rodríguez et al, 2011b). Several lipogenic stimuli, such as insulin,

ghrelin and dexamethasone control the expression of AQP7 in adipocytes. In this sense,

AQP7 is downregulated by acylated and desacyl ghrelin as well as by dexamethasone

(Fasshauer et al, 2003, Rodríguez et al, 2009, Shen et al, 2012), thus promoting fat

enlargement. Insulin regulates AQP7 expression in a different manner in rodents and

humans (Rodríguez et al, 2011b). In rodents, insulin decreases AQP7 expression in

WAT, since the Aqp7 gene promoter presents a negative insulin response element (IRE)

(Kishida et al, 2001b, Kishida et al, 2001a). By contrast, insulin increases the

expression of AQP3, 7 and 10 in human adipocytes through the phosphatidylinositol 3-

kinase (PI3K)/Akt/mechanistic target of rapamycin (mTOR) signaling pathway, which

might reflect the increase in TG content induced by this lipogenic hormone (Rodríguez

et al, 2011b, Laforenza et al, 2013).

In circumstances of negative energy balance, such as fasting or exercise, TG are

hydrolyzed to glycerol and FFA by adipose triglyceride lipase (ATGL) as well as

hormone-sensitive lipase (HSL) (Lafontan et al, 2009, Kolditz et al, 2010, Frühbeck et

al, 2014). Both FFA and glycerol are released into the bloodstream and can be used as

energy substrates in different peripheral tissues. FFA is recycled within adipose tissue

as well as in peripheral tissues such as liver, skeletal muscle, heart, pancreas or BAT

(Reshef et al, 2003). Glycerol released from the adipose tissue acts as a substrate for

hepatic gluconeogenesis and de novo TG biosynthesis (Rodríguez et al, 2011b). Several

stimuli involved in the regulation of lipolysis, such as catecholamines, leptin, atrial

natriuretic peptide (ANP), uroguanylin and guanylin, regulate the expression and

translocation of aquaglyceroporins in adipocytes (Yasui M. et al, 1999, Kishida et al,

2001b, Rodríguez et al, 2011b, Rodríguez et al, 2015a, Rodríguez et al, 2016). The

activation of β-adrenoreceptors leads to an increase in cAMP production and activation

of protein kinase A (PKA), which in turn induces HSL phosphorylation and

translocation of AQP3, 7 and 10 from the cytosolic fraction (AQP3) or lipid droplets

- 33 -

(AQP7 and AQP10) to the plasma membrane of adipocytes (Kishida et al, 2000, Walker

et al, 2007, Yasui H. et al, 2008, Rodríguez et al, 2011b, Frühbeck et al, 2014). A

recent study has shown that AQP7 is locked to the lipid droplet by perilipin-1, thereby

preventing localization of AQP7 to the plasma membrane where it can exert glycerol

efflux activity (Hansen et al, 2016). Interestingly, catecholamine-activated PKA

phosphorylates the N-terminus of AQP7 reducing the complex formation with perilipin,

and, thereby, facilitating its translocation to the plasma membrane and the subsequent

glycerol efflux. On the other hand, acute leptin stimulation induces the mobilization of

aquaglyceroporins towards lipid droplets (AQP3) and the plasma membrane (AQP7) in

murine adipocytes (Rodríguez et al, 2015a). Leptin represses AQP7 protein expression

in human adipocytes via the PI3K/Akt/mTOR signaling cascade (Rodríguez et al,

2011b), suggesting a negative feedback regulation to restrict glycerol release from

adipose tissue.

Figure 12. Role of aquaglyceroporins in lipogenesis and lipolysis [modified from (Rodríguez et al,

2011a)].

Human obesity is associated with a deregulation in the expression of

aquaglyceroporins in adipose tissue (Marrades et al, 2006, Prudente et al, 2007, Catalán

et al, 2008, Rodríguez et al, 2011b). In this sense, the expression of AQP3 and AQP7 is

increased in human visceral WAT, which might be related to the increased lipolytic rate

in this fat depot (Rodríguez et al, 2011b). However, AQP7 is downregulated in the

- 34 -

subcutaneous WAT (SCWAT) leading to the promotion of an intracellular glycerol

accumulation and a progressive adipocyte hypertrophy (Rodríguez et al, 2011b).

3.2.2. Aquaglyceroporins in hepatic gluconeogenesis and steatosis

The liver is responsible for about 70-90% of whole-body glycerol metabolism

(Peroni et al, 1995, Reshef et al, 2003). All the aquaglyceroporins are expressed in

human liver with AQP9 being the primary route of hepatocyte glycerol uptake (Jelen et

al, 2011, Calamita et al, 2012). AQP9 is mainly localized in the sinusoidal plasma

membrane that faces the portal vein (Jelen et al, 2011, Lebeck, 2014). Glycerol is

phosphorylated to glycerol-3-phosphate by the GK enzyme, and glycerol-3-phosphate

constitutes a precursor for gluconeogenesis as well as for the de novo TG synthesis

(Figure 13) (Rodríguez et al, 2006, Maeda et al, 2008). Insulin inhibits

gluconeogenesis by reducing the activity of PEPCK and by blocking glycogenolysis,

the breakdown glycogen polymers into glucose monomers (Rodríguez et al, 2011a).

Moreover, insulin regulates the hepatic expression of AQP9, although this regulation

appears to be different in rodent and humans. Insulin downregulates the Aqp9 gene

expression via the negative IRE in the gene promoter (Kishida et al, 2001b, Kuriyama

et al, 2002, Higuchi et al, 2007), while in humans insulin upregulates the expression of

AQP3, 7 and 9 in hepatocytes via the PI3K/Akt/mTOR pathway (Rodríguez et al,

2011b).

The coordinated regulation of adipose and hepatic aquaglyceroporins is required

for the control of whole-body glucose homeostasis as well as lipid accumulation in both

rodents and humans (Kuriyama et al, 2002, Catalán et al, 2008, Rodríguez et al, 2011b).

Under physiological circumstances, insulin regulates the expression of AQP7 and AQP9

channels that supposes the increase or decrease of glycerol release from fat and uptake

in the liver with the aim to regulate glucose production depending on the nutritional

state (Kuriyama et al, 2002, Rodríguez et al, 2006). In this sense, it has been

demonstrated in rodents that the overexpression of AQP7 in adipose tissue and AQP9 in

the liver in the context of insulin resistance leads to elevated circulating glycerol, thus

leading to an increase in hepatic glycerol uptake and gluconeogenesis, that supposes an

aggravation of hyperglycemia (Kishida et al, 2001b, Kuriyama et al, 2002). By contrast,

a reduced glycerol permeability and AQP9 expression has been identified in the liver of

insulin-resistant individuals that might constitute a compensatory mechanism to

diminish glycerol availability aimed at reducing the de novo synthesis of glucose in

- 35 -

hepatocytes and further enhancing the development of hyperglycemia (Catalán et al,

2008, Miranda et al, 2009, Rodríguez et al, 2011b, Rodríguez et al, 2014).

Figure 13. Role of aquaglyceroporins in hepatic gluconeogenesis and steatosis [modified from

(Rodríguez et al, 2011a)].

The expression and functionality of hepatic AQP9 is also impaired in NAFLD

and NASH (Rodríguez et al, 2014). Ectopic fat accumulation is strongly associated with

insulin-resistant states, such as obesity, metabolic syndrome or T2D (Utzschneider et al,

2006, Chalasani et al, 2012). In this scenario, the decreased hepatic AQP9 expression in

patients with NAFLD and NASH is in direct relation to the degree of steatosis and

lobular inflammation, being further reduced in insulin-resistant individuals (Rodríguez

et al, 2014). The downregulation of AQP9 together with the subsequent reduction in

hepatic glycerol permeability in insulin-resistant states emerges as a compensatory

mechanism whereby the liver counteracts further TG accumulation within its

parenchyma as well as reduces hepatic gluconeogenesis in patients with NAFLD

(Calamita et al, 2008, Potter et al, 2011, Rodríguez et al, 2014).

3.2.3. Aquaglyceroporins in pancreatic insulin secretion

Glucose is the primary regulator of insulin synthesis and secretion in pancreatic

β-cells (Muoio et al, 2008), but glycerol constitutes another metabolite involved in this

process (Matsumura et al, 2007, Louchami et al, 2012). AQP7 has been identified in

pancreatic -cells, but not in the ducts or the acini of the exocrine pancreas of mice and

- 36 -

rats as well as in BRIN-BD11 -cell line (Matsumura et al, 2007, Best et al, 2009,

Delporte et al, 2009). Circulating glycerol is transported into -cells through AQP7,

transformed into glycerol-3-phosphate by the activation of the GK activity and entered

into the glycerol-3-phosphate shuttle (Figure 14). In this metabolic process glycerol-3-

phosphate is converted into dihydroxyacetone phosphate (DHAP) by an inner

membrane-bound mitochondrial glycerol-3-phosphate dehydrogenase (GPD) reducing

FAD to FADH2 that enters mitochondrial oxidative phosphorylation to generate ATP

(Skelly et al, 2001, Matsumura et al, 2007). The subsequent increase in the cytoplasmic

ATP/ADP ratio induces the closure of ATP-sensitive K+ channels, followed by the

plasma membrane depolarization and, finally, the opening of voltage-sensitive Ca2+

channels and a rapid influx of Ca2+

(Ma et al, 1994). The consequent increase in

cytosolic Ca2+

triggers the exocytosis of insulin-containing secretory granules (Best et

al, 2009).

Figure 14. Role of aquaglyceroporins in pancreatic -cell glycerol uptake and insulin secretion [modified

from (Rodríguez et al, 2011a)].

Aqp7-knockout mice show increased β-cell glycerol content and GK activity,

which result in higher basal and glucose-induced insulin secretion as well as reduced β-

cell mass indicating a more efficient insulin biosynthesis and secretion (Matsumura et

- 37 -

al, 2007). Moreover, the elevated glycerol content in Aqp7-deficient mice promotes an

increase in islet TG levels. Obesity-associated T2D is associated with an altered

expression profile of AQP7 in insulin-sensitive tissues such as adipose tissue, liver and

skeletal muscle (Marrades et al, 2006, Matsumura et al, 2007, Prudente et al, 2007,

Catalán et al, 2008, Best et al, 2009, Delporte et al, 2009, Miranda et al, 2009,

Rodríguez et al, 2011b). However, the impact of obesity and insulin resistance on the

expression of AQP7 in pancreatic β-cells remains unknown.

38

39

40

- 41 -

HYPOTHESIS

The regulation of aquaglyceroporins in metabolic tissues is important for the

control of fat accumulation, glucose homeostasis and insulin secretion. Obesity and

insulin resistance are associated with changes in the expression of adipose tissue

aquaglyceroporins, one of the main sources of plasma glycerol. Moreover, the

coordinated regulation of aquaglyceroporins in adipose tissue and liver is impaired in

both pathologies. The overall aim of the present thesis was to analyze whether the

altered expression of aquaglyceroporins in adipose tissue, liver and pancreas is

recovered in diet-induced obese rats submitted to two different bariatric surgery

techniques, namely sleeve gastrectomy or gastric plication.

SPECIFIC AIMS

Specifically, the aims of the present thesis were:

1. To analyze the potential participation of adipose and hepatic

aquaglyceroporins in the improvement of adiposity and hepatic steatosis

after sleeve gastrectomy in an experimental model of diet-induced

obesity which leads to NAFLD.

2. To investigate the potential role of the two known pancreatic aquaporins,

AQP7 and AQP12, in the beneficial effect of sleeve gastrectomy on the

improvement of glucose tolerance and -cell function in diet-induced

obese rats.

3. To study the effectiveness of gastric plication on weight loss,

improvement of the metabolic profile, hepatic gluconeogenesis and

steatosis in diet-induced obese rats, focusing on the participation of

adipose and hepatic aquaglyceroporins in these effects.

- 45 -

STUDY I

1. Role of aquaglyceroporins and caveolins in energy and metabolic

homeostasis

Article

Méndez-Giménez L, Rodríguez A, Balaguer I, Frühbeck G.

Role of aquaglyceroporins and caveolins in energy and metabolic homeostasis.

Mol Cell Endocrinol 2014;397(1-2):78-92.

Principal objective

The present review focuses on the role as energy and metabolic sensors of

aquaglyceroporins and caveolins, two key integral membrane protein families involved

in the onset of obesity and lipodystrophies.

Specific objectives

To review the role of aquaglyceroporins involved in the control of fat

accumulation (lipogenesis and lipolysis), hepatic gluconeogenesis and insulin

secretion.

To describe the participation of caveolins on lipid trafficking and insulin

signaling.

To outline the relevance of aquaglyceroporins and caveolins in the

development of metabolic diseases such as obesity, congenital lipodystrophies,

insulin resistance and dyslipidemia.

Méndez-Giménez L, Rodríguez A, Balaguer I, Frühbeck G. Role of aquaglyceroporins

and caveolins in energy and metabolic homeostasis. Molecular and Cellular

Endocrinology 2014;397(1-2):78-92.

http://metalib.unav.es:3210/unav?url_ver=Z39.88-2004&url_ctx_fmt=info:ofi/fmt:kev:mtx:ctx&ctx_enc=info:ofi/enc:UTF-8&ctx_ver=Z39.88-2004&rfr_id=info:sid/sfxit.com:azlist&sfx.ignore_date_threshold=1&rft.object_id=954925511429&rft.object_portfolio_id=&svc.fulltext=yes

http://metalib.unav.es:3210/unav?url_ver=Z39.88-2004&url_ctx_fmt=info:ofi/fmt:kev:mtx:ctx&ctx_enc=info:ofi/enc:UTF-8&ctx_ver=Z39.88-2004&rfr_id=info:sid/sfxit.com:azlist&sfx.ignore_date_threshold=1&rft.object_id=954925511429&rft.object_portfolio_id=&svc.fullt

- 47 -

STUDY II

2. Sleeve gastrectomy reduces hepatic steatosis by improving the

coordinated regulation of aquaglyceroporins in adipose tissue

and liver in obese rats

Article

Méndez-Giménez L, Becerril S, Moncada R, Valentí V, Ramírez B, Lancha A,

Gurbindo J, Balaguer I, Cienfuegos JA, Catalán V, Fernández S, Gómez-Ambrosi J, Rodríguez A, Frühbeck G.

Sleeve gastrectomy reduces hepatic steatosis by improving the coordinated regulation of

aquaglyceroporins in adipose tissue and liver in obese rats.

Obes Surg 2015;25(9):1723-34.

Hypothesis

Aquaglyceroporins expressed in the adipose tissue and liver are involved in the

improvement of adiposity and hepatic steatosis after sleeve gastrectomy in diet-induced

obese rats.

Objectives

To study the effect of sleeve gastrectomy on body weight, whole-body

adiposity, metabolic profile and hepatosteatosis in diet-induced obese rats.

To analyze the impact of obesity and weight loss achieved by sleeve

gastrectomy and pair-feeding on the expression of aquaglyceroporins in EWAT

and SCWAT (AQP3 and AQP7) as well as in the liver (AQP9).

To evaluate the correlation of adipose and hepatic aquaglyceroporins with

markers of adiposity, glucose and lipid metabolism as well as hepatic steatosis.

Méndez-Giménez L, Becerril S, Moncada R, Valentí V, Ramírez B, Lancha A,

Gurbindo J, Balaguer I, Cienfuegos JA, Catalán V, Fernández S, Gómez-Ambrosi J,

Rodríguez A, Frühbeck G. Sleeve gastrectomy reduces hepatic steatosis by improving

the coordinated regulation of aquaglyceroporins in adipose tissue and liver in obese

rats. Obesity Surgery 2015;25(9):1723-34.

http://dx.doi.org/10.1007/s11695-015-1612-z

http://metalib.unav.es:3210/unav?url_ver=Z39.88-2004&url_ctx_fmt=info:ofi/fmt:kev:mtx:ctx&ctx_enc=info:ofi/enc:UTF-8&ctx_ver=Z39.88-2004&rfr_id=info:sid/sfxit.com:azlist&sfx.ignore_date_threshold=1&rft.object_id=954925579101&rft.object_portfolio_id=

- 49 -

STUDY III

3. Role of aquaporin-7 in ghrelin- and GLP-1-induced

improvement of pancreatic -cell function after sleeve

gastrectomy in obese rats

Article

Méndez-Giménez L, Becerril S, Camões SP, Vieira da Silva I, Rodrigues C, Moncada

R, Valentí V, Catalán V, Gómez-Ambrosi J, Miranda JP, Soveral G, Frühbeck G,

Rodríguez A.

Role of aquaporin-7 in ghrelin- and GLP-1-induced improvement of pancreatic -cell function after sleeve gastrectomy in obese rats.

Int J Obes 2017; (in press).

Hypothesis

Pancreatic AQP7 and AQP12 are involved in the beneficial effect of sleeve

gastrectomy on the improvement of glucose tolerance and -cell function, and steatosis

in diet-induced obese rats.

Objectives

To study the effect of sleeve gastrectomy on glucose tolerance, -cell mass,

apoptosis and steatosis in diet-induced obese rats.

To analyze the impact of obesity and weight loss achieved by sleeve

gastrectomy and pair-feeding on the expression of AQP7 and AQP12 in the rat

pancreas.

To evaluate the correlation of pancreatic AQP7 and AQP12 with markers of

glucose metabolism, -cell function and pancreatic steatosis.

To determine the water and glycerol permeability of rat RIN-m5F -cells.

To investigate the effect of acylated and desacyl ghrelin as well as GLP-1 (9-

36) on insulin release, intracellular TG content and expression of AQP7 and

AQP12 in rat RIN-m5F -cells.

��

�� !"#$% &!"��

�'��

��

��

�� !"��#�

$��%� &��'� ��%�� ( �� %�)��*��*��+�"& �'��

)��%� �� "�� % ��,��%�"�� )��'� ��&��+ &�� )�'�� (�)�

-��.��#/0�)�� 0��1� ��1�'�� 2�� ''��3��'��4'��1� ��3� �'��

0��!"��#��5�� #��#��%��'�6��-��7��'��-��4�'��.��2��&)��8

9��:��;-<��=��>��+&�&��+��3�� )� �"�0� &��

?��+��"'��"�/��%��''�� +� &�� %��''�� )��

��+��"�� %��)'�&�� '��+�'��%��%��"�� %��

&��@� ��'��

;�� @�.��"��''�� &��+�� <��&��3�� )� ��

;�� %��A<�3; B� �� &�� <�3; �� /)�� &� ��

��/�� "� ��%��C�� %�� &�'��)"�� &�� )� ��

4��'��

7� ��

;� �� '�-��'��%�<)��

& ��DD+++�� D��

////////////////////////////////////////////////////////////////////////

4�)�� ;-<��=�� E� ��

6�� @��)��;-<��=��

F '�� %�)��*��*��+�"& �'��)��%� �� "�� % ��,��%

"�� )��'� ��&��+ &�� )�'��

0� &��-��.��#/0�)�� 0��1� ��1�'�� 2�� ''��3��'��4'��1� ��

3� �'��0��!"��#��5�� #��#��%��'�6��-��7��'��-��4�'��.��

2��&)��8

�� .��#/0�)��

;��'�� %�� &� ��)�� &��+�)�� %��)'��

&��

�E7047��70 �F$7�2<EE<G;@.�30�72HEE?

F&��"�� &��%�� C�� '� ��"��E��

��)'�&�%��)�&�'%��%��''�� &��?�� )�� '�+��&�� &��E��

��)'�&�%��

(��)�*��+

E�� )'�&�%��

.�� '��%�� &��H� ��I�"��H� ��4 � ��3��C�� "�

��"�� '��E�� )'�&�%��

;%��%� &�� &�� &�� '��%��6;F�� &��H�� %��&��;�'�� H��

H342��.��"��F��&��3�'%��;�� %�F��&��'�"��$��H�� A2��' ��%�0� ��

4��B��"�%��<��0��'�� &��E�� )'�&�%��+ &��

+��%�� &�� %��%%�� &��

��

%) �� +

E�� )'�&�<��0��%��

.�� '��%��H� ��I�"��H� ��4 � ��3�� &�

��'�� .�� 7��'��<��0��E�� )'�&�%��

<��0��0� �'��"�3&��"��%��

,��-�.

;%�� "��)�� &� �� %"�� )�� '��+''�)��

�&�� '��3&��"�� '�� &��.��%��0� &��

�'�� &� �%��&�� 8�� &��+''�)�� '��&��"��%��'��

�� / �� -�0��/1

F��)'�� &��'� �� &��)'��%�''�+�"�� %��)'�� &�

�� &�� A�� "�� "��%��+B��%�� '��+''��)'�&��'��+ &��,

��%�� 00��)'�� '��+''�)��"�� <;�A " �'�<)��

;�� %��B�� &��%��)��%�� &��+�)� ��F��%�� '�8

&��

�E7047�@<F7��;%��+�&� ��'�� %�� &��)��"��+''�)��'% ��

��)'�&��00��;%�%��+�&� ��'�� &��)'�� %�� ''�+� ��%��

��'�� )��'�� E�� A�� B�;667 ;0F7E?�� %

&��'�

�� * � �� )��*� � ��2 ��3+�4&&�0 1� "!�56�77�� +

�'��

?��+��"'��"�/��%��''�� +� &�� %��''�� )��

��+��"�� %��)'�&�� '��+�'��%��%��"�� %��

&��@� ��'��

,�� (2��

F�� &�� "� &��&��+% '��'�"�''�� &��)�� 4&��;

� � ��+ &� &��)' �� "�� C��&��)'��'�8� &� �+''��''�+�� &�

��)'�&�� '��;%��&��'�� <��0�� %��+&��'��+

�� '�� '��)�� %� &��'�8�+''��'��)��)'�� +�'��

&�� 2�

ORIGINAL ARTICLE

Role of aquaporin-7 in ghrelin- and GLP-1-induced improvement of pancreatic β-cell function after sleeve gastrectomy in obese rats

L Méndez-Giménez1,6

, S Becerril1,6

, S P Camões2, I V da Silva

2, C Rodrigues

2, R Moncada

3,6, V

Valentí4,6

, V Catalán1,6

, J Gómez-Ambrosi1,6

, J P Miranda2, G Soveral

2, G Frühbeck

1,5,6,*, A

Rodriguez1,6,*

1Metabolic Research Laboratory, Clínica Universidad de Navarra, Pamplona, Spain; 2Research Institute for Medicines (iMed.ULisboa), Faculty of Pharmacy, Universidade de Lisboa, Lisboa, Portugal; Departments of 3Anesthesia, 4Surgery and 5Endocrinology & Nutrition, Clínica Universidad de Navarra, Pamplona, Spain; 6CIBER Fisiopatología de la Obesidad y Nutrición (CIBEROBN), Instituto de Salud Carlos III, Pamplona, Spain.

Running title: Changes in aquaporins in β-cells after bariatric surgery.

Word count: Abstract (251); Main text (4,324); References (59)

Abbreviations: AQP, aquaporin; AUC, area under the curve; FFA, free fatty acids; GIP, gastric inhibitory polypeptide; GK, glycerol kinase; GLP-1, glucagon-like peptide-1; HFD, high-fat diet; HOMA, homeostasis model assessment; IPITT, intraperitoneal insulin tolerance test; ND, normal diet; OGTT, oral glucose tolerance test; Pf, water permeability; Pgly, glycerol permeability; QUICKI, quantitative insulin sensitivity check index; TG, triacylglycerol; VRAC, volume-regulated anion channel.

Disclosure statement: The authors have nothing to disclose.

Funding: This work was supported by Fondo de Investigación Sanitaria-FEDER (FIS PI12/00515, PI13/01430, PI16/00221 and PI16/01217) from the Spanish Instituto de Salud Carlos III, as well as by the Department of Health of Gobierno de Navarra (61/2014). CIBER de Fisiopatología de la Obesidad y Nutrición (CIBEROBN) is an initiative of the Instituto de Salud Carlos III, Spain.

Contact information:

Gema Frühbeck, RNutr, MD, PhD Dept. Endocrinology & Nutrition Clínica Universidad de Navarra Avda. Pío XII, 36 31008 Pamplona, Spain Phone: +34 948 25 54 00 (ext. 4484) e-mail: [email protected]

Amaia Rodríguez, PhD Metabolic Research Laboratory Clínica Universidad de Navarra Irunlarrea 1 31008 Pamplona, Spain Phone: +34 948 42 56 00 (ext. 3357) e-mail: [email protected]

2

ABSTRACT

BACKGROUND/OBJECTIVES: Glycerol is a key metabolite for lipid accumulation

in insulin-sensitive tissues as well as for pancreatic insulin secretion. We examined the

role of aquaporin-7 (AQP7), the main glycerol channel in β-cells, and AQP12, a

aquaporin related to pancreatic damage, in the improvement of pancreatic function and 5

steatosis after sleeve gastrectomy in diet-induced obese rats.

SUBJECTS/METHODS: Male Wistar obese rats (n=125) were subjected to surgical

(sham operation and sleeve gastrectomy) or dietary (pair-fed to the amount of food

eaten by sleeve-gastrectomized animals) interventions. The tissue distribution and

expression of AQPs in rat pancreas were analyzed by real-time PCR, Western-blot and 10

immunohistochemistry. The effect of ghrelin isoforms and GLP-1 on insulin secretion,

triacylglycerol accumulation and AQP expression was determined in vitro in RIN-m5F

β-cells.

RESULTS: Sleeve gastrectomy reduced pancreatic β-cell apoptosis, steatosis and

insulin secretion. Lower ghrelin and higher GLP-1 concentrations were also found after 15

bariatric surgery. Acylated and desacyl ghrelin increased triacylglycerol content,

whereas GLP-1 increased insulin release in RIN-m5F β-cells. Sleeve gastrectomy was

associated with an upregulation of AQP7 together with a normalization of the increased

AQP12 levels in rat pancreas. Interestingly, ghrelin and GLP-1 repressed AQP7 and

AQP12 expression in RIN-m5F β-cells. AQP7 protein was negatively correlated with 20

intracellular lipid accumulation in acylated ghrelin-treated cells and with insulin release

in GLP-1-stimulated β-cells.

CONCLUSIONS: AQP7 upregulation in β-cells after sleeve gastrectomy contributes,

in part, to the improvement of pancreatic steatosis and insulin secretion by increasing

intracellular glycerol used for insulin release triggered by GLP-1, rather than for 25

ghrelin-induced triacylglycerol biosynthesis.

Keywords: Aquaporins ● Obesity ● Pancreas steatosis ● Insulin secretion ● Bariatric

surgery.

3

INTRODUCTION

Pancreatic β-cell function is influenced by changes in cell volume, which depend on

water permeability of the plasma membrane, conferred in part by aquaporins (AQPs).1

This integral membrane protein superfamily facilitates the transport of water and other

small solutes, such as glycerol and urea, across the biological membranes.2 Thirteen 5

mammalian AQPs have been characterized to date, which are divided in three

subfamilies based on their structural and functional properties: orthodox aquaporins

(AQP0, 1, 2, 4, 5, 6 and 8), aquaglyceroporins (AQP3, 7, 9 and 10) and superaquaporins

(AQP11 and 12).3-5 AQP7 is the main glycerol channel in the pancreas and mediates the

rapid entry of extracellular glycerol into β-cells.1, 6, 7 Glycerol uptake is followed by β-10

cell swelling, activation of the volume-regulated anion channel (VRAC) and insulin

release.1 Glycerol kinase (GK) catalyzes the enzymatic reaction leading to the

phosphorylation of glycerol to glycerol-3-phosphate, which is used as a substrate in the

glycerol-3-phosphate shuttle, a process that reduces equivalents into mitochondria for

use in oxidative phosphorylation and ATP production.4, 6, 8 The increase in the cytosolic 15

ADP:ATP ratio triggers the closure of ATP-sensitive K+ channels, cell membrane

depolarization and opening of voltage-sensitive Ca2+ channels, ultimately leading to the

exocytosis of insulin-containing granules and insulin secretion.1, 9, 10 Interestingly,

Aqp7-deficient mice develop adult-onset obesity, insulin resistance and

hyperinsulinemia.11 In this regard, Aqp7-knockout mice show increased β-cell glycerol 20

content and GK activity, which results in higher basal and glucose-induced insulin

secretion, as well as reduced β-cell mass, indicating a more efficient insulin

biosynthesis and secretion.6, 11 On the other hand, AQP12 (originally named AQPX2) is

expressed in pancreatic acinar cells and localizes on the membrane of intracellular

organelles.12, 13 The intracellular localization of this superaquaporin in pancreatic acinar 25

cells suggests a potential role in the maturation and exocytosis of zymogen granule.

However, its potential expression and function in β-cells remains unknown.

Glycerol represents an important metabolite as a substrate for de novo synthesis

of triacylglycerols (TG) as well as glucose during fasting.14 In this sense, the control of

glycerol influx/efflux in metabolic organs, such as adipose tissue, liver and skeletal 30

muscle, by aquaglyceroporins is important since the dysregulation of these glycerol

channels is associated with metabolic diseases, such as obesity, insulin resistance and

non-alcoholic fatty liver disease.15-19 Our group has previously described that sleeve

4

gastrectomy restores the coordinated regulation of expression of aquaglyceroporins in

adipose tissue and liver, playing a crucial role in the control of adipose and hepatic TG

accumulation as well as in glucose homeostasis.20 This bariatric surgery technique

produces significant weight loss in both humans21, 22 and rodents20, 23 as well as a

remission of β-cell dysfunction and insulin resistance.22 5

The impact of obesity and surgically-induced weight loss in pancreatic

aquaporins has not yet been elucidated. Thus, our aim was to investigate the potential

role of pancreatic AQP7 and AQP12 in the beneficial effect of sleeve gastrectomy on β-

cell mass and steatosis in diet-induced obese rats. Since changes in gut hormones

ghrelin and GLP-1 play a relevant role in for the remission of type 2 diabetes after 10

sleeve gastrectomy,24, 25 we analyzed the direct effect of the main isoforms of ghrelin

(acylated and desacyl ghrelin) and GLP-1 on insulin release, intracellular TG

accumulation and expression of AQP7 and AQP12 in rat RIN-m5F β-cells.

5

MATERIAL AND METHODS

Experimental animals and study design

Four-week-old male Wistar rats (n=125) were fed ad libitum either a normal diet

(ND) (n=25) (12.1 kJ/g: 4% fat, 82% carbohydrate and 14% protein, diet 2014S,

Harlan, Teklad Global Diets, Harlan Laboratories Inc., Barcelona, Spain) or a high-fat 5

diet (HFD) (n=100) (23.0 kJ/g: 59% fat, 27% carbohydrate and 14% protein, diet

F3282, Bio-Serv, Frenchtown, NJ, USA). Body weight and food intake were registered

regularly to follow up the progression of diet-induced obesity. Anesthesia, sleeve

gastrectomy (n=26) and sham surgery (n=27) were performed in weight-matched obese

rats in a blind, randomized study according to previously described methodology.26 10

After surgical interventions, animals were fed a ND. Another group of obese rats was

pair-fed with ND (n=23) with the same amount of food eaten by sleeve-gastrectomized

animals in order to discern the effects attributable solely to the decrease in food intake

after bariatric surgery. Four weeks after the interventions, rats were sacrificed by

decapitation and pancreas and blood samples were collected. A small portion of the 15

pancreas was fixed in 4% paraformaldehyde for histological analyses. All experimental

procedures conformed to the European Guidelines for the care and use of Laboratory

Animals (directive 2010/63/EU) and were approved by the Ethical Committee for

Animal Experimentation of the University of Navarra (049/10).

Blood and tissue analysis 20

Biochemical and hormonal assays were performed in sera samples as earlier

described.20, 23 Total ghrelin levels (#EZRGRT-91 K, Millipore, Billerica, MA, USA),

GLP-1 (AKMGP-011, Shibayagi Co., Ltd., Japan) and GIP (#EZRMGIP-55K,

Millipore) were evaluated by ELISA with inter- and intra-assay coefficients of variation

being 0.8% and 2.8% (ghrelin), <5% and <5% (GLP-1) and 3.7% and 2.6% (GIP), 25

respectively. The adipocyte insulin resistance (Adipo-IR) index, was also assessed.18

Oral glucose tolerance test and insulin peritoneal tolerance test

After a 12-h fasting period, oral glucose (OGTT) and insulin intraperitoneal

(IPITT) tolerance tests were performed as previously described.27 Glucose

concentrations were measured before and 15, 30, 60, 90 and 120 min after the oral 30

glucose challenge (2 g/kg of body weight) or intraperitoneal insulin administration (0.15

6

IU/mL) with an automatic glucose sensor (Ascensia Elite, Bayer, Barcelona, Spain)

from whole blood obtained from the tail vein. The area under the curve (AUC) of blood

glucose levels during OGTT and IPITT was calculated by the trapezoidal method.

RNA isolation and real-time PCR

RNA isolation and purification were performed as previously described.20 5

Transcript levels of Aqp3, Aqp7, Aqp9, and Aqp12 were quantified by real-time PCR

(7300 Real Time PCR System, Applied Biosystems, Foster City, CA, USA). Primers

and probes (Supplemental Table 1) were designed using the software Primer Express

2.0 (Applied Biosystems) and acquired from Genosys (Sigma, St. Louis, MO, USA).

All results were normalized for the expression of 18S rRNA (Applied Biosystems), and 10

relative quantification was calculated as fold expression over the calibrator sample.17

Western-blot studies

Blots were incubated overnight at 4 ºC with rabbit polyclonal anti-AQP7 (sc-

28625, Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA) and anti-AQP12

(CPA2913100, Acris antibodies, London, UK) antibodies or murine monoclonal anti-β-15

actin antibody (A5441, Sigma) diluted 1:1,000 (AQP7), 1:500 (AQP12) or 1:5,000 (β-

actin) in blocking solution. The antigen-antibody complexes were detected using HRP-

conjugated anti-rabbit or anti-mouse IgG antibodies and the enhanced

chemiluminescence ECL Plus system (Amersham Biosciences, Buckinghamshire, UK).

Immunohistochemistry of AQP7 and AQP12 in the pancreas 20

The immunodetection of AQP7 and AQP12 in histological sections of the

pancreas was performed by an indirect immunoperoxidase method,28 using rabbit

polyclonal anti-AQP7 (sc28625, Santa Cruz Biotechnology, Inc.) and anti-AQP12

(CPA2913100, Acris) antibodies (both diluted 1:100).

Imaging and quantification of β-cell area and number 25

Insulin immunohistochemistry was performed to identify β-cells in the pancreas

by using guinea pig polyclonal anti-insulin antibody (A0564, Dako, Golstrup, Denmark)

diluted 1:100.29 Images of insulin-positive pancreatic β-cells in Langerhans islets were

captured in all fields from each animal with the 20X objective, and their area and

number were assessed using the software AxioVision Release 4.6.3 (Zeiss, Göttingen, 30

Germany).

7

TUNEL assay

The apoptosis of β-cells was analyzed by TUNEL in histological sections of the

pancreas with the In Situ Cell Death Detection Kit, POD (11684817910, Roche, Basel,

Switzerland).

Cell cultures 5

RIN-m5F rat insulinoma β-cells (CRL-11605, ATCC, Manassas, VA, USA)

were cultured in ATCC-formulated RPMI 1640 medium with 10% fetal bovine serum

(FBS) and antibiotic-antimycotic. Cells were serum-starved for 24 h and then stimulated

with increasing concentrations of acylated or desacyl ghrelin (Tocris, Ellisville, MO,

USA) or GLP-1 (9-36) (Bachem, Bubendorf, Switzerland) for 24 h. Insulin release was 10

determined by ELISA (Crystal Chem, Inc., Chicago, IL, USA) and intracelullar TG

content was measured as previously described.30

Permeability assays

Water (Pf) and glycerol (Pgly) permeability were measured in RIN-m5F β-cells,

as previously described.31, 32 Pf and Pgly coefficients were calculated using the model 15

equations described by Madeira and colleagues33 and the Berkeley Madonna software

(http://www.berkeleymadonna.com/).

Statistical analysis

Data are expressed as the mean ± SEM. The PS Power and Sample Size

Calculations software (edition 3.0.43) was used to determine the power of the study and 20

sample size calculation. Statistical differences between mean values were analyzed

using Student’s t test or one-way ANOVA followed by Tukey’s or Dunnett’s post-hoc

tests, where appropriate. Kruskal-Wallis followed by U Mann-Whiney was performed

for a sample size less than 10. Pearson’s correlation coefficients (r) were used to

analyze the association between variables. The statistical analyses were performed using 25

the SPSS/Windows 15.0 software (SPSS Inc., Chicago, IL, USA).

8

RESULTS

Effect of sleeve gastrectomy on pancreatic β-cell mass and steatosis in obese rats

Obese rats exhibited higher body weight and whole-body adiposity, and sleeve

gastrectomy surgery improved these parameters to a higher extent than pair-feeding, as

previously reported.20 Diet-induced obesity was associated with insulin resistance, as 5

evidenced by higher (P<0.001) fasting glycemia, insulinemia, HOMA and adipo-IR

indices (Supplemental Table 2) as well as increased blood glucose levels (P<0.05) and

higher AUC (P<0.0001) during the OGTT and IPITT compared to control lean rats

(Supplemental Fig. 1). Four weeks after surgical interventions, rats submitted to sleeve

gastrectomy exhibited a decrease in fasting glycemia and improvement in the QUICKI 10

and adipo-IR indices (Supplemental Table 3) as well as lower blood glucose levels and

AUC during the OGTT and IPITT (Supplemental Fig. 2) compared to the sham-

operated and pair-fed groups.

To gain further insight into the improved glucose metabolism after sleeve

gastrectomy, we investigated the pancreatic β-cell mass and steatosis of the 15

experimental animals. Representative images of insulin staining in the pancreas are

illustrated in Fig. 1a-b. Quantitative analysis of β-cell mass revealed that obese rats

exhibited a 40% decrease in islet density (P<0.05), (Fig. 1d) without changes in β-cell

area and apoptosis (Fig. 1c and 1e). No statistically significant changes were observed

in the β-cell area and number after sleeve gastrectomy (Fig. 1f-g). However, a 20

significant reduction (P<0.05) in β-cell apoptosis was observed after sleeve gastrectomy

(Fig. 1h). Obese rats showed an increase (P<0.05) in pancreatic steatosis, which was

completely reversed (P<0.05) by sleeve gastrectomy (Fig. 1i-j). Nonetheless, no

differences between the intrapancreatic TG content in sleeve gastrectomy and pair-fed

groups were found (P=0.440). A positive correlation of pancreatic fat accumulation 25

with β-cell apoptosis was found (r=0.33, P<0.05).

Obesity and weight loss achieved by sleeve gastrectomy were associated with an

increased pancreatic AQP7 expression

To analyze the potential involvement of aquaglyceroporins in the changes in

pancreatic β-cell mass and steatosis after sleeve gastrectomy, we first evaluated the 30

transcript levels of Aqp3, Aqp7 and Aqp9 in rat pancreas. Since Aqp10 constitutes a

pseudogene in rodents,34 its expression was not included in this study. Aqp7 was the

9

most abundantly expressed aquaglyceroporin, while the expression of Aqp3 was

undetectable and Aqp9 was only detectable in 10% of the studied samples.

We next assessed the impact of obesity and weight loss achieved by sleeve

gastrectomy and pair-feeding on the mRNA and protein expression levels of pancreatic

AQP7 and AQP12, the other aquaporin with known functions in the pancreas. As 5

illustrated in Fig. 2a-b, tissue distribution of AQP7 and AQP12 presented a

predominant immunostaining in β-cells of the Langerhans islets. Obesity was associated

with an increased gene and protein expression (P<0.05) of pancreatic AQP7 and AQP12

(Fig. 2c-e). Pancreatic transcript levels of Aqp7 were negatively correlated with total

ghrelin (r=-0.37, P=0.005). Aqp12 mRNA was positively associated with insulin 10

(r=0.46, P=0.002), HOMA (r=0.41, P=0.006), serum TG (r=0.23, P=0.043) and

intrapancreatic TG content (r=0.49, P<0.001) while negatively correlated with QUICKI

(r=-0.36, P<0.001). A significant increase (P<0.05) in the mRNA and protein levels of

AQP7 in the pancreas was observed after sleeve gastrectomy compared to sham

surgery. Sleeve-gastrectomized rats exhibited a tendency towards higher AQP12 mRNA 15

and protein in the pancreas than sham-operated animals, but fell out of statistical

significance (both P>0.05). No changes were observed in the pair-fed group, suggesting

that changes in pancreatic AQP7 and AQP12 expression are beyond caloric restriction.

Effect of ghrelin and GLP-1 on insulin release and intracellular TG content in

RIN-m5F β-cells 20

Since ghrelin, GIP and GLP-1 are important gut hormones mediating the

amelioration of glucose metabolism after bariatric surgery,35 the fasting circulating

concentrations of these factors were evaluated in our experimental animals. Obese rats

showed lower (P<0.05) total ghrelin, without significant changes in GIP and GLP-1

levels (Supplemental Table 2). Sleeve gastrectomy induced a remarkable reduction 25

(P<0.001) in total ghrelin levels (Fig. 3a), lower (P<0.05) GIP values (Fig. 3b) as well

as a tendency towards higher (P=0.155) GLP-1 concentrations (Fig. 3c) compared to

the other groups.

We next analyzed the effect of acylated and desacyl ghrelin as well as GLP-1 on

insulin release and intracellular lipid accumulation in rat RIN-m5F β-cells, a widely 30

used cell line based on its high insulin secretion rate. The exposition of RIN-m5F β-

cells to increasing concentrations of acylated or desacyl ghrelin for 24 h did not modify

10

insulin release (Fig. 3d-e), but stimulated (P<0.05) the intracellular TG content (Fig.

3g-h). The treatment with increasing concentrations of GLP-1 stimulated (P<0.05)

insulin secretion (Fig. 3f) and diminished (P<0.05) the intracytoplasmatic lipid

accumulation (Fig. 3i) in RIN-m5F β-cells at the concentrations of 10 and 100 nmol/L.

Acylated ghrelin as well as GLP-1 downregulated AQP7 and AQP12 expression in 5

pancreatic β-cells

AQP7 facilitates glycerol transport in β-cells.6 Thus, we first confirmed the

water and glycerol permeability of the RIN-m5F β-cell line, a widely used cell line

based on its high insulin secretion rate36 (Fig. 4a-b). The time course of the relative cell

volume change (V/V0) of RIN-m5F β-cells exposed to an osmotic shock with mannitol, 10

inducing water outflow and cell shrinkage, is shown in Fig. 4a. The osmotic water

permeability coefficient (Pf) for this cell line was (0.8±0.2)x10-3cm/s. On the other

hand, glycerol permeability was evaluated by computing the time course of the cell

volume change of cells subjected to an osmotic shock with glycerol (Fig. 4b). After the

first shrinkage due to water outflow, the time course of cell re-swelling (V/V0) due to 15

facilitated glycerol influx gave a Pgly of (1.9±1.6)x10-6 cm/s. These permeability values

are within the range of the Pf and Pgly measured in mice mature 3T3-L1 adipocytes

with endogenous AQP7 expression33 and, thus, reflect the contribution of aquaporins in

RIN-m5F β-cells for water and glycerol transport.

To establish the potential mechanism of action triggered by ghrelin isoforms and 20

GLP-1 for regulating insulin release and lipid accumulation in β-cells, the expression of

AQP7 and AQP12 induced by these gut hormones was evaluated in RIN-m5F β-cells

(Fig. 4c-f). The 24-h exposure of RIN-m5F β-cells to acylated ghrelin (Fig. 4c-d) and

GLP-1 (Fig. 4g-h) downregulated AQP7 and AQP12 mRNA and protein, whereas the

stimulation with desacyl ghrelin did not modify the expression of these aquaporins (Fig. 25

4e-f). The stimulation of RIN-m5F β-cells with GLP-1 did not result in a uniform

concentration-dependent decrease in AQP12 mRNA expression, especially at the

highest concentration (Fig. 4g). In this regard, it has been reported that prolonged

exposure of INS-1 β-cell line to the GLP-1 receptor agonist exendin-4 induces GLP-1

receptor internalization and desensitization.37 Interestingly, the protein expression of 30

AQP7 was negatively associated with intracellular lipid accumulation (r=-0.43,

P=0.023) in β-cells stimulated with acylated ghrelin as well as with insulin release (r=-

11

0.46, P=0.025) in β-cells treated with GLP-1. No correlation between AQP12 protein

and these parameters was detected (all P>0.05).

12

DISCUSSION

Obesity-associated insulin resistance and the related compensatory

hyperinsulinemia have been attributed to ectopic lipid overload.38 The overload of FFA

into the pancreas promotes β-cell hypertrophy and insulin hypersecretion, ultimately

causing β-cell dysfunction and death through lipoapoptosis.39 In line with this 5

observation, our results showed that hyperinsulinemic, insulin-resistant obese rats

showed a marked decrease in Langerhans islet number. The herein observed positive

association of pancreatic fat accumulation and β-cell apoptosis highlights the relevance

of lipotoxicity on β-cell dysfunction. Sleeve gastrectomy restored insulin sensitivity, as

evidenced by lower basal glucose levels and AUC during the OGTT and IPITT as well 10

as a higher QUICKI index, which is in accordance with several studies,40, 41 including

ours.20, 23 Furthermore, this bariatric procedure improved β-cell dysfunction in obese

rats, as evidenced by a decrease in β-cell apoptosis as well as improved insulin

sensitivity in the fasted state. Interestingly, obesity-associated pancreatic steatosis was

ameliorated after sleeve gastrectomy, which is in agreement with other studies,42 but 15

also after caloric restriction in the pair-fed group, suggesting that the decreased fat

accumulation in the pancreas is mediated by the beneficial effects of lower energy

intake. Thus, sleeve gastrectomy improves β-cell mass, apoptosis and steatosis

contributing to the amelioration of insulin secretion and sensitivity after surgery.

The hormonal changes underlying the improved β-cell function after sleeve 20

gastrectomy have not been completely unraveled. The incretin hormones GLP-1 and

GIP are among the most widely studied modulators of β-cell function,43 with the

incretinic effect accounting for 70% of the insulin secretion after an OGTT.44 GLP-1 is

produced and secreted by L-cells of the small intestine in response to nutrient ingestion,

whereas GIP is synthesized and released from K-cells and stimulates both insulin and 25

glucagon secretion in the pancreas.43 At the endocrine pancreas, GLP-1 binds its

receptor GLP-1R and suppresses glucagon secretion from α-cells and potentiates insulin

secretion from β-cells in a glucose-dependent manner. On the other hand, ghrelin is

secreted from X/A-like cells of the oxyntic glands in the gastric fundus mucosa.45 The

clear preprandial rise and a postprandial fall of circulating ghrelin supports its role in 30

meal initiation.46 In the pancreas, ghrelin acts as a survival factor promoting cell

survival in vitro in HIT-T15 pancreatic β-cells47 and in vivo in streptozotocin-induced

13

diabetic mice.48 In the present study, a dramatic reduction of circulating ghrelin levels,

increased GLP-1 concentrations and no effect on plasma GIP was observed after sleeve

gastrectomy, which is in agreement with other studies.23, 41, 49 In RIN-m5F β-cells, GLP-

1 promoted insulin secretion and reduced intracellular TG content. By contrast, we

herein show, for the first time, that acylated and desacyl ghrelin induce intracellular 5

lipid accumulation in RIN-m5F β-cells, which is in agreement with the lipogenic effect

of ghrelin isoforms in other metabolic tissues, including the adipose tissue30 and the

liver.50 Interestingly, the highest increase in intracellular TG accumulation was observed

in RIN-m5F β-cells treated with the lower concentration of desacyl ghrelin. A plausible

explanation for this finding may be that ghrelin downregulates its own receptor in 10

several cell types, such as chicken and porcine pituitary somatotropes,51 rat

hypothalamic neurons52 or human visceral adipocytes.30 The pancreatic β-cells express

the classical ghrelin receptor GHS-R 1a.53 Nonetheless, several authors have proposed

that when the biological actions induced by ghrelin are equally elicited by desacyl

ghrelin, these effects cannot be mediated by GHS-R1a, because desacyl ghrelin is 15

reportedly inactive on GHS-R1a.54-56 Thus, further studies are warranted in order to

disentangle the potential existence of an alternative ghrelin receptor in pancreatic β-

cells. Our results also showed that neither desacyl nor acylated ghrelin modified insulin

secretion in RIN-m5F β-cells. Similar results were found by Bando and colleagues in

transgenic mice with overexpression of intraislet ghrelin and without changes in insulin 20

secretion in vivo.57 Taken together, the increased GLP-1 levels after sleeve gastrectomy

might be mainly related to the improvement of insulin secretion, whereas reduced

ghrelin levels appears to be responsible of the amelioration of pancreatic steatosis after

surgery. The contribution of additional signals involved in β-cell function cannot be

ruled out. 25

To gain further insight into the molecular mechanisms triggering the

improvement of β-cell function, the role of ghrelin and GLP-1 in the expression of

pancreatic AQP7 and AQP12 was studied. AQP7 facilitates glycerol influx into β-cells

leading to insulin synthesis and exocytosis as well as TG synthesis.6, 58 In this regard,

transgenic Aqp7-deficient mice exhibit hyperinsulinemia and increased pancreatic 30

insulin-1 and insulin-2 mRNA levels as well as increased intraislet glycerol and TG

content.6 Although AQP7 is the main aquaglyceroporin in the pancreas,6, 58 our data

provides evidence for the additional presence of AQP9 glycerol channel. In fact, we

14

have previously found30 that acylated and desacyl ghrelin constitute negative regulators

of AQP7 in adipocytes and this downregulation contributes, in part, to the lipid

accumulation in fat cells. Accordingly, we found that both ghrelin isoforms diminished

AQP7 expression in parallel to an increased TG content in RIN-m5F β-cells.

Interestingly, GLP-1 tended to repress AQP7 expression in RIN-m5F β-cells with 5

AQP7 protein expression being negatively associated with insulin release. Thus, it

seems plausible that the reduction of AQP7 induced by ghrelin and GLP-1 might result

in intracellular glycerol accumulation, which can be used for the biosynthesis of TG, as

well as for insulin synthesis and secretion. Obesity and obesity-associated insulin

resistance are associated with an altered transcription of AQP7 in insulin-sensitive 10

tissues, such as adipose tissue,15-17, 28 liver18, 28, 59 and skeletal muscle.19 Interestingly,

sleeve gastrectomy restores the altered expression of aquaglyceroporins in epididymal

and subcutaneous fat depots and liver in parallel to the improvement of whole-body

adiposity and non-alcoholic fatty liver.20 To the best of our knowledge, this is the first

study describing changes in AQP7 after weight gain and weight loss in the pancreas. 15

Importantly, both weight gain and weight loss achieved by sleeve gastrectomy were

related with higher AQP7 mRNA and protein in the pancreas. The upregulation of

AQP7 might constitute an adaptive response of β-cells to increase glycerol uptake and

the subsequent insulin synthesis and secretion, which seems nevertheless inefficient to

improve the enhanced glucose levels in the obese state, but not after bariatric surgery. 20

This beneficial effect of sleeve gastrectomy is beyond caloric restriction, since no

effects of pair-feeding on AQP7 expression in the pancreas were observed.

On the other hand, AQP12 is reportedly expressed in the rough endoplasmic

reticulum (RER) and on the membranes of zymogen granules near the RER of the

pancreatic acinar cells.13 This subcellular location supports the potential role of AQP12 25

in the proper maturation and exocytosis of zymogen granules. Our results show that

AQP12 is also expressed in β-cells of the Langerhans islets based on the

immunohistochemical staining in histological sections of rat pancreas as well as by the

mRNA and protein expression data in RIN-m5F β-cells and samples of rat pancreas.

Interestingly, acylated ghrelin- and GLP-1-induced AQP12 downregulation in RIN-m5F 30

cell line was neither related to insulin release nor to TG accumulation pointing to other

functions of AQP12 in β-cells. In this regard, the increased pancreatic expression of

AQP12 together with the positive association between this superaquaporin with markers

15

of insulin resistance (insulinemia and HOMA) and ectopic lipid overload (serum TG

and intrapancreatic TG content) suggest that AQP12 might constitute a marker of

pancreatic damage. In this sense, Aqp12-deficient mice are more susceptible to

caerulein-induced acute pancreatitis, showing larger exocytic vesicles (vacuoles) in the

pancreatic acini.12 The normalization of pancreatic AQP12 expression after sleeve 5

gastrectomy might reflect the restoration of pancreatic function due to the reduction of

intrapancreatic steatosis and improved insulin secretion.

We herein report, for the first time, that sleeve gastrectomy restores the altered

expression of pancreas-specific AQP7 and AQP12 in obese rats contributing to the

prevention of steatosis and impaired insulin secretion in the pancreas. Our results 10

identify these aquaporins as important elements in mediating part of the beneficial

effects of bariatric surgery on glucose metabolism via the regulation of glycerol

biodisponibility, a key metabolite for pancreatic insulin production and secretion as well

as TG accumulation. In line with this observation, ghrelin and GLP-1, two important

hormones involved in the resolution of insulin resistance after bariatric surgery, regulate 15

the expression of these aquaporins in pancreatic β-cells. Further investigations are

required to establish the suitability of pancreatic AQP7 and AQP12 as therapeutic

targets for human obesity-associated type 2 diabetes.

ACKNOWLEDGMENTS

We thank Beatriz Ramírez (Metabolic Research Laboratory, Clínica Universidad 20

de Navarra) for technical assistance as well as all the staff of the breeding house of the

University of Navarra.

16

REFERENCES

1. Best L, Brown PD, Yates AP, Perret J, Virreira M, Beauwens R et al. Contrasting effects of glycerol and urea transport on rat pancreatic beta-cell function. Cell Physiol Biochem 2009; 23: 255-264

2. Carbrey JM, Agre P. Discovery of the aquaporins and development of the field. 5 Handb Exp Pharmacol 2009; 3-28

3. Frühbeck G. Obesity: aquaporin enters the picture. Nature 2005; 438: 436-437

4. Rodríguez A, Catalán V, Gómez-Ambrosi J, Frühbeck G. Aquaglyceroporins serve as metabolic gateways in adiposity and insulin resistance control. Cell Cycle 2011; 10: 1548-1556 10

5. Verkman AS. Aquaporins in clinical medicine. Annu Rev Med 2012; 63: 303-316

6. Matsumura K, Chang BH, Fujimiya M, Chen W, Kulkarni RN, Eguchi Y et al. Aquaporin 7 is a beta-cell protein and regulator of intraislet glycerol content and glycerol kinase activity, beta-cell mass, and insulin production and secretion. 15 Mol Cell Biol 2007; 27: 6026-6037

7. Delporte C, Virreira M, Crutzen R, Louchami K, Sener A, Malaisse WJ et al. Functional role of aquaglyceroporin 7 expression in the pancreatic beta-cell line BRIN-BD11. J Cell Physiol 2009; 221: 424-429

8. Skelly RH, Wicksteed B, Antinozzi PA, Rhodes CJ. Glycerol-stimulated 20 proinsulin biosynthesis in isolated pancreatic rat islets via adenoviral-induced expression of glycerol kinase is mediated via mitochondrial metabolism. Diabetes 2001; 50: 1791-1798

9. Muoio DM, Newgard CB. Mechanisms of disease: molecular and metabolic mechanisms of insulin resistance and beta-cell failure in type 2 diabetes. Nat Rev 25 Mol Cell Biol 2008; 9: 193-205

10. Virreira M, Perret J, Delporte C. Pancreatic beta-cells: Role of glycerol and aquaglyceroporin 7. Int J Biochem Cell Biol 2011; 43: 10-13

11. Hibuse T, Maeda N, Funahashi T, Yamamoto K, Nagasawa A, Mizunoya W et al. Aquaporin 7 deficiency is associated with development of obesity through 30 activation of adipose glycerol kinase. Proc Natl Acad Sci USA 2005; 102: 10993-10998

12. Ohta E, Itoh T, Nemoto T, Kumagai J, Ko SB, Ishibashi K et al. Pancreas-specific aquaporin 12 null mice showed increased susceptibility to caerulein-induced acute pancreatitis. Am J Physiol Cell Physiol 2009; 297: C1368-1378 35

13. Itoh T, Rai T, Kuwahara M, Ko SB, Uchida S, Sasaki S et al. Identification of a novel aquaporin, AQP12, expressed in pancreatic acinar cells. Biochem Biophys Res Commun 2005; 330: 832-838

14. Reshef L, Olswang Y, Cassuto H, Blum B, Croniger CM, Kalhan SC et al. Glyceroneogenesis and the triglyceride/fatty acid cycle. J Biol Chem 2003; 278: 40 30413-30416

17

15. Marrades MP, Milagro FI, Martínez JA, Moreno-Aliaga MJ. Differential expression of aquaporin 7 in adipose tissue of lean and obese high fat consumers. Biochem Biophys Res Commun 2006; 339: 785-789

16. Prudente S, Flex E, Morini E, Turchi F, Capponi D, De Cosmo S et al. A functional variant of the adipocyte glycerol channel aquaporin 7 gene is 5 associated with obesity and related metabolic abnormalities. Diabetes 2007; 56: 1468-1474

17. Catalán V, Gómez-Ambrosi J, Pastor C, Rotellar F, Silva C, Rodríguez A et al. Influence of morbid obesity and insulin resistance on gene expression levels of AQP7 in visceral adipose tissue and AQP9 in liver. Obes Surg 2008; 18: 695-10 701

18. Rodríguez A, Gena P, Méndez-Giménez L, Rosito A, Valentí V, Rotellar F et al. Reduced hepatic aquaporin-9 and glycerol permeability are related to insulin resistance in non-alcoholic fatty liver disease. Int J Obes 2014; 38: 1213-1220

19. Wakayama Y, Hirako S, Ogawa T, Jimi T, Shioda S. Upregulated expression of 15 AQP 7 in the skeletal muscles of obese ob/ob mice. Acta Histochem Cytochem 2014; 47: 27-33

20. Méndez-Giménez L, Becerril S, Moncada R, Valentí V, Ramírez B, Lancha A et al. Sleeve gastrectomy reduces hepatic steatosis by improving the coordinated regulation of aquaglyceroporins in adipose tissue and liver in obese rats. Obes 20 Surg 2015; 25: 1723-1734

21. Gagner M, Deitel M, Erickson AL, Crosby RD. Survey on laparoscopic sleeve gastrectomy (LSG) at the Fourth International Consensus Summit on Sleeve Gastrectomy. Obes Surg 2013; 23: 2013-2017

22. Eickhoff H, Guimarães A, Louro TM, Seiça RM, Castro ESF. Insulin resistance 25 and beta cell function before and after sleeve gastrectomy in obese patients with impaired fasting glucose or type 2 diabetes. Surg Endosc 2015; 29: 438-443

23. Rodríguez A, Becerril S, Valentí V, Moncada R, Méndez-Giménez L, Ramírez B et al. Short-term effects of sleeve gastrectomy and caloric restriction on blood pressure in diet-induced obese rats. Obes Surg 2012; 22: 1481-1490 30

24. Nannipieri M, Baldi S, Mari A, Colligiani D, Guarino D, Camastra S et al. Roux-en-Y gastric bypass and sleeve gastrectomy: mechanisms of diabetes remission and role of gut hormones. J Clin Endocrinol Metab 2013; 98: 4391-4399

25. Vigneshwaran B, Wahal A, Aggarwal S, Priyadarshini P, Bhattacharjee H, 35 Khadgawat R et al. Impact of Sleeve Gastrectomy on Type 2 Diabetes Mellitus, Gastric Emptying Time, Glucagon-Like Peptide 1 (GLP-1), Ghrelin and Leptin in Non-morbidly Obese Subjects with BMI 30-35.0 kg/m2: a Prospective Study. Obes Surg 2016;

26. Valentí V, Martín M, Ramírez B, Gómez-Ambrosi J, Rodríguez A, Catalán V et 40 al. Sleeve gastrectomy induces weight loss in diet-induced obese rats even if high-fat feeding is continued. Obes Surg 2011; 21: 1438-1443

27. Méndez-Giménez L, Becerril S, Moncada R, Valentí V, Fernández S, Ramírez B et al. Gastric plication improves glycemia partly by restoring the altered

18

expression of aquaglyceroporins in adipose tissue and the liver in obese rats. Obes Surg 2017; doi: 10.1007/s11695-11016-12532-11692

28. Rodríguez A, Catalán V, Gómez-Ambrosi J, García-Navarro S, Rotellar F, Valentí V et al. Insulin- and leptin-mediated control of aquaglyceroporins in human adipocytes and hepatocytes is mediated via the PI3K/Akt/mTOR 5 signaling cascade. J Clin Endocrinol Metab 2011; 96: E586-597

29. Jones HB, Nugent D, Jenkins R. Variation in characteristics of islets of Langerhans in insulin-resistant, diabetic and non-diabetic-rat strains. Int J Exp Pathol 2010; 91: 288-301

30. Rodríguez A, Gómez-Ambrosi J, Catalán V, Gil MJ, Becerril S, Sáinz N et al. 10 Acylated and desacyl ghrelin stimulate lipid accumulation in human visceral adipocytes. Int J Obes 2009; 33: 541-552

31. Madeira A, Fernández-Veledo S, Camps M, Zorzano A, Moura TF, Ceperuelo-Mallafré V et al. Human aquaporin-11 is a water and glycerol channel and localizes in the vicinity of lipid droplets in human adipocytes. Obesity 2014; 22: 15 2010-2017

32. Madeira A, Mósca AF, Moura TF, Soveral G. Aquaporin-5 is expressed in adipocytes with implications in adipose differentiation. IUBMB Life 2015; 67: 54-60

33. Madeira A, Camps M, Zorzano A, Moura TF, Soveral G. Biophysical 20 assessment of human aquaporin-7 as a water and glycerol channel in 3T3-L1 adipocytes. PLoS One 2013; 8: e83442

34. Morinaga T, Nakakoshi M, Hirao A, Imai M, Ishibashi K. Mouse aquaporin 10 gene (AQP10) is a pseudogene. Biochem Biophys Res Commun 2002; 294: 630-634 25

35. Frühbeck G. Bariatric and metabolic surgery: a shift in eligibility and success criteria. Nat Rev Endocrinol 2015; 11: 465-477

36. Hohmeier HE, Newgard CB. Cell lines derived from pancreatic islets. Mol Cell Endocrinol 2004; 228: 121-128

37. Baggio LL, Kim JG, Drucker DJ. Chronic exposure to GLP-1R agonists 30 promotes homologous GLP-1 receptor desensitization in vitro but does not attenuate GLP-1R-dependent glucose homeostasis in vivo. Diabetes 2004; 53 Suppl 3: S205-214

38. Méndez-Giménez L, Rodríguez A, Balaguer I, Frühbeck G. Role of aquaglyceroporins and caveolins in energy and metabolic homeostasis. Mol Cell 35 Endocrinol 2014; 397: 78–92

39. Lee Y, Lingvay I, Szczepaniak LS, Ravazzola M, Orci L, Unger RH. Pancreatic steatosis: harbinger of type 2 diabetes in obese rodents. Int J Obes 2010; 34: 396-400

40. Wilson-Pérez HE, Chambers AP, Sandoval DA, Stefater MA, Woods SC, 40 Benoit SC et al. The effect of vertical sleeve gastrectomy on food choice in rats. Int J Obes 2013; 37: 288-295

19

41. Basso N, Soricelli E, Castagneto-Gissey L, Casella G, Albanese D, Fava F et al. Insulin Resistance, Microbiota, and Fat Distribution Changes by a New Model of Vertical Sleeve Gastrectomy in Obese Rats. Diabetes 2016; 65: 2990-3001

42. Honka H, Koffert J, Hannukainen JC, Tuulari JJ, Karlsson HK, Immonen H et al. The effects of bariatric surgery on pancreatic lipid metabolism and blood 5 flow. J Clin Endocrinol Metab 2015; 100: 2015-2023

43. Hussain MA, Akalestou E, Song WJ. Inter-organ communication and regulation of beta cell function. Diabetologia 2016; 59: 659-667

44. Romero F, Nicolau J, Flores L, Casamitjana R, Ibarzabal A, Lacy A et al. Comparable early changes in gastrointestinal hormones after sleeve gastrectomy 10 and Roux-En-Y gastric bypass surgery for morbidly obese type 2 diabetic subjects. Surg Endosc 2012; 26: 2231-2239

45. Frühbeck G, Díez Caballero A, Gil MJ. Fundus functionality and ghrelin concentrations after bariatric surgery. N Engl J Med 2004; 350: 308-309

46. Cummings DE, Purnell JQ, Frayo RS, Schmidova K, Wisse BE, Weigle DS. A 15 preprandial rise in plasma ghrelin levels suggests a role in meal initiation in humans. Diabetes 2001; 50: 1714-1719

47. Granata R, Settanni F, Trovato L, Destefanis S, Gallo D, Martinetti M et al. Unacylated as well as acylated ghrelin promotes cell survival and inhibit apoptosis in HIT-T15 pancreatic beta-cells. Journal of Endocrinological 20 Investigation 2006; 29: Rc19-Rc22

48. Bando M, Iwakura H, Ariyasu H, Koyama H, Hosoda K, Adachi S et al. Overexpression of intraislet ghrelin enhances beta-cell proliferation after streptozotocin-induced beta-cell injury in mice. Am J Physiol Endocrinol Metab 2013; 305: E140-148 25

49. Al-Sabah S, Alasfar F, Al-Khaledi G, Dinesh R, Al-Saleh M, Abul H. Incretin Response to a Standard Test Meal in a Rat Model of Sleeve Gastrectomy with Diet-Induced Obesity. Obes Surg 2014; 24: 95-101

50. Porteiro B, Díaz-Ruíz A, Martínez G, Senra A, Vidal A, Serrano M et al. Ghrelin requires p53 to stimulate lipid storage in fat and liver. Endocrinology 30 2013; 154: 3671-3679

51. Geelissen SM, Beck IM, Darras VM, Kuhn ER, Van der Geyten S. Distribution and regulation of chicken growth hormone secretagogue receptor isoforms. Gen Comp Endocrinol 2003; 134: 167-174

52. Luque RM, Kineman RD, Park S, Peng XD, Gracia-Navarro F, Castaño JP et al. 35 Homologous and heterologous regulation of pituitary receptors for ghrelin and growth hormone-releasing hormone. Endocrinology 2004; 145: 3182-3189

53. Volante M, Allia E, Gugliotta P, Funaro A, Broglio F, Deghenghi R et al. Expression of ghrelin and of the GH secretagogue receptor by pancreatic islet cells and related endocrine tumors. J Clin Endocrinol Metab 2002; 87: 1300-40 1308

54. Baldanzi G, Filigheddu N, Cutrupi S, Catapano F, Bonissoni S, Fubini A et al. Ghrelin and des-acyl ghrelin inhibit cell death in cardiomyocytes and endothelial cells through ERK1/2 and PI 3-kinase/AKT. J Cell Biol 2002; 159: 1029-1037

20

55. Muccioli G, Pons N, Ghe C, Catapano F, Granata R, Ghigo E. Ghrelin and des-acyl ghrelin both inhibit isoproterenol-induced lipolysis in rat adipocytes via a non-type 1a growth hormone secretagogue receptor. Eur J Pharmacol 2004; 498: 27-35

56. Thielemans L, Peeters PJ, Jonckheere H, Luyten W, de Hoogt R, Coulie B et al. 5 The hepatocarcinoma cell line HepG2 does not express a GHS-R1a-type ghrelin receptor. J Recept Signal Transduct Res 2007; 27: 309-322

57. Bando M, Iwakura H, Ariyasu H, Hosoda H, Yamada G, Hosoda K et al. Transgenic overexpression of intraislet ghrelin does not affect insulin secretion or glucose metabolism in vivo. American Journal of Physiology-Endocrinology 10 and Metabolism 2012; 302: E403-408

58. Louchami K, Best L, Brown P, Virreira M, Hupkens E, Perret J et al. A new role for aquaporin 7 in insulin secretion. Cell Physiol Biochem 2012; 29: 65-74

59. Rodríguez A, Moreno NR, Balaguer I, Méndez-Giménez L, Becerril S, Catalán V et al. Leptin administration restores the altered adipose and hepatic expression 15 of aquaglyceroporins improving the non-alcoholic fatty liver of ob/ob mice. Sci Rep 2015; 5: 12067

21

FIGURE LEGENDS

Fig. 1. Effect of obesity and sleeve gastrectomy-induced weight loss on rat β-cell mass

and steatosis. Representative images of insulin immunostaining in pancreas of

control lean and obese rats (a) as well as obese animals after surgical and dietary

interventions (b), magnification 200X, scale bar=200 µm. Bar graphs illustrate 5

the impact of obesity and weight loss achieved by sleeve gastrectomy in β-cell

area (c, f), number (d, g) and apoptosis (e, h) as well as in intrapancreatic

triacylglycerol content (i, j). Statistical differences were analyzed using

Student’s t test or Kruskal-Wallis followed by U Mann Whitney’s test, where

appropriate.*P<0.05; **P<0.01; ***P<0.001 vs lean control rats or sham-10

operated group.

Fig. 2. Impact of obesity and sleeve gastrectomy-induced weight loss on AQP7 and

AQP12 expression in rat pancreas. Immunohistochemical detection of AQP7

(upper panels) and AQP12 (lower panels) in rat pancreas of lean and obese rats

(a) as well as four weeks after surgical and dietary interventions (b), 15

magnification 100X, scale bar=200 µm. Pancreatic gene (c, d) and protein (e, f)

expression of AQP7 and AQP12 in experimental animals is shown. Statistical

differences were analyzed using Student’s t test or Kruskal-Wallis followed by

U Mann Whitney’s test, where appropriate. *P<0.05 vs lean control rats or

sham-operated group. 20

Fig. 3. Effect of acylated and desacyl ghrelin and GLP-1 on insulin release and

intracellular lipid accumulation in rat RIN-m5F β-cells. Post-surgical serum total

ghrelin (a), GIP (b) and GLP-1 (c) levels of the experimental animals after

surgical and dietary interventions. RIN-m5F β-cells were treated with acylated

ghrelin (d, g), desacyl ghrelin (e, h) or GLP-1 (f, i) at indicated concentrations 25

for 24 h. Insulin release and intracellular triacylglycerol content were measured

(n=9-10 per concentration). Statistical differences were analyzed using a one-

way ANOVA followed by Tukey’s or Dunnett’s post-hoc test, where

appropriate. *P<0.05. *P<0.01 vs sham-operated group or unstimulated cells.

Fig. 4. Effect of acylated and desacyl ghrelin and GLP-1 on AQP7 and AQP12 30

expression in rat RIN-m5F β-cells. Functional assessment of water (a) and

glycerol (b) permeability in rat RIN-m5F β-cells (n=3) is shown. Bar graphs

22

illustrate gene and protein expression of AQP7 and AQP12 in rat RIN-m5F β-

cells treated with acylated ghrelin (c, d), desacyl-ghrelin (e, f) and GLP-1 (g, h)

at indicated concentrations (n=9-10 per concentration). Statistical differences

were analyzed using a one-way ANOVA followed by Dunnett’s post-hoc test.

P<0.05; **P<0.01; ***P<0.001 vs unstimulated cells. 5

Fig.1

0

2000

4000

6000

8000

10000

12000

ND HFD

Lan

ger

han

s is

let

area

(mm

2)

0.0

0.5

1.0

1.5

ND HFD

Lan

ger

han

s is

let

num

ber

(% v

ersu

s co

ntr

ol

rats

)

*

b a

d c

Lan

ger

han

s is

let

area

(mm

2)

0

5000

10000

15000

20000

Lan

ger

han

s is

let

num

ber

(% v

ersu

s co

ntr

ol

rats

)

0.0

0.5

1.0

1.5

g f

e

h

b-c

ell

apopto

sis

(%)

b -

cell

apopto

sis

(%)

0

10

20

30

40

50

ND HFD

0

10

20

30

40

50

j i

Intr

apan

crea

tic

TG

(mg/g

pro

tein

)

Intr

apan

crea

tic

TG

(mg/g

pro

tein

)

ND HFD

ND HFD

Pan

crea

s

Sham surgery Sleeve gastrectomy Pair-fed

Pan

crea

s Sham surgery Sleeve gastrectomy Pair-fed




*

*

0.00

0.02

0.04

0.06

0.00

0.02

0.04

0.06

*

Fig.2

b

d c

f e

ND HFD Sham surgery Sleeve gastrectomy Pair-fed a P

ancr

eas

Aqp m

RN

A/1

8S r

RN

A

Pan

crea

s

AQ

P/b

-act

in

0.0

0.5

1.0

1.5

2.0

2.5

3.0

Aqp7 Aqp12

* *

0.0

0.5

1.0

1.5

2.0

2.5

3.0

Pan

crea

s

AQ

P/b

-act

in

Pan

crea

s

Aqp m

RN

A/1

8S r

RN

A

Aqp7 Aqp12

*

0.0

1.0

2.0

3.0

4.0

*

AQP7 AQP12

*

0.0

0.5

1.0

1.5

2.0

AQP7 AQP12

AQP7 AQP12 b-actin b-actin

AQP7 AQP12 b-actin b-actin

AQ

P7

AQ

P12

Pan

crea

s AQ

P7

AQ

P12 Pan

crea

s

ND HFD


ND HFD


*

e d

RIN

-m5F

b-c

ells

Insu

lin r

elea

se (

ng/m

L)

0

20

40

60

80

100

120 **

*

RIN

-m5F

b-c

ells

Insu

lin r

elea

se (

ng/m

L)

0

10

20

30

40

50

60

70

80

0

10

20

30

40

50

60

70

80

RIN

-m5F

b-c

ells

Insu

lin r

elea

se (

ng/m

L)

f

RIN

-m5F

b-c

ells

Intr

acel

lula

r T

G (

mg/g

pro

tein

)

0

2

4

6

* * *

0 2 4 6 8

10 12 14 16 18 20 *

*

RIN

-m5F

b-c

ells

Intr

acel

lula

r T

G (

mg/g

pro

tein

)

0

2

4

6

8

* *

RIN

-m5F

b-c

ells

Intr

acel

lula

r T

G (

mg/g

pro

tein

)

h g i

a T

ota

l ghre

lin (

ng/m

L)

0.0

0.2

0.4

0.6

0.8

1.0

1.2

***

b

0.0

GL

P-1

(pg/m

L)

1.0

2.0

3.0

4.0

5.0



Fig.3

Control Acylated ghrelin 10 pmol/L

Acylated ghrelin 1000 pmol/L Acylated ghrelin 100 pmol/L

Control Desacyl ghrelin 10 pmol/L

Desacyl ghrelin 1000 pmol/L Desacyl ghrelin 100 pmol/L

Control GLP-1 1 nmol/L

GLP-1 100 nmol/L GLP-1 10 nmol/L



Control Desacyl ghrelin 10 pmol/L

Desacyl ghrelin 1000 pmol/L Desacyl ghrelin 100 pmol/L

Control GLP-1 1 nmol/L

GLP-1 100 nmol/L GLP-1 10 nmol/L

c

0

10

20

30

40

50

60

GIP

(pg/m

L)

*


RIN

-m5F

b-c

ells

Aqp m

RN

A/1

8S r

RN

A

RIN

-m5F

b-c

ells

Aqp m

RN

A/1

8S r

RN

A

Aqp7 Aqp12

RIN

-m5F

b-c

ells

Aqp m

RN

A/1

8S r

RN

A

Aqp7 Aqp12 0.0

0.5

1.0

1.5

2.0

2.5

Aqp7 Aqp12 0.0

0.5

1.0

1.5

* **

*

*

AQP7 AQP12 R

IN-m

5F

b-c

ells

AQ

P/b

-act

in

RIN

-m5F

b-c

ells

AQ

P/b

-act

in

AQP7 AQP12 0.0

0.5

1.0

1.5

2.0

AQP7 AQP12

0.0

0.5

1.0

1.5

2.0

* * * *** *** ***

b a

d c

f e

h g

AQP7 AQP12

b-actin b-actin

AQP7 AQP12

b-actin b-actin

AQP7 AQP12

b-actin b-actin

RIN

-m5F

b-c

ells

AQ

P/b

-act

in

0.0

0.5

1.0

1.5

* *

Time (s) Time (s)

Control Desacyl ghrelin 10 pmol/L Desacyl ghrelin 100 pmol/L

Desacyl ghrelin 1000 pmol/L

Control Desacyl ghrelin 10 pmol/L Desacyl ghrelin 100 pmol/L

Desacyl ghrelin 1000 pmol/L

Control GLP-1 1 nmol/L GLP-1 10 nmol/L

GLP-1 100 nmol/L

Control GLP-1 1 nmol/L GLP-1 10 nmol/L

GLP-1 100 nmol/L

0.00

0.25

0.50

0.75

1.00

1.25

0 20 40 60 80 100 120 0.00

0.25

0.50

0.75

1.00

1.25

RIN

-m5F

b-c

ells

V

/V0

0 20 40 60 80 100 120

* * *

0.0

0.5

1.0

1.5

2.0

RIN

-m5F

b-c

ells

V

/V0

Fig.4





1

Supplemental Table 1. Sequences of primers and TaqMan® probes.

Gene

(GenBank accession no.) Oligonucleotide sequence (5’-3’) Nucleotides

Aqp3

(NM_031703.1) Forward CTTCTTGGGTGCTGGGATTG 412-431

Reverse CAATGAGCTTGTTGTCTCCGG 472-492

Taqman® probe FAM-TACTATGATGCAATCTGGG-TAMRA 443-461 Aqp7

(NM_019157.2)

Forward GGCTTCGTGGATGAGGTATTTG 724-745 Reverse ACAGTCCAGCACTTCAAGGGAC 794-815

Taqman® probe FAM-AGCTGTGTATCTTCGCCATCACG-TAMRA 761-783

Aqp9 (NM_022960.2)

Forward TTTGCAACATATCCAGCTCCATT 905-927

Reverse GATCGTCTTTGCCATGTTTGACTC 986-1008 Taqman® probe FAM-CGCCAGGTGCCTTTGTAGACCAAGTG-TAMRA 936-961

Aqp12

(NM_001109009.1)

Forward TCCACTGTTCTGGGAACACCTT 729-750

Reverse TCTGCCGGTAGAACAGATTTCTCT 843-866

Taqman® probe FAM-ATCCTGGCTGTCCTACTCCATCAGGGC-TAMRA 797-823

Aqp, aquaporin.

2

1

Supplemental Table 2. Metabolic profile of control lean and obese rats.

Determination ND

(n=25)

HFD

(n=24)

P

Glucose (mg/dL) 80 2 90 2 <0.001

Insulin (ng/mL) 2.1 0.4 3.6 0.6 <0.001

HOMA 0.53 0.02 0.96 0.17 <0.001

QUICKI 0.52 0.03 0.42 0.02 <0.001

Adipo-IR 258 48 400 85 <0.001

GLP-1 (pg/mL) 3.14 0.13 3.43 0.17 0.208

GIP (pg/mL) 67.6 7.3 49.7 8.0 0.415

Total ghrelin (ng/mL) 0.97 0.15 0.71 0.07 0.014

ND, normal diet; HFD, high-fat diet; HOMA, homeostasis model

assessment; QUICKI, quantitative insulin sensitivity check index; Adipo-

IR; adipocyte insulin resistance index; GLP-1, glucagon-like peptide-1;

GIP, gastric inhibitory polypeptide. Data are the mean ± S.E.M. Statistical

differences were analyzed by Student’s t test. Bold values are statistically

significant P values.

2

Supplemental Table 3. Metabolic profile four weeks after surgical and dietary

interventions.

Determination Sham surgery

(n=27)

Sleeve gastrectomy

(n=26)

Pair-fed

(n=23)

P

Glucose (mg/dL) 79 2 78 2b 89 3 0.004

Insulin (ng/mL) 2.2 0.4 1.7 0.3 1.8 0.2 0.432

HOMA 0.52 0.09 0.40 0.07 0.47 0.06 0.514

QUICKI 0.46 0.01 0.56 0.05a,b

0.44 0.01 0.011

Adipo-IR 132 15 126 15a,b

192 23 0.009

HOMA, homeostasis model assessment; QUICKI, quantitative insulin sensitivity

check index. Data are the mean ± S.E.M. Statistical differences were analyzed by one-

way ANOVA followed by a Tukey’s post-hoc test. Bold values are statistically

significant P values. aP<0.05 vs sham surgery;

bP<0.05 vs pair-fed group.

OGTT

Time (min)

Blo

od g

luco

se (

mg/d

L) ND

HFD

OGTT

50

100

150

200

250

ND HFD

AU

C (

mg/d

L/m

in)

a b

c d

***

IPITT

Time (min)

Blo

od g

luco

se (

mg/d

L)

IPITT

0

50

100

150

ND HFD

AU

C (

mg/d

L/m

in)

***

60

90

120

150

0 30 60 90 120

*

**

*

0

20

40

60

80

0 30 60 90 120

*

**

*** ***

ND HFD

Supplemental Fig. 1. Impaired glucose tolerance and insulin sensitivity in diet-induced obese rats.

Blood glucose levels (a, c) and AUC (b, d) during OGTT and IPITT in rats fed a normal diet (ND) or a

high-fat diet (HFD). Statistical differences were analyzed by using one-way ANOVA followed by a

Tukey’s post-hoc test or a Student’s t test, where appropriate. *P<0.05, **P<0.01 vs control rats fed a ND.

OGTT OGTT

a b

c d

IPITT IPITT

Time (min)

Blo

od g

luco

se (

mg/d

L)

50

100

150

200

250

AU

C O

GT

T

Time (min)

Blo

od g

luco

se (

mg/d

L)

0

50

100

150

AU

C I

PIT

T

*,†

**,††

*,†



60

70

80

90

100

110

120

0 30 60 90 120

0

20

40

60

80

0 30 60 90 120



*,†

Supplemental Fig. 2. Improved glucose tolerance and insulin sensitivity after sleeve gastrectomy in

diet-induced obese rats. Blood glucose levels (a, c) and AUC (b, d) during OGTT and IPITT four weeks

after surgical and dietary interventions. Statistical differences were analyzed by using one-way ANOVA

followed by a Tukey post-hoc test. *P<0.05, **P<0.01 vs sham-operated rats. †P<0.05, ††P<0.01 vs pair-

fed group.

- 51 -

STUDY IV

4. Gastric plication improves glycaemia partly by restoring the

altered expression of aquaglyceroporins in adipose tissue and

liver in obese rats

Article

Méndez-Giménez L, Becerril S, Moncada R, Valentí V, Fernández S, Ramírez B, Catalán V, Gómez-Ambrosi J, Soveral G, Malagón MM, Diéguez C, Rodríguez A,

Frühbeck G.

Gastric plication improves glycaemia partly by restoring the altered expression of

aquaglyceroporins in adipose tissue and liver in obese rats.

Obes Surg 2017; doi: 10.1007/s11695-016-2532-2.

Hypothesis

Gastric plication improves body weight, metabolic profile and hepatic

gluconeogenesis as well as steatosis in diet-induced obese rats through the regulation of

aquaglyceroporins in adipose tissue and liver.

Objectives

To confirm the effectiveness of gastric plication in the reduction of body

weight, food intake and whole-body adiposity as well as in the improvement of

glucose tolerance in rats fed a normal diet or a high-fat diet.

To study the impact of gastric plication on markers of hepatic gluconeogenesis

and steatosis in rats fed a normal diet or a high-fat diet.

To analyze the impact of weight loss achieved by gastric plication and pair-

feeding on the expression of aquaglyceroporins in EWAT and SCWAT (AQP3

and AQP7) as well as in the liver (AQP9).

To evaluate the correlation of adipose and hepatic aquaglyceroporins with

markers of adiposity, glucose and lipid metabolism as well as hepatic steatosis.

Méndez-Giménez L, Becerril S, Moncada R, Valentí V, Fernández S, Ramírez B,

Catalán V, Gómez-Ambrosi J, Soveral G, Malagón MM, Diéguez C, Rodríguez A,

Frühbeck G. Gastric Plication Improves Glycemia Partly by Restoring the Altered

Expression of Aquaglyceroporins in Adipose Tissue and the Liver in Obese Rats.

Obesity Surgery January 2017;27(7):1763-1774.

http://dx.doi.org/10.1007/s11695-016-2532-2

http://metalib.unav.es:3210/unav?url_ver=Z39.88-2004&url_ctx_fmt=info:ofi/fmt:kev:mtx:ctx&ctx_enc=info:ofi/enc:UTF-8&ctx_ver=Z39.88-2004&rfr_id=info:sid/sfxit.com:azlist&sfx.ignore_date_threshold=1&rft.object_id=954925579101&rft.object_portfolio_id=

1

Supplemental table 1. Sequences of primers and TaqMan® probes.

Gene

(GenBank accession no.) Oligonucleotide sequence (5’-3’) Nucleotides

Aqp3

(NM_031703.1)

Forward CTTCTTGGGTGCTGGGATTG 412-431

Reverse CAATGAGCTTGTTGTCTCCGG 472-492

Taqman®

probe FAM-TACTATGATGCAATCTGGG-TAMRA 443-461

Aqp7

(NM_019157.2)

Forward GGCTTCGTGGATGAGGTATTTG 724-745

Reverse ACAGTCCAGCACTTCAAGGGAC 794-815

Taqman®

probe FAM-AGCTGTGTATCTTCGCCATCACG-TAMRA 761-783

Aqp9

(NM_022960.2)

Forward TTTGCAACATATCCAGCTCCATT 905-927

Reverse GATCGTCTTTGCCATGTTTGACTC 986-1008

Taqman®

probe FAM-CGCCAGGTGCCTTTGTAGACCAAGTG-TAMRA 936-961

Gk

(NM_024381.2)

Forward GGGACCAGTCTGCTGCTTTG 869-888

Reverse TGGCCCGTGTTACACAGTAAGA 947-968

Taqman®

probe FAM-ACAGGCCAAAAACACGTATGGAACAGG-TAMRA 915-941

G6pc

(NM_013098.2)

Forward GGATCTACCTTGCGGCTCACT 575-595

Reverse CCCGGATGTGGCTGAAAGT 646-664

Taqman®

probe FAM-CTGGAGTCTTGTCAGGCATTGCTGTGG-TAMRA 614-640

Pck1

(NM_198780.3)

Forward GTGATGACATTGCCTGGATGAA 1069-1090

Reverse TAATGGCGTTCGGATTTGTCTT 1167-1188

Taqman®

probe FAM-CAAGGCAACTTAAGGGCCATCAACC-TAMRA 1101-1125

Ppara

(NM_013196.1)

Forward AAGGCCTCAGGATACCACTATGG 699-721

Reverse CAGCTTCGATCACACTTGTCGTA 783-805

Taqman®

probe FAM-CTGCAAGGGCTTCTTTCGGCGAAC-TAMRA 740-763

Pparg

(NM_013124)

Forward CTGACCCAATGGTTGCTGATTAC 257-279

Reverse CCTGTTGTAGAGTTGGGTTTTTTCA 351-375

Taqman®

probe FAM-TGAAGCTCCAAGAATACCAAAGTGCG-TAMRA 290-315

Slc2a2

(NM_012879.2)

Forward GTTTTTCTGTGCCGTCTTCATGT 1155-1177

Reverse GAAGAGGAAGATGGCCGTCAT 1228-1248

Taqman®

probe FAM-TTGCTGGATAAGTTCACCTGGATG-TAMRA 1192-1215

Srebf1

(NM_001276707.1)

Forward ATGCGGCTGTCGTCTACCAT 2050-2069

Reverse AGTGTGCAGGAGATGCTATATCCAT 2158-2182

Taqman®

probe FAM-CATGCCATGGGCAAGTACACAGGAGG-TAMRA 2085-2110

Aqp, aquaporin; Gk, glycerol kinase; G6pc, glucose-6-phosphatase; Pck1, phosphoenolpyruvate carboxykinase 1;

Ppara, peroxisome proliferator-activator receptor ; Pparg, peroxisome proliferator-activator receptor ; Slc2a2, solute

carrier family 2 (facilitated glucose transporter), member 2; Srebf1, sterol regulatory element binding factor 1.

2

Supplemental table 2. Metabolic profile of lean and obese rats.

Determination Lean

(n=10)

DIO

(n=7)

P

Glucose (mg/dL) 85 1 93 3 0.034

Insulin (ng/mL) 4.2 0.4 5.5 0.6 0.059

HOMA 1.0 0.1 1.5 0.2 0.022

QUICKI 0.40 0.01 0.36 0.01 0.028

Glycerol (mg/dL) 29 3 31 4 0.691

FFA (mg/dL) 17.3 0.8 13.9 1.0 0.008

Adipo-IR index 65 10 84 12 0.267

Triacylglycerols (mg/dL) 185 34 132 12 0.155

Total cholesterol (mg/dL) 101 8 116 13 0.310

AST (U/L) 24 2 32 3 0.026

ALT (U/L) 10 2 14 2 0.090

Adiponectin ( g/mL) 13.3 0.5 12.1 0.4 0.106

Leptin (ng/mL) 13.0 1.1 23.5 1.9 0.001

Total ghrelin (ng/mL) 1.33 0.14 1.04 0.07 0.089

DIO, diet-induced obesity; HOMA, homeostasis model assessment; QUICKI, quantitative insulin

sensitivity check index; FFA, free fatty acids; AST, aspartate transaminase; ALT, alanine transaminase.

Data are the mean ± S.E.M. Statistical differences were analyzed by t Student’s test. Bold values are

statistically significant P values. 5

3

Supplemental Fig. 1. Body weight and whole-body adiposity in diet-induced obese rats. Bar graphs show the body weight (A), epididymal (EWAT), subcutaneous

(SCWAT), perirenal (PRWAT) and total adiposity fat content (B), cell surface area

(CSA) of EWAT adipocytes (C) and adipocyte size distribution (D) of lean and diet-5

induced obese rats. Representative histological sections of EWAT of the experimental

groups (E); magnification 100X, scale bar=100 m. Daily food intake (F) and food efficiency ratio (G) is also shown. *P<0.05; ***P<0.001 vs lean group.

4

Supplemental Fig. 2. Impact of gastric plication on body weight and whole-body

adiposity in diet-induced obese rats. Bar graphs show the body weight (A), percentage

of total weight loss (%TWL) (B), epididymal (EWAT), subcutaneous (SCWAT),

perirenal (PRWAT) and whole-body white adiposity (C), cell surface area (CSA) of 5 epididymal white adipocytes (D), as well as adipocyte size distribution (E) of

experimental animals fed either a normal (ND) or a high-fat diet (HFD) after surgical

interventions. Representative histological sections of EWAT of the experimental groups

(F); magnification 100X, scale bar=100 m. Daily food intake (G) and food efficiency

ratio (H) is also shown. aP<0.05 effect of diet.

bP<0.05 effect of surgery. (I) 10

Representative macroscopic view of Bouin-fixed stomachs obtained from rats submitted

to sham surgery (left panel) and gastric plication (right panel) (scale bar=1 cm). ng,

non-glandular stomach; g, glandular stomach.

5

Supplemental Fig. 3. Bar graphs show the liver weight (A) and intrahepatic

triacylglycerol content (B) in rats fed a normal or high-fat diet. Representative

histological sections of liver of the experimental groups (C); magnification 200X, scale

bar=100 m. Hepatic expression levels of lipogenic (D) and gluconeogenic (E) genes. 5

*P<0.05 vs lean group.

- 55 -

1. Summary of the main findings

Glycerol constitutes an important metabolite for the control of lipid

accumulation and glucose homeostasis in insulin-sensitive tissues and for pancreatic

insulin secretion. The present thesis shows the role of aquaglyceroporins, which mediate

glycerol transport in adipocytes (AQP3 and AQP7), hepatocytes (AQP9) and -cells

(AQP7), in the improvement of adiposity, NAFLD and -cell function induced by two

different bariatric surgery procedures, sleeve gastrectomy and gastric plication, in an

experimental model of diet-induced obesity. We confirmed the alterations in the

expression of aquaglyceroporins in insulin-sensitive tissues in the obese state. Obese

rats exhibited excess adiposity, hepatic and pancreatic steatosis, as well as impaired

glucose tolerance and insulin secretion. Obesity was associated with an increase in

EWAT AQP3 and SCWAT AQP7 and a decrease in hepatic AQP9. Interestingly, Aqp7

transcript levels in EWAT and SCWAT were positively associated with adiposity and

glycemia, while hepatic Aqp9 mRNA was negatively correlated with markers of hepatic

steatosis and insulin resistance. The two studied restrictive bariatric surgery techniques

exerted different impact on whole-body metabolism. On the one hand, obese rats

undergoing sleeve gastrectomy showed a reduction in body weight, whole-body

adiposity and hepatic steatosis as well as improved glucose tolerance four weeks after

surgery. Sleeve gastrectomy down-regulated AQP7 in both EWAT and SCWAT,

without changing hepatic AQP9. Thus, sleeve gastrectomy restores the coordinated

regulation of fat-specific AQP7 and liver-specific AQP9, thereby improving whole-

body adiposity and hepatic steatosis (Table 3). By contrast, gastric plication did not

change body weight and induced a modest reduction in whole-body adiposity and

hepatosteatosis. However, gastric plication improved basal glycemia by downregulating

AQP3, which entails lower efflux of glycerol from fat, lower plasma glycerol

availability, and a reduced use of glycerol as a substrate for hepatic gluconeogenesis.

Our results show, for the first time, that obesity is associated with higher AQP7

levels in the pancreas, which is involved in insulin secretion and TG accumulation in -

cells. Sleeve gastrectomy improved glucose tolerance and reduced pancreatic -cell

mass, apoptosis, steatosis and insulin secretion in obese rats. Circulating levels of

ghrelin and GLP-1, two important gut hormones mediating the resolution of insulin

resistance after bariatric surgery, were decreased and increased, respectively, after

- 56 -

sleeve gastrectomy. Interestingly, ghrelin and GLP-1 not only increased intracellular TG

content and insulin secretion, respectively, but also downregulated AQP7 expression in

vitro in RIN-m5F -cells. AQP7 protein was negatively correlated with intracellular

lipid accumulation in acylated ghrelin-treated cells and with insulin release in GLP-1-

stimulated -cells. Together, sleeve gastrectomy improves excess lipid accumulation

and impaired insulin secretion in obese rats with AQP7 contributing to this beneficial

effect through the regulation of glycerol availability in -cells (Table 3).

Table 3. Summary of the functional role of the changes in AQP expression after sleeve

gastrectomy and gastric plication.

▲Increase; ▼ Decrease.

2. Effect of sleeve gastrectomy and gastric plication on body weight,

whole-body adiposity and metabolic profile in obese rats

The prevalence of obesity and obesity-associated comorbidities, such as T2D

and NAFLD, has markedly increased during the past three decades, becoming a major

health problem worldwide. Bariatric surgery has emerged as the most effective

treatment to induce sustainable weight loss and improve metabolic profile in obesity

(Frühbeck, 2015). In this thesis, we have characterized the changes in body composition

as well as metabolic profile after two different bariatric surgical procedures, namely

sleeve gastrectomy and gastric plication, in diet-induced obese rats. The survival rate of

both surgical techniques was 100% with no animals being excluded due to

AQP

Tissue

(subcellular

location)

Changes

in

obesity

Changes after surgery Functional

changes associated

with AQPs after

surgery

Sleeve

gastrectomy

Gastric

plication

AQP3 WAT

(lipid droplets) ▲ ▲ ▼

Improvement in

lipolysis

AQP7

WAT

(membrane) ▲ ▼ =

Reduction in

adipocyte size

Pancreas

(membrane) ▲ ▲

No data

available

Improved insulin

synthesis and

secretion

AQP9 Liver

(membrane) =▼ ▲ ▼

Decrease in hepatic

gluconeogenesis

and lipogenesis

AQP12 Pancreas

(cytoplasm) =▼ -

No data available

Reduction of pancreatic damage

- 57 -

complications, confirming the safety of both sleeve gastrectomy (Rubino et al, 2016)

and gastric plication (Kourkoulos et al, 2012, Talebpour et al, 2012). In study II, our

results showed that four weeks after surgery, rats undergoing sleeve gastrectomy

exhibited a decrease in body weight and in all WAT depots (EWAT, SCWAT and

PRWAT) as well as lower adipocyte hypertrophy compared to the other animal groups

of the study. By contrast, animals submitted to gastric plication presented similar body

weight, whole-body adiposity and adipocyte cell surface area (CSA) compared to sham-

operated rats 1 month after surgery. One plausible explanation for the different results

obtained for weight loss consists in the distinct gastric capacity limitation approach. By

using the technique of sleeve gastrectomy, around the 60-80% of the stomach is cut

along the greater curvature leaving a narrow tube and excluding the gastric fundus,

while in the procedure of gastric plication, the stomach is invaginated inside the gastric

lumen without resection. In this regard, the reduction of circulating ghrelin, a hormone

mainly produced in the fundus of the stomach with orexigenic and adipogenic

properties (Rodríguez et al, 2009), appears to be involved in the weight-loss effects of

sleeve gastrectomy. Rats submitted to sleeve gastrectomy exhibit a dramatic reduction

in circulating concentrations of ghrelin, which may contribute to the higher weight loss

when compared to pair-fed rats. By contrast, in line with reports of other authors (Ivano

et al, 2013, Darido et al, 2014), animals that underwent the gastric plication procedure

exhibited higher serum total ghrelin levels than sham-operated rats. The elevated

concentration of ghrelin may promote the continued eating of the rats even if the

stomach is full, due to the reduction of the mechanosensitivity of the gastric vagus nerve

(Page et al, 2007). Taken together, the increase in circulating total ghrelin after gastric

plication might explain, in part, the lack of effect of this surgical technique in food

intake, total adiposity, and body weight compared to sleeve gastrectomy.

The observed changes in the metabolic profile after sleeve gastrectomy and

gastric plication are summarized in Table 4. The results obtained in the present thesis

evidence that sleeve gastrectomy was associated with an improvement in insulin

sensitivity and lipid profile compared to sham-operated group, which is in agreement

with previous results of our group (Rodríguez et al, 2012b, Rodríguez et al, 2012a,

Moncada et al, 2016a, Moncada et al, 2016c) and others (Patrikakos et al, 2009,

Stefater et al, 2010, Wilson-Pérez et al, 2013b). Moreover, our data showed that sleeve

gastrectomy reduced intrahepatic TG accumulation and macrovesicular steatosis of

- 58 -

obese rats, which is in accordance with previous reports showing the beneficial effects

of this bariatric procedure on the fatty liver of experimental models of genetic and diet-

induced obesity (Wang et al, 2009, Kawano et al, 2013). On the other hand, gastric

plication improved basal glycemia and glucose tolerance in obese rats, which is in

accordance with data reported by other authors (Guimarães et al, 2013). In contrast with

results of other authors (Talebpour et al, 2015), we did not find an improvement in

serum TG and cholesterol levels in obese rats submitted to gastric plication. Moreover,

our data support the notion that hepatic steatosis was not improved after gastric

plication despite the improvement in hyperglycemia. Taken together, sleeve

gastrectomy constitutes a more effective technique to improve obesity-associated

metabolic derangements than gastric plication.

Table 4. Metabolic effects of sleeve gastrectomy and gastric plication in obese rats.

Characteristic Sleeve gastrectomy Gastric plication

Excess body weight Decreased Very modest reduction

Excess adiposity Decreased No effect

Hyperglycemia Improved Improved

Insulin resistance Improved Improved

Dyslipidemia Improved No effect

NAFLD Improved No effect

3. Role of aquaglyceroporins in the improvement of adiposity after

bariatric surgery

Obesity is associated with increased lipolysis due to higher lipolytic activity of

3-adrenergic receptors and reduced anti-lipolytic action of insulin, leading to elevated

circulating concentrations of FFA and glycerol (Méndez-Giménez et al, 2014). Glycerol

is released to the bloodstream through AQP7 and, to a lesser extent, via AQP3 in

adipocytes to compensate body energy demands (Hara-Chikuma et al, 2005, Rodríguez

et al, 2011b, Madeira et al, 2013). AQP3 and AQP7 facilitate glycerol efflux from

adipocytes in response to lipolysis induced by -adrenergic agonists via its translocation

from the cytosolic fraction (AQP3) or lipid droplets (AQP7) (Kishida et al, 2000, Yasui

- 59 -

H. et al, 2008, Rodríguez et al, 2011b). Our findings provide evidence that obese rats

present an increase of AQP3 in EWAT and AQP7 in SCWAT suggesting a higher

lipolytic response and glycerol release in both fat depots, which is in accordance with

previous results of our group and others (Marrades et al, 2006, Prudente et al, 2007,

Catalán et al, 2008, Rodríguez et al, 2011b). Plausible explanations for the upregulation

of WAT aquaglyceroporins in obese animals include: i) the decrease in circulating

ghrelin, a negative regulator of AQP7 expression in adipocytes (Rodríguez et al, 2009);

ii) the activation of the transcription factors PPAR and PPAR since rat genes

encoding Aqp3, Aqp7 and Aqp9 present PPAR-response elements (PPRE) in their gene

promoters (Kishida et al, 2001a, Méndez-Giménez et al, 2014); and iii) the altered

expression of adipokines, including leptin, adiponectin, lipocalin-14 or apelin-13

(Rodríguez et al, 2011b, Guo et al, 2014, Rodríguez et al, 2015a, Lee J. T. et al, 2016,

Tardelli et al, 2017), which regulate the expression of aquaglyceroporins in adipose

tissue (Figure 15).

Figure 15. Factors involved in the regulation of the expression of aquaglyceroporins in adipocytes

[modified from (Rosen et al, 2000)].

Sleeve gastrectomy, but not gastric plication, reduced adipocyte hypertrophy of

obese rats. In order to unravel the molecular mechanisms involved in adiposity changes

after both bariatric surgery techniques, the expression of aquaglyceroporins was

evaluated in different fat depots of our experimental animals. AQP7 is considered a

marker of mature adipocytes, since the expression of this aquaglyceroporin is almost

negligible in undifferentiated preadipocytes, while AQP7 becomes markedly expressed

during the late adipogenesis in a process mediated by PPAR , the master adipogenic

transcription factor (Figure 15) (Kishida et al, 2001a). Interestingly, sleeve gastrectomy

was associated with a downregulation of AQP7 and PPAR in EWAT and SCWAT, and

a positive association of Aqp7 and Pparg transcript levels was observed in both fat

- 60 -

depots. However, gastric plication did not modify the expression of AQP7 in adipose

tissue. Together, the lower expression of AQP7 in both fat depots after sleeve

gastrectomy appears to be related to the reduction in adipocyte cell size after sleeve

gastrectomy. In line with this observation, the remodeling of EWAT after exercise

training in obese rats is also related with a decrease in AQP7 content (Rocha-Rodrigues

et al, 2016).

In 3T3-L1 adipocytes, AQP3 is translocated in response to the lipolytic action of

leptin from the plasma membrane to lipid droplets, a step that might facilitate glycerol

mobilization after lipolysis (Rodríguez et al, 2015a). Sleeve gastrectomy induced an

increase in EWAT AQP3, which may reflect an improvement in the lipolytic rate in this

fat depot following this surgical intervention. By contrast, animals submitted to gastric

plication exhibited a decrease in the expression of AQP3 in EWAT and SCWAT

suggesting a reduction in the release of glycerol from both fat depots to the

bloodstream. In conclusion, changes in the expression of adipose AQP3 after sleeve

gastrectomy and gastric plication might reflect modifications in adipocyte lipolysis.

4. Impact of sleeve gastrectomy and gastric plication on

hepatosteatosis in diet-induced obese rats

NAFLD is commonly associated with obesity, dyslipidemia, insulin resistance

and T2D (European Association for the Study of the Liver et al, 2016). The

mechanisms underlying intrahepatic TG accumulation, as the hallmark of NAFLD,

include increased delivery of FFA to the liver, inadequate FFA oxidation, and increased

de novo lipogenesis (Utzschneider et al, 2006, Ezquerro et al, 2016). In the studies II,

III and IV of the present thesis, obese rats exhibited insulin resistance, evidenced by

higher glucose levels during the oral glucose tolerance test (OGTT) and intraperitoneal

insulin tolerance test (IPITT), hyperinsulinemia, higher HOMA index and adipose

tissue insulin resistance index (adipo-IR), hypoadiponectinemia, as well as worse lipid

profile, supported by higher total cholesterol levels compared to their lean counterparts.

Moreover, obese animals developed hepatosteatosis, evidenced by an increase in liver

weight and intrahepatic TG content as well as macrovesicular steatosis in the liver

histological sections compared to lean control rats.

The transcription factors PPAR , PPAR and sterol regulatory element-binding

transcription factor 1 (SREBF1) represent key elements in the control of hepatic lipid

- 61 -

metabolism (Tontonoz et al, 1993, Costet et al, 1998, Kersten et al, 1999, Musso et al,

2009, Rodríguez et al, 2009, Gong et al, 2016). PPARs belong to the nuclear receptor

superfamily and form a heterodimer with retinoid X receptor (RXR) that bind to DNA

at the PPRE in the gene promoters, resulting in gene transcription (Evans et al, 2004).

PPAR was the first PPAR to be identified and is predominantly expressed in the liver,

where it is a major activator of FFA -oxidation (Evans et al, 2004, Poulsen et al,

2012). In this regard, it is well established that impaired PPAR function is associated

with hepatic lipid accumulation (Reddy, 2001). PPAR is highly expressed in WAT and

BAT and, to a lesser extent, in hepatocytes (Braissant et al, 1996, Escher et al, 2001).

PPAR promotes lipid storage in the adipose tissue, thereby reducing FFA delivery and

lipotoxicity in non-adipose organs, such as the liver or pancreas (Chawla et al, 1994,

Fajas et al, 1997). Furthermore, PPAR plays an important role in increasing insulin

sensitivity with PPAR agonists being currently used to treat diabetes. SREBF1

(formerly known as adipocyte determination and differentiation factor 1, ADD1)

belongs to the basic helix-loop-helix family of transcription factors and induces the

transcription of lipogenic genes (including ACC, FAS and LPL) with sterol response

elements (SRE) in their gene promoters (Tontonoz et al, 1993, Kim et al, 2004). In

studies II and IV, obese rats exhibited increased transcript levels of Ppara, Pparg and

Srebf1, confirming the important role of these lipogenic transcription factors in the

onset of NAFLD in obesity.

Certain studies investigating the effect of bariatric surgery on NAFLD have

shown an improvement in serum transaminases and hepatic histologic features after

surgery (Dixon et al, 2006, Burza et al, 2013). Our data showed that sleeve gastrectomy

induced the highest reduction of liver weight and intrahepatic TG levels compared to

sham surgery and pair-feeding, which is in accordance with other reports (Wang et al,

2009, Kawano et al, 2013). Study II also demonstrated that sleeve gastrectomy was

associated with a downregulation of Pparg and Srebf1 in obese rats, suggesting the

implication of these lipogenic transcription factors in the amelioration of the

hepatosteatosis after this bariatric surgery technique. In another study of our group

(Ezquerro et al, 2016), an upregulation of Ppara and Cpt1a together with an increased

mitochondrial DNA content was observed in the liver after sleeve gastrectomy,

suggesting an increased flux of FFA towards mitochondrial β-oxidation and higher

mitochondrial copy number after this bariatric surgery procedure. Conversely, gastric

- 62 -

plication surgery did not improve the fatty liver of obese rats as evidenced by similar

liver weight, intrahepatic TG accumulation and hepatic Ppara, Pparg and Srebf1

expression.

Several plausible explanations of the different impact of sleeve gastrectomy and

gastric plication on the amelioration of NAFLD are summarized in Figure 16. Firstly,

fasting serum FFA constitute the majority of fat delivered to the liver and contribute to

TG synthesis and accumulation in NAFLD (Zhang J. et al, 2014). Sleeve gastrectomy

tended to decrease circulating FFA, whereas gastric plication did not change serum FFA

levels and, hence, the increased FFA delivery remained unchanged. Secondly, while

sleeve gastrectomy reduced hepatic steatosis through the down-regulation of

transcription factors involved in lipogenesis, gastric plication induced a modest, but not

significant, reduction in intrahepatic TG accumulation and lipogenic factors Ppara,

Pparg and Srebf1. Thirdly, in the context of obesity and diabetes, insulin no longer

suppressed hepatic gluconeogenesis, while continuing to activate lipogenesis, a state

referred to as “selective insulin resistance” (Kubota et al, 2016). This state of “selective

insulin resistance” has been related to defective insulin receptor substrates 1 and 2

(IRS1/2) in the periportal zone (primary site of gluconeogenesis), which otherwise is

enhanced in the perivenous zone (primary site of lipogenesis) of the liver. Both sleeve

gastrectomy (studies II and III) and gastric plication (study IV) improved glycemia and

glucose tolerance, which is in accordance with previous reports (Guimarães et al, 2013).

However, it can be speculated that gastric plication might cause a differential hepatic

distribution of IRS1 and 2 that restores the altered gluconeogenesis, but not lipogenesis.

Finally, we have recently demonstrated that both acylated and desacyl ghrelin regulate

hepatic lipogenesis, mitochondrial FFA -oxidation and autophagy in rat hepatocytes

(Ezquerro et al, 2016). In study II, total ghrelin levels after sleeve gastrectomy were

diminished due to the resection of the gastric fundus, which is consistent with the

literature (Frühbeck et al, 2004a, Peterli et al, 2012). In this sense, the decrease in the

most abundant isoform, desacyl ghrelin after sleeve gastrectomy contributes to the

reduction of lipogenesis, whereas the increased relative acylated ghrelin levels activate

factors involved in mitochondrial FFA -oxidation and autophagy in obese rats, thereby

ameliorating NAFLD (Ezquerro et al, 2016). Conversely, gastric plication surgery

exhibits higher ghrelin levels due to the exposition of the greater curvature to the gastric

lumen, which might enhance the ability of both isoforms to promote hepatic

- 63 -

lipogenesis. In summary, although other bariatric procedures such as sleeve gastrectomy

or RYGB ameliorate NAFLD (Froylich et al, 2016), gastric plication cannot be

considered an effective method to reduce hepatosteatosis in obesity.

Figure 16. Schematic view of the impact of sleeve gastrectomy (SG) and gastric plication (GP) on the

mechanisms involved in the onset of NAFLD in the context of obesity. FFA derived from

adipocyte lipolysis (A) or through hepatic de novo lipogenesis (B). FFA once in the liver, can be

used as a substrate for mitochondrial FFA -oxidation (C) or converted to TG for storage and

secretion in the form of VLDL assembled with apolipoprotein B [modified from (Gong et al,

2016)]. Sleeve gastrectomy, but not gastric plication, improves hepatosteatosis ameliorating

several pathways of hepatic lipid metabolism.

5. Role of aquaglyceroporins in the amelioration of non-alcoholic

fatty liver disease after bariatric surgery

AQP9 is the most abundant glycerol channel in rodents and human liver, and it

is mainly localized at the sinusoidal plasma membrane that faces the portal vein (Jelen

et al, 2011, Calamita et al, 2012, Gena et al, 2013, Rodríguez et al, 2014). This

aquaglyceroporin allows the influx of glycerol and urea into the hepatocytes, and its

expression is markedly increased during fasting (Carbrey et al, 2003, Rojek A. M. et al,

2007, Jelen et al, 2012). Plasma glycerol is introduced into the hepatocytes via AQP9

(Rojek A. M. et al, 2007, Calamita et al, 2012, Gena et al, 2017), where it is converted

to glycerol-3-phosphate by GK and is used as a substrate for de novo synthesis of

glucose (gluconeogenesis) and TG (lipogenesis) (Jelen et al, 2011, Lebeck, 2014).

Regarding the participation of AQP9 in the onset of hepatosteatosis, our group has

previously reported a downregulation of hepatic AQP9 and reduced glycerol

- 64 -

permeability in parallel to the degree of steatosis in both genetically obese ob/ob mice

(Gena et al, 2013) as well as obese patients with NAFLD (Rodríguez et al, 2014). In the

present study, we found a downregulation of hepatic AQP9 in diet-induced obese rats.

The hepatic Aqp9 expression was negatively associated with markers of fatty liver, such

as intrahepatic TG and with insulin resistance, including insulinemia and HOMA index.

In this sense, it is well known that insulin resistance constitutes a major feature of

NAFLD (Kalhan et al, 2001, Reshef et al, 2003, Chalasani et al, 2012, Méndez-

Giménez et al, 2014). The diet-induced obese rats used in studies II, III and IV

developed insulin resistance, as evidenced by higher glycemia, insulinemia, HOMA,

and adipo-IR indices. Taken together, the decreased hepatic AQP9 expression in both

genetic and diet-induced obesity appears to be a compensatory mechanism whereby the

liver counteracts further TG accumulation within its parenchyma as well as further

aggravation of the hyperglycemia by reducing glycerol permeability.

The molecular mechanisms whereby bariatric surgery ameliorates NAFLD is

poorly understood. In the present thesis, we investigated whether the reduction of

hepatosteatosis after bariatric surgery is also related to changes in hepatic AQP9

expression. In study II, our data revealed a slight increase of hepatic AQP9 expression

after sleeve gastrectomy. Several plausible mechanisms might explain the effect of

sleeve gastrectomy on hepatic AQP9 expression. Firstly, AQP9 is positively regulated

by the activation of PPARα and PPARγ (Kishida et al, 2001a, Lebeck et al, 2015).

Interestingly, we also found a positive association of hepatic of Aqp9 expression with

Pparg suggesting a positive modulation of this aquaporin by this transcription factor in

the liver. Secondly, our group recently reported that leptin replacement improved the

fatty liver of leptin-deficient ob/ob mice in parallel to an increase in hepatic AQP9

content (Rodríguez et al, 2015a). Owing to its ability to induce weight loss and decrease

adiposity, it can be speculated that sleeve gastrectomy, but not gastric plication,

improves leptin sensitivity in the liver, and hence, contributes to increase hepatic AQP9

expression. Thirdly, in rodents, the promoter of Aqp9 gene presents a negative IRE with

insulin repressing the expression of this aquaglyceroporin in the liver (Kuriyama et al,

2002). In study II, AQP9 was negatively correlated with insulin and HOMA, both

markers of insulin resistance. Sleeve gastrectomy improved glycemia and insulin

sensitivity, which is in agreement with several studies (Wilson-Pérez et al, 2013b,

Basso et al, 2016), including ours (Rodríguez et al, 2012b). Thus, the increase in

- 65 -

hepatic AQP9 might also reflect the decrease in insulinemia observed in sleeve

gastrectomy. Altogether, sleeve gastrectomy restores the coordination of AQP7 in the

adipose tissue and AQP9 in the liver, leading to normal circulating glycerol levels

(Figure 17).

Figure 17. Proposed working model for the role of aquaglyceroporins in the improvement of hepatic

steatosis and gluconeogenesis in the physiological state, obesity and after sleeve gastrectomy. Obesity is associated with an increased expression of aquaglyceroporins AQP3 and AQP7 in the

adipose tissue leading to an increased glycerol output from fat cells and glycerol use for hepatic

gluconeogenesis and lipogenesis increase. Sleeve gastrectomy restores the coordinated

regulation of fat-specific AQP7 and liver-specific AQP9, contributing to a reduction in

circulating glycerol that reduced the excessive lipid accumulation in liver parenchyma as well as

decreasing whole-body glucose levels.

In study IV, gastric plication did not change the expression of AQP9 or factors

involved in lipogenesis (Ppara, Pparg and Srebf1) or gluconeogenesis (Gk, Pck1, G6pc

and Slc2a2) in the liver. Despite the lack of effect of gastric plication on hepatosteatosis,

this restrictive bariatric surgery technique improved basal glycemia and glucose

tolerance, which is in accordance with data reported by other authors (Guimarães et al,

2013). It seems plausible that the decrease in adipose AQP3 after gastric plication might

contribute to the prevention of excessive plasma glycerol availability used for hepatic

gluconeogenesis, thereby preventing high circulating glucose levels (Figure 18).

However, the contribution of other mechanisms in insulin-sensitive organs cannot be

discarded.

- 66 -

Figure 18. Impact of gastric plication in hepatic steatosis and gluconeogenesis. Gastric plication induced

a decrease in the expression of AQP3 in the adipose tissue, which might contribute to the

prevention of excessive plasma glycerol availability used for hepatic gluconeogenesis, thereby

preventing high glucose levels.

6. Influence of sleeve gastrectomy on -pancreatic function in diet-

induced obese rats

Obesity is commonly associated with insulin resistance (Kahn et al, 2006).

Under normal conditions, pancreatic islet -cells increase insulin secretion sufficiently

to overcome the reduced efficiency of insulin action, thereby maintaining normal

glucose tolerance. In order to maintain an appropriate long-term glycemic control in

insulin-resistant states, the number of pancreatic islet -cells or -cell mass, is expanded

(de Koning et al, 2008). T2D occurs when pancreatic -cell dysfunction leads to

impaired insulin secretion in the context of insulin resistance (Turner et al, 1999, Heine

et al, 2006). The -cell dysfunction is characterized by a decreased insulin gene

expression, blunted glucose-stimulated insulin secretion as well as increased -cell

apoptosis rates (Wajchenberg, 2007). Accordingly, in study III, we found that

hyperinsulinemic and insulin-resistant obese rats exhibited adaptive changes in -cell

mass, evidenced by a 40% decrease in islet density as well as a slight, but not

significant, increase in -cell apoptosis. Sleeve gastrectomy restored insulin sensitivity,

as evidenced by improved glucose levels during the OGTT and IPITT as well as a

higher quantitative insulin sensitivity check index (QUICKI), which is in agreement

with several studies (Rodríguez et al, 2012b, Wilson-Pérez et al, 2013b, Basso et al,

- 67 -

2016). Furthermore, this bariatric procedure improved insulin sensitivity in the fasted

state.

Obesity-associated insulin resistance and hyperinsulinemia have been attributed

to ectopic lipid overload, with lipotoxicity being a major contributor of -cell

dysfunction (Lee Y. et al, 2010, van Raalte et al, 2010, Ou et al, 2013). In this regard,

obesity is strongly associated with pancreatic steatosis (Mathur et al, 2007, Lee J. S. et

al, 2009, Lee Y. et al, 2010), which has been proposed as a link for the development of

obesity-associated metabolic derangements including the metabolic syndrome (Lee J. S.

et al, 2009), NAFLD (van Geenen et al, 2010) and T2D (Smits et al, 2011). The

overload of FFA in -cells promotes endoplasmic reticulum stress, oxidative stress,

mitochondrial uncoupling and dysfunction, islet inflammation and -cell apoptosis (van

Raalte et al, 2010). In line with these observations, in the present thesis, obese rats

showed pancreatic steatosis with pancreatic fat accumulation being positively associated

with -cell apoptosis. Interestingly, sleeve gastrectomy ameliorated obesity-associated

pancreatic steatosis and reduced -cell apoptosis, which is in agreement with other

studies (Honka et al, 2015). Thus, sleeve gastrectomy improves -cell apoptosis and

steatosis contributing to the improvement of insulin secretion and sensitivity after

surgery.

Bariatric surgery improves insulin sensitivity 2-fold to 3-fold within days after

this procedure, which implicates mechanisms independent of weight loss that involve

the modulation of intrinsic gut hormones via the gastro-entero-insular axis (Frühbeck,

2015). The incretin hormones glucagon-like peptide-1 (GLP-1) and gastric inhibitory

polypeptide (GIP) are among the most widely studied modulators of -cell function,

with the incretin effect accounting for 70% of the insulin secretion after an OGTT

(Hussain A. et al, 2010, Romero et al, 2012). At the endocrine pancreas, GLP-1 binds

its receptor GLP-1R and suppresses glucagon secretion from -cells and potentiates

insulin secretion from -cells in a glucose-dependent manner. GIP is synthesized and

secreted from K-cells and stimulates both insulin and glucagon secretion in the pancreas

(Hussain M. A. et al, 2016). On the other hand, ghrelin acts as a survival factor

promoting cell survival in vitro in HIT-T15 pancreatic -cells (Granata et al, 2006) and

in vivo in streptozotocin-induced diabetic mice (Bando et al, 2013). The ability of

ghrelin to modulate insulin secretion in pancreatic islets remains controversial, with

- 68 -

some authors- pointing to an inhibitory effect of acylated ghrelin on insulin release in

vitro (Qader et al, 2008) and others reporting that in vivo insulin secretion and islet

architecture are not significantly different in transgenic overexpression of intraislet

ghrelin (Bando et al, 2012). In study III, obese rats submitted to sleeve gastrectomy

showed a dramatic reduction of circulating ghrelin levels, increased GLP-1

concentrations and no effect on plasma GIP compared to the pair-fed group, which is in

accordance with other studies (Rodríguez et al, 2012b, Al-Sabah et al, 2014, Basso et

al, 2016). In the in vitro experiments in RIN-m5F -cells, we found that GLP-1 (9-36)

promoted insulin secretion and reduced intracellular TG content. By contrast, acylated

and desacyl ghrelin induced intracellular lipid accumulation in RIN-m5F -cells, which

is in agreement with the lipogenic effect of ghrelin isoforms in other metabolic tissues,

including adipose tissue (Rodríguez et al, 2009) and liver (Porteiro et al, 2013,

Ezquerro et al, 2016). However, contrary to other reports (Qader et al, 2008), neither

desacyl nor acylated ghrelin modified insulin secretion in RIN-m5F -cells. Taken

together, the increased GLP-1 levels after sleeve gastrectomy might be mainly related to

the improvement of insulin secretion, whereas reduced ghrelin levels appears to be

responsible of the amelioration of pancreatic steatosis after surgery. Nonetheless, the

contribution of additional hormones involved in -cell function cannot be discarded.

7. Role of aquaglyceroporins in the restoration of -pancreatic

function after bariatric surgery

Insulin release can be induced not only by the activation of metabolically-

regulated KATP channels, but also by VRAC that are activated by D-glucose

concentrations within the range effective in modulating electrical activity in -cells

(Best et al, 2010). More precisely, the intracellular accumulation of lactate and HCO3-

anions generated by the catabolism of D-glucose leads to -cell swelling and, hence, the

activation of the volume-sensitive anion channels, which induces plasma membrane

depolarization and the subsequent gating of voltage-dependent Ca2+

channels and

insulin secretion (Malaisse, 2008, Louchami et al, 2012). In line with this observation,

AQP7 allows a rapid influx of glycerol to -cells leading to -cell swelling (Matsumura

et al, 2007, Best et al, 2009). The activation of VRAC in response to -cell swelling

results in Cl- efflux thereby generating an inward (depolarizing) current, leading to

activation of voltage-sensitive Ca2+

channels, Ca2+

influx and hence, insulin exocytosis

- 69 -

(Muoio et al, 2008, Best et al, 2009, Virreira et al, 2011, Louchami et al, 2012). AQP7

not only induces insulin synthesis and exocytosis in -cells, but also TG synthesis

(Matsumura et al, 2007, Louchami et al, 2012) (Figure 19). In this regard, Aqp7-

deficient mice exhibit hyperinsulinemia and increased pancreatic insulin-1 and insulin-2

transcript levels as well as increased intraislet glycerol and TG content (Matsumura et

al, 2007). In study III, we first confirmed the water (Pf) and glycerol (Pgly)

permeability of the rat RIN-m5F -cells, a widely used cell line based on its high insulin

secretion rate (Hohmeier et al, 2004). We found that the permeability values were

within the range of the Pf and Pgly measured in mature murine 3T3-L1 adipocytes with

endogenous AQP7 expression (Madeira et al, 2013) and, thus, reflect the contribution of

aquaporins in RIN-m5F -cells for water and glycerol transport. In line with previous

studies (Matsumura et al, 2007, Louchami et al, 2012), we found that AQP7 was mainly

localized in the -cells of the Langerhans islets of our experimental animals.

Figure 19. Role of ghrelin and GLP-1 in AQP7-induced insulin secretion and TG accumulation in -

cells. AQP7 facilitates glycerol influx to -cells.

de novo

- 70 -

To gain further insight into the molecular mechanisms triggering the

improvement of -cell function, the role of ghrelin and GLP-1 in the expression of

pancreatic AQP7 was studied. Acylated and desacyl ghrelin constitute negative

regulators of AQP7 in adipocytes and this downregulation contributes, in part, to the

lipid accumulation in fat cells (Rodríguez et al, 2009). Accordingly, in study III, we

found that acylated and desacyl ghrelin diminished AQP7 expression in parallel to an

increased TG content in RIN-m5F -cells. However, we could not replicate the ability

of ghrelin to stimulate insulin secretion reported by other authors (Yada et al, 2014).

Interestingly, GLP-1 (9-36) showed a tendency towards a downregulation of AQP7 in

RIN-m5F -cells with AQP7 protein expression being negatively associated with

insulin release. Thus, it seems plausible that the reduction of AQP7 induced by ghrelin

and GLP-1 might result in intracellular glycerol accumulation, which can be used for

the biosynthesis of TG as well as for insulin synthesis and secretion (Figure 19).

Obesity and obesity-associated insulin resistance are associated with an altered

gene expression profile of AQP7 in insulin-sensitive tissues, such as adipose tissue

(Marrades et al, 2006, Prudente et al, 2007, Catalán et al, 2008, Rodríguez et al,

2011b), liver (Rodríguez et al, 2011b, Rodríguez et al, 2014, Rodríguez et al, 2015a)

and skeletal muscle (Wakayama et al, 2014). To the best of our knowledge, we report,

for the first time, that both weight gain and weight loss achieved by sleeve gastrectomy

were related with higher AQP7 mRNA and protein levels in rat pancreas. AQP7

upregulation might constitute an adaptive response of -cells to increase glycerol uptake

and the subsequent insulin synthesis and secretion, which seems nevertheless inefficient

to reduce the hyperglycemia in the obese state, but not after bariatric surgery. This

beneficial effect of sleeve gastrectomy is beyond food intake reduction, since no effects

of pair-feeding on AQP7 expression in the pancreas were observed.

In the present thesis, we also studied the potential role of AQP12, the other

pancreatic aquaporin, in the improvement of -cell function after bariatric surgery,

AQP12 is reportedly expressed in the acinar cells of the pancreas and a potential role of

this superaquaporin in the maturation and exocytosis of zymogen granules due to its

intracellular location has been proposed (Itoh et al, 2005, Ohta et al, 2009). In study III,

we show that AQP12 is also expressed in -cells of the Langerhans islets based on the

- 71 -

immunohistochemical staining in histological sections of rat pancreas as well as by the

gene and protein expression data in RIN-m5F -cells and rat pancreas. Interestingly,

acylated ghrelin- and GLP-1-induced AQP12 downregulation in the RIN-m5F cell line

was neither related to insulin release nor to TG accumulation pointing to other functions

of AQP12 in -cells. In this regard, the increased pancreatic expression of AQP12

together with the positive association between this superaquaporin with markers of

insulin resistance (insulinemia and HOMA) and ectopic lipid overload (serum TG and

intrapancreatic TG content) suggest that AQP12 might constitute a marker of pancreatic

damage. In line with this observation, Aqp12-knockout mice present an increased

susceptibility to caerulein-induced acute pancreatitis, showing larger exocytic vesicles

(vacuoles) in the pancreatic acini (Ohta et al, 2009). The normalization of pancreatic

AQP12 expression after sleeve gastrectomy might reflect the restoration of pancreatic

function due to the reduction of intrapancreatic steatosis and improved insulin secretion.

In conclusion, sleeve gastrectomy restores the altered expression of pancreas-

specific AQP7 and AQP12 in obese rats contributing to the prevention of excess lipid

accumulation and impaired insulin secretion in -cells. Our results identify these

aquaporins as key elements in mediating part of the beneficial effects of bariatric

surgery on glucose metabolism via the regulation of glycerol availability, a key

metabolite for pancreatic insulin synthesis and secretion as well as TG accumulation. In

line with this observation, ghrelin and GLP-1, two important hormones involved in the

resolution of insulin resistance after bariatric surgery, regulate the expression of these

aquaporins in pancreatic -cells.

- 75 -

1. Sleeve gastrectomy decreases body weight and adiposity and improves insulin

sensitivity, -cell function, lipid profile and hepatosteatosis of obese rats. By

contrast, gastric plication improves basal glycemia and glucose tolerance, with a

modest reduction in whole-body adiposity and intrahepatic triacylglycerol

accumulation.

2. Sleeve gastrectomy and gastric plication downregulate the expression of AQP7

and AQP3, respectively, in epididymal and subcutaneous white adipose tissue.

These changes are associated with improvement of adipocyte metabolism after

bariatric surgery, with the reduction of AQP7 being related to lower adipocyte

hypertrophy whereas the decrease in AQP3 reflects a reduction in adipocyte

glycerol release.

3. Sleeve gastrectomy, but not gastric plication, induces a slight increase in hepatic

AQP9 expression, which might reflect the recovery of glycerol uptake due to the

improvement of hepatic steatosis and gluconeogenesis following weight loss

achieved with this bariatric surgery technique.

4. Sleeve gastrectomy is associated with an increase in pancreatic AQP7

expression and a normalization of the increased AQP12 levels in the pancreas of

obese rats. The upregulation of AQP7 appears to be an adaptive response of -

cells to increase glycerol uptake and the subsequent insulin synthesis and

secretion. The normalization of AQP12 levels might reflect the reduction of -

cell injury induced by bariatric surgery, since this superaquaporin is positively

associated with markers of insulin resistance and pancreatic steatosis.

5. Ghrelin and GLP-1 constitute negative regulators of AQP7 in RIN-m5F -cells.

The subsequent increase in intracellular glycerol might be used for the

biosynthesis of triacylglycerols induced by ghrelin as well as for insulin

synthesis and secretion triggered by GLP-1.

- 76 -

Concluding remarks

Sleeve gastrectomy constitutes a more effective technique to improve obesity-

associated metabolic derangements than gastric plication. Our results identify

aquaglyceroporins as key elements in mediating part of the beneficial effects of bariatric

surgery via the regulation of glycerol availability, a key metabolite for the control of fat

accumulation control, whole-body glucose homeostasis and insulin secretion. The

altered expression of aquaglyceroporins in adipose tissue (AQP3 and AQP7), liver

(AQP9) and pancreas (AQP7) in diet-induced obese rats is restored after sleeve

gastrectomy. These changes contribute, in part, to the prevention of adipocyte

hypertrophy and excessive lipid accumulation in the liver and pancreas as well as with

an amelioration of -cell function and insulin sensitivity after sleeve gastrectomy. By

contrast, gastric plication restores glycemia by AQP3 downregulation, which entails

lower efflux of glycerol from fat, lower plasma glycerol availability, and a reduced use

of glycerol as a substrate for hepatic gluconeogenesis.

- 79 -

Abdennour M, Reggio S, Le Naour G, Liu Y, Poitou C, Aron-Wisnewsky J, Charlotte

F, Bouillot JL, Torcivia A, Sasso M, Miette V, Zucker JD, Bedossa P, Tordjman J,

Clement K. Association of adipose tissue and liver fibrosis with tissue stiffness in

morbid obesity: links with diabetes and BMI loss after gastric bypass. J Clin Endocrinol

Metab 2014;99:898-907.

Agre P, Preston GM, Smith BL, Jung JS, Raina S, Moon C, Guggino WB, Nielsen S.

Aquaporin CHIP: the archetypal molecular water channel. Am J Physiol

1993;265:F463-76.

Agre P, Kozono D. Aquaporin water channels: molecular mechanisms for human

diseases. FEBS Lett 2003;555:72-8.

Ahima RS, Carr R. Alas! Ileal interposition surgery for diabetes prevention?

Gastroenterology 2010;138:2224-6.

Al-Sabah S, Alasfar F, Al-Khaledi G, Dinesh R, Al-Saleh M, Abul H. Incretin Response to a Standard Test Meal in a Rat Model of Sleeve Gastrectomy with Diet-Induced

Obesity. Obes Surg 2014;24:95-101.

Alamri BN, Shin K, Chappe V, Anini Y. The role of ghrelin in the regulation of glucose

homeostasis. Horm Mol Biol Clin Investig 2016;26:3-11.

Alfa RW, Park S, Skelly KR, Poffenberger G, Jain N, Gu X, Kockel L, Wang J, Liu Y,

Powers AC, Kim SK. Suppression of insulin production and secretion by a decretin

hormone. Cell Metab 2015;21:323-33.

Algahtani HA, Khan AS, Khan MA, Aldarmahi AA, Lodhi Y. Neurological

complications of bariatric surgery. Neurosciences (Riyadh) 2016;21:241-5.

Alvarez-Leite JI. Nutrient deficiencies secondary to bariatric surgery. Curr Opin Clin

Nutr Metab Care 2004;7:569-75.

Anthes E. Treatment: Marginal gains. Nature 2014;508:S54-6.

Arner E, Westermark PO, Spalding KL, Britton T, Rydén M, Frisén J, Bernard S, Arner

P. Adipocyte turnover: relevance to human adipose tissue morphology. Diabetes

2010;59:105-9.

Arner P, Andersson DP, Thörne A, Wirén M, Hoffstedt J, Näslund E, Thorell A, Rydén

M. Variations in the size of the major omentum are primarily determined by fat cell

number. J Clin Endocrinol Metab 2013;98:E897-901.

Ashrafian H, Athanasiou T, Li JV, Bueter M, Ahmed K, Nagpal K, Holmes E, Darzi A,

Bloom SR. Diabetes resolution and hyperinsulinaemia after metabolic Roux-en-Y

gastric bypass. Obes Rev 2011;12:e257-72.

Astrup A, Finer N. Redefining type 2 diabetes: 'diabesity' or 'obesity dependent diabetes mellitus'? Obes Rev 2000;1:57-9.

Atkinson RL. Current status of the field of obesity. Trends Endocrinol Metab

2014;25:283-4.

Azad AK, Yoshikawa N, Ishikawa T, Sawa Y, Shibata H. Substitution of a single amino

acid residue in the aromatic/arginine selectivity filter alters the transport profiles of

tonoplast aquaporin homologs. Biochim Biophys Acta 2012;1818:1-11.

- 80 -

Bahamontes-Rosa N, Tena-Tomás C, Wolkow J, Kremsner PG, Kun JF. Genetic

conservation of the GIL blood group determining aquaporin 3 gene in African and

Caucasian populations. Transfusion 2008;48:1164-8.

Bando M, Iwakura H, Ariyasu H, Hosoda H, Yamada G, Hosoda K, Adachi S, Nakao K, Kangawa K, Akamizu T. Transgenic overexpression of intraislet ghrelin does not

affect insulin secretion or glucose metabolism in vivo. American Journal of Physiology-

Endocrinology and Metabolism 2012;302:E403-8.

Bando M, Iwakura H, Ariyasu H, Koyama H, Hosoda K, Adachi S, Nakao K, Kangawa

K, Akamizu T. Overexpression of intraislet ghrelin enhances beta-cell proliferation after

streptozotocin-induced beta-cell injury in mice. Am J Physiol Endocrinol Metab

2013;305:E140-8.

Barker KB, Palekar NA, Bowers SP, Goldberg JE, Pulcini JP, Harrison SA. Non-

alcoholic steatohepatitis: effect of Roux-en-Y gastric bypass surgery. Am J Gastroenterol 2006;101:368-73.

Basso N, Soricelli E, Castagneto-Gissey L, Casella G, Albanese D, Fava F, Donati C,

Tuohy K, Angelini G, La Neve F, Severino A, Kamvissi-Lorenz V, Birkenfeld AL,

Bornstein S, Manco M, Mingrone G. Insulin Resistance, Microbiota, and Fat

Distribution Changes by a New Model of Vertical Sleeve Gastrectomy in Obese Rats.

Diabetes 2016;65:2990-3001.

Batterham RL, Cummings DE. Mechanisms of diabetes improvement following

bariatric/metabolic surgery. Diabetes Care 2016;39:893-901.

Bauwens M, Wierts R, van Royen B, Bucerius J, Backes W, Mottaghy F, Brans B.

Molecular imaging of brown adipose tissue in health and disease. Eur J Nucl Med Mol

Imaging 2014;41:776-91.

Beiroa D, Imbernon M, Gallego R, Senra A, Herranz D, Villarroya F, Serrano M, Fernø

J, Salvador J, Escalada J, Diéguez C, López M, Frühbeck G, Nogueiras R. GLP-1

agonism stimulates brown adipose tissue thermogenesis and browning through

hypothalamic AMPK. Diabetes 2014;63:3346-58.

Beitz E, Wu B, Holm LM, Schultz JE, Zeuthen T. Point mutations in the aromatic/arginine region in aquaporin 1 allow passage of urea, glycerol, ammonia, and

protons. Proc Natl Acad Sci USA 2006;103:269-74.

Bergman RN, Ader M. Free fatty acids and pathogenesis of type 2 diabetes mellitus.

Trends Endocrinol Metab 2000;11:351-6.

Best L, Brown PD, Yates AP, Perret J, Virreira M, Beauwens R, Malaisse WJ, Sener A,

Delporte C. Contrasting effects of glycerol and urea transport on rat pancreatic beta-cell

function. Cell Physiol Biochem 2009;23:255-64.

Best L, Brown PD, Sener A, Malaisse WJ. Electrical activity in pancreatic islet cells: The VRAC hypothesis. Islets 2010;2:59-64.

Bienert GP, Møller AL, Kristiansen KA, Schulz A, Møller IM, Schjoerring JK, Jahn

TP. Specific aquaporins facilitate the diffusion of hydrogen peroxide across membranes.

J Biol Chem 2007;282:1183-92.

Birkmeyer JD, Finks JF, O'Reilly A, Oerline M, Carlin AM, Nunn AR, Dimick J,

Banerjee M, Birkmeyer NJ, Michigan Bariatric Surgery C. Surgical skill and

complication rates after bariatric surgery. N Engl J Med 2013;369:1434-42.

- 81 -

Blachar A, Federle MP, Pealer KM, Ikramuddin S, Schauer PR. Gastrointestinal

complications of laparoscopic Roux-en-Y gastric bypass surgery: clinical and imaging

findings. Radiology 2002;223:625-32.

Blaydon DC, Lind LK, Plagnol V, Linton KJ, Smith FJ, Wilson NJ, McLean WH, Munro CS, South AP, Leigh IM, O'Toole EA, Lundstrom A, Kelsell DP. Mutations in

AQP5, encoding a water-channel protein, cause autosomal-dominant diffuse

nonepidermolytic palmoplantar keratoderma. Am J Hum Genet 2013;93:330-5.

Blundell JE, Dulloo AG, Salvador J, Frühbeck G. Beyond BMI--phenotyping the

obesities. Obes Facts 2014;7:322-8.

Boza C, Riquelme A, Ibañez L, Duarte I, Norero E, Viviani P, Soza A, Fernandez JI,

Raddatz A, Guzman S, Arrese M. Predictors of nonalcoholic steatohepatitis (NASH) in

obese patients undergoing gastric bypass. Obes Surg 2005;15:1148-53.

Braghetto I, Csendes A, Lanzarini E, Papapietro K, Cárcamo C, Molina JC. Is laparoscopic sleeve gastrectomy an acceptable primary bariatric procedure in obese

patients? Early and 5-year postoperative results. Surg Laparosc Endosc Percutan Tech

2012;22:479-86.

Braissant O, Foufelle F, Scotto C, Dauca M, Wahli W. Differential expression of

peroxisome proliferator-activated receptors (PPARs): tissue distribution of PPAR-alpha,

-beta, and -gamma in the adult rat. Endocrinology 1996;137:354-66.

Bray GA, Frühbeck G, Ryan DH, Wilding JP. Management of obesity. Lancet 2016;387:1947-56.

Brethauer SA, Harris JL, Kroh M, Schauer PR. Laparoscopic gastric plication for

treatment of severe obesity. Surg Obes Relat Dis 2011;7:15-22.

Broderick RC, Fuchs HF, Harnsberger CR, Sandler BJ, Jacobsen GR. Comparison of

bariatric restrictive operations: laparoscopic sleeve gastrectomy and laparoscopic gastric

greater curvature plication. Surg Technol Int 2014;25:82-9.

Buchwald H, Estok R, Fahrbach K, Banel D, Jensen MD, Pories WJ, Bantle JP, Sledge

I. Weight and type 2 diabetes after bariatric surgery: systematic review and meta-analysis. Am J Med 2009;122:248-56.

Burza MA, Romeo S, Kotronen A, Svensson PA, Sjöholm K, Torgerson JS, Lindroos

AK, Sjöström L, Carlsson LM, Peltonen M. Long-term effect of bariatric surgery on

liver enzymes in the Swedish Obese Subjects (SOS) study. PLoS One 2013;8:e60495.

Calamita G, Ferri D, Gena P, Carreras FI, Liquori GE, Portincasa P, Marinelli RA,

Svelto M. Altered expression and distribution of aquaporin-9 in the liver of rat with

obstructive extrahepatic cholestasis. Am J Physiol Gastrointest Liver Physiol

2008;295:G682-90.

Calamita G, Gena P, Ferri D, Rosito A, Rojek A, Nielsen S, Marinelli RA, Frühbeck G, Svelto M. Biophysical assessment of aquaporin-9 as principal facilitative pathway in

mouse liver import of glucogenetic glycerol. Biol Cell 2012;104:342-51.

Calvanese L, Pellegrini-Calace M, Oliva R. In silico study of human aquaporin AQP11

and AQP12 channels. Protein Sci 2013;22:455-66.

Candreia C, Schmuziger N, Gürtler N. Molecular analysis of aquaporin genes 1 to 4 in

patients with Meniere's disease. Cell Physiol Biochem 2010;26:787-92.

- 82 -

Carbrey JM, Gorelick-Feldman DA, Kozono D, Praetorius J, Nielsen S, Agre P.

Aquaglyceroporin AQP9: solute permeation and metabolic control of expression in

liver. Proc Natl Acad Sci USA 2003;100:2945-50.

Carbrey JM, Agre P. Discovery of the aquaporins and development of the field. Handb Exp Pharmacol 2009;3-28.

Carpentier GA, Garneau AP, Marcoux AA, Noël M, Frenette-Cotton R, Isenring P.

Identification of key residues involved in Si transport by the aquaglyceroporins. J Gen

Physiol 2016;148:239-51.

Carr MC, Brunzell JD. Abdominal obesity and dyslipidemia in the metabolic syndrome:

importance of type 2 diabetes and familial combined hyperlipidemia in coronary artery

disease risk. J Clin Endocrinol Metab 2004;89:2601-7.

Catalán V, Gómez-Ambrosi J, Ramírez B, Rotellar F, Pastor C, Silva C, Rodríguez A, Gil MJ, Cienfuegos JA, Frühbeck G. Proinflammatory cytokines in obesity: impact of

type 2 diabetes mellitus and gastric bypass. Obes Surg 2007;17:1464-74.

Catalán V, Gómez-Ambrosi J, Pastor C, Rotellar F, Silva C, Rodríguez A, Gil MJ,

Cienfuegos JA, Salvador J, Vendrell J, Frühbeck G. Influence of morbid obesity and

insulin resistance on gene expression levels of AQP7 in visceral adipose tissue and

AQP9 in liver. Obes Surg 2008;18:695-701.

Catalán V, Gómez-Ambrosi J, Rodríguez A, Salvador J, Frühbeck G. Adipokines in the

treatment of diabetes mellitus and obesity. Expert Opin Pharmacother 2009;10:239-54.

Cinti S, Mitchell G, Barbatelli G, Murano I, Ceresi E, Faloia E, Wang S, Fortier M,

Greenberg AS, Obin MS. Adipocyte death defines macrophage localization and

function in adipose tissue of obese mice and humans. J Lipid Res 2005;46:2347-55.

Cinti S. The adipose organ at a glance. Dis Model Mech 2012;5:588-94.

Clark JM, Alkhuraishi AR, Solga SF, Alli P, Diehl AM, Magnuson TH. Roux-en-Y

gastric bypass improves liver histology in patients with non-alcoholic fatty liver disease.

Obes Res 2005;13:1180-6.

Cook KS, Min HY, Johnson D, Chaplinsky RJ, Flier JS, Hunt CR, Spiegelman BM. Adipsin: a circulating serine protease homolog secreted by adipose tissue and sciatic

nerve. Science 1987;237:402-5.

Costet P, Legendre C, Moré J, Edgar A, Galtier P, Pineau T. Peroxisome proliferator-

activated receptor alpha-isoform deficiency leads to progressive dyslipidemia with

sexually dimorphic obesity and steatosis. J Biol Chem 1998;273:29577-85.

Courcoulas AP, Christian NJ, Belle SH, Berk PD, Flum DR, Garcia L, Horlick M,

Kalarchian MA, King WC, Mitchell JE, Patterson EJ, Pender JR, Pomp A, Pories WJ,

Thirlby RC, Yanovski SZ, Wolfe BM, Longitudinal Assessment of Bariatric Surgery C. Weight change and health outcomes at 3 years after bariatric surgery among individuals

with severe obesity. JAMA 2013;310:2416-25.

Courcoulas AP, Belle SH, Neiberg RH, Pierson SK, Eagleton JK, Kalarchian MA,

DeLany JP, Lang W, Jakicic JM. Three-Year Outcomes of Bariatric Surgery vs

Lifestyle Intervention for Type 2 Diabetes Mellitus Treatment: A Randomized Clinical

Trial. JAMA Surg 2015;150:931-40.

- 83 -

Cummings BP, Strader AD, Stanhope KL, Graham JL, Lee J, Raybould HE, Baskin

DG, Havel PJ. Ileal interposition surgery improves glucose and lipid metabolism and

delays diabetes onset in the UCD-T2DM rat. Gastroenterology 2010;138:2437-46.

Cummings DE, Purnell JQ, Frayo RS, Schmidova K, Wisse BE, Weigle DS. A preprandial rise in plasma ghrelin levels suggests a role in meal initiation in humans.

Diabetes 2001;50:1714-9.

Cummings DE, Weigle DS, Frayo RS, Breen PA, Ma MK, Dellinger EP, Purnell JQ.

Plasma ghrelin levels after diet-induced weight loss or gastric bypass surgery. N Engl J

Med 2002;346:1623-30.

Cypess AM, Lehman S, Williams G, Tal I, Rodman D, Goldfine AB, Kuo FC, Palmer

EL, Tseng YH, Doria A, Kolodny GM, Kahn CR. Identification and importance of

brown adipose tissue in adult humans. N Engl J Med 2009;360:1509-17.

Chalasani N, Younossi Z, Lavine JE, Diehl AM, Brunt EM, Cusi K, Charlton M, Sanyal AJ. The diagnosis and management of non-alcoholic fatty liver disease: practice

Guideline by the American Association for the Study of Liver Diseases, American

College of Gastroenterology, and the American Gastroenterological Association.

Hepatology 2012;55:2005-23.

Chawla A, Schwarz EJ, Dimaculangan DD, Lazar MA. Peroxisome proliferator-

activated receptor (PPAR) gamma: adipose-predominant expression and induction early

in adipocyte differentiation. Endocrinology 1994;135:798-800.

Chen HY, Trumbauer ME, Chen AS, Weingarth DT, Adams JR, Frazier EG, Shen Z, Marsh DJ, Feighner SD, Guan XM, Ye Z, Nargund RP, Smith RG, Van der Ploeg LH,

Howard AD, MacNeil DJ, Qian S. Orexigenic action of peripheral ghrelin is mediated

by neuropeptide Y and agouti-related protein. Endocrinology 2004;145:2607-12.

Chouillard E, Schoucair N, Alsabah S, Alkandari B, Montana L, Dejonghe B, Biagini J.

Laparoscopic gastric plication (LGP) as an alternative to laparoscopic sleeve

gastrectomy (LSG) in patients with morbid obesity: A preliminary, short-Term, case-

control study. Obes Surg 2016;26:1167-72.

Darido E, Moore JR. Comparison of gastric fundus invagination and gastric greater curvature plication for weight loss in a rat model of diet-induced obesity. Obes Surg

2014;24:897-902.

de Bona Castelan J, Bettiol J, d'Acampora AJ, Castelan JV, de Souza JC, Bressiani V,

Giroldi SB. Sleeve gastrectomy model in Wistar rats. Obes Surg 2007;17:957-61.

de Koning EJ, Bonner-Weir S, Rabelink TJ. Preservation of beta-cell function by

targeting beta-cell mass. Trends Pharmacol Sci 2008;29:218-27.

Deen PM, Verdijk MA, Knoers NV, Wieringa B, Monnens LA, van Os CH, van Oost

BA. Requirement of human renal water channel aquaporin-2 for vasopressin-dependent concentration of urine. Science 1994;264:92-5.

Deitel M, Crosby RD, Gagner M. The First International Consensus Summit for Sleeve

Gastrectomy (SG), New York City, October 25-27, 2007. Obes Surg 2008;18:487-96.

Delporte C, Virreira M, Crutzen R, Louchami K, Sener A, Malaisse WJ, Beauwens R.

Functional role of aquaglyceroporin 7 expression in the pancreatic beta-cell line BRIN-

BD11. J Cell Physiol 2009;221:424-9.

DeMaria EJ. Bariatric surgery for morbid obesity. N Engl J Med 2007;356:2176-83.

- 84 -

Després JP. Is visceral obesity the cause of the metabolic syndrome? Ann Med

2006;38:52-63.

Dhanvantari S, Seidah NG, Brubaker PL. Role of prohormone convertases in the tissue-

specific processing of proglucagon. Mol Endocrinol 1996;10:342-55.

Direito I, Madeira A, Brito MA, Soveral G. Aquaporin-5: from structure to function and

dysfunction in cancer. Cell Mol Life Sci 2016;73:1623-40.

Dirksen C, Jørgensen NB, Bojsen-Møller KN, Jacobsen SH, Hansen DL, Worm D,

Holst JJ, Madsbad S. Mechanisms of improved glycaemic control after Roux-en-Y

gastric bypass. Diabetologia 2012;55:1890-901.

Dixon JB, Bhathal PS, O'Brien PE. Nonalcoholic fatty liver disease: predictors of

nonalcoholic steatohepatitis and liver fibrosis in the severely obese. Gastroenterology

2001;121:91-100.

Dixon JB, Bhathal PS, O'Brien PE. Weight loss and non-alcoholic fatty liver disease:

falls in gamma-glutamyl transferase concentrations are associated with histologic

improvement. Obes Surg 2006;16:1278-86.

Drucker DJ. Glucagon-like peptide-1 and the islet beta-cell: augmentation of cell

proliferation and inhibition of apoptosis. Endocrinology 2003;144:5145-8.

Echevarría M, Windhager EE, Tate SS, Frindt G. Cloning and expression of AQP3, a

water channel from the medullary collecting duct of rat kidney. Proc Natl Acad Sci USA

1994;91:10997-1001.

Eickhoff H, Guimarães A, Louro TM, Seiça RM, Castro ESF. Insulin resistance and

beta cell function before and after sleeve gastrectomy in obese patients with impaired

fasting glucose or type 2 diabetes. Surg Endosc 2015;29:438-43.

Elgazar-Carmon V, Rudich A, Hadad N, Levy R. Neutrophils transiently infiltrate intra-

abdominal fat early in the course of high-fat feeding. J Lipid Res 2008;49:1894-903.

Eljaafari A, Robert M, Chehimi M, Chanon S, Durand C, Vial G, Bendridi N, Madec

AM, Disse E, Laville M, Rieusset J, Lefai E, Vidal H, Pirola L. Adipose tissue-derived

stem cells from obese subjects contribute to inflammation and reduced insulin response in adipocytes through differential regulation of the Th1/Th17 balance and monocyte

activation. Diabetes 2015;64:2477-88.

Escher P, Braissant O, Basu-Modak S, Michalik L, Wahli W, Desvergne B. Rat PPARs:

quantitative analysis in adult rat tissues and regulation in fasting and refeeding.

Endocrinology 2001;142:4195-202.

European Association for the Study of the Liver, Electronic address

[email protected], European Association for the Study of Diabetes, Obesity

EAftSo. EASL-EASD-EASO Clinical Practice Guidelines for the management of non-alcoholic fatty liver disease. J Hepatol 2016;64:1388-402.

Evans RM, Barish GD, Wang YX. PPARs and the complex journey to obesity. Nat Med

2004;10:355-61.

Ezquerro S, Méndez-Giménez L, Becerril S, Moncada R, Valentí V, Catalán V, Gómez-

Ambrosi J, Frühbeck G, Rodríguez A. Acylated and desacyl ghrelin are associated with

hepatic lipogenesis, β-oxidation and autophagy: role in NAFLD amelioration after

sleeve gastrectomy in obese rats. Sci Rep 2016;6:39942.

- 85 -

Fajas L, Auboeuf D, Raspé E, Schoonjans K, Lefebvre AM, Saladin R, Najib J, Laville

M, Fruchart JC, Deeb S, Vidal-Puig A, Flier J, Briggs MR, Staels B, Vidal H, Auwerx

J. The organization, promoter analysis, and expression of the human PPARgamma gene.

J Biol Chem 1997;272:18779-89.

Fang S, Suh JM, Reilly SM, Yu E, Osborn O, Lackey D, Yoshihara E, Perino A, Jacinto S, Lukasheva Y, Atkins AR, Khvat A, Schnabl B, Yu RT, Brenner DA, Coulter S,

Liddle C, Schoonjans K, Olefsky JM, Saltiel AR, Downes M, Evans RM. Intestinal

FXR agonism promotes adipose tissue browning and reduces obesity and insulin

resistance. Nat Med 2015;21:159-65.

Farilla L, Bulotta A, Hirshberg B, Li Calzi S, Khoury N, Noushmehr H, Bertolotto C,

Di Mario U, Harlan DM, Perfetti R. Glucagon-like peptide 1 inhibits cell apoptosis and

improves glucose responsiveness of freshly isolated human islets. Endocrinology

2003;144:5149-58.

Farpour-Lambert NJ, Baker JL, Hassapidou M, Holm JC, Nowicka P, O'Malley G,

Weiss R. Childhood Obesity Is a Chronic Disease Demanding Specific Health Care--a

Position Statement from the Childhood Obesity Task Force (COTF) of the European

Association for the Study of Obesity (EASO). Obes Facts 2015;8:342-9.

Fasshauer M, Klein J, Lossner U, Klier M, Kralisch S, Paschke R. Suppression of

aquaporin adipose gene expression by isoproterenol, TNFalpha, and dexamethasone.

Horm Metab Res 2003;35:222-7.

Francis P, Berry V, Bhattacharya S, Moore A. Congenital progressive polymorphic cataract caused by a mutation in the major intrinsic protein of the lens, MIP (AQP0). Br

J Ophthalmol 2000;84:1376-9.

Fried M. Bariatric and metabolic surgery. Minerva Endocrinol 2013;38:237-44.

Fried M, Yumuk V, Oppert JM, Scopinaro N, Torres AJ, Weiner R, Yashkov Y,

Frühbeck G. Interdisciplinary European Guidelines on metabolic and bariatric surgery.

Obes Facts 2013;6:449-68.

Fried M, Yumuk V, Oppert JM, Scopinaro N, Torres A, Weiner R, Yashkov Y,

Frühbeck G, International Federation for Surgery of O, Metabolic Disorders-European C, European Association for Study of O. Interdisciplinary European guidelines on

metabolic and bariatric surgery. Obes Surg 2014;24:42-55.

Froylich D, Corcelles R, Daigle C, Boules M, Brethauer S, Schauer P. Effect of Roux-

en-Y gastric bypass and sleeve gastrectomy on nonalcoholic fatty liver disease: a

comparative study. Surg Obes Relat Dis 2016;12:127-31.

Frühbeck G, Diez-Caballero A, Gil MJ, Montero I, Gómez-Ambrosi J, Salvador J,

Cienfuegos JA. The decrease in plasma ghrelin concentrations following bariatric

surgery depends on the functional integrity of the fundus. Obes Surg 2004a;14:606-12.

Frühbeck G, Díez Caballero A, Gil MJ. Fundus functionality and ghrelin concentrations after bariatric surgery. N Engl J Med 2004b;350:308-9.

Frühbeck G. Obesity: aquaporin enters the picture. Nature 2005;438:436-7.

Frühbeck G. Overview of adipose tissue and its role in obesity and metabolic disorders.

Methods Mol Biol 2008;456:1-22.

Frühbeck G, Becerril S, Sainz N, Garrastachu P, García-Velloso MJ. BAT: a new target

for human obesity? Trends Pharmacol Sci 2009;30:387-96.

- 86 -

Frühbeck G, Toplak H, Woodward E, Yumuk V, Maislos M, Oppert JM, Executive

Committee of the European Association for the Study of Obesity. Obesity: the gateway

to ill health - an EASO position statement on a rising public health, clinical and

scientific challenge in Europe. Obes Facts 2013a;6:117-20.

Frühbeck G, Gómez-Ambrosi J. Adipose tissue: structure, function and metabolism. In: Caballero B, editor. Encyclopedia of human nutrition. 3rd edition ed: Elsevier Ltd;

2013b. p. 1-13.

Frühbeck G, Méndez-Giménez L, Fernández-Formoso JA, Fernández S, Rodríguez A.

Regulation of adipocyte lipolysis. Nutr Res Rev 2014;1-31.

Frühbeck G. Bariatric and metabolic surgery: a shift in eligibility and success criteria.

Nat Rev Endocrinol 2015;11:465-77.

Fusco PE, Poggetti RS, Younes RN, Fontes B, Birolini D. Evaluation of gastric greater curvature invagination for weight loss in rats. Obes Surg 2006;16:172-7.

Gagner M, Deitel M, Erickson AL, Crosby RD. Survey on laparoscopic sleeve

gastrectomy (LSG) at the Fourth International Consensus Summit on Sleeve

Gastrectomy. Obes Surg 2013;23:2013-7.

Gallagher D, Heymsfield SB, Heo M, Jebb SA, Murgatroyd PR, Sakamoto Y. Healthy

percentage body fat ranges: an approach for developing guidelines based on body mass

index. Am J Clin Nutr 2000;72:694-701.

Gena P, Mastrodonato M, Portincasa P, Fanelli E, Mentino D, Rodríguez A, Marinelli RA, Brenner C, Frühbeck G, Svelto M, Calamita G. Liver glycerol permeability and

aquaporin-9 are dysregulated in a murine model of non-alcoholic fatty liver disease.

PLoS One 2013;8:e78139.

Gena P, Buono ND, D'Abbicco M, Mastrodonato M, Berardi M, Svelto M, Lopez L,

Calamita G. Dynamical modeling of liver Aquaporin-9 expression and glycerol

permeability in hepatic glucose metabolism. Eur J Cell Biol 2017;96:61-69.

Gigoux V, Fourmy D. Acting on hormone receptors with minimal side effect on cell

proliferation: a timely challenge illustrated with GLP-1R and GPER. Front Endocrinol (Lausanne) 2013;4:50.

Giordano A, Smorlesi A, Frontini A, Barbatelli G, Cinti S. White, brown and pink

adipocytes: the extraordinary plasticity of the adipose organ. Eur J Endocrinol

2014;170:R159-71.

Giralt M, Villarroya F. White, brown, beige/brite: different adipose cells for different

functions? Endocrinology 2013;154:2992-3000.

Gómez-Ambrosi J, Silva C, Galofré JC, Escalada J, Santos S, Millán D, Vila N, Ibañez

P, Gil MJ, Valentí V, Rotellar F, Ramírez B, Salvador J, Frühbeck G. Body mass index classification misses subjects with increased cardiometabolic risk factors related to

elevated adiposity. Int J Obes 2012;36:286-94.

Gómez-Ambrosi J, Moncada R, Valentí V, Silva C, Ramírez B, Catalán V, Rodríguez

A, Andrada P, Escalada J, Pastor C, Cienfuegos JA, Gil MJ, Salvador J, Frühbeck G.

Cardiometabolic profile related to body adiposity identifies patients eligible for bariatric

surgery more accurately than BMI. Obes Surg 2015;25:1594-603.

Gong Z, Tas E, Yakar S, Muzumdar R. Hepatic lipid metabolism and non-alcoholic

fatty liver disease in aging. Mol Cell Endocrinol 2016;10.1016/j.mce.2016.12.022.

- 87 -

Gonzales AM, Orlando RA. Role of adipocyte-derived lipoprotein lipase in adipocyte

hypertrophy. Nutr Metab 2007;4:22.

Gorelick DA, Praetorius J, Tsunenari T, Nielsen S, Agre P. Aquaporin-11: a channel

protein lacking apparent transport function expressed in brain. BMC Biochem 2006;7:14.

Granata R, Settanni F, Trovato L, Destefanis S, Gallo D, Martinetti M, Ghigo E,

Muccioli G. Unacylated as well as acylated ghrelin promotes cell survival and inhibit

apoptosis in HIT-T15 pancreatic beta-cells. Journal of Endocrinological Investigation

2006;29:Rc19-Rc22.

Grundy SM. Obesity, metabolic syndrome, and cardiovascular disease. J Clin

Endocrinol Metab 2004;89:2595-600.

Guan HP, Li Y, Jensen MV, Newgard CB, Steppan CM, Lazar MA. A futile metabolic cycle activated in adipocytes by antidiabetic agents. Nat Med 2002;8:1122-8.

Guimarães M, Nora M, Ferreira T, Andrade S, Ribeiro AM, Oliveira V, Carreira MC,

Casanueva FF, Monteiro MP. Sleeve gastrectomy and gastric plication in the rat result

in weight loss with different endocrine profiles. Obes Surg 2013;23:710-7.

Guo M, Chen F, Lin T, Peng Y, Li W, Zhu X, Lin L, Chen Y. Apelin-13 decreases lipid

storage in hypertrophic adipocytes in vitro through the upregulation of AQP7

expression by the PI3K signaling pathway. Med Sci Monit 2014;20:1345-52.

Gurriarán-Rodríguez U, Al-Massadi O, Crujeiras AB, Mosteiro CS, Amil-Diz M, Beiroa D, Nogueiras R, Seoane LM, Gallego R, Pazos Y, Casanueva FF, Camiña JP.

Preproghrelin expression is a key target for insulin action on adipogenesis. J Endocrinol

2011;210:R1-7.

Gutiérrez-Fisac JL, Guallar-Castillón P, León-Muñoz LM, Graciani A, Banegas JR,

Rodríguez-Artalejo F. Prevalence of general and abdominal obesity in the adult

population of Spain, 2008-2010: the ENRICA study. Obes Rev 2012;13:388-92.

Hansen JS, Krintel C, Hernebring M, Haataja TJ, de Marè S, Wasserstrom S, Kosinska-

Eriksson U, Palmgren M, Holm C, Stenkula KG, Jones HA, Lindkvist-Petersson K. Perilipin 1 binds to aquaporin 7 in human adipocytes and controls its mobility via

protein kinase A mediated phosphorylation. Metabolism 2016;65:1731-42.

Hara-Chikuma M, Sohara E, Rai T, Ikawa M, Okabe M, Sasaki S, Uchida S, Verkman

AS. Progressive adipocyte hypertrophy in aquaporin-7-deficient mice: adipocyte

glycerol permeability as a novel regulator of fat accumulation. J Biol Chem

2005;280:15493-6.

Hara-Chikuma M, Verkman AS. Aquaporin-3 facilitates epidermal cell migration and

proliferation during wound healing. J Mol Med 2008a;86:221-31.

Hara-Chikuma M, Verkman AS. Prevention of skin tumorigenesis and impairment of epidermal cell proliferation by targeted aquaporin-3 gene disruption. Mol Cell Biol

2008b;28:326-32.

Hara M, Ma T, Verkman AS. Selectively reduced glycerol in skin of aquaporin-3-

deficient mice may account for impaired skin hydration, elasticity, and barrier recovery.

J Biol Chem 2002;277:46616-21.

Hatakeyama S, Yoshida Y, Tani T, Koyama Y, Nihei K, Ohshiro K, Kamiie JI, Yaoita

E, Suda T, Hatakeyama K, Yamamoto T. Cloning of a new aquaporin (AQP10)

- 88 -

abundantly expressed in duodenum and jejunum. Biochem Biophys Res Commun

2001;287:814-9.

Heine RJ, Diamant M, Mbanya JC, Nathan DM. Management of hyperglycaemia in

type 2 diabetes: the end of recurrent failure? BMJ 2006;333:1200-4.

Heinonen S, Saarinen L, Naukkarinen J, Rodríguez A, Frühbeck G, Hakkarainen A,

Lundbom J, Lundbom N, Vuolteenaho K, Moilanen E, Arner P, Hautaniemi S,

Suomalainen A, Kaprio J, Rissanen A, Pietiläinen KH. Adipocyte morphology and

implications for metabolic derangements in acquired obesity. Int J Obes 2014;38:1423-

31.

Henegar C, Tordjman J, Achard V, Lacasa D, Cremer I, Guerre-Millo M, Poitou C,

Basdevant A, Stich V, Viguerie N, Langin D, Bedossa P, Zucker JD, Clement K.

Adipose tissue transcriptomic signature highlights the pathological relevance of

extracellular matrix in human obesity. Genome Biol 2008;9:R14.

Herrera M, Hong NJ, Garvin JL. Aquaporin-1 transports NO across cell membranes.

Hypertension 2006;48:157-64.

Herrera M, Garvin JL. Novel role of AQP-1 in NO-dependent vasorelaxation. Am J

Physiol Renal Physiol 2007;292:F1443-51.

Hibuse T, Maeda N, Funahashi T, Yamamoto K, Nagasawa A, Mizunoya W, Kishida

K, Inoue K, Kuriyama H, Nakamura T, Fushiki T, Kihara S, Shimomura I. Aquaporin 7

deficiency is associated with development of obesity through activation of adipose glycerol kinase. Proc Natl Acad Sci USA 2005;102:10993-8.

Higa KD, Boone KB, Ho T. Complications of the laparoscopic Roux-en-Y gastric

bypass: 1,040 patients--what have we learned? Obes Surg 2000;10:509-13.

Higuchi S, Kubota M, Iguchi K, Usui S, Kiho T, Hirano K. Transcriptional regulation

of aquaporin 3 by insulin. J Cell Biochem 2007;102:1051-8.

Hohmeier HE, Newgard CB. Cell lines derived from pancreatic islets. Mol Cell

Endocrinol 2004;228:121-8.

Honka H, Koffert J, Hannukainen JC, Tuulari JJ, Karlsson HK, Immonen H, Oikonen V, Tolvanen T, Soinio M, Salminen P, Kudomi N, Mari A, Iozzo P, Nuutila P. The

effects of bariatric surgery on pancreatic lipid metabolism and blood flow. J Clin

Endocrinol Metab 2015;100:2015-23.

Hotamisligil GS, Shargill NS, Spiegelman BM. Adipose expression of tumor necrosis

factor-alpha: direct role in obesity-linked insulin resistance. Science 1993;259:87-91.

Huang CK, Lo CH, Shabbir A, Tai CM. Novel bariatric technology: laparoscopic

adjustable gastric banded plication: technique and preliminary results. Surg Obes Relat

Dis 2012;8:41-5.

Hussain A, Mahmood H, El-Hasani S. Gastric plication can reduce slippage rate after

laparoscopic gastric banding. JSLS 2010;14:221-7.

Hussain MA, Akalestou E, Song WJ. Inter-organ communication and regulation of beta

cell function. Diabetologia 2016;59:659-67.

Iannelli A, Anty R, Schneck AS, Tran A, Gugenheim J. Inflammation, insulin

resistance, lipid disturbances, anthropometrics, and metabolic syndrome in morbidly

obese patients: a case control study comparing laparoscopic Roux-en-Y gastric bypass

and laparoscopic sleeve gastrectomy. Surgery 2011;149:364-70.

- 89 -

Ishibashi K, Kuwahara M, Gu Y, Kageyama Y, Tohsaka A, Suzuki F, Marumo F,

Sasaki S. Cloning and functional expression of a new water channel abundantly

expressed in the testis permeable to water, glycerol, and urea. J Biol Chem

1997;272:20782-6.

Ishibashi K, Kuwahara M, Gu Y, Tanaka Y, Marumo F, Sasaki S. Cloning and functional expression of a new aquaporin (AQP9) abundantly expressed in the

peripheral leukocytes permeable to water and urea, but not to glycerol. Biochem

Biophys Res Commun 1998;244:268-74.

Ishibashi K. Aquaporin subfamily with unusual NPA boxes. Biochim Biophys Acta

2006;1758:989-93.

Ishibashi K, Koike S, Kondo S, Hara S, Tanaka Y. The role of a group III AQP, AQP11

in intracellular organelle homeostasis. J Med Invest 2009;56 Suppl:312-7.

Ishibashi K, Tanaka Y, Morishita Y. The role of mammalian superaquaporins inside the cell. Biochim Biophys Acta 2014;1840:1507-12.

Itoh T, Rai T, Kuwahara M, Ko SB, Uchida S, Sasaki S, Ishibashi K. Identification of a

novel aquaporin, AQP12, expressed in pancreatic acinar cells. Biochem Biophys Res

Commun 2005;330:832-8.

Ivano FH, Silva Lde M, Seniski GG, Menacho AM, Chigueira MA, Barros R.

Comparison of ghrelin plasma levels between pre and postoperative period in patients

submitted to gastric plication associated with fundoplication. Arq Bras Cir Dig 2013;26:8-12.

Jelen S, Wacker S, Aponte-Santamaría C, Skott M, Rojek A, Johanson U, Kjellbom P,

Nielsen S, de Groot BL, Rützler M. Aquaporin-9 protein is the primary route of

hepatocyte glycerol uptake for glycerol gluconeogenesis in mice. J Biol Chem

2011;286:44319-25.

Jelen S, Gena P, Lebeck J, Rojek A, Praetorius J, Frøkiaer J, Fenton RA, Nielsen S,

Calamita G, Rützler M. Aquaporin-9 and urea transporter-A gene deletions affect urea

transmembrane passage in murine hepatocytes. Am J Physiol Gastrointest Liver Physiol

2012;303:G1279-87.

Ji Y, Wang Y, Zhu J, Shen D. A systematic review of gastric plication for the treatment

of obesity. Surg Obes Relat Dis 2014;10:1226-32.

Jocken JW, Blaak EE. Catecholamine-induced lipolysis in adipose tissue and skeletal

muscle in obesity. Physiol Behav 2008;94:219-30.

Jung JS, Preston GM, Smith BL, Guggino WB, Agre P. Molecular structure of the water

channel through aquaporin CHIP. The hourglass model. J Biol Chem 1994;269:14648-

54.

Kahn SE, Hull RL, Utzschneider KM. Mechanisms linking obesity to insulin resistance and type 2 diabetes. Nature 2006;444:840-6.

Kalhan SC, Mahajan S, Burkett E, Reshef L, Hanson RW. Glyceroneogenesis and the

source of glycerol for hepatic triacylglycerol synthesis in humans. J Biol Chem

2001;276:12928-31.

Kamvissi V, Salerno A, Bornstein SR, Mingrone G, Rubino F. Incretins or anti-

incretins? A new model for the "entero-pancreatic axis". Horm Metab Res 2015;47:84-

7.

- 90 -

Kanneganti TD, Dixit VD. Immunological complications of obesity. Nat Immunol

2012;13:707-12.

Kashyap SR, Daud S, Kelly KR, Gastaldelli A, Win H, Brethauer S, Kirwan JP,

Schauer PR. Acute effects of gastric bypass versus gastric restrictive surgery on beta-cell function and insulinotropic hormones in severely obese patients with type 2

diabetes. Int J Obes 2010;34:462-71.

Kashyap SR, Bhatt DL, Wolski K, Watanabe RM, Abdul-Ghani M, Abood B, Pothier

CE, Brethauer S, Nissen S, Gupta M, Kirwan JP, Schauer PR. Metabolic effects of

bariatric surgery in patients with moderate obesity and type 2 diabetes: analysis of a

randomized control trial comparing surgery with intensive medical treatment. Diabetes

Care 2013;36:2175-82.

Katsuma S, Hirasawa A, Tsujimoto G. Bile acids promote glucagon-like peptide-1

secretion through TGR5 in a murine enteroendocrine cell line STC-1. Biochem Biophys Res Commun 2005;329:386-90.

Katz DP, Lee SR, Nachiappan AC, Willis MH, Bray CD, Farinas CA, Whigham CJ,

Spiegel F. Laparoscopic sleeve gastrectomy: a guide to postoperative anatomy and

complications. Abdom Imaging 2011;36:363-71.

Kawano Y, Ohta M, Hirashita T, Masuda T, Inomata M, Kitano S. Effects of sleeve

gastrectomy on lipid metabolism in an obese diabetic rat model. Obes Surg

2013;23:1947-56.

Kelley DE, McKolanis TM, Hegazi RA, Kuller LH, Kalhan SC. Fatty liver in type 2 diabetes mellitus: relation to regional adiposity, fatty acids, and insulin resistance. Am J

Physiol Endocrinol Metab 2003;285:E906-16.

Kersten S, Seydoux J, Peters JM, Gonzalez FJ, Desvergne B, Wahli W. Peroxisome

proliferator-activated receptor alpha mediates the adaptive response to fasting. J Clin

Invest 1999;103:1489-98.

Khan T, Muise ES, Iyengar P, Wang ZV, Chandalia M, Abate N, Zhang BB, Bonaldo P,

Chua S, Scherer PE. Metabolic dysregulation and adipose tissue fibrosis: role of

collagen VI. Mol Cell Biol 2009;29:1575-91.

Kim KH, Song MJ, Yoo EJ, Choe SS, Park SD, Kim JB. Regulatory role of glycogen

synthase kinase 3 for transcriptional activity of ADD1/SREBP1c. J Biol Chem

2004;279:51999-2006.

King LS, Choi M, Fernandez PC, Cartron JP, Agre P. Defective urinary-concentrating

ability due to a complete deficiency of aquaporin-1. N Engl J Med 2001;345:175-9.

King LS, Kozono D, Agre P. From structure to disease: the evolving tale of aquaporin

biology. Nat Rev Mol Cell Biol 2004;5:687-98.

Kintscher U, Hartge M, Hess K, Foryst-Ludwig A, Clemenz M, Wabitsch M, Fischer-Posovszky P, Barth TF, Dragun D, Skurk T, Hauner H, Blüher M, Unger T, Wolf AM,

Knippschild U, Hombach V, Marx N. T-lymphocyte infiltration in visceral adipose

tissue: a primary event in adipose tissue inflammation and the development of obesity-

mediated insulin resistance. Arterioscler Thromb Vasc Biol 2008;28:1304-10.

Kishida K, Kuriyama H, Funahashi T, Shimomura I, Kihara S, Ouchi N, Nishida M,

Nishizawa H, Matsuda M, Takahashi M, Hotta K, Nakamura T, Yamashita S, Tochino

Y, Matsuzawa Y. Aquaporin adipose, a putative glycerol channel in adipocytes. J Biol

Chem 2000;275:20896-902.

- 91 -

Kishida K, Shimomura I, Nishizawa H, Maeda N, Kuriyama H, Kondo H, Matsuda M,

Nagaretani H, Ouchi N, Hotta K, Kihara S, Kadowaki T, Funahashi T, Matsuzawa Y.

Enhancement of the aquaporin adipose gene expression by a peroxisome proliferator-

activated receptor . J Biol Chem 2001a;276:48572-9.

Kishida K, Shimomura I, Kondo H, Kuriyama H, Makino Y, Nishizawa H, Maeda N,

Matsuda M, Ouchi N, Kihara S, Kurachi Y, Funahashi T, Matsuzawa Y. Genomic

structure and insulin-mediated repression of the aquaporin adipose (AQPap), adipose-

specific glycerol channel. J Biol Chem 2001b;276:36251-60.

Kojima M, Hosoda H, Date Y, Nakazato M, Matsuo H, Kangawa K. Ghrelin is a growth-hormone-releasing acylated peptide from stomach. Nature 1999;402:656-60.

Kolditz CI, Langin D. Adipose tissue lipolysis. Curr Opin Clin Nutr Metab Care

2010;13:377-81.

Kondo H, Shimomura I, Kishida K, Kuriyama H, Makino Y, Nishizawa H, Matsuda M,

Maeda N, Nagaretani H, Kihara S, Kurachi Y, Nakamura T, Funahashi T, Matsuzawa

Y. Human aquaporin adipose (AQPap) gene. Genomic structure, promoter analysis and

functional mutation. Eur J Biochem 2002;269:1814-26.

Kopelman PG. Obesity as a medical problem. Nature 2000;404:635-43.

Kourkoulos M, Giorgakis E, Kokkinos C, Mavromatis T, Griniatsos J, Nikiteas N,

Tsigris C. Laparoscopic gastric plication for the treatment of morbid obesity: a review.

Minim Invasive Surg 2012;2012:696348.

Krane CM, Fortner CN, Hand AR, McGraw DW, Lorenz JN, Wert SE, Towne JE, Paul

RJ, Whitsett JA, Menon AG. Aquaporin 5-deficient mouse lungs are hyperresponsive to

cholinergic stimulation. Proc Natl Acad Sci USA 2001;98:14114-9.

Kubota N, Kubota T, Kajiwara E, Iwamura T, Kumagai H, Watanabe T, Inoue M, Takamoto I, Sasako T, Kumagai K, Kohjima M, Nakamuta M, Moroi M, Sugi K, Noda

T, Terauchi Y, Ueki K, Kadowaki T. Differential hepatic distribution of insulin receptor

substrates causes selective insulin resistance in diabetes and obesity. Nat Commun

2016;7:12977.

Kuk JL, Katzmarzyk PT, Nichaman MZ, Church TS, Blair SN, Ross R. Visceral fat is

an independent predictor of all-cause mortality in men. Obesity 2006;14:336-41.

Kuriyama H, Shimomura I, Kishida K, Kondo H, Furuyama N, Nishizawa H, Maeda N,

Matsuda M, Nagaretani H, Kihara S, Nakamura T, Tochino Y, Funahashi T, Matsuzawa

Y. Coordinated regulation of fat-specific and liver-specific glycerol channels, aquaporin adipose and aquaporin 9. Diabetes 2002;51:2915-21.

Laferrère B, Teixeira J, McGinty J, Tran H, Egger JR, Colarusso A, Kovack B, Bawa B,

Koshy N, Lee H, Yapp K, Olivan B. Effect of weight loss by gastric bypass surgery

versus hypocaloric diet on glucose and incretin levels in patients with type 2 diabetes. J

Clin Endocrinol Metab 2008;93:2479-85.

Lafontan M, Langin D. Lipolysis and lipid mobilization in human adipose tissue. Prog

Lipid Res 2009;48:275-97.

Laforenza U, Scaffino MF, Gastaldi G. Aquaporin-10 represents an alternative pathway for glycerol efflux from human adipocytes. PLoS One 2013;8:e54474.

Langin D. Adipose tissue lipolysis as a metabolic pathway to define pharmacological

strategies against obesity and the metabolic syndrome. Pharmacol Res 2006;53:482-91.

- 92 -

le Roux CW, Aylwin SJ, Batterham RL, Borg CM, Coyle F, Prasad V, Shurey S, Ghatei

MA, Patel AG, Bloom SR. Gut hormone profiles following bariatric surgery favor an

anorectic state, facilitate weight loss, and improve metabolic parameters. Ann Surg

2006;243:108-14.

Lebeck J. Metabolic impact of the glycerol channels AQP7 and AQP9 in adipose tissue and liver. J Mol Endocrinol 2014;52:R165-R78.

Lebeck J, Cheema MU, Skowronski MT, Nielsen S, Praetorius J. Hepatic AQP9

expression in male rats is reduced in response to PPARalpha agonist treatment. Am J

Physiol Gastrointest Liver Physiol 2015;308:G198-205.

Lee JS, Kim SH, Jun DW, Han JH, Jang EC, Park JY, Son BK, Jo YJ, Park YS, Kim

YS. Clinical implications of fatty pancreas: correlations between fatty pancreas and

metabolic syndrome. World J Gastroenterol 2009;15:1869-75.

Lee JT, Huang Z, Pan K, Zhang HJ, Woo CW, Xu A, Wong CM. Adipose-derived lipocalin 14 alleviates hyperglycaemia by suppressing both adipocyte glycerol efflux

and hepatic gluconeogenesis in mice. Diabetologia 2016;59:604-13.

Lee P, Greenfield JR. Non-pharmacological and pharmacological strategies of brown

adipose tissue recruitment in humans. Mol Cell Endocrinol 2015;418 Pt 2:184-90.

Lee Y, Lingvay I, Szczepaniak LS, Ravazzola M, Orci L, Unger RH. Pancreatic

steatosis: harbinger of type 2 diabetes in obese rodents. Int J Obes 2010;34:396-400.

Li H, Kamiie J, Morishita Y, Yoshida Y, Yaoita E, Ishibashi K, Yamamoto T. Expression and localization of two isoforms of AQP10 in human small intestine. Biol

Cell 2005;97:823-9.

Lidell ME, Betz MJ, Dahlqvist Leinhard O, Heglind M, Elander L, Slawik M, Mussack

T, Nilsson D, Romu T, Nuutila P, Virtanen KA, Beuschlein F, Persson A, Borga M,

Enerbäck S. Evidence for two types of brown adipose tissue in humans. Nat Med

2013;19:631-4.

Liu J, Divoux A, Sun J, Zhang J, Clément K, Glickman JN, Sukhova GK, Wolters PJ,

Du J, Gorgun CZ, Doria A, Libby P, Blumberg RS, Kahn BB, Hotamisligil GS, Shi GP. Genetic deficiency and pharmacological stabilization of mast cells reduce diet-induced

obesity and diabetes in mice. Nat Med 2009;15:940-5.

Liu Z, Shen J, Carbrey JM, Mukhopadhyay R, Agre P, Rosen BP. Arsenite transport by

mammalian aquaglyceroporins AQP7 and AQP9. Proc Natl Acad Sci USA

2002;99:6053-8.

Longitudinal Assessment of Bariatric Surgery C, Flum DR, Belle SH, King WC, Wahed

AS, Berk P, Chapman W, Pories W, Courcoulas A, McCloskey C, Mitchell J, Patterson

E, Pomp A, Staten MA, Yanovski SZ, Thirlby R, Wolfe B. Perioperative safety in the

longitudinal assessment of bariatric surgery. N Engl J Med 2009;361:445-54.

López M, Lage R, Saha AK, Pérez-Tilve D, Vázquez MJ, Varela L, Sangiao-Alvarellos

S, Tovar S, Raghay K, Rodríguez-Cuenca S, Deoliveira RM, Castañeda T, Datta R,

Dong JZ, Culler M, Sleeman MW, Alvarez CV, Gallego R, Lelliott CJ, Carling D,

Tschöp MH, Diéguez C, Vidal-Puig A. Hypothalamic fatty acid metabolism mediates

the orexigenic action of ghrelin. Cell Metab 2008;7:389-99.

Louchami K, Best L, Brown P, Virreira M, Hupkens E, Perret J, Devuyst O, Uchida S,

Delporte C, Malaisse WJ, Beauwens R, Sener A. A new role for aquaporin 7 in insulin

secretion. Cell Physiol Biochem 2012;29:65-74.

- 93 -

Lumeng CN, Bodzin JL, Saltiel AR. Obesity induces a phenotypic switch in adipose

tissue macrophage polarization. J Clin Invest 2007;117:175-84.

Ma T, Frigeri A, Hasegawa H, Verkman AS. Cloning of a water channel homolog

expressed in brain meningeal cells and kidney collecting duct that functions as a stilbene-sensitive glycerol transporter. J Biol Chem 1994;269:21845-9.

Ma T, Yang B, Gillespie A, Carlson EJ, Epstein CJ, Verkman AS. Generation and

phenotype of a transgenic knockout mouse lacking the mercurial-insensitive water

channel aquaporin-4. J Clin Invest 1997;100:957-62.

Ma T, Song Y, Gillespie A, Carlson EJ, Epstein CJ, Verkman AS. Defective secretion

of saliva in transgenic mice lacking aquaporin-5 water channels. J Biol Chem

1999;274:20071-4.

Ma T, Song Y, Yang B, Gillespie A, Carlson EJ, Epstein CJ, Verkman AS. Nephrogenic diabetes insipidus in mice lacking aquaporin-3 water channels. Proc Natl

Acad Sci USA 2000;97:4386-91.

Ma T, Hara M, Sougrat R, Verbavatz JM, Verkman AS. Impaired stratum corneum

hydration in mice lacking epidermal water channel aquaporin-3. J Biol Chem

2002;277:17147-53.

Machado M, Marques-Vidal P, Cortez-Pinto H. Hepatic histology in obese patients

undergoing bariatric surgery. J Hepatol 2006;45:600-6.

Madeira A, Camps M, Zorzano A, Moura TF, Soveral G. Biophysical assessment of human aquaporin-7 as a water and glycerol channel in 3T3-L1 adipocytes. PLoS One

2013;8:e83442.

Madeira A, Fernández-Veledo S, Camps M, Zorzano A, Moura TF, Ceperuelo-Mallafré

V, Vendrell J, Soveral G. Human aquaporin-11 is a water and glycerol channel and

localizes in the vicinity of lipid droplets in human adipocytes. Obesity 2014;22:2010-7.

Madeira A, Mosca AF, Moura TF, Soveral G. Aquaporin-5 is expressed in adipocytes

with implications in adipose differentiation. IUBMB Life 2015;67:54-60.

Maeda N, Funahashi T, Hibuse T, Nagasawa A, Kishida K, Kuriyama H, Nakamura T, Kihara S, Shimomura I, Matsuzawa Y. Adaptation to fasting by glycerol transport

through aquaporin 7 in adipose tissue. Proc Natl Acad Sci USA 2004;101:17801-6.

Maeda N, Funahashi T, Shimomura I. Metabolic impact of adipose and hepatic glycerol

channels aquaporin 7 and aquaporin 9. Nat Clin Pract Endocrinol Metab 2008;4:627-

34.

Malaisse WJ. [An ionic determination of the insulinotropic action of insulin: not

everyone agrees]. Bull Mem Acad R Med Belg 2008;163:143-9; discussion 50-1.

Malin SK, Samat A, Wolski K, Abood B, Pothier CE, Bhatt DL, Nissen S, Brethauer SA, Schauer PR, Kirwan JP, Kashyap SR. Improved acylated ghrelin suppression at 2

years in obese patients with type 2 diabetes: effects of bariatric surgery vs standard

medical therapy. Int J Obes 2014;38:364-70.

Manley GT, Fujimura M, Ma T, Noshita N, Filiz F, Bollen AW, Chan P, Verkman AS.

Aquaporin-4 deletion in mice reduces brain edema after acute water intoxication and

ischemic stroke. Nat Med 2000;6:159-63.

- 94 -

Marrades MP, Milagro FI, Martínez JA, Moreno-Aliaga MJ. Differential expression of

aquaporin 7 in adipose tissue of lean and obese high fat consumers. Biochem Biophys

Res Commun 2006;339:785-9.

Mathur A, Marine M, Lu D, Swartz-Basile DA, Saxena R, Zyromski NJ, Pitt HA. Nonalcoholic fatty pancreas disease. HPB (Oxford) 2007;9:312-8.

Mathurin P, Hollebecque A, Arnalsteen L, Buob D, Leteurtre E, Caiazzo R, Pigeyre M,

Verkindt H, Dharancy S, Louvet A, Romon M, Pattou F. Prospective study of the long-

term effects of bariatric surgery on liver injury in patients without advanced disease.

Gastroenterology 2009;137:532-40.

Matsumura K, Chang BH, Fujimiya M, Chen W, Kulkarni RN, Eguchi Y, Kimura H,

Kojima H, Chan L. Aquaporin 7 is a beta-cell protein and regulator of intraislet glycerol

content and glycerol kinase activity, beta-cell mass, and insulin production and

secretion. Mol Cell Biol 2007;27:6026-37.

Mattar SG, Velcu LM, Rabinovitz M, Demetris AJ, Krasinskas AM, Barinas-Mitchell

E, Eid GM, Ramanathan R, Taylor DS, Schauer PR. Surgically-induced weight loss

significantly improves nonalcoholic fatty liver disease and the metabolic syndrome. Ann

Surg 2005;242:610-7; discussion 18-20.

Méndez-Giménez L, Rodríguez A, Balaguer I, Frühbeck G. Role of aquaglyceroporins

and caveolins in energy and metabolic homeostasis. Mol Cell Endocrinol 2014;397:78-

92.

Miranda M, Ceperuelo-Mallafré V, Lecube A, Hernández C, Chacón MR, Fort JM, Gallart L, Baena-Fustegueras JA, Simo R, Vendrell J. Gene expression of paired

abdominal adipose AQP7 and liver AQP9 in patients with morbid obesity: relationship

with glucose abnormalities. Metabolism 2009;58:1762-8.

Miranda M, Escote X, Ceperuelo-Mallafré V, Alcaide MJ, Simón I, Vilarrasa N,

Wabitsch M, Vendrell J. Paired subcutaneous and visceral adipose tissue aquaporin-7

expression in human obesity and type 2 diabetes: differences and similarities between

depots. J Clin Endocrinol Metab 2010;95:3470-9.

Mithieux G. A novel function of intestinal gluconeogenesis: central signaling in glucose and energy homeostasis. Nutrition 2009;25:881-4.

Mobasheri A, Shakibaei M, Marples D. Immunohistochemical localization of aquaporin

10 in the apical membranes of the human ileum: a potential pathway for luminal water

and small solute absorption. Histochem Cell Biol 2004;121:463-71.

Moncada R, Becerril S, Rodríguez A, Méndez-Giménez L, Ramírez B, Catalán V,

Gómez-Ambrosi J, Gil MJ, Fernández S, Cienfuegos JA, Valentí V, Frühbeck G. Sleeve

gastrectomy reduces body weight and improves metabolic profile also in obesity-prone

rats. Obes Surg 2016a;26:1537-48.

Moncada R, Landecho MF, Frühbeck G. Metabolic surgery enters the T2DM treatment algorithm. Trends Endocrinol Metab 2016b;27:678-80.

Moncada R, Rodríguez A, Becerril S, Méndez-Giménez L, Valentí V, Ramírez B,

Cienfuegos JA, Fernández S, Catalán V, Gómez-Ambrosi J, Frühbeck G. Sleeve

gastrectomy decreases body weight, whole-body adiposity, and blood pressure even in

aged diet-induced obese rats. Obes Surg 2016c;26:1549-58.

Morinaga T, Nakakoshi M, Hirao A, Imai M, Ishibashi K. Mouse aquaporin 10 gene

(AQP10) is a pseudogene. Biochem Biophys Res Commun 2002;294:630-4.

- 95 -

Morishita Y, Matsuzaki T, Hara-chikuma M, Andoo A, Shimono M, Matsuki A,

Kobayashi K, Ikeda M, Yamamoto T, Verkman A, Kusano E, Ookawara S, Takata K,

Sasaki S, Ishibashi K. Disruption of aquaporin-11 produces polycystic kidneys

following vacuolization of the proximal tubule. Mol Cell Biol 2005;25:7770-9.

Mortensen K, Petersen LL, Ørskov C. Colocalization of GLP-1 and GIP in human and porcine intestine. Ann N Y Acad Sci 2000;921:469-72.

Müller TD, Nogueiras R, Andermann ML, Andrews ZB, Anker SD, Argente J,

Batterham RL, Benoit SC, Bowers CY, Broglio F, Casanueva FF, D'Alessio D,

Depoortere I, Geliebter A, Ghigo E, Cole PA, Cowley M, Cummings DE, Dagher A,

Diano S, Dickson SL, Dieguez C, Granata R, Grill HJ, Grove K, Habegger KM,

Heppner K, Heiman ML, Holsen L, Holst B, Inui A, Jansson JO, Kirchner H, Korbonits

M, Laferrere B, LeRoux CW, Lopez M, Morin S, Nakazato M, Nass R, Perez-Tilve D,

Pfluger PT, Schwartz TW, Seeley RJ, Sleeman M, Sun Y, Sussel L, Tong J, Thorner MO, van der Lely AJ, van der Ploeg LH, Zigman JM, Kojima M, Kangawa K, Smith

RG, Horvath T, Tschop MH. Ghrelin. Mol Metab 2015;4:437-60.

Mumphrey MB, Hao Z, Townsend RL, Patterson LM, Berthoud HR. Sleeve

gastrectomy does not cause hypertrophy and reprogramming of intestinal glucose

metabolism in rats. Obes Surg 2015;25:1468-73.

Muoio DM, Newgard CB. Mechanisms of disease: molecular and metabolic

mechanisms of insulin resistance and beta-cell failure in type 2 diabetes. Nat Rev Mol

Cell Biol 2008;9:193-205.

Musso G, Gambino R, Cassader M. Recent insights into hepatic lipid metabolism in non-alcoholic fatty liver disease (NAFLD). Prog Lipid Res 2009;48:1-26.

Mutch DM, Tordjman J, Pelloux V, Hanczar B, Henegar C, Poitou C, Veyrie N, Zucker

JD, Clément K. Needle and surgical biopsy techniques differentially affect adipose

tissue gene expression profiles. Am J Clin Nutr 2009;89:51-7.

Nakatani H, Kasama K, Oshiro T, Watanabe M, Hirose H, Itoh H. Serum bile acid

along with plasma incretins and serum high-molecular weight adiponectin levels are

increased after bariatric surgery. Metabolism 2009;58:1400-7.

Nakazato M, Murakami N, Date Y, Kojima M, Matsuo H, Kangawa K, Matsukura S. A role for ghrelin in the central regulation of feeding. Nature 2001;409:194-8.

Nedergaard J, Bengtsson T, Cannon B. New powers of brown fat: fighting the

metabolic syndrome. Cell Metab 2011;13:238-40.

Nedergaard J, Cannon B. How brown is brown fat? It depends where you look. Nat Med

2013;19:540-1.

Nejsum LN, Kwon TH, Jensen UB, Fumagalli O, Frøkiaer J, Krane CM, Menon AG,

King LS, Agre PC, Nielsen S. Functional requirement of aquaporin-5 in plasma membranes of sweat glands. Proc Natl Acad Sci USA 2002;99:511-6.

Ng M, Fleming T, Robinson M, Thomson B, Graetz N, Margono C, Mullany EC,

Biryukov S, Abbafati C, Abera SF, Abraham JP, Abu-Rmeileh NM, Achoki T,

AlBuhairan FS, Alemu ZA, Alfonso R, Ali MK, Ali R, Guzman NA, Ammar W,

Anwari P, Banerjee A, Barquera S, Basu S, Bennett DA, Bhutta Z, Blore J, Cabral N,

Nonato IC, Chang JC, Chowdhury R, Courville KJ, Criqui MH, Cundiff DK,

Dabhadkar KC, Dandona L, Davis A, Dayama A, Dharmaratne SD, Ding EL, Durrani

AM, Esteghamati A, Farzadfar F, Fay DF, Feigin VL, Flaxman A, Forouzanfar MH,

- 96 -

Goto A, Green MA, Gupta R, Hafezi-Nejad N, Hankey GJ, Harewood HC, Havmoeller

R, Hay S, Hernandez L, Husseini A, Idrisov BT, Ikeda N, Islami F, Jahangir E, Jassal

SK, Jee SH, Jeffreys M, Jonas JB, Kabagambe EK, Khalifa SE, Kengne AP, Khader

YS, Khang YH, Kim D, Kimokoti RW, Kinge JM, Kokubo Y, Kosen S, Kwan G, Lai T,

Leinsalu M, Li Y, Liang X, Liu S, Logroscino G, Lotufo PA, Lu Y, Ma J, Mainoo NK, Mensah GA, Merriman TR, Mokdad AH, Moschandreas J, Naghavi M, Naheed A,

Nand D, Narayan KM, Nelson EL, Neuhouser ML, Nisar MI, Ohkubo T, Oti SO,

Pedroza A, Prabhakaran D, Roy N, Sampson U, Seo H, Sepanlou SG, Shibuya K, Shiri

R, Shiue I, Singh GM, Singh JA, Skirbekk V, Stapelberg NJ, Sturua L, Sykes BL,

Tobias M, Tran BX, Trasande L, Toyoshima H, van de Vijver S, Vasankari TJ,

Veerman JL, Velasquez-Melendez G, Vlassov VV, Vollset SE, Vos T, Wang C, Wang

X, Weiderpass E, Werdecker A, Wright JL, Yang YC, Yatsuya H, Yoon J, Yoon SJ,

Zhao Y, Zhou M, Zhu S, Lopez AD, Murray CJ, Gakidou E. Global, regional, and

national prevalence of overweight and obesity in children and adults during 1980-2013:

a systematic analysis for the Global Burden of Disease Study 2013. Lancet 2014;384:766-81.

Niazi M, Maleki AR, Talebpour M. Short-term outcomes of laparoscopic gastric

plication in morbidly obese patients: importance of postoperative follow-up. Obes Surg

2013;23:87-92.

Ohta E, Itoh T, Nemoto T, Kumagai J, Ko SB, Ishibashi K, Ohno M, Uchida K, Ohta A,

Sohara E, Uchida S, Sasaki S, Rai T. Pancreas-specific aquaporin 12 null mice showed

increased susceptibility to caerulein-induced acute pancreatitis. Am J Physiol Cell

Physiol 2009;297:C1368-78.

Okada S, Misaka T, Tanaka Y, Matsumoto I, Ishibashi K, Sasaki S, Abe K. Aquaporin-11 knockout mice and polycystic kidney disease animals share a common mechanism of

cyst formation. FASEB J 2008;22:3672-84.

Olbers T, Björkman S, Lindroos A, Maleckas A, Lönn L, Sjöström L, Lönroth H. Body

composition, dietary intake, and energy expenditure after laparoscopic Roux-en-Y

gastric bypass and laparoscopic vertical banded gastroplasty: a randomized clinical trial.

Ann Surg 2006;244:715-22.

Oliva R, Calamita G, Thornton JM, Pellegrini-Calace M. Electrostatics of aquaporin

and aquaglyceroporin channels correlates with their transport selectivity. Proc Natl Acad Sci USA 2010;107:4135-40.

Orskov C, Wettergren A, Holst JJ. Secretion of the incretin hormones glucagon-like

peptide-1 and gastric inhibitory polypeptide correlates with insulin secretion in normal

man throughout the day. Scand J Gastroenterol 1996;31:665-70.

Ou HY, Wang CY, Yang YC, Chen MF, Chang CJ. The association between

nonalcoholic fatty pancreas disease and diabetes. PLoS One 2013;8:e62561.

Ouchi N, Parker JL, Lugus JJ, Walsh K. Adipokines in inflammation and metabolic

disease. Nat Rev Immunol 2011;11:85-97.

Ouellet V, Routhier-Labadie A, Bellemare W, Lakhal-Chaieb L, Turcotte E, Carpentier

AC, Richard D. Outdoor temperature, age, sex, body mass index, and diabetic status

determine the prevalence, mass, and glucose-uptake activity of 18F-FDG-detected BAT

in humans. J Clin Endocrinol Metab 2011;96:192-9.

- 97 -

Page AJ, Slattery JA, Milte C, Laker R, O'Donnell T, Dorian C, Brierley SM,

Blackshaw LA. Ghrelin selectively reduces mechanosensitivity of upper gastrointestinal

vagal afferents. Am J Physiol Gastrointest Liver Physiol 2007;292:G1376-84.

Papadopoulos MC, Manley GT, Krishna S, Verkman AS. Aquaporin-4 facilitates reabsorption of excess fluid in vasogenic brain edema. FASEB J 2004;18:1291-3.

Patel SR, Hakim D, Mason J, Hakim N. The duodenal-jejunal bypass sleeve

(EndoBarrier Gastrointestinal Liner) for weight loss and treatment of type 2 diabetes.

Surg Obes Relat Dis 2013;9:482-4.

Patrikakos P, Toutouzas KG, Perrea D, Menenakos E, Pantopoulou A, Thomopoulos T,

Papadopoulos S, Bramis JI. A surgical rat model of sleeve gastrectomy with staple

technique: long-term weight loss results. Obes Surg 2009;19:1586-90.

Penney NC, Kinross J, Newton RC, Purkayastha S. The role of bile acids in reducing the metabolic complications of obesity after bariatric surgery: a systematic review. Int J

Obes 2015;39:1565-74.

Peroni O, Large V, Beylot M. Measuring gluconeogenesis with [2-13C]glycerol and

mass isotopomer distribution analysis of glucose. Am J Physiol 1995;269:E516-23.

Peterli R, Steinert RE, Woelnerhanssen B, Peters T, Christoffel-Courtin C, Gass M,

Kern B, von Fluee M, Beglinger C. Metabolic and hormonal changes after laparoscopic

Roux-en-Y gastric bypass and sleeve gastrectomy: a randomized, prospective trial. Obes

Surg 2012;22:740-8.

Pories WJ, Swanson MS, MacDonald KG, Long SB, Morris PG, Brown BM, Barakat

HA, deRamon RA, Israel G, Dolezal JM, et al. Who would have thought it? An

operation proves to be the most effective therapy for adult-onset diabetes mellitus. Ann

Surg 1995;222:339-50; discussion 50-2.

Porteiro B, Díaz-Ruíz A, Martínez G, Senra A, Vidal A, Serrano M, Gualillo O, López

M, Malagón MM, Diéguez C, Nogueiras R. Ghrelin requires p53 to stimulate lipid

storage in fat and liver. Endocrinology 2013;154:3671-9.

Potter JJ, Koteish A, Hamilton J, Liu X, Liu K, Agre P, Mezey E. Effects of acetaldehyde on hepatocyte glycerol uptake and cell size: implication of aquaporin 9.

Alcohol Clin Exp Res 2011;35:939-45.

Poulsen L, Siersbæk M, Mandrup S. PPARs: fatty acid sensors controlling metabolism.

Semin Cell Dev Biol 2012;23:631-9.

Pournaras DJ, le Roux CW. Are bile acids the new gut hormones? Lessons from weight

loss surgery models. Endocrinology 2013;154:2255-6.

Pöykkö SM, Ukkola O, Kauma H, Kellokoski E, Hörkkö S, Kesäniemi YA. The

negative association between plasma ghrelin and IGF-I is modified by obesity, insulin resistance and type 2 diabetes. Diabetologia 2005;48:309-16.

Preitner F, Ibberson M, Franklin I, Binnert C, Pende M, Gjinovci A, Hansotia T,

Drucker DJ, Wollheim C, Burcelin R, Thorens B. Gluco-incretins control insulin

secretion at multiple levels as revealed in mice lacking GLP-1 and GIP receptors. J Clin

Invest 2004;113:635-45.

Preston GM, Smith BL, Zeidel ML, Moulds JJ, Agre P. Mutations in aquaporin-1 in

phenotypically normal humans without functional CHIP water channels. Science

1994;265:1585-7.

- 98 -

Prudente S, Flex E, Morini E, Turchi F, Capponi D, De Cosmo S, Tassi V, Guida V,

Avogaro A, Folli F, Maiani F, Frittitta L, Dallapiccola B, Trischitta V. A functional

variant of the adipocyte glycerol channel aquaporin 7 gene is associated with obesity

and related metabolic abnormalities. Diabetes 2007;56:1468-74.

Qader SS, Håkanson R, Rehfeld JF, Lundquist I, Salehi A. Proghrelin-derived peptides influence the secretion of insulin, glucagon, pancreatic polypeptide and somatostatin: A

study on isolated islets from mouse and rat pancreas. Regul Pept 2008;146:230-37.

Ramírez-Lorca R, Vizuete ML, Venero JL, Revuelta M, Cano J, Ilundáin AA,

Echevarría M. Localization of aquaporin-3 mRNA and protein along the gastrointestinal

tract of Wistar rats. Pflugers Arch 1999;438:94-100.

Ramos A, Galvao Neto M, Galvao M, Evangelista LF, Campos JM, Ferraz A.

Laparoscopic greater curvature plication: initial results of an alternative restrictive

bariatric procedure. Obes Surg 2010;20:913-8.

Reddy JK. Nonalcoholic steatosis and steatohepatitis. III. Peroxisomal beta-oxidation,

PPAR alpha, and steatohepatitis. Am J Physiol Gastrointest Liver Physiol

2001;281:G1333-9.

Reggio S, Rouault C, Poitou C, Bichet JC, Prifti E, Bouillot JL, Rizkalla S, Lacasa D,

Tordjman J, Clément K. Increased basement membrane components in adipose tissue

during obesity: links with TGFbeta and metabolic phenotypes. J Clin Endocrinol Metab

2016;101:2578-87.

Reshef L, Olswang Y, Cassuto H, Blum B, Croniger CM, Kalhan SC, Tilghman SM, Hanson RW. Glyceroneogenesis and the triglyceride/fatty acid cycle. J Biol Chem

2003;278:30413-6.

Ribaric G, Buchwald JN, McGlennon TW. Diabetes and weight in comparative studies

of bariatric surgery vs conventional medical therapy: a systematic review and meta-

analysis. Obes Surg 2014;24:437-55.

Rimm EB, Stampfer MJ, Giovannucci E, Ascherio A, Spiegelman D, Colditz GA,

Willett WC. Body size and fat distribution as predictors of coronary heart disease

among middle-aged and older US men. Am J Epidemiol 1995;141:1117-27.

Rocha-Rodrigues S, Rodríguez A, Becerril S, Ramirez B, Gonçalves IO, Beleza J,

Frühbeck G, Ascensão A, Magalhães J. Physical exercise remodels visceral adipose

tissue and mitochondrial lipid metabolism in rats fed a high-fat diet. Clin Exp

Pharmacol Physiol 2016;

Rodríguez A, Catalán V, Gómez-Ambrosi J, Frühbeck G. Role of aquaporin-7 in the

pathophysiological control of fat accumulation in mice. FEBS Lett 2006;580:4771-6.

Rodríguez A, Catalán V, Gómez-Ambrosi J, Frühbeck G. Visceral and subcutaneous

adiposity: are both potential therapeutic targets for tackling the metabolic syndrome? Curr Pharm Des 2007a;13:2169-75.

Rodríguez A, Catalán V, Becerril S, Sáinz N, Salvador J, Gómez-Ambrosi J, Frühbeck

G. Aquaporins and their metabolic implications. Obesity and Metabolism 2007b;3:58-

67.

Rodríguez A, Gómez-Ambrosi J, Catalán V, Gil MJ, Becerril S, Sáinz N, Silva C,

Salvador J, Colina I, Frühbeck G. Acylated and desacyl ghrelin stimulate lipid

accumulation in human visceral adipocytes. Int J Obes 2009;33:541-52.

- 99 -

Rodríguez A, Gómez-Ambrosi J, Catalán V, Becerril S, Sáinz N, Gil MJ, Silva C,

Salvador J, Barba J, Colina I, Frühbeck G. Association of plasma acylated ghrelin with

blood pressure and left ventricular mass in patients with metabolic syndrome. J

Hypertens 2010;28:560-7.

Rodríguez A, Catalán V, Gómez-Ambrosi J, Frühbeck G. Aquaglyceroporins serve as metabolic gateways in adiposity and insulin resistance control. Cell Cycle

2011a;10:1548-56.

Rodríguez A, Catalán V, Gómez-Ambrosi J, García-Navarro S, Rotellar F, Valentí V,

Silva C, Gil MJ, Salvador J, Burrell MA, Calamita G, Malagón MM, Frühbeck G.

Insulin- and leptin-mediated control of aquaglyceroporins in human adipocytes and

hepatocytes is mediated via the PI3K/Akt/mTOR signaling cascade. J Clin Endocrinol

Metab 2011b;96:E586-97.

Rodríguez A, Becerril S, Valentí V, Ramírez B, Martín M, Méndez-Giménez L, Lancha A, del Sol Calderón P, Catalán V, Burrell MA, Gómez-Ambrosi J, Frühbeck G. Sleeve

gastrectomy reduces blood pressure in obese (fa/fa) Zucker rats. Obes Surg

2012a;22:309-15.

Rodríguez A, Becerril S, Valentí V, Moncada R, Méndez-Giménez L, Ramírez B,

Lancha A, Martín M, Burrell MA, Catalán V, Gómez-Ambrosi J, Frühbeck G. Short-

term effects of sleeve gastrectomy and caloric restriction on blood pressure in diet-

induced obese rats. Obes Surg 2012b;22:1481-90.

Rodríguez A, Gena P, Méndez-Giménez L, Rosito A, Valentí V, Rotellar F, Sola I, Moncada R, Silva C, Svelto M, Salvador J, Calamita G, Frühbeck G. Reduced hepatic

aquaporin-9 and glycerol permeability are related to insulin resistance in non-alcoholic

fatty liver disease. Int J Obes 2014;38:1213-20.

Rodríguez A, Moreno NR, Balaguer I, Méndez-Giménez L, Becerril S, Catalán V,

Gomez-Ambrosi J, Portincasa P, Calamita G, Soveral G, Malagón MM, Frühbeck G.

Leptin administration restores the altered adipose and hepatic expression of

aquaglyceroporins improving the non-alcoholic fatty liver of ob/ob mice. Sci Rep

2015a;5:12067.

Rodríguez A, Ezquerro S, Méndez-Giménez L, Becerril S, Frühbeck G. Revisiting the adipocyte: a model for integration of cytokine signaling in the regulation of energy

metabolism. Am J Physiol Endocrinol Metab 2015b;309:E691-714.

Rodríguez A, Gómez-Ambrosi J, Catalán V, Ezquerro S, Méndez-Giménez L, Becerril

S, Ibañez P, Vila N, Margall MA, Moncada R, Valentí V, Silva C, Salvador J, Frühbeck

G. Guanylin and uroguanylin stimulate lipolysis in human visceral adipocytes. Int J

Obes 2016;40:1405-15.

Rojek A, Füchtbauer EM, Kwon TH, Frøkiaer J, Nielsen S. Severe urinary

concentrating defect in renal collecting duct-selective AQP2 conditional-knockout mice.

Proc Natl Acad Sci USA 2006;103:6037-42.

Rojek A, Füchtbauer EM, Füchtbauer A, Jelen S, Malmendal A, Fenton RA, Nielsen S.

Liver-specific Aquaporin 11 knockout mice show rapid vacuolization of the rough

endoplasmic reticulum in periportal hepatocytes after amino acid feeding. Am J Physiol

Gastrointest Liver Physiol 2013;304:G501-15.

- 100 -

Rojek AM, Skowronski MT, Füchtbauer EM, Füchtbauer AC, Fenton RA, Agre P,

Frøkiaer J, Nielsen S. Defective glycerol metabolism in aquaporin 9 (AQP9) knockout

mice. Proc Natl Acad Sci USA 2007;104:3609-14.

Romero F, Nicolau J, Flores L, Casamitjana R, Ibarzabal A, Lacy A, Vidal J. Comparable early changes in gastrointestinal hormones after sleeve gastrectomy and

Roux-En-Y gastric bypass surgery for morbidly obese type 2 diabetic subjects. Surg

Endosc 2012;26:2231-9.

Rosen ED, Walkey CJ, Puigserver P, Spiegelman BM. Transcriptional regulation of

adipogenesis. Genes Dev 2000;14:1293-307.

Ross R, Bradshaw AJ. The future of obesity reduction: beyond weight loss. Nat Rev

Endocrinol 2009;5:319-25.

Roudier N, Ripoche P, Gane P, Le Pennec PY, Daniels G, Cartron JP, Bailly P. AQP3 deficiency in humans and the molecular basis of a novel blood group system, GIL. J

Biol Chem 2002;277:45854-9.

Rubino F, Gagner M, Gentileschi P, Kini S, Fukuyama S, Feng J, Diamond E. The early

effect of the Roux-en-Y gastric bypass on hormones involved in body weight regulation

and glucose metabolism. Ann Surg 2004;240:236-42.

Rubino F, Forgione A, Cummings DE, Vix M, Gnuli D, Mingrone G, Castagneto M,

Marescaux J. The mechanism of diabetes control after gastrointestinal bypass surgery

reveals a role of the proximal small intestine in the pathophysiology of type 2 diabetes. Ann Surg 2006;244:741-9.

Rubino F, Nathan DM, Eckel RH, Schauer PR, Alberti KG, Zimmet PZ, Del Prato S, Ji

L, Sadikot SM, Herman WH, Amiel SA, Kaplan LM, Taroncher-Oldenburg G,

Cummings DE, Delegates of the 2nd Diabetes Surgery S. Metabolic Surgery in the

Treatment Algorithm for Type 2 Diabetes: A Joint Statement by International Diabetes

Organizations. Surg Obes Relat Dis 2016;12:1144-62.

Ryan KK, Tremaroli V, Clemmensen C, Kovatcheva-Datchary P, Myronovych A,

Karns R, Wilson-Pérez HE, Sandoval DA, Kohli R, Bäckhed F, Seeley RJ. FXR is a

molecular target for the effects of vertical sleeve gastrectomy. Nature 2014;509:183-8.

Saadoun S, Papadopoulos MC, Hara-Chikuma M, Verkman AS. Impairment of

angiogenesis and cell migration by targeted aquaporin-1 gene disruption. Nature

2005;434:786-92.

Saeidi N, Meoli L, Nestoridi E, Gupta NK, Kvas S, Kucharczyk J, Bonab AA,

Fischman AJ, Yarmush ML, Stylopoulos N. Reprogramming of intestinal glucose

metabolism and glycemic control in rats after gastric bypass. Science 2013;341:406-10.

Saito M, Okamatsu-Ogura Y, Matsushita M, Watanabe K, Yoneshiro T, Nio-Kobayashi

J, Iwanaga T, Miyagawa M, Kameya T, Nakada K, Kawai Y, Tsujisaki M. High incidence of metabolically active brown adipose tissue in healthy adult humans: effects

of cold exposure and adiposity. Diabetes 2009;58:1526-31.

Salehi M, Prigeon RL, D'Alessio DA. Gastric bypass surgery enhances glucagon-like

peptide 1-stimulated postprandial insulin secretion in humans. Diabetes 2011;60:2308-

14.

Sandoval DA, Bagnol D, Woods SC, D'Alessio DA, Seeley RJ. Arcuate glucagon-like

peptide 1 receptors regulate glucose homeostasis but not food intake. Diabetes

2008;57:2046-54.

- 101 -

Sangiao-Alvarellos S, Vázquez MJ, Varela L, Nogueiras R, Saha AK, Cordido F, López

M, Diéguez C. Central ghrelin regulates peripheral lipid metabolism in a growth

hormone-independent fashion. Endocrinology 2009;150:4562-74.

Sayin SI, Wahlstrom A, Felin J, Jantti S, Marschall HU, Bamberg K, Angelin B, Hyötyläinen T, Oreŝič M, Bäckhed F. Gut microbiota regulates bile acid metabolism by

reducing the levels of tauro-beta-muricholic acid, a naturally occurring FXR antagonist.

Cell Metab 2013;17:225-35.

Scott WR, Batterham RL. Roux-en-Y gastric bypass and laparoscopic sleeve

gastrectomy: understanding weight loss and improvements in type 2 diabetes after

bariatric surgery. Am J Physiol Regul Integr Comp Physiol 2011;301:R15-27.

Scully T. Public health: Society at large. Nature 2014;508:S50-1.

Schauer PR, Burguera B, Ikramuddin S, Cottam D, Gourash W, Hamad G, Eid GM, Mattar S, Ramanathan R, Barinas-Mitchel E, Rao RH, Kuller L, Kelley D. Effect of

laparoscopic Roux-en Y gastric bypass on type 2 diabetes mellitus. Ann Surg

2003;238:467-84; discussion 84-5.

Schauer PR, Kashyap SR, Wolski K, Brethauer SA, Kirwan JP, Pothier CE, Thomas S,

Abood B, Nissen SE, Bhatt DL. Bariatric surgery versus intensive medical therapy in

obese patients with diabetes. N Engl J Med 2012;366:1567-76.

Schauer PR, Bhatt DL, Kirwan JP, Wolski K, Brethauer SA, Navaneethan SD, Aminian

A, Pothier CE, Kim ES, Nissen SE, Kashyap SR, Investigators S. Bariatric surgery versus intensive medical therapy for diabetes-3-year outcomes. N Engl J Med

2014;370:2002-13.

Seo S, Ju S, Chung H, Lee D, Park S. Acute effects of glucagon-like peptide-1 on

hypothalamic neuropeptide and AMP activated kinase expression in fasted rats. Endocr

J 2008;55:867-74.

Shapiro H, Pecht T, Shaco-Levy R, Harman-Boehm I, Kirshtein B, Kuperman Y, Chen

A, Blüher M, Shai I, Rudich A. Adipose tissue foam cells are present in human obesity.

J Clin Endocrinol Metab 2013;98:1173-81.

Shen FX, Gu X, Pan W, Li WP, Li W, Ye J, Yang LJ, Gu XJ, Ni LS. Over-expression of AQP7 contributes to improve insulin resistance in adipocytes. Exp Cell Res

2012;318:2377-84.

Shiels A, Bassnett S, Varadaraj K, Mathias R, Al-Ghoul K, Kuszak J, Donoviel D,

Lilleberg S, Friedrich G, Zambrowicz B. Optical dysfunction of the crystalline lens in

aquaporin-0-deficient mice. Physiol Genomics 2001;7:179-86.

Shimizu I, Hirota M, Ohboshi C, Shima K. Identification and localization of glucagon-

like peptide-1 and its receptor in rat brain. Endocrinology 1987;121:1076-82.

Sjöstrom L, Peltonen M, Jacobson P, Ahlin S, Andersson-Assarsson J, Anveden A, Bouchard C, Carlsson B, Karason K, Lönroth H, Näslund I, Sjöstrom E, Taube M,

Wedel H, Svensson PA, Sjöholm K, Carlsson LM. Association of bariatric surgery with

long-term remission of type 2 diabetes and with microvascular and macrovascular

complications. JAMA 2014;311:2297-304.

Sjöström L, Lindroos AK, Peltonen M, Torgerson J, Bouchard C, Carlsson B, Dahlgren

S, Larsson B, Narbro K, Sjöström CD, Sullivan M, Wedel H, Swedish Obese Subjects

Study Scientific G. Lifestyle, diabetes, and cardiovascular risk factors 10 years after

bariatric surgery. N Engl J Med 2004;351:2683-93.

- 102 -

Sjöström L, Narbro K, Sjöström CD, Karason K, Larsson B, Wedel H, Lystig T,

Sullivan M, Bouchard C, Carlsson B, Bengtsson C, Dahlgren S, Gummesson A,

Jacobson P, Karlsson J, Lindroos AK, Lönroth H, Näslund I, Olbers T, Stenlöf K,

Torgerson J, Agren G, Carlsson LM, Swedish Obese Subjects S. Effects of bariatric

surgery on mortality in Swedish obese subjects. N Engl J Med 2007;357:741-52.

Sjöström L. Bariatric surgery and reduction in morbidity and mortality: experiences

from the SOS study. Int J Obes 2008;32 Suppl 7:S93-7.

Sjöström L, Peltonen M, Jacobson P, Sjöström CD, Karason K, Wedel H, Ahlin S,

Anveden A, Bengtsson C, Bergmark G, Bouchard C, Carlsson B, Dahlgren S, Karlsson

J, Lindroos AK, Lönroth H, Narbro K, Näslund I, Olbers T, Svensson PA, Carlsson

LM. Bariatric surgery and long-term cardiovascular events. JAMA 2012;307:56-65.

Sjöström L. Review of the key results from the Swedish Obese Subjects (SOS) trial - a

prospective controlled intervention study of bariatric surgery. J Intern Med 2013;273:219-34.

Skelly RH, Wicksteed B, Antinozzi PA, Rhodes CJ. Glycerol-stimulated proinsulin

biosynthesis in isolated pancreatic rat islets via adenoviral-induced expression of

glycerol kinase is mediated via mitochondrial metabolism. Diabetes 2001;50:1791-8.

Sloth B, Holst JJ, Flint A, Gregersen NT, Astrup A. Effects of PYY1-36 and PYY3-36

on appetite, energy intake, energy expenditure, glucose and fat metabolism in obese and

lean subjects. Am J Physiol Endocrinol Metab 2007;292:E1062-8.

Smits MM, van Geenen EJ. The clinical significance of pancreatic steatosis. Nat Rev Gastroenterol Hepatol 2011;8:169-77.

Sohara E, Rai T, Miyazaki J, Verkman AS, Sasaki S, Uchida S. Defective water and

glycerol transport in the proximal tubules of AQP7 knockout mice. Am J Physiol Renal

Physiol 2005;289:F1195-200.

Soria LR, Fanelli E, Altamura N, Svelto M, Marinelli RA, Calamita G. Aquaporin-8-

facilitated mitochondrial ammonia transport. Biochem Biophys Res Commun

2010;393:217-21.

Spalding KL, Arner E, Westermark PO, Bernard S, Buchholz BA, Bergmann O, Blomqvist L, Hoffstedt J, Näslund E, Britton T, Concha H, Hassan M, Rydén M, Frisén

J, Arner P. Dynamics of fat cell turnover in humans. Nature 2008;453:783-7.

Stefater MA, Pérez-Tilve D, Chambers AP, Wilson-Pérez HE, Sandoval DA, Berger J,

Toure M, Tschöp M, Woods SC, Seeley RJ. Sleeve gastrectomy induces loss of weight

and fat mass in obese rats, but does not affect leptin sensitivity. Gastroenterology

2010;138:2426-36, 36 e1-3.

Steinert RE, Peterli R, Keller S, Meyer-Gerspach AC, Drewe J, Peters T, Beglinger C.

Bile acids and gut peptide secretion after bariatric surgery: a 1-year prospective randomized pilot trial. Obesity 2013;21:E660-8.

Strader AD, Vahl TP, Jandacek RJ, Woods SC, D'Alessio DA, Seeley RJ. Weight loss

through ileal transposition is accompanied by increased ileal hormone secretion and

synthesis in rats. Am J Physiol Endocrinol Metab 2005;288:E447-53.

Stratopoulos C, Papakonstantinou A, Terzis I, Spiliadi C, Dimitriades G, Komesidou V,

Kitsanta P, Argyrakos T, Hadjiyannakis E. Changes in liver histology accompanying

massive weight loss after gastroplasty for morbid obesity. Obes Surg 2005;15:1154-60.

- 103 -

Sun K, Tordjman J, Clément K, Scherer PE. Fibrosis and adipose tissue dysfunction.

Cell Metab 2013;18:470-7.

Tack J, Deloose E. Complications of bariatric surgery: dumping syndrome, reflux and

vitamin deficiencies. Best Pract Res Clin Gastroenterol 2014;28:741-9.

Taitano AA, Markow M, Finan JE, Wheeler DE, Gonzalvo JP, Murr MM. Bariatric

surgery improves histological features of nonalcoholic fatty liver disease and liver

fibrosis. J Gastrointest Surg 2015;19:429-36; discussion 36-7.

Talebpour M, Amoli BS. Laparoscopic total gastric vertical plication in morbid obesity.

J Laparoendosc Adv Surg Tech A 2007;17:793-8.

Talebpour M, Motamedi SM, Talebpour A, Vahidi H. Twelve year experience of

laparoscopic gastric plication in morbid obesity: development of the technique and

patient outcomes. Ann Surg Innov Res 2012;6:7.

Talebpour M, Talebpour A, Barzin G, Shariat Moharari R, Khajavi MR. Effects of

laparoscopic gastric plication (LGP) in patients with type 2 diabetes, one year follow-

up. J Diabetes Metab Disord 2015;14:60.

Tardelli M, Moreno-Viedma V, Zeyda M, Itariu BK, Langer FB, Prager G, Stulnig TM.

Adiponectin regulates aquaglyceroporin expression in hepatic stellate cells altering their

functional state. J Gastroenterol Hepatol 2017;32:253-60.

Tchekneva EE, Khuchua Z, Davis LS, Kadkina V, Dunn SR, Bachman S, Ishibashi K,

Rinchik EM, Harris RC, Dikov MM, Breyer MD. Single amino acid substitution in aquaporin 11 causes renal failure. J Am Soc Nephrol 2008;19:1955-64.

Tontonoz P, Kim JB, Graves RA, Spiegelman BM. ADD1: a novel helix-loop-helix

transcription factor associated with adipocyte determination and differentiation. Mol

Cell Biol 1993;13:4753-9.

Toplak H, Woodward E, Yumuk V, Oppert JM, Halford JC, Frühbeck G. 2014 EASO

Position Statement on the Use of Anti-Obesity Drugs. Obes Facts 2015;8:166-74.

Toshinai K, Date Y, Murakami N, Shimada M, Mondal MS, Shimbara T, Guan JL,

Wang QP, Funahashi H, Sakurai T, Shioda S, Matsukura S, Kangawa K, Nakazato M. Ghrelin-induced food intake is mediated via the orexin pathway. Endocrinology

2003;144:1506-12.

Troy S, Soty M, Ribeiro L, Laval L, Migrenne S, Fioramonti X, Pillot B, Fauveau V,

Aubert R, Viollet B, Foretz M, Leclerc J, Duchampt A, Zitoun C, Thorens B, Magnan

C, Mithieux G, Andreelli F. Intestinal gluconeogenesis is a key factor for early

metabolic changes after gastric bypass but not after gastric lap-band in mice. Cell Metab

2008;8:201-11.

Tschöp M, Smiley DL, Heiman ML. Ghrelin induces adiposity in rodents. Nature 2000;407:908-13.

Tsukaguchi H, Shayakul C, Berger UV, Mackenzie B, Devidas S, Guggino WB, van

Hoek AN, Hediger MA. Molecular characterization of a broad selectivity neutral solute

channel. J Biol Chem 1998;273:24737-43.

Turner RC, Cull CA, Frighi V, Holman RR. Glycemic control with diet, sulfonylurea,

metformin, or insulin in patients with type 2 diabetes mellitus: progressive requirement

for multiple therapies (UKPDS 49). UK Prospective Diabetes Study (UKPDS) Group.

JAMA 1999;281:2005-12.

- 104 -

Uerlich MF, Yumuk V, Finer N, Basdevant A, Visscher TL. Obesity management in

Europe: current status and objectives for the future. Obes Facts 2016;9:273-83.

Unger RH. Lipotoxic diseases. Annu Rev Med 2002;53:319-36.

Utzschneider KM, Kahn SE. Review: The role of insulin resistance in nonalcoholic fatty liver disease. J Clin Endocrinol Metab 2006;91:4753-61.

Valentí V, Martín M, Ramírez B, Gómez-Ambrosi J, Rodríguez A, Catalán V, Becerril

S, Lancha A, Fernández S, Cienfuegos JA, Burrell MA, Frühbeck G. Sleeve

gastrectomy induces weight loss in diet-induced obese rats even if high-fat feeding is

continued. Obes Surg 2011;21:1438-43.

van den Hoek AM, Heijboer AC, Corssmit EP, Voshol PJ, Romijn JA, Havekes LM,

Pijl H. PYY3-36 reinforces insulin action on glucose disposal in mice fed a high-fat

diet. Diabetes 2004;53:1949-52.

van Geenen EJ, Smits MM, Schreuder TC, van der Peet DL, Bloemena E, Mulder CJ.

Nonalcoholic fatty liver disease is related to nonalcoholic fatty pancreas disease.

Pancreas 2010;39:1185-90.

van Raalte DH, van der Zijl NJ, Diamant M. Pancreatic steatosis in humans: cause or

marker of lipotoxicity? Curr Opin Clin Nutr Metab Care 2010;13:478-85.

Verbavatz JM, Brown D, Sabolić I, Valenti G, Ausiello DA, Van Hoek AN, Ma T,

Verkman AS. Tetrameric assembly of CHIP28 water channels in liposomes and cell

membranes: a freeze-fracture study. J Cell Biol 1993;123:605-18.

Verdi D, Prevedello L, Albanese A, Lobba A, Foletto M. Laparoscopic gastric plication

(LGCP) vs sleeve gastrectomy (LSG): a single institution experience. Obes Surg

2015;1653-7.

Verkman AS, Anderson MO, Papadopoulos MC. Aquaporins: important but elusive

drug targets. Nat Rev Drug Discov 2014;13:259-77.

Vidal J, Ibarzabal A, Romero F, Delgado S, Momblán D, Flores L, Lacy A. Type 2

diabetes mellitus and the metabolic syndrome following sleeve gastrectomy in severely

obese subjects. Obes Surg 2008;18:1077-82.

Virreira M, Perret J, Delporte C. Pancreatic beta-cells: Role of glycerol and

aquaglyceroporin 7. Int J Biochem Cell Biol 2011;43:10-3.

Virtanen KA, Lidell ME, Orava J, Heglind M, Westergren R, Niemi T, Taittonen M,

Laine J, Savisto NJ, Enerbäck S, Nuutila P. Functional brown adipose tissue in healthy

adults. N Engl J Med 2009;360:1518-25.

Virtue S, Vidal-Puig A. Adipose tissue expandability, lipotoxicity and the metabolic

syndrome--an allostatic perspective. Biochim Biophys Acta 2010;1801:338-49.

Wajchenberg BL. beta-cell failure in diabetes and preservation by clinical treatment.

Endocr Rev 2007;28:187-218.

Wakayama Y, Hirako S, Ogawa T, Jimi T, Shioda S. Upregulated expression of AQP 7

in the skeletal muscles of obese ob/ob mice. Acta Histochem Cytochem 2014;47:27-33.

Walker CG, Holness MJ, Gibbons GF, Sugden MC. Fasting-induced increases in

aquaporin 7 and adipose triglyceride lipase mRNA expression in adipose tissue are

attenuated by peroxisome proliferator-activated receptor alpha deficiency. Int J Obes

2007;31:1165-71.

- 105 -

Wang Y, Liu J. Sleeve gastrectomy relieves steatohepatitis in high-fat-diet-induced

obese rats. Obes Surg 2009;19:921-5.

Wang Y, Tajkhorshid E. Nitric oxide conduction by the brain aquaporin AQP4.

Proteins 2010;78:661-70.

Weisberg SP, McCann D, Desai M, Rosenbaum M, Leibel RL, Ferrante AW, Jr.

Obesity is associated with macrophage accumulation in adipose tissue. J Clin Invest

2003;112:1796-808.

Wilson-Pérez HE, Chambers AP, Ryan KK, Li B, Sandoval DA, Stoffers D, Drucker

DJ, Pérez-Tilve D, Seeley RJ. Vertical sleeve gastrectomy is effective in two genetic

mouse models of glucagon-like peptide 1 receptor deficiency. Diabetes 2013a;62:2380-

5.

Wilson-Pérez HE, Chambers AP, Sandoval DA, Stefater MA, Woods SC, Benoit SC, Seeley RJ. The effect of vertical sleeve gastrectomy on food choice in rats. Int J Obes

2013b;37:288-95.

Woelnerhanssen B, Peterli R, Steinert RE, Peters T, Borbély Y, Beglinger C. Effects of

postbariatric surgery weight loss on adipokines and metabolic parameters: comparison

of laparoscopic Roux-en-Y gastric bypass and laparoscopic sleeve gastrectomy--a

prospective randomized trial. Surg Obes Relat Dis 2011;7:561-8.

Wren AM, Small CJ, Ward HL, Murphy KG, Dakin CL, Taheri S, Kennedy AR,

Roberts GH, Morgan DG, Ghatei MA, Bloom SR. The novel hypothalamic peptide ghrelin stimulates food intake and growth hormone secretion. Endocrinology

2000;141:4325-8.

Wren AM, Small CJ, Abbott CR, Dhillo WS, Seal LJ, Cohen MA, Batterham RL,

Taheri S, Stanley SA, Ghatei MA, Bloom SR. Ghrelin causes hyperphagia and obesity

in rats. Diabetes 2001;50:2540-7.

Wu D, Molofsky AB, Liang HE, Ricardo-Gonzalez RR, Jouihan HA, Bando JK,

Chawla A, Locksley RM. Eosinophils sustain adipose alternatively activated

macrophages associated with glucose homeostasis. Science 2011;332:243-7.

Wu J, Boström P, Sparks LM, Ye L, Choi JH, Giang AH, Khandekar M, Virtanen KA, Nuutila P, Schaart G, Huang K, Tu H, van Marken Lichtenbelt WD, Hoeks J, Enerbäck

S, Schrauwen P, Spiegelman BM. Beige adipocytes are a distinct type of thermogenic

fat cell in mouse and human. Cell 2012;150:366-76.

Yada T, Damdindorj B, Rita RS, Kurashina T, Ando A, Taguchi M, Koizumi M, Sone

H, Nakata M, Kakei M, Dezaki K. Ghrelin signalling in beta-cells regulates insulin

secretion and blood glucose. Diabetes Obes Metab 2014;16 Suppl 1:111-7.

Yakata K, Hiroaki Y, Ishibashi K, Sohara E, Sasaki S, Mitsuoka K, Fujiyoshi Y.

Aquaporin-11 containing a divergent NPA motif has normal water channel activity. Biochim Biophys Acta 2007;1768:688-93.

Yang B, Song Y, Zhao D, Verkman AS. Phenotype analysis of aquaporin-8 null mice.

Am J Physiol Cell Physiol 2005;288:C1161-70.

Yang J, Brown MS, Liang G, Grishin NV, Goldstein JL. Identification of the

acyltransferase that octanoylates ghrelin, an appetite-stimulating peptide hormone. Cell

2008;132:387-96.

- 106 -

Yasui H, Kubota M, Iguchi K, Usui S, Kiho T, Hirano K. Membrane trafficking of

aquaporin 3 induced by epinephrine. Biochem Biophys Res Commun 2008;373:613-7.

Yasui M, Hazama A, Kwon TH, Nielsen S, Guggino WB, Agre P. Rapid gating and

anion permeability of an intracellular aquaporin. Nature 1999;402:184-7.

Yusuf S, Hawken S, Ounpuu S, Bautista L, Franzosi MG, Commerford P, Lang CC,

Rumboldt Z, Onen CL, Lisheng L, Tanomsup S, Wangai P, Jr., Razak F, Sharma AM,

Anand SS, Investigators IS. Obesity and the risk of myocardial infarction in 27,000

participants from 52 countries: a case-control study. Lancet 2005;366:1640-9.

Zhang J, Zhao Y, Xu C, Hong Y, Lu H, Wu J, Chen Y. Association between serum free

fatty acid levels and nonalcoholic fatty liver disease: a cross-sectional study. Sci Rep

2014;4:5832.

Zhang Y, Proenca R, Maffei M, Barone M, Leopold L, Friedman JM. Positional cloning of the mouse obese gene and its human homologue. Nature 1994;372:425-32.

Zhu J, Gupta R, Safwa M. The Mechanism of metabolic surgery: gastric center

hypothesis. Obes Surg 2016;26:1639-41.

- 109 -

1. Regulation of adipocyte lipolysis

Article

Frühbeck G, Méndez-Giménez L, Fernández-Formoso JA, Fernández S, Rodríguez A.

Regulation of adipocyte lipolysis.

Nutr Res Rev 2014;27(1):63-93.

Main objective

Overview of the control of adipocyte lipolysis by classic and novel factors

together with analysis of the molecular mechanisms underlying this catabolic process as

well as its involvement in the onset of obesity-associated diseases.

Specific objectives

To review the control of lipolysis by classic factors, such as catecholamines,

insulin, cytokines and other hormones, including ghrelin or the

endocannabinoid system.

To identify the influence of the subcellular compartmentalization of lipases.

To outline the relevance of lipid droplet proteins and lipid-binding proteins.

To characterize the changes in adipocyte lipolysis in human obesity and their

metabolic impact.

Regulation of adipocyte lipolysis

Gema Fruhbeck1,2,3*, Leire Mendez-Gimenez1,2, Jose-Antonio Fernandez-Formoso2,Secundino Fernandez2,4 and Amaia Rodrıguez1,2

1Metabolic Research Laboratory, Clınica Universidad de Navarra, Pamplona, Spain2CIBER Fisiopatologıa de la Obesidad y Nutricion (CIBERobn), ISCIII, Spain3Department of Endocrinology and Nutrition, Clınica Universidad de Navarra, Pamplona, Spain4Department of Otorhinolaryngology, Clınica Universidad de Navarra, Pamplona, Spain

Abstract

In adipocytes the hydrolysis of TAG to produce fatty acids and glycerol under fasting conditions or times of elevated energy demands is

tightly regulated by neuroendocrine signals, resulting in the activation of lipolytic enzymes. Among the classic regulators of lipolysis,

adrenergic stimulation and the insulin-mediated control of lipid mobilisation are the best known. Initially, hormone-sensitive lipase

(HSL) was thought to be the rate-limiting enzyme of the first lipolytic step, while we now know that adipocyte TAG lipase is the key

enzyme for lipolysis initiation. Pivotal, previously unsuspected components have also been identified at the protective interface of the

lipid droplet surface and in the signalling pathways that control lipolysis. Perilipin, comparative gene identification-58 (CGI-58) and

other proteins of the lipid droplet surface are currently known to be key regulators of the lipolytic machinery, protecting or exposing

the TAG core of the droplet to lipases. The neuroendocrine control of lipolysis is prototypically exerted by catecholaminergic stimulation

and insulin-induced suppression, both of which affect cyclic AMP levels and hence the protein kinase A-mediated phosphorylation of HSL

and perilipin. Interestingly, in recent decades adipose tissue has been shown to secrete a large number of adipokines, which exert direct

effects on lipolysis, while adipocytes reportedly express a wide range of receptors for signals involved in lipid mobilisation. Recently recog-

nised mediators of lipolysis include some adipokines, structural membrane proteins, atrial natriuretic peptides, AMP-activated protein

kinase and mitogen-activated protein kinase. Lipolysis needs to be reanalysed from the broader perspective of its specific physiological

or pathological context since basal or stimulated lipolytic rates occur under diverse conditions and by different mechanisms.

Key words: Catecholamines: Insulin: Hormone-sensitive lipase: Adipocyte TAG lipase: Perilipin: Adipokines: Lipid mobilisation

Introduction

Under normal conditions, the adipose tissue is able to fine-

tune a series of neuroendocrine signals to precisely adapt

the balance between TAG synthesis (lipogenesis) and

breakdown (lipolysis) to meet physiological needs. In

higher eukaryotes adipocyte TAG depots represent the

major energy reserve of the organism as a result of the

constant flux between lipolysis and re-esterification(1–5).

During energy surplus adipocytes accomodate the excess

fuel as TAG for retrieval during periods of negative

energy balance such as fasting, starvation or long-term

exercise. The hydrolysis of TAG produces NEFA and

glycerol that are released into the vasculature for use as

energy substrates by other organs. Since TAG are not

able to pass through biological membranes they need to

be cleaved by TAG hydrolases, also termed lipases,

before entering or exiting cells(6,7). The ability to rapidly

mobilise lipid reserves as NEFA to subvene energy

demands represents a highly adapted metabolic response.

In addition, the balance between the lipogenic drive and

the lipolytic rate prevents an exaggerated elevation of

plasma NEFA, which is considered a key aetiological

factor in the development of insulin resistance(8,9). Thus,

the fat-storing ability of adipocytes prevents the appear-

ance of lipotoxicity (lipid-induced dysfunction) and lipo-

apoptosis (lipid-induced programmed cell death) in other

* Corresponding author: Dr Gema Fruhbeck, fax þ34 948 29 65 00, email [email protected]

Abbreviations: ACSL1, long-chain acyl-CoA synthetase 1; AMPK, AMP-activated protein kinase; AQP, aquaporin; ATGL, adipocyte TAG lipase; cAMP, cyclic

AMP; CB, cannabinoid receptor; CD36, fatty acid translocase; CGI-58, comparative gene identification-58; Cide, cell death-inducing DFFA (DNA

fragmentation factor-a)-like effector; COPI, coat protein complex I; DAG, diacylglyerol; ERK, extracellular signal-related kinase; FABP4, fatty acid-

binding protein 4; FATP, fatty acid transport protein; G0S2, G0/G1 switch gene 2; GH, growth hormone; Gi, G-inhibitory protein; GLP-1, glucagon-like

peptide-1; HSL, hormone-sensitive lipase; IRS, insulin receptor substrate; LC3, light chain 3; LPL, lipoprotein lipase; MAP, mitogen-activated protein;

MGL, monoacylglycerol lipase; mTOR, mammalian target of rapamycin; PDE-3B, phosphodiesterase-3B; PI3K, phosphatidyl inositol 3-kinase; PKA,

protein kinase A; PTH, parathyroid hormone; RNAi, RNA interference; ZAG, Zn-a2-glycoprotein.

Nutrition Research Reviews (2014), 27, 63–93 doi:10.1017/S095442241400002Xq The Author 2014

Nut

ritio

n R

esea

rch

Rev

iew

s

tissues (especially skeletal muscle and liver)(10–12). While

the metabolic importance of lipolysis remains unchanged,

established models of adipose tissue lipolysis have under-

gone substantial revision lately. Notably, adipocyte lipid

droplets are now considered dynamic organelles critical

for the handling of lipid stores, containing specific struc-

tural proteins and lipid-metabolising enzymes involved in

the modulation of both basal and hormone-regulated lipo-

lysis(13–17). Current knowledge in this field is reviewed

from the broader perspective of providing an overview

of the classic lipolytic factors as well as by focusing on

the recently identified influence of the subcellular compart-

mentalisation of lipases, the relevance of lipid droplet pro-

teins and lipid-binding proteins, as well as the activation

of the different signalling pathways together with their

regulation.

Control of lipolysis

Lipolysis constitutes the catabolic process leading to the

breakdown of TAG into glycerol and NEFA in the adipose

tissue(2). Basal lipolytic activity of adipocytes is conditioned

by sex, age, physical activity, fat depot location, species

and genetic variance, whereas stimulated adipocyte

lipolysis is regulated by multiple factors, which are

depicted in Fig. 1 (18,19). Interestingly, fat cell lipolysis

exhibits species-unique characteristics based on the predo-

minance of specific receptors and their relative density and

expression(20,21). A decreased lipolytic rate is observed

both in the early years of life and the elderly in relation

to the action of catecholamines and insulin(22–25). For the

same BMI, women exhibit higher NEFA circulating concen-

trations than men due to their constitutively larger

fat depots and subcutaneous adipocytes(26). Regional

differences in the sensitivity to catecholamine-stimulated

and insulin-inhibited lipolysis further underlie these sex-

specific characteristics, which will be described more

extensively below. An increased basal lipolysis together

with an enhanced lipolytic sensitivity to catecholamines

take place during situations of negative energy balance

such as fasting, starvation or semi-starvation, contributing

to the increased mobilisation of NEFA from adipocytes

and the subsequent fat mass loss when maintained over

time(2). As in situations of energy deprivation, during

prolonged exercise plasma NEFA increase in response to

the elevated release of catecholamines and decreased

production of insulin(27). Both short- and long-term

endurance training make adipocytes more sensitive to

catecholamine stimulation via adrenoceptor signal trans-

duction changes(28–31).

Some dietary compounds also have the capacity to exert

a direct impact on lipolysis regulation. The well-known

lipolytic effect of caffeine and other methylxanthines

occurs by elevating the cyclic AMP (cAMP) intracellular

levels by two mechanisms. On the one hand, this is through

A1-adenosine receptor antagonism, leading to a reduction

of adenylyl cyclase activity and subsequent increased lipoly-

sis. On the other hand, methylxanthines further prevent

the breakdown of cAMP by inhibiting phosphodiesterase

activity(3). Thus, coffee consumption increases lipid turnover

and raises plasma NEFA, while a high intake of methylxan-

thines may also contribute to weight loss and maintenance

through an enhanced fat oxidation and thermogenesis(32,33).

Another dietary compound influencing adipocyte lipolysis is

Ca, with high intakes being associated with decreased

adiposity and a reduced risk of obesity in diverse epidemio-

logical studies(3). Ca supplementation reportedly favours

weight loss in both obese mice and human subjects

undergoing energy-restricted diets, stimulating lipolysis via

inhibition of the secretion of parathyroid hormone

(PTH)(34) and the subsequent activation of 25-hydroxychole-

calciferol to 1,25-dihydroxycalciferol(35–38). While acute

ethanol intake exerts an anti-lipolytic effect, chronic

ethanol consumption suppresses the b-adrenergic recep-

tor-mediated lipolytic action via an increased activation

of phosphodiesterase, resulting in a decreased protein

kinase A (PKA) stimulation and a diminished activating

phosphorylation of perilipin-1 and hormone-sensitive

lipase (HSL)(39).

Genetic variance also plays a role in determining

lipolytic rate(5,18,40). Variations in adrenoceptors have

been intensely analysed for their putative functional effects

on lipolysis and association with the development of

obesity. The most studied are the polymorphisms in

codon 64 of the b3-adrenergic receptor and in codons 16,

27 and 164 of the b2-adrenoceptor. The Trp64Arg missense

mutation of the b3-adrenergic receptor gene was

reportedly associated with decreased lipolysis induced by

b3-adrenoceptor agonists(41). However, other studies have

failed to show any phenotypic effect of this polymorphism,

so its true pathophysiological contribution to fat metab-

olism and energy homeostasis in humans remains contro-

versial(18). Noteworthy, variations in non-coding regions

of calpain 10 lead to a decreased b3-adrenergic receptor

Species

SNS

Natriuretic peptides

NutritionAge

Sex

Location

Genetic variance

Hormones

Paracrine–autocrine factors

Pathology

Physicalactivity

Fig. 1. Main factors influencing adipocyte lipolysis. SNS, sympathetic

nervous system; WAT, white adipose tissue. (A colour version of this figure

can be found online at http://www.journals.cambridge.org/nrr)

G. Fruhbeck et al.64

Nut

ritio

n R

esea

rch

Rev

iew

s

function. In the b2-adrenergic receptor gene the Arg16Gly

mutation has been shown to be associated with altered

b2-adrenergic receptor function, with carriers of this

mutation showing a five-fold increased agonist sensi-

tivity(18). The Gln27Glu substitution was found to be

twice as common in obese than in non-obese subjects in

some populations, with homozygotes exhibiting an aver-

age excess fat mass of 20 kg and about 50 % larger fat

cells(42). On the contrary, the rare Thr164Ile substitution

in the b2-adrenergic receptor gene has not been consist-

ently observed in obese individuals. Polymorphisms in

the G-b3 gene, encoding for a specific G-coupling protein

that links a- as well as b-adrenergic receptors to adenylate

cyclase, alter catecholamine-induced lipolysis in human fat

cells, improving the lipolytic function of b-adrenoceptors

at the same time as enhancing the anti-lipolytic activity of

a2-adrenoceptors. Furthermore, variations in intronic

dinucleotide repeats of the HSL gene are accompanied

by a decreased function of the lipase with a reduced

lipolytic effect of catecholamines(43,44).

Classic factors

In humans the main elements controlling lipolysis are the

activity of the autonomic nervous system and the endocrine

influence derived from the release of insulin(2,18,45). Adipose

tissue is richly innervated by both the sympathetic and para-

sympathetic nervous systems with nerve terminals running

along blood vessels and a certain number of adipocytes in

direct contact with nerve varicosities. Thus, electrical stimu-

lationof sympathetic nervous systemnerve endings results in

an increase in lipolytic activity, while surgical sympathec-

tomy reportedly reduces lipolysis in the denervated adipose

depot(46–49). Although the parasympathetic nervous system

has been shown to also innervate white adipose tissue and

decrease lipolysis, stimulating an increase in insulin sensi-

tivity(50,51), its true functional role has been subsequently

questioned(52).

Catecholamine-induced regulation. Catecholamines,

adrenaline and noradrenaline, exert their impact on lipolysis

upon binding to the diverse adrenergic receptor subtypes

located on the plasma membrane of adipocytes(2,45,53).

These receptors are linked to G-proteins, with G-protein

receptor complexes regulating adenylate cyclase in the cell

membrane. In mammals at least four adrenoceptors exert

their action with marked species characteristics(4). In

humans b1- and b2-adrenoceptors are the most active

lipolytic elements, while the contribution of b3-adrenergic

receptors remains to be better established. The presence of

b3-adrenoceptors in human white adipocytes has been

clearly proven with tissue and subcellular distribution as

well as response to stimulators being consistent with

participation in lipolysis(54). However, the failure of

b3-adrenoceptor agonists to elicit clear-cut lipolytic and

weight-loss effects in obese patients casted doubts on

the true physiological relevance of this b-adrenoceptor

subtype in humans(55,56). Contrarily, b3-adrenoceptors are

abundantly expressed in adipocytes of rodents(57). Upon

binding to their ligand, b-adrenergic receptors initiate the

activation of the lipolytic cascade through the stimulation

of cAMP production and subsequent activation of the

cAMP-dependent PKA, which is followed by the phos-

phorylation of perilipin and HSL, ultimately leading to lipo-

lysis stimulation (Fig. 2). Another peculiarity of human

adipocytes resides in the presence of abundant a2-adreno-

ceptors, which are coupled to G-inhibitory proteins (Gi),

thereby inhibiting cAMP production and, thus, lipoly-

sis(58,59). Therefore, the balance between the lipolytic effect

of b-adrenergic receptors and the opposing anti-lipolytic

activity ofa2-adrenoceptors alsodetermines thenet outcome

of catecholamine-induced fat mobilisation in humans. The

identification of brown adipose tissue in human adults

beyond the vestigial amounts originally acknowledged and

its association with BMI and adiposity has triggered a

re-focusing of attention to the true relevance of b3-adreno-

ceptors in lipid metabolism and energy homeostasis(60,61).

Hormone-mediated control. A number of hormones

are known to participate in the regulation of lipolysis.

Among all endocrine factors, insulin is quantitatively and

qualitatively the most relevant one. The impact of growth

hormone (GH), adrenocorticotropic hormone, cortisol,

thyroid hormones, PTH and glucagon is comparatively

much more reduced than that of insulin. The mechanisms

of action of all are briefly discussed below.

Hormone-mediated control: insulin. Insulin is a key

regulator of white adipose tissue biology, controlling not

only lipogenesis but also the rate of lipolysis and NEFA

efflux. Insulin regulates glucose uptake by adipocytes

and triggers fatty acid transport protein translocation as

well as fatty acid uptake by fat cells(62). Binding of insulin

to its specific cell-surface receptor produces tyrosine phos-

phorylation and activation of the insulin receptor, which

leads to the interaction with the insulin receptor substrates

(IRS-1 and IRS-2), in turn activating the phosphatidyl inosi-

tol 3-kinase (PI3K) complex(2). Insulin powerfully inhibits

basal and catecholamine-induced lipolysis through

phosphorylation (via a PKB/Akt-dependent action) and

activation of phosphodiesterase-3B (PDE-3B). The

phosphodiesterase catalyses the breakdown of cAMP to

its inactive form, thereby decreasing cAMP levels, which

in turn reduces PKA activation and, therefore, also

translates into preventing HSL stimulation. Insulin may

also suppress lipolysis through phosphorylation of the

regulatory subunit of protein phosphatase-1 (PP-1),

which once activated rapidly dephosphorylates and

deactivates HSL, thus decreasing the lipolytic rate(63). The

anti-lipolytic effect of insulin is observed already minutes

upon binding of the hormone to its receptors.

Hormone-mediated control: growth hormone. While

insulin repesents the primary anabolic hormone exerting

the main influence periprandially, GH operates directly

and through stimulation of insulin growth factor-1, insulin

Adipocyte lipolysis control 65

Nut

ritio

n R

esea

rch

Rev

iew

s

and NEFA during stress and fasting(64). Thus, GH

represents a less potent though critically important

regulator of lipolysis, which influences body composition,

stimulating muscle mass accretion at the same time as

reducing adiposity by a direct lipolytic effect using cAMP-

and PKA-dependent pathways. GH-deficient individuals

can experience up to a 40 % reduction in plasma NEFA

and lipolysis that are returned to normal values by GH

replacement therapy. Interestingly, GH activates adenylyl

cyclase by selectively shifting the Gia2 subunit and

removing cAMP production inhibition(65). Exogenous GH

administration produces an increase in NEFA after 2–3 h,

thus reflecting a delayed lipolytic effect when compared

with that of catecholamines. In this context, small physio-

logical GH pulses reportedly increase interstitial glycerol

levels in abdominal and femoral fat(66). In addition,

suppression of the normal nocturnal rise in GH is followed

by a reduction in subsequent lipolysis in subcutaneous adi-

pose tissue(67). Endogenous GH has been shown to play a

limited metabolic role during the daily fed–fast cycle,

whereas it is essential for the increased lipolytic rate

observed with more prolonged fasting(68). Recently, adipo-

cyte-specific disruption of JAK2 (JAK2A) in mice has been

shown to result in GH resistance in adipocytes, with

reduced lipolysis and increased body fat, thereby offering

complementary mechanistic insights into the well-

recognised effects of GH on lipid flux(69).

Hormone-mediated control: other hormones. Cortisol

also exerts a lipolytic effect, which is less potent than

that of catecholamines at the same time as being delayed

(minutes in the case of adrenaline v. hours for

cortisol)(62,70). Importantly, the in vivo lipolysis stimulation

is counteracted by the corticoid-induced insulin

release(71,72), whereby the net outcome of a short-term

treatment with a standard dose of corticosteroids is an

increase in abdominal adipose tissue lipolysis, without

changes in GH concentrations, hyperglucagonaemia and

insulin resistance. While a stimulation of lipolysis in

human adipose tissue has been also ascribed to

PTH(20,73), it has also been suggested that a PTH excess

NEFA Natriuretic peptide receptors

NPR-CNPR-A

PKG

CGI-58

cGMP

cAMPPKA

NO

Leptinreceptor

A1Rα2-AR

CL receptor

ADRP

Lipid droplet

NOS

HSL

TIP47

Adreno-medullin

RAMP2

FABP4AMPK

PKB p42/44

PI3K IRS-1

Other lipolytic factors:Growth hormone

IL-15, IL-1βZAG

PEDF

Anti-lipolytic agents (inhibitory receptors):α2-Agonists (α2-AR)

Adenosine (A1R)PGE (EP-3R)

NPY, peptide YY (NPY-R1)Nicotinic acid

Nucleus

Glycerol

AQP7

ATGL

Perilipin 1 Perilipin 1

JNK

Gi

Gi

Gi

AC

Gs

PDE3B

FSP27

CIDEA

Glycerol

GC

IL-6 receptor

Insulin receptor

TNF-α-R

β1,2,3-AR

Fig. 2. Principal regulators and major pathways involved in adipocyte lipolysis. A1R, A1 adenosine receptor; AC, adenylyl cyclase; ADRP, adipophilin/adipocyte

differentiation-related protein; AMPK, AMP-activated protein kinase; AQP7, aquaporin 7; AR, adrenoreceptor; ATGL, adipocyte TAG lipase; cAMP, cyclic AMP;

CGI-58, comparative gene identification-58; cGMP, cyclic GMP; CIDEA, cell death-inducing DFFA (DNA fragmentation factor-a)-like effector A; CL, calcitonin recep-

tor-like; EP-3R, PGE receptor 3; FABP4, fatty acid binding protein 4; FSP27, fat-specific protein 27; GC, guanylyl cyclase; Gi, inhibitory GTP-binding proteins; Gs,

stimulatory GTP-binding proteins; HSL, hormone-sensitive lipase; IRS-1, insulin receptor substrate-1; JNK, Jun kinase; NOS, NO synthase; NPR, natriuretic peptide

receptor; NPY, neuropeptide Y; NPY-R1, neuropeptide Y receptor 1; PDE3B, phosphodiesterase 3B; PEDF, pigment epithelium-derived factor; PI3K, phospatidyli-

nositol-3 kinase; PKA, protein kinase A; PKB, protein kinase B; PKG, protein kinase G; RAMP2, receptor activity modifying protein-2; TIP47, tail-interacting protein

of 47 kDa; TNF-a-R, TNF-a receptor; ZAG, zinc-a2-glycoprotein. (A colour version of this figure can be found online at http://www.journals.cambridge.org/nrr)


Nut

ritio

n R

esea

rch

Rev

iew

s

may promote weight gain by impeding catecholamine-

induced lipolysis(34). Whereas in rodents testosterone

up-regulates catecholamine-induced lipolysis(74), in

humans testosterone in physiological concentrations

causes a depot-specific reduction of catecholamine-

stimulated lipolysis in subcutaneous fat cells, probably

due to reduced protein expression of b2-adrenoceptors

and HSL(75–77). The relevance of androgen signalling in

lipolysis regulation became evident from the observation

that late-onset obesity development in androgen recep-

tor-null male mice was caused in part by a decreased

lipolytic activity(78). The direct molecular mechanism

accounting for the hypertrophic adipocytes and expanded

white adipose tissue of these mice depends on an altered

lipid homeostasis characterised by a decreased lipolysis

but not an increased lipogenesis. Interestingly, transcripts

for HSL were strikingly decreased, whereas those for lipo-

genic genes were unchanged or decreased. Androgens

slightly decrease lipoprotein lipase (LPL) activity in

human adipose tissue organ cultures, but markedly inhibit

adipogenesis in primary preadipocyte cultures obtained

from subcutaneous and omental depots of both sexes(79).

Thus, the androgenic effects on adipose tissue in men as

opposed to women may differ more in terms of the magni-

tude of their negative impact on adipogenesis and lipid

synthesis rather than in the direction of the lipolytic action.

Although commonly acting in rodent fat cells as lipolytic

agents via stimulatory GTP-binding protein (Gs protein)-

coupled receptors, thyrotropin-stimulating hormone,

adrenocorticotropic hormone and a-melanocyte-stimulat-

ing hormone are either ineffective or very weak stimulators

of lipolysis in human adipocytes(62). Neither glucagon nor

glucagon-like peptide-1 (GLP-1) has been clearly shown to

stimulate lipolysis in vitro. Likewise, no significant effects of

glucagon or GLP-1 on lipolytic rate or adipose tissue blood

flow following local or experimental intravenous normo-

and hyperglucagonaemia have been observed(80,81).

However, during the present decade the role of the

GLP-1/GLP-1 receptor system in lipolysis has experienced

renewed interest(82). A dose-dependent lipolytic effect of

GLP-1 in 3T3-L1 adipocytes in a receptor-dependent

manner involving downstream adenylate cyclase/cAMP

signalling has been shown(83).

Cytokines and other ‘newcomers’

Over the past years adipose tissue has been recognised as

an extraordinarily active endocrine organ with the ability

to secrete numerous products of diverse nature such as

hormones, cytokines, enzymes, complement factors, vaso-

active peptides and growth factors, among others(84–87).

All these adipose-derived factors, collectively termed

adipokines, are involved in a pleiad of physiological func-

tions ranging from energy homeostasis to reproduction,

including inflammation and immunity as well as angio-

genesis and bone metabolism, among others(88–94). The

dynamic cross-talk of adipokines with other non-metabolic

biological processes extends to the cardiovascular(95–99),

gastrointestinal(100–103), respiratory(104–106) andmuscular(107–110)

systems. In addition to their participation in plentiful diverse

physiological functions, many of the recently identified

hormones and adipokines have also been shown to be

able to directly affect lipolysis.

Cytokine regulation of lipolysis. Cytokine release by

both adipocytes and stromovascular cells underlies the

participation of adipose tissue in a dynamic cross-talk

and potent feedback signalling with key neuroendocrine

organs involved in the regulation of food intake, lipid

metabolism, glucose disposal, energy expenditure and

the stress response(111,112). The complex secretory activities

of adipose tissue also contribute to the development of

insulin resistance and atherogenic processes(113–115). The

release of cytokines further exerts important local

autocrine and paracrine effects, mainly involved in

adipose tissue remodelling, adipogenesis, angiogenesis,

inflammation and immunity. Noteworthy, cytokines, like

TNF-a, as well as some interleukins and adipokines, are

important regulators of spontaneous lipolysis.

Cytokine regulation of lipolysis: TNF-a. TNF-a is pro-

duced in large amounts by adipocytes and other cell types

within adipose tissue(84,116). In humans, contrarily to

rodents, TNF-a is not released from adipose tissue into

the circulation but rather acts predominantly as a local

factor(117–119). As with other lipolytic agents, important

species differences have also been observed as regards

TNF-a action. TNF-a is able to stimulate lipolysis by at

least three separate mechanisms(117,120,121). First, it inhibits

insulin receptor signalling, thereby counteracting the anti-

lipolytic effect of the hormone. In this respect, TNF-a oper-

ates via the inactivation of IRS-1. This can be brought about

by the inhibition of tyrosine phosphorylation and by a

reduction in the amount of IRS-1 in adipocytes. In fact,

TNF-a counteracts tyrosine phosphorylation by promoting

serine phosphorylation of IRS-1. The most important TNF-a

effect on adipocyte IRS-1 is mediated through the p42/44

mitogen-activated protein (MAP) kinase (Fig. 2). Second,

TNF-a is able to stimulate lipolysis by inhibiting the Gi-pro-

tein-coupled adenosine receptor signalling to counteract

the anti-lipolytic effect of adenosine. TNF-a markedly

decreases the protein content of all three Gia subtypes in

rodent fat cells, without changing the amount of Gs protein

or b-subunit of the G-protein complex. This decrease in Gi

protein mitigates the anti-lipolytic effect of adenosine.

Interestingly, TNF-a decreases Gi-protein content through

an induction of protein degradation by the proteasomal

pathway(122). However, the TNF-a–Gi interaction appears

to be specific for rodents because it has not been observed

in human fat cells. The third way by which TNF-a induces

lipolysis is via direct stimulation of basal lipolysis through

interactions with the lipid-binding protein perilipin. Only

TNF-a receptor 1 and MAP kinases promote lipolytic

effects in fat cells leading to phosphorylation and


Nut

ritio

n R

esea

rch

Rev

iew

s

decreased production of perilipin, the adipose lipid droplet

coating protein that protects it from being hydrolysed by

HSL(117,123,124). Three MAP kinases, namely p44/42, Jun

kinase (JNK) and p38, are activated by TNF-a in fat cells

but only the first two have been linked to lipolysis so far.

Mechanistically, TNF-a can stimulate lipolysis in the

absence of insulin, thus providing evidence that it does

not simply antagonise the anti-lipolytic effects of insulin.

Moreover, extracellular glucose is required for the TNF-a-

induced lipolytic effect, suggesting that a certain nutritional

state or substrate availability is required(119). The down-

stream signals of the TNF-a receptor 1-dependent pathway

involve the activation of extracellular signal-related kinases

(ERK1/2), JNK, AMP-activated protein kinase (AMPK),

inhibitor of kB kinase (IKK) and PKA(119,125,126). However,

in fat cells the TNF-a-induced activation of ERK1/2, JNK

and IKK is rapid and transient, while TNF-a-induced lipo-

lysis takes more than 6 h, suggesting the existence of more

distant events that are likely to be controlled by transcrip-

tional regulation(119,127).

Cytokine regulation of lipolysis: IL-6 and IL-15. The

IL-6 receptor and glycoprotein 130, key elements of the

cytokine pathway, are expressed in human adipocytes,

pointing to a direct autocrine/paracrine action of IL-6 on

fat cells(62). Infusions of recombinant human IL-6 have

been reported to increase plasma NEFA and glycerol

concentrations, leading the authors to conclude that IL-6

represents a novel lipolytic factor that operates as a

potent stimulator of lipolysis(128,129). Interestingly, IL-6

infusions were accompanied by parallel increases in

plasma cortisol and adrenaline levels, whereas the

potential effect on GH concentrations was not analysed.

In this regard, it is difficult to establish whether the

increased lipolysis depends on the direct action of IL-6 or

rather reflects the effects of other lipolytic factors such as

GH, cortisol and noradrenaline(130). A more recent study

has shown that higher circulating IL-6 concentrations are

associated with an increased isoproterenol-stimulated

lipolysis especially in omental adipocytes in women(131).

In any case, the reported effect on lipolysis of IL-6 is

relatively modest compared with that elicited by catechol-

amines and insulin. The potential involvement of IL-6

during the practice of exercise or other situations related

to severe illness, where a clear need for an elevated lipid

fuel takes place, has been set forward(132,133).

Another member of the interleukin family has been

proposed to participate in the modulation of lipolysis. The

administration of IL-15 has been shown to produce a signifi-

cant reduction in white adipose tissue via both a decreased

rate of lipogenesis and a reduction in LPL activity, without

a concomitant decrease in food intake(134). Comparative

studies with other cytokines revealed that IL-15 is apparently

more potent in its acute stimulation of lipolysis than IL-6 and

TNF-a(135). Noteworthy, when specific inhibitors of PKA or

Janus kinase were present an attenuation of the lipolytic

effect of IL-15 was observed. IL-15 is known to be highly

expressed in skeletal muscle, exerting a potent anabolic

effect on muscle protein accretion while decreasing fat

depots in adipose tissue(136). Taking these observations

together, it can be speculated that IL-15 may operate as a

homeorhectic factor that mobilises and directs energy away

from the adipocyte to other cells during the acute phase of

the inflammatory response.

Interestingly, IL-1b and TNF-a have been shown to

activate MAP3K8, also called Tpl2, which is expressed in

adipocytes and is implicated in cytokine-induced lipo-

lysis(127). Pharmacological inhibition or silencing of Tpl2

was able to prevent MAP kinase kinas/ERK1/2 activation

by these cytokines but not by insulin, thereby providing

evidence of its involvement in ERK1/2 activation particu-

larly in response to inflammatory stimuli(127).

Cytokine regulation of lipolysis: leptin. More than a

decade ago the identification of functional leptin receptors

(OB-R) in white adipose tissue suggested the involvement

of leptin in the direct peripheral regulation of adipocyte

metabolism(137–139). In fact, leptin was shown to directly

participate in lipid metabolism control through the inhi-

bition of lipogenesis and the stimulation of lipolysis.

Leptin reportedly exerts an autocrine–paracrine lipolytic

effect on isolated white adipocytes both in vitro and ex

vivo (140–143).

Adenosine A1 receptors have been shown to be markedly

expressed in adipocytes and influence fat cellmetabolismvia

the regulation of adenylyl cyclase and, therefore, participate

in lipolysis control via the inhibitory guanosine 50-tripho-

sphate (GTP) binding proteins, Gi(144,145). The adenosinergic

system increases leptin secretion by directly activating

adenosine A1 in white adipose tissue(146). In this respect, a

defective leptin-induced stimulationof lipolysis that opposes

the adenosine-mediated tonic inhibition was identified(143).

Interestingly, the lipolytic effect of leptin is located at the

adenylyl cyclase-inhibitory G protein step (Fig. 2), providing

an explanation for the defective stimulation of adipocyte

adenylate cyclase and the blunted lipolysis observed in

leptin-deficient and OB-R-lacking rodents as well as in

morbidly obese humans(147–149). Moreover, storage of

surplus energy in white adipose tissue and the development

of diet-induced obesity require the blockade of a latent

leptin-stimulated energy sump in white adipocytes(150). In

this regard, the pleiotropic effects of leptin in other

metabolically relevant organs like brown adipose tissue,

skeletal muscle, pancreas, liver and heart need to be

considered(108,151–157).

Cytokine regulation of lipolysis: adiponectin.

Adiponectin, also known as Acrp30, AdipoQ, apM1 or

GBP28, is a hydrophilic 30-kDa protein highly expressed

and secreted by adipocytes(88,90). The three-dimensional

structure of the C-terminal globular domain of adiponectin

shows a high structural homology with TNF-a, another

well-known lipolytic cytokine(158). Interestingly, HSL activity

has been shown to be positively correlated to adiponectin

expression, with percentage body fat and adiponectin


Nut

ritio

n R

esea

rch

Rev

iew

s

mRNA arising as the only independent predictors of adipose

tissue HSL activity explaining 26 % of its variability(159).

Increased adipose tissue mass has been suggested to explain

the association between low adiponectin and reduced NEFA

tolerance(160). Adiponectin has been shown to inhibit spon-

taneous and catecholamine-induced lipolysis in human

adipocytes of non-obese subjects through AMPK-dependent

mechanisms(161). In contrast to most adipokines, which are

markedly up-regulated in obesity, adipose tissue expression

and circulating concentrations of adiponectin are decreased

in both overweight and obesity, thereby implying a plausibly

decreased impact on overall lipolysis. Adiponectin gene

knockout mice and primary adipocytes obtained from

these mice exhibit an increased lipolysis(162). Moreover, adi-

ponectin was shown to suppress HSL activation without

modifying adipocyte TAG lipase (ATGL) and comparative

gene identification-58 (CGI-58) expression in adipocytes.

In addition, adiponectin reportedly reduced the type 2

regulatory subunit RIIa protein levels of PKA by reducing

its protein stability, with ectopic expression of RIIa

abolishing the inhibitory effects of adiponectin on lipolysis

in adipocytes(162). The proportion of secreted high-

molecular-weight v. total adiponectin has been shown to

be higher in visceral than in subcutaneous adipose tissue

explants in non-obese individuals, while no differences

were observed in obese individuals(163). More recently,

full-length adiponectin was shown to exert an anti-lipolytic

effect in non-obese subcutaneous adipose tissue, while the

globular and trimeric isoforms exhibited anti-lipolytic

activity in obese subcutaneous and visceral adipose tissue,

respectively(164).

Other elements involved in lipolysis. Analysis of the

involvement of other factors in the control of lipolytic

pathways is unravelling a huge number of potential

modulators, which vary greatly not only in their biochemi-

cal structure but also in their main physiological effect and

the signalling cascade activated.

Other elements involved in lipolysis: nitric oxide. NO

or related redox species have been described to act as

regulators of lipolysis both in rodent and human adipo-

cytes(165–170). Inhibition of NO release increased lipolysis

independently of local blood flow changes. While

chemical NO donors stimulate basal lipolysis, they block

the characteristic isoproterenol-induced lipolytic activity

via the inhibition of adenylyl cyclase and PKA. Inducible

NO synthase has emerged as a negative modulator of

lipolysis via an oxidative signalling pathway upstream of

cAMP production(169).

A functional relationship between leptin and NO has been

established in several physiological processes(139,171–175).

Given the co-localisation of both factors in fat cells and

their involvement in lipolysis, a potential role of NO in the

leptin-induced lipolytic effect seemed plausible. In fact, 1 h

after exogenous leptin administration a dose-dependent

increase in both serum NO concentrations and basal

adipose tissue lipolytic rate was observed(143). Up to 27 %

of the variability taking place in lipolysis was attributable to

the changes in NO concentrations. The leptin-induced NO

production in white adipocytes was shown to be mediated

through PKA and MAP kinase activation(176). Inhibition of

NO synthesis by N v-nitro-L-arginine methyl ester (L-NAME)

pretreatment was followed by a reduction in the leptin-

mediated lipolysis stimulation compared with leptin-treated

control animals. Contrarily, in adipocytes obtained from

rats under acute ganglionic blockade, the leptin-induced

lipolytic effect did not show differences with the lipolytic

rate achieved by leptin in control rats. The NO donor

S-nitroso-N-acetyl-penicillamine (SNAP) was able to exert a

significant inhibitory effect on isoproterenol-stimulated

lipolysis. Thus, NO has emerged as a potentially relevant

autocrine–paracrine physiological signal to fine-tune

lipolysis by facilitating leptin-induced lipolysis and, at the

same time, being able to inhibit catecholamine-induced

lipolysis(173).

Other elements involved in lipolysis: natriuretic

peptides. Until recently, human fat cell lipolysis was

thought to be mediated essentially by a cAMP-dependent

PKA-regulated pathway under the control of catecholamines

and insulin. However, Lafontan et al.(177) provided evidence

that natriuretic peptides also have the ability to potently

stimulate lipolysis in human adipocytes to the same degree

as a non-selective b-adrenoceptor agonist. This lipolytic

effect is mediated mainly by natriuretic peptide receptor

type A through a cyclic GMP-dependent PKG (cGK-I) signal-

ling pathway (Fig. 2) that does not involve PDE-3B inhibition

or cAMP production and PKA activity(178–182). Noteworthy,

in vitro studies have shown that HSL can also be phosphory-

lated by the cyclic GMP-dependent signalling cascade. In

fact, cGK-I phosphorylates perilipin and HSL. Increases in

plasma atrial natriuretic peptide levels by physiological

(exercise) or pharmacological stimuli are followed by an

enhanced lipid mobilisation(183,184). In humans atrial

natriuretic peptide also reportedly induces postprandial

lipid oxidation, energy expenditure, and concomitantly

arterial blood pressure(185,186). Taken together, this pathway

that participates in lipid mobilisation and energy homeo-

stasis becomes especially important during chronic

treatment with b-adrenoceptor antagonists, which inhibit

catecholamine-induced lipolysis but enhance cardiac atrial

natriuretic peptide release.

Other elements involved in lipolysis: endocannabinoid

system. Our understanding of the participation of the

endocannabinoid system in energy homeostasis has pro-

gressed enormously over the past years(187–189). In

particular, the observation of the presence of G protein-

coupled cannabinoid receptor (CB) CB1 receptors in

adipocytes provided a clue for the involvement of endo-

cannabinoids in the peripheral control of lipid meta-

bolism(190–193). Selective CB1 antagonism was shown to

coordinately induce key genes of the fatty acid catabolic

pathway, thereby favouring lipolysis and reducing fat

storage in adipose tissue(191). Interestingly, the selective


Nut

ritio

n R

esea

rch

Rev

iew

s

antagonism of CB1 receptors reportedly induced b3-

adrenoceptors and GH receptors at the same time as

repressing the expression of catechol-O-methyltransferase,

an enzyme involved in the degradation of catecholamines.

The reduced expression of this methyltransferase along

with the induction of the receptors of two well-known

hormones with lipolytic effects further supports the

molecular basis for the participation of endocannabinoids

in the modulation of lipolysis.

Amides of fatty acids with ethanolamine (FAE)

are biologically active lipids participating in a variety of

physiological effects, including appetite regulation. While

the polyunsaturated FAE anandamide (arachidonoyletha-

nolamide) increases food intake by activating G protein-

coupled cannabinoid receptors, the monounsaturated

FAE oleoylethanolamide (OEA) reduces feeding as well

as body-weight gain and stimulates lipolysis by activating

the nuclear receptor PPAR-a(194,195).

Other elements involved in lipolysis: ghrelin. Beyond

its strong orexigenic effect, the gastrointestinal twenty-

eight-amino acid octanoylated peptide ghrelin exerts a

wide spectrum of actions including the inhibition of isopro-

terenol-induced lipolysis in rodent adipocytes(196). Both

ghrelin and des-acyl ghrelin have been shown to antagonise

the catecholamine-stimulated lipolysis via a non-type 1A GH

secretagogue receptor. Moreover, acylated and unacylated

ghrelin have been also shown to attenuate isoproterenol-

induced lipolysis in isolated rat visceral adipocytes through

activation of phosphoinositide 3-kinase g and PDE-3B(197).

However, ghrelin infusion in human subjects was observed

to induce acute insulin resistance and lipolysis independent

ofGH signalling(198). All of the elements of the ghrelin system

have been identified in human adipocytes, including

receptors and isoforms as well as the ghrelin-O-acyltransfer-

ase or GOAT enzyme(199,200). Interestingly, in differentiating

omental adipocytes, incubation with both acylated and

desacyl ghrelin increased PPAR-g and sterol regulatory

element-binding protein-1 mRNA levels, as well as fat

storage-related proteins, like acetyl-CoA carboxylase, fatty

acid synthase, LPL and perilipin(199). Consequently, both

ghrelin forms stimulate intracytoplasmatic lipid

accumulation at the same time as exhibiting an anti-lipolytic

effect.

Other elements involved in lipolysis: other miscella-

neous agents. The potent anti-lipolytic effect of nicotinic

acid together with its specific binding to adipose tissue was

firmly established more than half a century ago(201,202).

However, the mechanistic basis for this action on lipolysis

control has beenprovidedonlymore recently(203). Activation

of the nicotinic acid receptor triggers an inhibitory G-protein

signal, which decreases cAMP concentrations in adipocytes,

thereby inhibiting lipolysis. Continuous 24 h nicotinic acid

infusion in rats reportedly alters gene expression and basal

lipolysis in adipose tissue, producing a NEFA rebound and

insulin resistance(204) that are consistent with clinical

observations following treatment with this compound.

Other agents originating from either adipocytes or

surrounding cells are known to negatively control adenylyl

cyclase activity and inhibit lipolysis via their interaction

with plasma membrane receptors belonging to the seven-

transmembrane domain receptor family. Autacoid agents,

as already mentioned including adenosine, prostaglandins

and their metabolites, exert a clear anti-lipolytic effect.

Whereas adenosine and neuropeptide Y reportedly inhibit

lipolysis, for PGE2 a biphasic effect has been put forward

with nanomolar concentrations suppressing lipolysis, but

micromolar levels resulting in lipolysis stimulation(63). On

the contrary, PGI2 showed no effect or exerted also a

biphasic effect, whereby nanomolar concentrations

stimulated lipolysis, whereas at micromolar levels lipolysis

was suppressed.

Cachexia-inducing tumours produce a lipid-mobilising

factor (LMF) that causes an immediate glycerol release

when incubated with murine adipocytes, with the

stimulation of lipolysis by LMF being associated with an

elevation in intracellular cAMP concentrations(205–207).

Zn-a2-glycoprotein (ZAG), a tumour-related LMF of 43

kDa, has been found to be expressed in 3T3-L1 cells as

well as in the major fat depots of mice, being up-regulated

in rodents with cancer cachexia(208). Both ZAG expression

and protein have been also detected in human adipocytes

of visceral and subcutaneous origin. Remodelling of adipose

tissue together with decreased lipid storage constitute a

hallmark of cancer patients with cachexia. In addition to

ATGL- and HSL-enhanced lipolysis, in cancer other factors

such as ZAG have been shown to participate in TAG degra-

dation leading to white adipose tissue atrophy. ZAG

expression and release by adipose tissue are up-regulated

in weight-losing cancer patients, suggesting that ZAG oper-

ates both locally and systemically to stimulate lipid

mobilisation(206). However, ZAG did not display the thermo-

genic effects of the b-adrenoceptor agonist, nor did it

increase b3-adrenoceptor or UCP1 (uncoupling protein 1)

gene expression in brown adipose tissue, thereby implying

that it does not behave as a typical b3/2-adrenoceptor ago-

nist(209). Thus, ZAG has emerged as a novel adipokine,

being identified as an additional adipose tissue factor closely

related to body weight loss not only via modulation of

lipolysis in fat cells but also by activating AMPK in skeletal

muscle cells(208,210).

The octapeptide angiotensin II (Ang II) is the active

component of the renin–angiotensin system (RAS). A local

RAS is present in adipose tissue, with all the elements of

the system, including angiotensinogen, renin and angioten-

sin-converting enzyme, having been identified in

adipocytes(211). Noteworthy, Ang II has been shown to

decrease local blood flow in a dose-dependent manner

and to inhibit lipolysis in adipose tissue with the effects

being similar in both normal-weight and obese individ-

uals(212). In the last decade evidence has been provided

that adipose tissue is a source of vasoactive peptides that

further exert metabolic actions(213). Thus, endothelin-1 is


Nut

ritio

n R

esea

rch

Rev

iew

s

a powerful vasoconstrictor primarily produced and secreted

by endothelial cells to operate on the underlying vascular

smoothmuscle cell layer that can also act on adipocytes indu-

cing lipolysis via the ERK pathway(214,215). In human subjects

endothelin-1 has been shown to selectively counteract insu-

lin inhibition of visceral adipocyte lipolysis, decreasing the

expression of insulin receptor, IRS-1 and PDE-3B and

increasing the expression of the endothelin receptor-B

(ETBR) in visceral but not subcutaneous adipocytes(216).

The ETBR-mediated effects were signalled via the PKC and

calmodulin pathways. Subsequently, it was further observed

that long-term incubation of human adipocytes with

endothelin-1 increases lipolysis via the activation of

ETAR(217). Likewise, the fifty-two-amino acid vasoactive pep-

tide adrenomedullin together with its receptor components

(calcitonin receptor-like receptor and receptor activity mod-

ifying protein-2 (CRLR/RAMP2)) have been identified to be

concomitantly expressed in adipose tissue (Fig. 2), exhibit-

ing a tissue-specific up-regulation during the development

of obesity(218,219). Interestingly, in adipose tissue adrenome-

dullin acts as an autocrine–paracrine factor to regulate lipid

mobilisation, inhibiting lipolysis through NO-mediated

b-adrenergic agonist oxidation(220). In this context, it has

been proposed that adrenomedullin alone is devoid of lipo-

lytic function and inhibits b-adrenergic-stimulated lipolysis

by shifting the concentration–response curve for isoprotere-

nol by a NO-dependent mechanism; specifically, adrenome-

dullin-induced NO modifies isoproterenol through an

extracellular oxidative reaction to yield its aminochrome,

isoprenochrome. However, other studies have provided

evidence for adrenomedullin dose-dependently elevating

cAMP levels and the lipolytic rate(221). In this case, adrenome-

dullin was shown to increase the phosphorylation of PKA,

ERK and Akt and would reportedly exhibit additive effects

on isoproterenol-induced lipolysis.

Apelin represents a further peptide with vasoactive

characteristics that has been subsequently shown to be

secreted by adipocytes of both humans and rodents, being

up-regulated in states of obesity(222). The identification in

adipocytes of apelin and the apelin receptor (APJ), a G-pro-

tein-coupled receptor, supported a plausible autocrine par-

ticipation of this peptide in adipobiology. In this line, apelin

was shown to dose-dependently stimulate AMPK phos-

phorylation in human adipose tissue, which was associated

with increased glucose uptake(223). Apelin reportedly

decreased isoproterenol-induced NEFA and glycerol release

in 3T3-L1 cells and isolated adipocytes abrogating the cat-

echolamine-induced HSL phosphorylation via G-protein q

polypeptide (Gq), Gi pathways and AMPK activation(224).

The apelin-induced inhibition of basal lipolysis was exerted

through AMPK-dependent enhancement of perilipin

expression by preventing lipid droplet fragmentation and

hormone-stimulated acute lipolysis inhibition mediated by

decreasing perilipin phosphorylation(225). Moreover, apelin

also suppressed adipogenesis through MAP kinase kinase/

ERK signalling.

Pigment epithelium-derived factor (PEDF) is a 50-kDa

protein of the non-inhibitory serpin family of serine pro-

tease inhibitors originally identified as a regulator of hepa-

tic TAG metabolism involved in the development of insulin

resistance in obesity(6,226,227). Subsequently it was tested

whether this adipocyte-secreted factor also exhibits

autocrine–paracrine lipolytic effects. PEDF was shown to

stimulate TAG hydrolysis in adipose tissue, muscle and

liver via ATGL(228). The exact mechanisms underlying the

participation of PEDF in insulin resistance, obesity and

non-alcoholic fatty liver disease still need to be fully eluci-

dated(229–231). The potential role of other recently ident-

ified adipose-related factors on lipolysis such as serum

amyloid A, osteopontin, osteocalcin, osteoprotegerin,

obestatin, lipocalin 2, visfatin, nerve growth factor-induci-

ble derived peptides, omentin, mammalian chitinase-like

protein YKL40, chemerin, vitamin D and tenascin C,

among others, beyond their originally reported effects

merits to be specifically investigated(111,227,232–245).

Influence of subcellular compartmentalisation of lipases

Multicellular organisms ranging from insects to mammals

have evolved specialised systems to store surplus lipid

energy for subsequent mobilisation in times of need. In

mammals the storage and mobilisation of lipids are funda-

mental functions of adipocytes. About 80 % of the total adi-

pose tissue weight is due to the fat content, with over 90 %

of lipids being stored as TAG(246). The major secretory pro-

ducts of adipose tissue are NEFA(247), which are derived

from the lipolysis of stored TAG in a process involving

three main steps and requiring, at least, three different

lipases, which are regulated by both adipocyte and non-

adipocyte factors(7). Thus, the classic lipolytic pathway

encompasses the three following consecutive steps:

(i) TAG hydrolysation by ATGL to generate fatty acids

and diacylglyerol (DAG)(248); (ii) subsequently, HSL

catalyses the hydrolysis of DAG to monoacylglycerol

(MAG) and fatty acids(249,250); (iii) monoacylglycerol

lipase (MGL) is required to complete the hydrolysis of

MAG into one fatty acid and glycerol(251). HSL and ATGL

are quantitatively the most important lipases based on

the blunted isoprenaline-induced lipolysis observed in

adipocytes of Atgl- and Hsl-knockout mice(248,252).

TAG hydrolysis. Only a decade ago the initiation of

TAG hydrolysis was thought to be exclusively controlled

by HSL(2–7,253–255). However, the generation of Hsl-knock-

out mice revealed the existence of residual HSL-indepen-

dent TAG lipase activity, pointing to the existence of

previously unidentified adipose tissue lipases. Currently,

ATGL is well recognised to be the lipase responsible for

initiating TAG breakdown to yield DAG(5,6). ATGL is a

54-kDa TAG hydrolase, also named phospholipase A2j or

desnutrin, belonging to the family of patatin-like phospho-

lipase domain-containing proteins (PNPLA) with specificity

for TAG as a substrate(6,248,256,257). Atgl-knockout mice and


Nut

ritio

n R

esea

rch

Rev

iew

s

knockdown studies in adipocytes provided evidence for

the involvement of ATGL in TAG but not DAG hydrolysis.

Atgl-null mice exhibited a blunted lipolysis, producing a

more than 75 % reduction in NEFA release and a significant

TAG accumulation in adipocytes leading to obesity(248,258).

The co-activator of ATGL, CGI-58, also known as a/b-

hydrolase domain-containing protein 5 (ABHD5), was

shown to stimulate TAG hydrolase activity in wild-type

and Hsl-deficient but not Atgl-deficient mice. ATGL and

HSL are responsible for 95 % of TAG lipase activity, thereby

suggesting a complementary relationship between the two

lipases(257–259).

ATGL is highly expressed in adipose tissue, with its

expression being profoundly elevated during adipocyte

differentiation. Two phosphorylation sites (Ser404 and

Ser428) have been identified within the C-terminal region

of ATGL. Furthermore, the enzymic activity and its inter-

action with CGI-58 are dependent on the C-terminal

region(260). Overexpression of Atgl elevates TAG hydrolysis

as well as basal and catecholamine-stimulated lipolysis,

while Atgl silencing decreases TAG hydrolase activity,

TAG storage and lipid droplet size(257). Alterations of Atgl

expression resulted in dramatic changes in whole-cell lipo-

lysis. Conversely, silencing of Atgl or CGI-58 significantly

reduced basal lipolysis and essentially abolished forsko-

lin-stimulated lipolysis. Taken together, these findings

suggest that in humans the ATGL–CGI-58 complex acts

independently of HSL and precedes its action in the

sequential hydrolysis of TAG.

Fasting, glucocorticoids and PPAR agonists increase Atgl

mRNA expression, whereas food intake and insulin

decrease it(261,262). Cellular TAG lipolysis by ATGL pro-

duces essential mediators involved in lipid ligand gener-

ation for PPAR activation, with Atgl deficiency in mice

reducing mRNA levels of PPAR-a and PPAR-d target

genes(263). While mammalian target of rapamycin

(mTOR)-dependent signalling has been observed to

decrease Atgl mRNA expression, FoxO1 activation by

SIRT1-mediated deacetylation elevated it(262,264–266). How-

ever, the role of AMPK in lipolysis control remains contro-

versial(267–271). In this sense, the precise mechanisms of

ATGL regulation need to be fully established. Recently, a

protein encoded by the G0/G1 switch gene 2 (G0S2) has

been identified as a selective regulator of ATGL by attenu-

ating its action both in vitro and in vivo (272,273). G0S2 is

highly expressed in adipose tissue and differentiated adi-

pocytes interacting specifically with ATGL to inhibit its

TAG hydrolase activity. While knockdown of endogenous

G0S2 enhances both basal and stimulated lipolysis in adi-

pocytes, overexpression of G0S2 decreases the lipolytic

rate of adipocytes and adipose tissue explants. G0S2 has

been further shown to regulate human lipolysis influencing

ATGL activity and intracellular localisation by anchoring

the lipase to lipid droplets (Fig. 3) independently of the

C-terminal lipid-binding domain of ATGL(273). Moreover,

G0S2 expression has been observed to be diminished in

poorly controlled type 2 diabetes, thereby establishing

a potential link between adipose tissue G0S2 down-

regulation and insulin resistance. Given that the above-

mentioned characteristics reveal ATGL as an attractive

therapeutic target, the development and characterisation

of a selective small-molecule inhibitor of ATGL, atglistatin,

may prove of interest for the pharmacological treatment of

dyslipidaemic and metabolic disorders(274).

Diacylglycerol hydrolysis. HSL, an 84-kDa cytoplasmic

protein with demonstrated activity for a wide range of

substrates including TAG, DAG, cholesteryl esters and

retinyl esters, was presumed to be the rate-limiting

enzyme in the initial steps of the lipolytic process. How-

ever, several important findings challenged this view of

the unique regulatory and rate-limiting role of HSL on

lipolysis, pointing to the existence of alternative lipases

targeting TAG molecules to counterbalance the strong

affinity of HSL for DAG(4,5,7,250,257,275): (i) PKA-dependent

HSL phosphorylation led only to a 2- to 3-fold increase

in TAG hydrolase activity, while whole-cell lipolysis

resulted in a 100-fold increase; (ii) Hsl-null mice exhibited

a normal body weight with decreased adiposity; (iii) these

mutants further showed DAG adipocyte accumulation;

(iv) the existence of residual TAG hydrolase activity and

lipolysis despite HSL silencing or specific pharmacological

inhibition; and (v) failure of HSL overexpression to

promote whole-cell lipolysis. As mentioned previously,

the identification of ATGL provided explanations for

these findings(250,254,276).

Fig. 3 illustrates ATGL and HSL regulation in basal and

stimulated conditions. ATGL and HSL have the capacity

to hydrolyse in vitro the first ester bond of TAG. ATGL

exhibits 10-fold higher substrate specificity for TAG than

DAG, selectively enabling the first step in TAG hydrolysis,

leading to the formation of DAG and fatty acid. An import-

ant step in lipolysis activation comprises the translocation

of HSL from a cytosolic compartment to the surface of

the lipid droplet. Upon lipolytic stimulation, HSL moves

from the cytosol to the surface of lipid droplets where it

interacts with perilipin-1 and neutral lipids. Noteworthy,

adipocytes lacking perilipin-1 are incapable of trans-

locating HSL to the lipid droplet after increases in

cAMP(277,278). Perilipin-1 operates as a dynamic scaffold

to coordinate the access of enzymes to the lipid droplet

in a way that is responsive to the metabolic state of the

adipocyte(279,280). Thus, in basal conditions (Fig. 3(a)) peri-

lipin-1 limits lipase access to the lipid droplet(281). Lipolysis

stimulation is followed by HSL translocation from the cyto-

sol to lipid droplets and redistribution of ATGL, resulting in

enriched colocalisation of the two lipases. Interestingly,

the ATGL–CGI-58 complex acts independently of HSL

and precedes its action in the sequential hydrolysis of

TAG in humans. The increased number of ATGL–CGI-58

complexes formed following perilipin-1 phosphorylation

(which releases CCI-58) and docked on small lipid droplets

govern PKA-stimulated lipolysis (Fig. 3(b)). The association


Nut

ritio

n R

esea

rch

Rev

iew

s

between fatty acid binding protein 4 (FABP4) and HSL

represents a further regulatory step. Fatty acid binding to

FABP4 and HSL phosphorylation precede the association

of FABP4 and HSL. FABP4 also participates in the traffick-

ing of fatty acids from the site of hydrolysis (i.e. the lipid

droplet) to the plasma membrane. In addition to support-

ing fatty acid trafficking to the plasma membrane in a

reaction that is independent of its physical association

with HSL, FABP4 bound to fatty acids associates with

activated, phosphorylated HSL on the surface of lipid

droplets. The sequential effect of ATGL-accentuated TAG

hydrolysis, phosphorylated HSL and MGL activity yields

massive increases in NEFA release in response to PKA

activation.

The expression profile of HSL basically mirrors that of

ATGL, given that both enzymes coordinatedly hydrolyse

TAG and, therefore, share some regulatory characteristics

but differ in the mechanisms of enzyme control(6). Whereas

Fig. 3. Schematic representation of basal (a) and stimulated (b) lipolysis, the catabolic pathway by which TAG are hydrolysed into fatty acids (FA). AC, adenylyl

cyclase; ATGL, adipocyte TAG lipase; cAMP, cyclic AMP; CGI-58, comparative gene identification-58; DAG, diacylglycerol; FABP4, fatty acid binding protein 4;

G0S2, G0/G1 switch gene 2; Gs, stimulatory GTP-binding proteins; HSL, hormone-sensitive lipase; MAG, monoacylglycerol; MGL, monoacylglycerol lipase;

P, phosphate; PKA, protein kinase A. (A colour version of this figure can be found online at http://www.journals.cambridge.org/nrr)


Nut

ritio

n R

esea

rch

Rev

iew

s

b-adrenergic stimulation exerts ATGL regulation mainly

via CGI-58 recruitment, HSL constitutes the main target

for PKA-catalysed phosphorylation(282). Adipocyte HSL

encompasses an N-terminal domain (that interacts with

FABP4) and a C-terminal catalytic domain (that contains

the active site as well as a regulatory module with all the

known phosphorylation sites of HSL)(4,255,283). Phosphoryl-

ation of HSL at Ser563, Ser659 and Ser660 by PKA and at

Ser660 via the ERK pathway activate lipolysis(284). The

PKA-dependent lipolytic effect is exerted increasing HSL’s

intrinsic activity and promoting its access to TAG molecules

within the adipocyte. Conversely, AMPK exerts an anti-

lipolytic effect, blocking the translocation of HSL to the

lipid droplets by its phosphorylation at Ser565(261). Deacti-

vation of lipolysis mediated by insulin is associated with

down-regulation of HSL and ATGL expression(285,286).

Moreover, insulin signalling phosphorylates and activates

PDE isoforms via PKB, cAMP hydrolysis and PKA inhi-

bition, resulting in the prevention of HSL and perilipin-1

phosphorylation, HSL activation and translocation as well

as CGI-58-mediated ATGL activation. The peripheral con-

trol of insulin is accompanied by a central mechanism via

the sympathetic nervous system that reduces the activitiy

of both HSL and ATGL(287).

Monoacylglycerol hydrolysis. The final step of lipolysis

is catalysed by MGL, which is constitutively expressed in

adipose tissue and has no affinity for DAG, TAG or choles-

teryl esters(255). The enzymic activity of MGL is required in

the final hydrolysis of the 2-monoacylglycerols produced

by HSL activation. Site-directed mutagenesis has shown

the relevance of Ser122, Asp239 and His269 in the lipase

and esterase activities of MGL(255,288).

Other lipases. The contribution of alternative lipases to

ATGL and HSL to the overall lipolytic capacity and main-

tenance of the highly dynamic TAG turnover has yet to

be completely discerned. Potential TAG hydrolases have

been identified within members of the carboxylesterase/

lipase and the patatin homology domain families(6).

Carboxylesterase-3/TAG hydrolase-1 is supposedly

involved in HSL-independent lipolysis in adipocytes and

participates in the assembly and secretion of VLDL in the

liver (289,290). Among the patatin homology domain

family, PNPLA4 and PNPLA5 have been observed to exhibit

TAG hydrolase, DAG transacylase and retinylester

hydrolase activity in vitro, which needs to be confirmed

in vivo (291). Noteworthy, the member with the highest

ATGL homology is PNPLA3 or adiponutrin(292–295).

Lipid droplet proteins. Cytoplasmic lipid droplets are

organelles in which cells store neutral lipids for use as an

energy source in times of need, but they also play import-

ant roles in the regulation of key metabolic processes, with

excess accumulation of intracellular lipids being associated

with obesity, type 2 diabetes and atherosclerosis. Fat dro-

plets may constitute up to 95 % of the total adipocyte

volume, being mainly composed by TAG. Intracellular

TAG storage droplets have emerged as extraordinarily

dynamic organelles, with signalling events underlying

lipid mobilisation by shuttling protein trafficking to a

specialised subset of these droplets(15). Thus, lipid droplet

scaffold proteins are key elements in organising and

directing the lipolytic signalling cascade(15,246).

The function of lipid droplets is regulated by their

coating proteins, collectively termed PAT proteins after

perilipin, adipophilin/adipocyte differentiation-related

protein (ADRP), and tail-interacting protein of 47 kDa

(TIP47)(4,296,297). Further members of the family are S3-12,

oxidative tissue-enriched PAT protein (OXPAT), myocardial

lipid droplet protein (MLDP) and lipid storage droplet pro-

tein 5 (LSDP5)(298,299). The members of this family share

varying levels of sequence similarity, lipid droplet associ-

ation and functions in stabilising lipid droplets.

Lipid droplet proteins: perilipin. Lipid droplets in most

tissues are coated by two or more members of the perilipin

family, which are now numbered according to the order of

discovery(291). Expression of perilipin-1 is mainly restricted

to white and brown adipocytes and, to a lesser extent,

steroidogenic cells of adrenal cortex, testes and ovaries.

Perilipin-2 (formerly adipophilin or ADRP) and perilipin-3

(formerly TIP47) are ubiquitously expressed and, there-

fore, lipid droplet components of most tissues. While

perilipin-4 (formerly S3-12) is primarily expressed in

white adipocytes, perilipin-5 (formerly OXPAT, MLDP, or

LSDP5) is expressed in brown adipocytes as well as

myocytes of skeletal muscle and heart, all of which rely

on lipolysis to provide fatty acids to mitochondria for

b-oxidation to drive either ATP production or heat gene-

ration. Thus, the perilipin composition of lipid droplets

within a specific tissue constitutes an important component

of lipolysis regulation.

Perilipin is the best-known member of the PAT family,

with perilipin-1 being the predominant isoform found

in mature adipocytes, the most abundant protein on the

lipid droplet surface and the major substrate for cAMP-

dependent PKA in lipolytically stimulated adipo-

cytes(297,300–308). Perilipin limits the access of cytosolic

lipases to lipid droplets, thereby facilitating TAG storage

under basal conditions (Fig. 3(a)). When energy is

needed, perilipin is phosphorylated by PKA, facilitating

maximal lipolysis by ATGL and HSL (Fig. 3(b)). Thus, peri-

lipin expression and its phosphorylation state are key in

lipolysis control, with phosphorylation of Ser492 produ-

cing a lipid droplet remodelling, widely increasing the sur-

face area for lipase binding, while Ser517 is essential

for ATGL-dependent lipolysis in stimulated conditions(4).

Perilipin-1 is also phosphorylated by the cyclic GMP-

dependent PKG.

Perilipin ablation confers resistance to genetic or diet-

induced obesity, producing a lean phenotype with smaller

adipocytes, increased basal lipolysis and attenuated stimu-

lated lipolysis(301). Recently, perilipin-1 has been shown to

move between the fat droplet and the endoplasmic reticu-

lum(309), which is physiologically reasonable given that


Nut

ritio

n R

esea

rch

Rev

iew

s

lipid droplets are largely derived from the endoplasmic

reticulum. In this regard, perilipin-mediated lipid droplet

formation in adipocytes was demonstrated to promote

sterol regulatory element-binding protein-1 (SREBP-1) pro-

cessing and TAG accumulation, suggesting an interplay

between lipid droplet formation and SREBP-1 activation

via a positive feedback loop(310). Therefore, the lysosomal

protein degradation machinery of perilipin may constitute

a target mechanism for enhancing adipocyte lipolysis.

Interestingly, a genome-wide RNA interference (RNAi)

screen in Drosophila S2 cells highlighted the relevance of

elements of the vesicle-transport systems in lipolysis regu-

lation through the identification of the vesicle-mediated

coat protein complex I (COPI) as an evolutionary-con-

served regulator of PAT protein composition at the lipid

droplet surface(311,312). In addition to regulating PAT pro-

tein composition, COPI promotes the association of ATGL

with the lipid droplet surface to mediate lipolysis. These

genes are conserved in mammalian cells, thus suggesting

that a similar complex might be operative in adipocytes.

Although COPI-mediated transport reportedly participates

in delivery of ATGL to the lipid droplet surface, depletion

of b-COP (a subunit of the COPI coat complex) does not

affect association of ATGL with lipid droplets or ATGL-

mediated lipolysis, pointing to the possibility of alternative

transport mechanisms implicated in the regulation of lipid

homeostasis(313).

Lipid droplet proteins: coactivator comparative gene

identification-58 (CGI-58) or a/b-hydrolase domain-

containing protein 5 (ABHD5). CGI-58 lacks lipase activity

in itself but potently and selectively stimulates lipolysis by

activating ATGL. As mentioned above, in basal unstimulated

conditions CGI-58 binds tightly to lipid droplets by inter-

acting with perilipin-1 and is unable to activate ATGL(4).

However, following b-adrenoceptor stimulation CGI-58 is

quickly dispersed to the cytosol, favouring ATGL

co-localisation and migration to small lipid droplets. Thus,

under stimulated conditions, the intracellular cAMP

elevation and PKA activation promote perilipin-1

phosphorylation, which is followed by the dissociation

from perilipin of CGI-58, which subsequently interacts with

ATGL and activates TAG hydrolysis (Fig. 3(b)). In addition

to ATGL activation, a further physiological function for

CGI-58 in phospholipid synthesis with lysophosphatidic

acid acyltransferase activity has been observed(4).

Lipid droplet proteins: Cide domain-containing proteins.

A further family of lipid droplet-associated proteins encom-

passes the cell death-inducing DFFA (DNA fragmentation

factor-a)-like effectors (Cide), which includes three mem-

bers (Cidea, Cideb and Cidec/Fsp27) with tissue-specific

expression(5). In spite of Cidea and Cideb not being

expressed in white adipose tissue, their deletion yielded

rodents with lower body weight and improved insulin sen-

sitivity as well as resistant to diet-induced obesity(314,315). In

the Cidea knockout model the elevated energy expendi-

ture was attributable to brown adipose tissue via enhanced

AMPK activity leading to increased fatty acid oxidation(316).

The Cideb mutants exhibited a decreased hepatic VLDL

secretion and de novo fatty acid oxidation related to

enhanced hepatic oxidative activity(317,318). Cidea is also

involved in human adipocyte lipolysis, TAG deposition

and fatty acid oxidation via cross-talk with TNF-a, which

inhibits the transcription of the gene(319–321). Cidea

co-localises with perilipin around lipid droplets in fat

cells. An increased lipolysis is observed in Cidea-depleted

human adipocytes. Contrarily, ectopical expression of

Cidea in preadipocytes markedly enhances lipid droplet

size, promoting lipid accumulation(322). Noteworthy,

Cidea expression is elevated in human cancer cachexia,

exhibiting a correlation with elevated NEFA concentrations

and weight loss(323). In humans Cidec, also referred to as

fat-specific protein 27, FSP27, is predominantly expressed

in subcutaneous adipocytes, being down-regulated in

response to a reduced energy intake(324). Small interfering

RNA-mediated knockdown of Cidec translated into an

increased basal release of NEFA, and decreased respon-

siveness to adrenergic lipolysis stimulation(4,325). The inter-

action between the diverse lipases is also starting to be

unfolded. FSP27 and perilipin-1 interaction promotes the

formation of large lipid droplets in human adipo-

cytes(326–329). Recently, the unilocular to multilocular trans-

formation that takes place during ‘browning’ of white

adipose tissue has been related to Cide-triggered dynamic

changes in lipid droplet-associated proteins(330).

Lipid droplet proteins: other proteins (GPIHBP1 and

Rab). Glycosylphosphatidylinositol-anchored HDL-bind-

ing protein (GPIHBP1) is a 28-kDa glycosylphosphatidyli-

nositol-anchored glycoprotein located on the luminal

surface of endothelial cells in tissues where lipolysis

takes place such as adipose tissue, skeletal muscle and

heart(7,331). The expression of GPIHBP1 in mice is

modulated by fasting and refeeding as well as by PPAR-g

agonists. GPIHBP1 knockout mice exhibit chylomicro-

naemia, even on a low-fat diet, with highly elevated

plasma TAG concentrations(332–334). GPIHBP1 is highly

expressed in the same tissues that express high levels of

LPL, namely, heart, adipose tissue, and skeletal muscle

where it binds both LPL and chylomicrons, suggesting

that GPIHBP1 functions as a platform for LPL-dependent

lipolytic processing of TAG-rich lipoproteins, stabilising

LPL without activating it.

Rab GTPases, which are key regulators of membrane

trafficking, have emerged as particularly relevant mol-

ecules in the highly dynamic cellular interactions involved

in lipid mobilisation. In this sense, proteomic analyses have

consistently identified the small GTPase Rab18 as a com-

ponent of the lipid droplet coat(335). Thus, Rab18 provides

an excellent marker to follow the dynamics of lipid dro-

plets in living cells as well as to gain insight into the com-

plex regulatory mechanisms involved in lipid storage and

release(336–338). In 3T3-L1 adipocytes, stimulation of lipo-

lysis increases the association of Rab18 with lipid droplets,


Nut

ritio

n R

esea

rch

Rev

iew

s

suggesting that Rab18 recruitment is regulated by the meta-

bolic state of individual lipid droplets. Furthermore, Rab1a

and its effector protein are reportedly involved in the CD36

trafficking signalling pathway(259).

Integral membrane proteins and transporters. While

the main signalling cascades and regulators of lipolysis

have been identified, the cellular interactions involved in

lipid mobilisation and release still remain to be completely

disentangled. Except in adipocytes, lipid droplets are

normally small, mobile and interact with other cellular

compartments in cells. On the contrary, fat cells are

composed mainly of very large, immotile lipid droplets.

The striking morphological differences between lipid

droplets in adipocytes and non-adipocytes suggest that

key differences must exist in the way in which lipid

droplets in different cell types interact with other

organelles to facilitate lipid transfer. A plethora of mole-

cules involved in these interactions are now emerging,

with integral membrane proteins and fatty acid transporters

standing out as pivotal elements operating at the dynamic

plasma membrane–lipid droplet interface.

Integral membrane proteins and transporters: aqua-

porin-7. Aquaporins (AQP) are integral membrane

proteins that function mainly as water channels. AQP7

belongs to the subfamily of aquaglyceroporins, which are

permeable to both glycerol and water, being expressed

in adipocytes(339–341). Mouse and human AQP7 exhibit

six prospective sites for PKA phosphorylation, suggesting

a putative cAMP/PKA-dependent regulation. Aqp7-knock-

out mice show defective glycerol exit from fat cells, adipo-

cyte hypertrophy due to TAG accumulation and moderate

adult-onset obesity(342,343). Short-term regulation and trans-

location of AQP7 to the plasma membrane is stimulated by

catecholamines, while insulin exerts a long-term negative

control. More recently, in addition to AQP7, the presence

and functionality of other members of the aquaglycero-

porin subfamily, AQP3 and AQP9, have been identified

in adipose tissue and shown to be regulated by insulin

and leptin via the PI3K/Akt/mTOR signalling cascade(344).

Integral membrane proteins and transporters: caveolin-1.

Caveolae account for over 25 % of the adipocyte’s

membrane, being specialised plasma membrane microdo-

main invaginations involved in important cellular transport

processes such as endo- and transcytosis as well as signal

transduction(345). Three classes of caveolae formed by

caveolin-1, the scaffolding hairpin-like protein facing the

cytosol, have been identified, with high-density caveolae

taking up exogenous fatty acids and converting them to

TAG. These TAG-metabolising caveolae serve as a platform

for FABP4, fatty acid transport protein (FATP) 1 and 4

(FATP1 and FATP4), long-chain acyl-CoA synthetase 1

(ACSL1) and CD36 (also known as fatty acid translocase).

Noteworthy, these caveolae contain FATP1 and FATP4

together with the enzymes needed for TAG syn-

thesis(346–348). Furthermore, HSL and perilipin have been

shown to be associated to these caveolae(349), demostrating

that TAG can be hydrolysed in them (Fig. 4). Caveolin-1

exerts an indirect structural role in caveolae formation,

controlling surface availability or stability of CD36, a fatty

acid transporter key to long-chain fatty acid uptake(350).

In response to NEFA, caveolin-1 reportedly translocates

from the plasma membrane to lipid droplets. Caveolin-1

knockout mice lack caveolae in adipocyte plasma mem-

branes, exhibiting increased circulating NEFA and TAG,

reduced adipocyte lipid droplet size and resistance to

diet-induced obesity(351). Experiments with caveolin-1-

null mouse embryonic fibroblasts indicate that caveolin-1

deficiency is followed by a total loss of caveolae, absence

of CD36 plasma membrane expression and a reduction in

fatty acid uptake, which is reverted by re-expression of

caveolin-1(352). Interestingly, caveolin-1 has been shown

to exert inhibitory interactions with various proteins such

as PKA, endothelial NOS and insulin receptors, with

knockout mice exhibiting an attenuated lipolytic activity

and decreased perilipin phosphorylation(349). Caveolin-1

potently inhibits cAMP-dependent signalling in vivo, with

a direct interaction between caveolin-1 and the catalytic

subunit of PKA having been demonstrated both in vitro

and in vivo.

Integral membrane proteins and transporters: fatty acid

translocase (CD36). As mentioned above, CD36 localises

to caveolae as well as to intracellular vesicles. CD36 is a

glycoprotein belonging to the family of class B scavenger

receptors predicted to have two transmembrane domains

at the N- and C-terminal, a large extracellular domain loop

and two short intracellular cytoplasmic tails(259). CD36 is

expressed in organs with high fatty acid metabolism rates,

such as adipose tissue, operating as a NEFA scavenger. Insu-

lin activation of the forkhead transcription factor and AMPK

stimulation trigger CD36 translocation from intracellular

stores to the plasma membrane, thereby enhancing NEFA

uptake. CD36 deficiency is associated with increased basal

lipolysis and responsiveness to the anti-lipolytic effect of

insulin, with Cd36-null mice exhibiting an impaired fatty

acid uptake in metabolic tissues (including adipocytes)

and increased plasma NEFA and TAG concentrations(353,354).

Knockdown of CD36 by RNAi in 3T3-L1 adipocytes resulted

in a profound reduction of both basal and insulin-stimulated

NEFA uptake. Conversely, overexpression of CD36 led to

mice with decreased adiposity and low circulating levels of

NEFA, TAG and cholesterol, suggesting that a strict control

of these molecules for an effective lipolysis is required.

Integral membrane proteins and transporters: adipose

fatty acid binding protein. FABP4, also known as

ALBP and aP2, is a cytosolic lipid-binding protein highly

expressed in adipocytes involved in fatty acid and retinoic

acid intracellular trafficking(259). It acts as a molecular cha-

perone, facilitating NEFA uptake and lipolysis, interacting

with HSL and shuttling fatty acids out of adipocytes

(Fig. 4). Upon PKA activation the HSL–FABP4 complex

translocates to lipid droplets. Consistently with this, in

Fabp4-knockout mice basal and stimulated lipolysis are


Nut

ritio

n R

esea

rch

Rev

iew

s

attenuated(291,355–357). Interestingly, Fabp4-null mice have

been shown to compensate FABP4 deletion by increasing

the expression of other FABP, thereby highlighting that

lipolysis seems to be linked to total FABP content rather

than to a specific FABP type(4).


transport protein 1. The underlying mechanism for fatty

acid uptake by FATP1, an integral membrane protein of

about 71 kDa with a hydrophobic domain at the N-terminal

that may be membrane-anchored and other membrane-

associated domains peripherally associated with the inner

leaflet of the membrane, is still unknown. In response

to insulin, FATP1 may translocate to structurally disordered

non-lipid raft regions of the plasma membrane.

Subsequently, FATP1 may extract fatty acid from the

inner membrane leaflet and esterify it to CoA, thereby

preventing its efflux and driving a NEFA concentration gra-

dient across the membrane(358,359). Most of the incoming

fatty acids are converted into acyl-CoA and preferentially

shunted into TAG synthesis (Fig. 4). Noteworthy, the con-

version of incoming long-chain fatty acids to TAG takes

place on or around the plasma membrane in rat adipo-

cytes, plausibly linking in a mechanistic way fatty acid

influx to TAG synthesis(259,360). Knockdown and knockout

experiments revealed an absolute requirement for FATP1 in

insulin-stimulated fatty acid uptake, whereas FATP1 over-

expression led to a fatty acid uptake increase.


transport protein 4. FATP4 presents a 60 % identity to

FATP1 and is expressed in adipose tissue, skin, heart, skel-

etal muscle, liver, as well as in the small intestine, where it

was observed to work in intestinal lipid absorption(259,361).

FATP4 knockdown in 3T3-L1 adipocytes by RNAi did not

affect basal and insulin-stimulated fatty acid uptake.

FATP4 knockouts exhibit perinatal lethality due to restric-

tive dermopathy, suggesting a key role in the formation

of the epidermal barrier rather than in fatty acid uptake

and intestinal lipid absorption.

Integral membrane proteins and transporters: acyl-CoA

synthetase long-chain 1. ACSL1, a 78-kDa membrane

protein expressed in adipocytes and localised to various

subcellular sites including the plasma membrane, lipid

droplets, and GLUT4-containing vesicles, co-localises with

FATP1(259). ACSL1 was found to be involved in the reacyla-

tion of fatty acids released from the lipid droplets during

basal and hormone-induced lipolysis(359). Overexpression

of ACSL1 in fibroblasts is followed by an increase in

NEFA uptake, thereby supporting a co-operative role in

fatty acid transport across the adipocyte plasma

membrane(362). However, knockdown of ACSL1 expression

FATP1 FATP1

FABP4

ATP + CoA

FA-CoA + AMP+PP1

TAG Caveolin-1NEFA

NEFA

GLUT4

HSL

Caveola

LD FABP4

TAGInactive

PKA Activated PKA

cAMP

HSL

Perilipin 1

NEFA

NEFA

ACSL1 FATP1FATP4

Glucose

NEFA

NEFA

CD36

CD36

CD36 CD36

Perilipin 1

NOS

Fig. 4. Schematic diagram of a caveola present in the adipocyte’s membrane and its participation in lipolysis. ACSL1, acyl coenzyme A synthetase 1; cAMP, cyclic

AMP; CD36, fatty acid translocase; FA, fatty acid; FABP, fatty acid binding protein; FATP, fatty acid transport protein; HSL, hormone-sensitive lipase; LD, lipid

droplet; NOS, NO synthase; PKA, protein kinase A; PP1, pyrophosphate. (A colour version of this figure can be found online at http://www.journals.cambridge.org/nrr)


Nut

ritio

n R

esea

rch

Rev

iew

s

by RNAi in 3T3-L1 adipocytes points to a role in fatty acid

efflux but not influx.

Depot-specific differences

The main anatomical fat depots in humans include intra-

abdominal (greater and lesser omental and mesenteric

depots, also known as visceral fat), lower-body (gluteal,

subcutaneous leg and intramuscular fat) and upper-body

subcutaneous fat(363,364). Subcutaneous adipose tissue

constitutes the largest site for fat storage (about 80 % of

total body fat), while under normal circumstances visceral

adipose tissue accounts for a small fraction of body fat

(about 20 % in men, and 5–8 % in women)(365). Regional

differences, including preadipocyte replication and differ-

entiation, adipocyte size, blood supply, gene expression,

basal metabolic activities and hormonal responsiveness,

contribute to regional fat distribution(363–366). Increased

NEFA availability, resulting from increased effective

adipose tissue lipolysis, plausibly undelies some of the visc-

eral obesity-associated metabolic alterations(367,368). Owing

to its anatomical distribution, NEFA released from visceral

fat are drained directly to the liver through the portal vein,

whereas venous drainage of NEFA from subcutaneous

adipose tissue is through systemic veins(369). The venous

drainage of fat via the portal system directly provides

NEFA as substrates for hepatic lipoprotein metabolism or

glucose production. Excess NEFA favours the onset of dys-

lipidaemia, hyperinsulinaemia and insulin resistance by

reducing hepatic degradation of apoB and insulin as well

as by increasing VLDL production(4).

Table 1 summarises regional variations in adipocyte

lipolysis leading to increased NEFA release from visceral

as compared with subcutaneous fat during hormone stimu-

lation. Visceral adipocytes show the highest lipolytic

responsiveness to catecholamines due to an increased

function of the lipolytic b1-, b2- and b3-adrenocep-

tors(370,371). On the other hand, as mentioned above,

several mechanisms have been linked to the weak

lipolytic response to catecholamines in subcutaneous adi-

pocytes, such as enhanced anti-lipolytic a2-adrenoceptor

activity, decreased lipolytic b2-adrenoceptor responsive-

ness as well as reduced expression or function of HSL,

FABP4 or perilipin(363,370).

The anti-lipolytic effect of insulin is more prominent

in subcutaneous adipocytes compared with visceral fat

cells(370,372). Regional differences involve insulin receptor

affinity, which is partly caused by variations in the

insulin dissociation rate, but also by reduced insulin

receptor phosphorylation and signal transduction via the

IRS-1/PI3K pathway(370,372,373). Testosterone has been

reported to show both stimulatory(374) (i.e. up-regulation

Table 1. Depot-specific differences of diverse factors regulating adipocyte lipolysis

Regulatory factor Activity Main fat depot target Reference

Catecholaminesb1-Adrenoreceptor Lipolytic Visceral adipose tissue 370b2-Adrenoreceptor Lipolytic Visceral adipose tissue 370b3-Adrenoreceptor Lipolytic Visceral adipose tissue 370a2-Adrenoreceptor Anti-lipolytic Subcutaneous fat 370InsulinInsulin receptor Anti-lipolytic Subcutaneous fat 370Growth hormoneGrowth hormone receptor Lipolytic Unknown 431Ghrelin/obestatinGrowth hormone secretagogue receptor Anti-lipolytic Visceral and subcutaneous fat 432, 433TestosteroneAndrogen receptors Anti-lipolytic Subcutaneous fat 75OestrogensOestrogen receptor-a Anti-lipolytic Subcutaneous fat 375EndothelinEndothelin receptor A Lipolytic Unknown 217Endothelin receptor B Lipolytic Visceral adipose tissue 216TNF-aTNF receptor 1 Lipolytic Unknown 434IL-6IL-6 receptor and glycoprotein 130 Lipolytic Visceral adipose tissue 131, 435LipopolysaccharideToll-like receptor 4 Lipolytic Unknown 436LeptinLeptin receptor: OB-R Lipolytic Subcutaneous fat 376AdiponectinFull-length adiponectin Anti-lipolytic Subcutaneous fat 164Globular adiponectin Anti-lipolytic Visceral and subcutaneous fat 164Trimeric adiponectin Anti-lipolytic Visceral and subcutaneous fat 164Natriuretic peptidesAtrial natriuretic peptide Lipolytic Visceral and subcutaneous fat 378Brain natriuretic peptide Lipolytic Unknown 377C-type natriuretic peptide Lipolytic Unknown 377


Nut

ritio

n R

esea

rch

Rev

iew

s

of b2-adrenoreceptors in visceral fat cells) and inhibi-

tory(75) (i.e. down-regulation of b2-adrenoceptors and

HSL in subcutaneous adipocytes) effects on cathecola-

mine-induced lipolytic activity. Oestrogen attenuates the

lipolytic response through up-regulation of a number of

anti-lipolytic a2-adrenergic receptors(375).

Leptin and adiponectin, the most abundant adipocyte-

secreted factors, show opposite actions on lipolysis

regulation(12). Leptin produces a significantly greater stimu-

lation of lipolysis in subcutaneous fat cells compared with

omental adipocytes(376). Adiponectin has recently emerged

as an anti-lipolytic factor on binding adiponectin receptor

type 1 and 2 (AdipoR1 and AdipoR2). Full-length adipo-

nectin exerts an anti-lipolytic action in subcutaneous

adipose tissue in non-obese subjects, while exhibiting no

effect on visceral fat(163,164). Atrial (ANP), brain (BNP)

and C-type (CNP) natiruretic peptides also induce lipolysis

in human abdominal adipocytes, with the potency order

of the lipolytic effect being ANP . BNP . CNP(377).

ANP-induced lipolysis is not subjected to primary regional

regulation in differentiated human subcutaneous and visc-

eral fat cells(378). Fat-depot differences in the lipolytic effect

of BNP and CNP remain to be established.

In addition to the physiological depot-specific differences

in the neuroendocrine control of adipose tissue, it is

important to consider the role of body fat distribution in

the development of cardiometabolic alterations(363–366).

Adipose tissue distribution varies with sex, age, genetic

background, nervous and endocrine factors, nutritional

and pharmacological influences as well as disease

state, which impinge on preadipocyte replication and

differentiation, developmental gene expression, vascularity,

inflammation, adipokine secretion and apoptosis. The

excess visceral fat observed in obesity is closely linked with

metabolic and cardiovascular co-morbidities, whereas

increased subcutaneous fat may even exert protective

effects. However, how interdepot differences in the

molecular, cellular, histological and pathophysiological

properties translate into co-morbidity development needs

to be fully unravelled(379–381).

Lipophagy: role of autophagy in lipid metabolism

Autophagy is a self-digestive process that entails the

formation of double-membrane vesicles, termed auto-

phagosomes, that sequester and target cytoplasmic cargo

for lysosomal degradation(382–384). In addition to quality

control, autophagy also regulates lipid metabolism by

degrading lipid droplets via lipophagy (Fig. 5). Small lipid

droplets can be completely taken up by an autophagosome,

or alternatively portions of large lipid droplets can

be degraded(382). Depletion of nutrients during

starvation activates a second important cellular energy

sensor, AMPK, that further activates unc51-like kinase 1

(ULK1) phosphorylation. Active ULK1 induces autophagy

via the phosphorylation of beclin-1, a protein that recruits

regulatory proteins to the VPS34 complex (class III PI3K),

which is essential for the activity of the phagophore(385).

During the vesicle elongation process, ATG7 induces the

conjugation of ATG12 to ATG5 as well as the conjugation

of cytosolic light chain 3 (LC3)-I to phosphatidylethanola-

mine to generate LC3-II, one of the best-characterised

components of autophagosomes. Once formed, autophago-

somes engulf lipid droplets and eventually fuse with a hydro-

lase-containing lysosome, the lipases of which degrade

lipids(382). This process generates fatty acids that are released

into the cytoplasm and can be oxidised in the mitochondria

to generateATP tomaintain energyhomeostasis. Under basal

fed conditions, nutrients (particularly amino acids) or insulin

and growth factors trigger the activity of class I PI3K that,

in turn, activates mTOR, the best-characterised negative

regulator of autophagy, and blocks autophagosome

formation(386,387) (Fig. 5). As a result, lipid breakdown by

autophagy is minimal in the fed state.

Autophagy also participates in adipocyte differentiation

regulation(388). Transgenic animals lacking the autophagy-

related proteins ATG5 and ATG7 show a reduction in

adipose mass, supporting that autophagy is essential for

normal adipogenesis(389,390). Analogously, Atg5 and Atg7

knockdown in 3T3-L1 adipocytes decrease intracellular

lipid content and gene expression levels of the key adipo-

genic transcription factors, CCAAT/enhancer-binding

protein a and b (C/EBPa and b) and PPAR-g(389). White

adipocytes of Atg7-deficient mice acquire some character-

istics of brown adipocytes, such as higher mitochondrial

content, multilocular lipid droplets and increased levels

of the brown adipogenic factors PPAR-g-coactivator 1a

(PGC-1a) and uncoupling protein-1 (UCP-1), triggering

adipose tissue fatty acid b-oxidation(390). Interestingly,

loss of Atg7 disrupts brown fat differentiation and

promotes the ‘beige’ (brown adipocyte-like) cell develop-

ment in inguinal adipose tissue, thereby contributing to

increased energy expenditure(391,392).

Human adipose tissue contains autophagosomes and

obesity is associated with an altered expression of the auto-

phagy-related molecules LC3-I, LC3-II, beclin-1, ATG5 and

ATG7(200,393,394). Markers of autophagy are correlated with

whole-body adiposity, visceral fat distribution and adipocyte

hypertrophy. However, the altered expression of autophagy

inhumanobesity appears tobe related to thedegree of insulin

resistance, rather than to excess adiposity(200). In this sense,

insulin constitutes a major inhibitor of autophagy,with insulin

resistance being a potential activator of this process, since

patients with type 2 diabetes show elevated formation

of autophagosomes in subcutaneous adipose tissue(395).

Adipocyte autophagy is also regulated by TNF-a and ghrelin,

showing opposite effects on the regulation of fat storage in

human adipocytes(200). TNF-a plays an important role in the

pathophysiology of deranged lipid metabolism through

both the suppression of LPL activity and enhancement of

lipolysis inhuman fat cells(396). Inaddition, TNF-a also triggers

autophagy by increasing the transcript levels of BECN1


Nut

ritio

n R

esea

rch

Rev

iew

s

(beclin 1), required for the formation of the autophagosome

initiation complex, as well as those of ATG5, and ATG7, the

autophagy proteins involved in the conjugation cascades for

autophagosome elongation in human adipocytes(200). On

the other hand, ghrelin is a gut-derived hormone that

promotes adiposity through orexigenic and adipogenic

actions(199,397). Ghrelin isoforms (acylated and desacyl

ghrelin) stimulate the expression of several fat storage-related

proteins such as acetyl-CoA carboxylase, fatty acid synthase,

LPL or perilipin through central mechanims(397) and directly

acting on human adipocytes(199), thereby stimulating

intracellular lipid accumulation. Besides its lipogenic action,

acylated ghrelin reduces basal ATG5 and ATG7, while desacyl

ghrelin inhibits TNF-a-induced expression of ATG5,

ATG7 and BECN1. Taken together, ghrelin constitutes a

negative regulator of basal and TNF-a-induced autophagy in

human visceral adipocytes(200).

Novel fascinating findings in the field of adipocyte apop-

tosis have been recently reported(398,399). White adipose

tissue inflammation, a characteristic feature of obesity,

results from the death of hypertrophic adipocytes that are

subsequently cleared by macrophages, giving rise to

crown-like structures (CLS). It has been recently shown

that infiltrating macrophages actively take up remnant

lipids of dead adipocytes(398). Upon induction of adipocyte

apoptosis, inflammatory cells infiltrate adipose tissue

initially consisting of neutrophils followed by macrophages

that are involved in CLS formation. Moreover, subcu-

taneous and visceral hypertrophic adipocytes obtained

from obese mice exhibit ultrastructural abnormalities

(cholesterol crystals and Ca accumulation), being more

common in the hyperglycaemic db/db v. normoglycaemic

ob/ob mice and in the visceral v. subcutaneous depots.

Data indicate that white adipocyte overexpansion induces

a stress state that ultimately leads to death with NOD-like

receptor family, pyrin domain containing 3 (NLRP3)-

dependent caspase-1 activation in hypertrophic adipocytes

probably inducing obese adipocyte death by pyroptosis, a

proinflammatory programmed cell death(399).

Lipolysis in human obesity

Obesity is characterised by a marked secretion of pro-

inflammatory adipokines, including TNF-a, and a profound

decrease in adiponectin synthesis(234). The increased

TNF-a production in adipose tissue triggers MAP kinase

Fed Starved

Insulin/IGF-1 Nutrients

ULK1

ATP

Plasma membrane

Cytosol

Mitochondria

NEFA

Lysosome

Autophagosome AutolysosomeConjugation

cascadesInitiationcomplex

Beclin-1VPS15VPS34

ATG7ATG5

ATG12

LC3-I

LC3-II

Lipid droplets

IRS 1/2

p 110P13K

Akt

mTOR

P

P

P

P

P

P

P

P

P

AMPK

Fig. 5. Regulation of lipophagy. AMPK, AMP-activated protein kinase; Akt, protein kinase B; ATG, autophagy-related gene; IGF-1, insulin growth factor-1; IRS

1/2, insulin receptor substrate 1/2; LC3, light chain 3; mTOR, mammalian target of rapamycin; P, phosphate; PI3K, phospatidylinositol-3 kinase; ULK1, unc51-like

kinase 1; VPS15, phosphoinositide-3-kinase, regulatory subunit 4; VPS34, class III phosphatidylinositol 3-kinase. (A colour version of this figure can be found

online at http://www.journals.cambridge.org/nrr)


Nut

ritio

n R

esea

rch

Rev

iew

s

activity in adipocytes, thus altering the action of perilipin

and leading to an enhanced basal lipolytic rate(2,400).

Otherwise, adiponectin inhibits basal and cathecolamine-

induced lipolysis in non-obese subjects, but this effect is

lost in obesity(161). The isoform-specific ability to prevent

lipolysis is modified in obesity. While full-length adiponec-

tin exerts an anti-lipolytic action in subcutaneous fat,

without effect on visceral fat, in non-obese individuals,

the lower adiponectin isoforms (globular and trimeric)

become important actors in obesity, showing anti-lipolytic

activity in obese subcutaneous and visceral adipose tissue,

respectively(164).

Circulating NEFA and glycerol concentrations are elevated

in obesity, suggesting an increase in overall lipolysis during

fasting(344). Several impairments in the control of lipolysis

have been reported in obese individuals, including an altered

responsiveness to catecholamines(2,4,53).Obese subjects show

a lower lipolytic effect of catecholamines in subcutaneous adi-

pose tissue through decreased action of lipolytic b2-adrener-

gic receptors and increased activity of the anti-lipolytic

a2-adrenergic adrenoceptors(370,401). In this regard, a blunted

lipolytic response has been shown in abdominal sub-

cutaneous adipose tissue of obese individuals during intra-

venous infusion of the non-selective b-agonist

isoprenaline(402). On the other hand, catecholamine-induced

lipolysis is markedly increased in visceral fat due to increased

activity of b3-adrenergic receptors and decreased activity of

a2-adrenoceptors(370,401). In subjectswithupper-bodyobesity

these regional variations in the action of catecholamines on

lipolysis are further enhanced(368,370). These abnormalities in

catecholamine function promote the release of NEFA from

the visceral adipocytes through the portal system and might

cause several of the metabolic complications of upper-body

obesity. In addition, several polymorphisms in genes encod-

ing b1- (ADRB1), b2- (ADRB2) and b3- (ADRB3) adrenergic

receptors have been associated with altered cathecolamine-

induced adipocyte lipolysis and with obesity(403,404). The

polymorphisms in the ADRB2 gene are highly frequent in

obesity and associated with altered b2-adrenergic function

(Arg16Gly and Gln27Glu) and catecholamine-induced

lipolysis in subcutaneous fat cells (Arg16Gly and

Thr164Ile)(42,405,406). However, the ADRB1 (Ser49Gly and

Arg389Gly)(404,407,408) and ADRB3 (Trp64Arg)(409–411)

polymorphisms do not appear to be major determinants of

b1- and b3-adrenergic function for lipolysis or the patho-

physiology of obesity.

It is not clear whether the anti-lipolytic effect of insulin

is affected in obesity, since the altered catecholamine

concentrations found in the obese state counteract the

effect of insulin(2). Consequently, normal, decreased and

increased anti-lipolytic effects of insulin have been

reported in obese patients(4). Insulin sensitivity of adipose

tissue lipolysis is normal or slightly impaired in the adipose

tissue of obese individuals(4,412). Modifications of other

anti-lipolytic factors may also be altered in obesity.

The pathological enlargement of fat cells in obesity

compromises angiogenesis and increases the formation of

hypoxic areas that promote the apoptosis of adipocytes

and induce the fibrotic and inflammatory programme(87).

Apoptotic adipocytes are surrounded by M1-stage macro-

phages that form CLS in the adipose tissue. This process

is accompanied by a chronic inflammation due to the

secretion by adipose tissue-embedded immune cells and

the dysfunctional adipocytes of proinflammatory cytokines

and acute-phase reactants, such as TNF-a, C-reactive

protein, IL-6, IL-8, leptin, serum amyloid A (SAA) and

monocyte chemotactic protein (MCP)-1(232,234). As detailed

in the Cytokines and other ‘newcomers’ section, the

increase in proinflammatory adipokines, such as TNF-a

or leptin, might be responsible for the high basal rate of

lipolysis in obese patients.

Obesity is associated with a decreased expression and

activity of HSL, but not ATGL, in visceral and subcutaneous

adipocytes of obese individuals independently of age and

sex, which may play an important role in the defective

lipid mobilisation observed in obesity(413–415). Further-

more, a decreased access of lipases to TAG due to

alterations in lipid droplet-associated proteins cannot be

ruled out(416–419). In humans CGI-58 mutations have

been identified in patients with Chanarin–Dorfman

syndrome, a disorder characterised by the accumulation

of abnormally large amounts of lipid droplets in several

organs(420,421). In these cases CGI-58 cannot be recruited

to lipid droplets and fails to interact with perilipin, which

may affect basal and PKA-stimulated lipolysis. Interest-

ingly, CGI-58 gene silencing importantly reduces basal

lipolysis by approximately 50 % but also completely

abrogates PKA-stimulated lipolysis in a human white adi-

pocyte model(255,422). The exact and complex dynamics

involving CGI-58, the diverse perilipins and ATGL in

basal as well as PKA-stimulated lipolysis has yet to be

completely unravelled.

Finally, changes in the molecules involved in lipolysis-

derived metabolites, fatty acids and glycerol also contribute

to lipolytic derangements in obesity. Several proteins like

FABP, CD36 or FATP facilitate fatty acid transport across

the membrane in adipocytes(423). The transport of the

other lipolysis-derived metabolite, glycerol, from adipo-

cytes in response to the lipolytic stimuli is facilitated by

AQP3 and AQP7 via their translocation from the cytosolic

fraction (AQP3) or lipid droplets (AQP7) to the plasma

membrane(341,344,424,425). AQP7 expression is decreased in

subcutaneous adipose tissue of obese subjects, resulting

in an increase in intracellular glycerol accumulation,

which is converted to glycerol-3-phosphate by the glycerol

kinase enzyme and re-esterified into TAG, thereby promot-

ing adipocyte hypertrophy(344,426). On the other hand, the

increased AQP3 and AQP7 expression in visceral fat in

obese subjects suggests an overall increase in the lipolytic

activity in this fat depot in obesity(344,426,427).


Nut

ritio

n R

esea

rch

Rev

iew

s

Concluding remarks and future perspectives

While adipose tissue elicited scarce interest for many dec-

ades(428), the identification in 1994 of leptin as an adipose-

derived hormone(429) started a new era in adipobiology

that recognises adipocytes as important dynamic endocrine

cells. Essential lipolytic enzymes and a plethora of regulat-

ory proteins and mechanisms have fundamentally changed

our view of lipolysis and its impact, not only on adipose

tissue but also more broadly on cellular metabolism(430).

Although the importance of lipolysis has been recognised

for decades, many of the key proteins involved have

been uncovered only recently. In this line, to further deci-

pher the participation of lipolytic products and intermedi-

ates in many non-adipose tissues will be especially

relevant to unravel previously underappreciated aspects

of lipolysis and their relation to disease development.

The regulation of lipolysis by numerous, and to some

extent still incompletely identified, factors embodies the

‘lipolysome’, a complex metabolic network involved in

ultimately controlling lipid mobilisation and fat storage.

Information derived from the reactome linking the

genome and metabolome via genome-sequence indepen-

dent functional analysis of metabolic phenotypes and net-

works will be particularly fascinating. With the advent of

systems biology a better integration of knowledge can be

further expected to provide a more profound view of the

true contribution of adipose tissue to health and disease.

Acknowledgements

The authors gratefully acknowledge the funding of the

Spanish Instituto de Salud Carlos III, Fondo de Investiga-

cion Sanitaria – FEDER (project numbers CIBERobn

CB06/03/1014, FIS PI10/01677 and PI12/00515) from the

Ministerio de Economıa y Competitividad, as well as the

Plan de Investigacion de la Universidad de Navarra (project

PIUNA 2011-13). None of the funders had a role in the

design, analysis or writing of this article.

All authors contributed fundamentally to the present

paper. G. F. conducted the main review of the literature

and drafted the manuscript. A. R. and L. M.-G. contributed

significantly to the further drafting of the manuscript. All

authors (G. F., L. M.-G., J. A. F.-F., S. F. and A. R.) made a criti-

cal review of the draft, provided input on data interpretation

as well as commented on and approved the final manuscript.

The authors declare no conflicts of interest.

References

1. Frayn KN (2002) Adipose tissue as a buffer for daily lipidflux. Diabetologia 45, 1201–1210.

2. Arner P (2005) Human fat cell lipolysis: biochemistry,regulation and clinical role. Best Pract Res Clin EndocrinolMetab 19, 471–482.

3. Duncan RE, Ahmadian M, Jaworski K, et al. (2007) Regu-lation of lipolysis in adipocytes. Annu Rev Nutr 27, 79–101.

4. Lafontan M & Langin D (2009) Lipolysis and lipid mobiliz-ation in human adipose tissue. Prog Lipid Res 48, 275–297.

5. Girousse A & Langin D (2012) Adipocyte lipases and lipiddroplet-associated proteins: insight from transgenic mousemodels. Int J Obes (Lond) 36, 581–594.

6. Zechner R, Zimmermann R, Eichmann TO, et al. (2012) Fatsignals – lipases and lipolysis in lipid metabolism and sig-naling. Cell Metab 15, 279–291.

7. Young SG & Zechner R (2013) Biochemistry and pathophy-siology of intravascular and intracellular lipolysis. GenesDev 27, 459–484.

8. Guilherme A, Virbasius JV, Puri V, et al. (2008) Adipocytedysfunctions linking obesity to insulin resistance and type2 diabetes. Nat Rev Mol Cell Biol 9, 367–377.

9. Girousse A, Tavernier G, Valle C, et al. (2013) Partial inhi-bition of adipose tissue lipolysis improves glucose metab-olism and insulin sensitivity without alteration of fat mass.PLoS Biol 11, e1001485.

10. Virtue S & Vidal-Puig A (2010) Adipose tissue expandability,lipotoxicity and the metabolic syndrome – an allostatic per-spective. Biochim Biophys Acta 1801, 338–349.

11. Unger RH, Clark GO, Scherer PE, et al. (2010) Lipid homeo-stasis, lipotoxicity and the metabolic syndrome. BiochimBiophys Acta 1801, 209–214.

12. Unger RH, Scherer PE & Holland WL (2013) Dichotomousroles of leptin and adiponectin as enforcers against lipo-toxicity during feast and famine. Mol Biol Cell 24,3011–3015.

13. Gross DN, Miyoshi H, Hosaka T, et al. (2006) Dynamicsof lipid droplet-associated proteins during hormonallystimulated lipolysis in engineered adipocytes:stabilization and lipid droplet binding of adipocytedifferentiation-related protein/adipophilin. Mol Endocrinol20, 459–466.

14. Ducharme NA & Bickel PE (2008) Lipid droplets in lipogen-esis and lipolysis. Endocrinology 149, 942–949.

15. Greenberg AS, Coleman RA, Kraemer FB, et al. (2011) Therole of lipid droplets in metabolic disease in rodents andhumans. J Clin Invest 121, 2102–2110.

16. Hashimoto T, Segawa H, Okuno M, et al. (2012) Activeinvolvement of micro-lipid droplets and lipid-droplet-associated proteins in hormone-stimulated lipolysis inadipocytes. J Cell Sci 125, 6127–6136.

17. Walther TC & Farese RV Jr (2012) Lipid droplets and cellularlipid metabolism. Annu Rev Biochem 81, 687–714.

18. Langin D, Lucas S & Lafontan M (2000) Millennium fat-celllipolysis reveals unsuspected novel tracks. Horm MetabRes 32, 443–452.

19. Fruhbeck G & Gomez-Ambrosi J (2003) Control of bodyweight: a physiologic and transgenic perspective. Diabeto-logia 46, 143–172.

20. Bousquet-Melou A, Galitzky J, Lafontan M, et al. (1995)Control of lipolysis in intra-abdominal fat cells of non-human primates: comparison with humans. J Lipid Res 36,451–461.

21. Langin D, Portillo MP, Saulnier Blache JS, et al. (1991)Coexistence of three b-adrenoceptor subtypes in white fatcells of various mammalian species. Eur J Pharmacol 199,291–301.

22. Blaak EE (2000) Adrenergically stimulated fat utilizationand ageing. Ann Med 32, 380–382.

23. Imbeault P, Prud’Homme D, Tremblay A, et al. (2000) Adi-pose tissue metabolism in young and middle-aged menafter control for total body fatness. J Clin EndocrinolMetab 85, 2455–2462.

24. Toth MJ & Tchernof A (2000) Lipid metabolism in theelderly. Eur J Clin Nutr 54, Suppl. 3, S121–S125.


Nut

ritio

n R

esea

rch

Rev

iew

s

25. Herrera E (2002) Lipid metabolism in pregnancy and itsconsequences in the fetus and newborn. Endocrine 19,43–55.

26. Blaak E (2001) Gender differences in fat metabolism. CurrOpin Clin Nutr Metab Care 4, 499–502.

27. Lange KH (2004) Fat metabolism in exercise – with specialreference to training and growth hormone administration.Scand J Med Sci Sports 14, 74–99.

28. Mauriege P, Prud’Homme D, Marcotte M, et al. (1997)Regional differences in adipose tissue metabolism betweensedentary and endurance-trained women. Am J Physiol273, E497–E506.

29. Stich V, de Glisezinski I, Galitzky J, et al. (1999) Endurancetraining increases the b-adrenergic lipolytic response insubcutaneous adipose tissue in obese subjects. Int J ObesRelat Metab Disord 23, 374–381.

30. De Glisezinski I, Crampes F, Harant I, et al. (1998)Endurance training changes in lipolytic responsiveness ofobese adipose tissue. Am J Physiol 275, E951–E956.

31. De Glisezinski I, Marion-Latard F, Crampes F, et al. (2001)Lack of a2-adrenergic antilipolytic effect during exercisein subcutaneous adipose tissue of trained men. J ApplPhysiol 91, 1760–1765.

32. Westerterp-Plantenga MS, Lejeune MP & Kovacs EM (2005)Body weight loss and weight maintenance in relation tohabitual caffeine intake and green tea supplementation.Obes Res 13, 1195–1204.

33. Murosaki S, Lee TR, Muroyama K, et al. (2007) Acombination of caffeine, arginine, soy isoflavones, andl-carnitine enhances both lipolysis and fatty acid oxidationin 3T3-L1 and HepG2 cells in vitro and in KK micein vivo. J Nutr 137, 2252–2257.

34. McCarty MF & Thomas CA (2003) PTH excess may promoteweight gain by impeding catecholamine-induced lipolysis –implications for the impact of calcium, vitamin D, andalcohol on body weight. Med Hypotheses 61, 535–542.

35. Shi H, Dirienzo D & Zemel MB (2001) Effects of dietarycalcium on adipocyte lipid metabolism and body weightregulation in energy-restricted aP2-agouti transgenic mice.FASEB J 15, 291–293.

36. Zemel MB, Thompson W, Milstead A, et al. (2004) Calciumand dairy acceleration of weight and fat loss during energyrestriction in obese adults. Obes Res 12, 582–590.

37. Xue B, Greenberg AG, Kraemer FB, et al. (2001) Mechanismof intracellular calcium ([Ca2þ]i) inhibition of lipolysis inhuman adipocytes. FASEB J 15, 2527–2529.

38. Major GC, Chaput JP, Ledoux M, et al. (2008) Recentdevelopments in calcium-related obesity research. ObesRev 9, 428–445.

39. Kang L & Nagy LE (2006) Chronic ethanol feedingsuppresses b-adrenergic receptor-stimulated lipolysis inadipocytes isolated from epididymal fat. Endocrinology147, 4330–4338.

40. Arner P (2001) Genetic variance and lipolysis regulation:implications for obesity. Ann Med 33, 542–546.

41. Umekawa T, Yoshida T, Sakane N, et al. (1999) Trp64Argmutation of b3-adrenoceptor gene deteriorates lipolysisinduced by b3-adrenoceptor agonist in human omentaladipocytes. Diabetes 48, 117–120.

42. Large V, Hellstrom L, Reynisdottir S, et al. (1997) Human b-2adrenoceptor gene polymorphisms are highly frequent inobesity and associate with altered adipocyte b-2 adreno-ceptor function. J Clin Invest 100, 3005–3013.

43. Klannemark M, Orho M, Langin D, et al. (1998) Theputative role of the hormone-sensitive lipase gene in thepathogenesis of type II diabetes mellitus and abdominalobesity. Diabetologia 41, 1516–1522.

44. Magre J, Laurell H, Fizames C, et al. (1998) Humanhormone-sensitive lipase: genetic mapping, identificationof a new dinucleotide repeat, and association with obesityand NIDDM. Diabetes 47, 284–286.

45. Arner P (1999) Catecholamine-induced lipolysis in obesity.Int J Obes Relat Metab Disord 23, Suppl. 1, 10–13.

46. Dodt C, Lonnroth P, Fehm HL, et al. (1999) Intraneuralstimulation elicits an increase in subcutaneous interstitialglycerol levels in humans. J Physiol 521, 545–552.

47. Dodt C, Lonnroth P, Wellhoner JP, et al. (2003) Sympatheticcontrol of white adipose tissue in lean and obese humans.Acta Physiol Scand 177, 351–357.

48. Brito MN, Brito NA, Baro DJ, et al. (2007) Differential acti-vation of the sympathetic innervation of adipose tissuesby melanocortin receptor stimulation. Endocrinology 148,5339–5347.

49. Bartness TJ & Song CK (2007) Thematic review series:adipocyte biology. Sympathetic and sensory innervationof white adipose tissue. J Lipid Res 48, 1655–1672.

50. Kreier F, Fliers E, Voshol PJ, et al. (2002) Selective parasym-pathetic innervation of subcutaneous and intra-abdominalfat – functional implications. J Clin Invest 110, 1243–1250.

51. Bartness TJ (2002) Dual innervation of white adipose tissue:some evidence for parasympathetic nervous systeminvolvement. J Clin Invest 110, 1235–1237.

52. Giordano A, Song CK, Bowers RR, et al. (2006) White adi-pose tissue lacks significant vagal innervation and immuno-histochemical evidence of parasympathetic innervation.Am J Physiol Regul Integr Comp Physiol 291, R1243–R1255.

53. Jocken JW & Blaak EE (2008) Catecholamine-inducedlipolysis in adipose tissue and skeletal muscle in obesity.Physiol Behav 94, 219–230.

54. De Matteis R, Arch JR, Petroni ML, et al. (2002) Immunohis-tochemical identification of the b3-adrenoceptor in intacthuman adipocytes and ventricular myocardium: effect ofobesity and treatment with ephedrine and caffeine. Int JObes Relat Metab Disord 26, 1442–1450.

55. Buemann B, Toubro S & Astrup A (2000) Effects of the twob3-agonists, ZD7114 and ZD2079 on 24 hour energy expen-diture and respiratory quotient in obese subjects. Int J ObesRelat Metab Disord 24, 1553–1560.

56. Redman LM, de Jonge L, Fang X, et al. (2007) Lack ofan effect of a novel b3-adrenoceptor agonist, TAK-677, onenergy metabolism in obese individuals: a double-blind,placebo-controlled randomized study. J Clin EndocrinolMetab 92, 527–531.

57. Gomez-Ambrosi J, Fruhbeck G, Aguado M, et al. (2001)Divergent effects of an a2-adrenergic antagonist on lipolysisand thermogenesis: interactions with a b3-adrenergicagonist in rats. Int J Mol Med 8, 103–109.

58. Lafontan M & Berlan M (1995) Fat cell a2-adrenoceptors:the regulation of fat cell function and lipolysis. EndocrRev 16, 716–738.

59. Langin D (2006) Adipose tissue lipolysis as a metabolicpathway to define pharmacological strategies against obesityand the metabolic syndrome. Pharmacol Res 53, 482–491.

60. Fruhbeck G, Becerril S, Sainz N, et al. (2009) BAT: anew target for human obesity? Trends Pharmacol Sci 30,387–396.

61. Fruhbeck G, Sesma P & Burrell MA (2009) PRDM16:the interconvertible adipo-myocyte switch. Trends CellBiol 19, 141–146.

62. Lafontan M (2005) Fat cells: afferent and efferent messagesdefine new approaches to treat obesity. Annu RevPharmacol Toxicol 45, 119–146.

63. Jaworski K, Sarkadi-Nagy E, Duncan RE, et al. (2007)Regulation of triglyceride metabolism. IV. Hormonal


Nut

ritio

n R

esea

rch

Rev

iew

s

regulation of lipolysis in adipose tissue. Am J PhysiolGastrointest Liver Physiol 293, G1–G4.

64. Møller N & Jørgensen JOL (2009) Effects of growthhormone on glucose, lipid, and protein metabolism inhuman subjects. Endocr Rev 30, 152–177.

65. Yip RG & Goodman HM (1999) Growth hormone and dexa-methasone stimulate lipolysis and activate adenylyl cyclasein rat adipocytes by selectively shifting Gia2 to lower densitymembrane fractions. Endocrinology 140, 1219–1227.

66. Gravholt CH, Schmitz O, Simonsen L, et al. (1999) Effects ofa physiological GH pulse on interstitial glycerol in abdomi-nal and femoral adipose tissue. Am J Physiol 277,E848–E854.

67. Samra JS, Clark ML, Humphreys SM, et al. (1999) Suppres-sion of the nocturnal rise in growth hormone reducessubsequent lipolysis in subcutaneous adipose tissue. EurJ Clin Invest 29, 1045–1052.

68. Sakharova AA, Horowitz JF, Surya S, et al. (2008) Roleof growth hormone in regulating lipolysis, proteolysis,and hepatic glucose production during fasting. J ClinEndocrinol Metab 93, 2755–2759.

69. Nordstrom SM, Tran JL, Sos BC, et al. (2013) Disruption ofJAK2 in adipocytes impairs lipolysis and improves fattyliver in mice with elevated GH. Mol Endocrinol 27,1333–1342.

70. Djurhuus CB, Gravholt CH, Nielsen S, et al. (2002) Effects ofcortisol on lipolysis and regional interstitial glycerol levelsin humans. Am J Physiol Endocrinol Metab 283,E172–E177.

71. Samra JS, Clark ML, Humphreys SM, et al. (1998) Effects ofphysiological hypercortisolemia on the regulation of lipo-lysis in subcutaneous adipose tissue. J Clin EndocrinolMetab 83, 626–631.

72. Ottosson M, Lonnroth P, Bjorntorp P, et al. (2000) Effects ofcortisol and growth hormone on lipolysis in human adiposetissue. J Clin Endocrinol Metab 85, 799–803.

73. Taniguchi A, Kataoka K, Kono T, et al. (1987) Parathyroidhormone-induced lipolysis in human adipose tissue. J LipidRes 28, 490–494.

74. Xu XF, De Pergola G & Bjorntorp P (1991) Testosteroneincreases lipolysis and the number of b-adrenoceptors inmale rat adipocytes. Endocrinology 128, 379–382.

75. Dicker A, Ryden M, Naslund E, et al. (2004) Effect of testos-terone on lipolysis in human pre-adipocytes from differentfat depots. Diabetologia 47, 420–428.

76. Arner P (2005) Effects of testosterone on fat cell lipolysis.Species differences and possible role in polycystic ovariansyndrome. Biochimie 87, 39–43.

77. Zang H, Ryden M, Wahlen K, et al. (2007) Effects oftestosterone and estrogen treatment on lipolysis signalingpathways in subcutaneous adipose tissue of postmeno-pausal women. Fertil Steril 88, 100–106.

78. Fan W, Yanase T, Nomura M, et al. (2005) Androgen recep-tor null male mice develop late-onset obesity caused bydecreased energy expenditure and lipolytic activity butshow normal insulin sensitivity with high adiponectinsecretion. Diabetes 54, 1000–1008.

79. Blouin K, Nadeau M, Perreault M, et al. (2010) Effects ofandrogens on adipocyte differentiation and adipose tissueexplant metabolism in men and women. Clin Endocrinol(Oxf) 72, 176–188.

80. Bertin E, Arner P, Bolinder J, et al. (2001) Action ofglucagon and glucagon-like peptide-1-(7-36) amide on lipo-lysis in human subcutaneous adipose tissue and skeletalmuscle in vivo. J Clin Endocrinol Metab 86, 1229–1234.

81. Gravholt CH, Moller N, Jensen MD, et al. (2001) Physio-logical levels of glucagon do not influence lipolysis in

abdominal adipose tissue as assessed by microdialysis.J Clin Endocrinol Metab 86, 2085–2089.

82. Sancho V, Trigo MV, Martin-Duce A, et al. (2006) Effect ofGLP-1 on d-glucose transport, lipolysis and lipogenesis inadipocytes of obese subjects. Int J Mol Med 17, 1133–1137.

83. Vendrell J, El Bekay R, Peral B, et al. (2011) Study ofthe potential association of adipose tissue GLP-1 receptorwith obesity and insulin resistance. Endocrinology 152,4072–4079.

84. Fruhbeck G, Gomez-Ambrosi J, Muruzabal FJ, et al. (2001)The adipocyte: a model for integration of endocrine andmetabolic signaling in energy metabolism regulation. AmJ Physiol Endocrinol Metab 280, E827–E847.

85. Fruhbeck G & Gomez Ambrosi J (2001) Rationale for theexistence of additional adipostatic hormones. FASEB J 15,1996–2006.

86. Trayhurn P (2007) Adipocyte biology. Obes Rev 8, Suppl. 1,41–44.

87. Sun K, Kusminski CM & Scherer PE (2011) Adipose tissueremodeling and obesity. J Clin Invest 121, 2094–2101.

88. Fortuno A, Rodrıguez A, Gomez-Ambrosi J, et al. (2003)Adipose tissue as an endocrine organ: role of leptin andadiponectin in the pathogenesis of cardiovascular diseases.J Physiol Biochem 59, 51–60.

89. Fruhbeck G (2006) Hunting for new pieces to the complexpuzzle of obesity. Proc Nutr Soc 65, 329–347.

90. Ahima RS & Lazar MA (2008) Adipokines and the peripheraland neural control of energy balance. Mol Endocrinol 22,1023–1031.

91. Gomez-Ambrosi J, Rodrıguez A, Catalan V, et al. (2008)The bone-adipose axis in obesity and weight loss. ObesSurg 18, 1134–1143.

92. Liu Y, Song CY, Wu SS, et al. (2013) Novel adipokines andbone metabolism. Int J Endocrinol 2013, 895045.

93. Trayhurn P (2013) Hypoxia and adipose tissue function anddysfunction in obesity. Physiol Rev 93, 1–21.

94. Hefetz-Sela S & Scherer PE (2013) Adipocytes: impact ontumor growth and potential sites for therapeutic interven-tion. Pharmacol Ther 138, 197–210.

95. Gomez-Ambrosi J & Fruhbeck G (2001) Do resistin andresistin-like molecules also link obesity to inflammatorydiseases? Ann Intern Med 135, 306–307.

96. Gomez-Ambrosi J, Salvador J, Paramo JA, et al. (2002)Involvement of leptin in the association betweenpercentage of body fat and cardiovascular risk factors.Clin Biochem 35, 315–320.

97. Fortuno A, Rodrıguez A, Gomez-Ambrosi J, et al. (2002)Leptin inhibits angiotensin II-induced intracellular calciumincrease and vasoconstriction in the rat aorta. Endo-crinology 143, 3555–3560.

98. Rodrıguez A, Catalan V, Becerril S, et al. (2008) Impairedadiponectin-AMPK signalling in insulin-sensitive tissues ofhypertensive rats. Life Sci 83, 540–549.

99. Poulain-Godefroy O, Lecoeur C, Pattou F, et al. (2008)Inflammation is associated with a decrease of lipogenicfactors in omental fat in women. Am J Physiol RegulIntegr Comp Physiol 295, R1–R7.

100. Muruzabal FJ, Fruhbeck G, Gomez-Ambrosi J, et al. (2002)Immunocytochemical detection of leptin in non-mamma-lian vertebrate stomach. Gen Comp Endocrinol 128,149–152.

101. Martın M, Burrell MA, Gomez-Ambrosi J, et al. (2012)Short- and long-term changes in gastric morphology andhistopathology following sleeve gastrectomy indiet-induced obese rats. Obes Surg 22, 634–640.

102. Seeley RJ & Tschop MH (2011) Uroguanylin: how the gutgot another satiety hormone. J Clin Invest 121, 3384–3386.


Nut

ritio

n R

esea

rch

Rev

iew

s

103. Fruhbeck G (2012) Gastrointestinal hormones: uroguanylin– a new gut-derived weapon against obesity? Nat RevEndocrinol 8, 5–6.

104. Campo A, Fruhbeck G, Zulueta JJ, et al. (2007) Hyper-leptinaemia, respiratory drive and hypercapnic responsein obese patients. Eur Respir J 30, 223–231.

105. Fernandez-Real JM, Valdes S, Manco M, et al. (2010)Surfactant protein D, a marker of lung innate immunity, ispositively associated with insulin sensitivity. Diabetes Care33, 847–853.

106. Weng M, Raher MJ, Leyton P, et al. (2011) Adiponectindecreases pulmonary arterial remodeling in murinemodels of pulmonary hypertension. Am J Respir Cell MolBiol 45, 340–347.

107. Sainz N, Rodrıguez A, Catalan V, et al. (2010) Leptin admin-istration downregulates the increased expression levels ofgenes related to oxidative stress and inflammation in theskeletal muscle of ob/ob mice. Mediators Inflamm 2010,784343.

108. Sainz N, Rodrıguez A, Catalan V, et al. (2012) Leptin reducesthe expression and increases the phosphorylation of thenegative regulators of GLUT4 traffic TBC1D1 and TBC1D4in muscle of ob/ob mice. PLOS ONE 7, e29389.

109. Taube A, Lambernd S, van Echten-Deckert G, et al. (2012)Adipokines promote lipotoxicity in human skeletal musclecells. Arch Physiol Biochem 118, 92–101.

110. Sainz N, Rodrıguez A, Catalan V, et al. (2009) Leptin admin-istration favors muscle mass accretion by decreasingFoxO3a and increasing PGC-1a in ob/ob mice. PLoS ONE4, e6808.

111. Gannage-Yared MH, Yaghi C, Habre B, et al. (2008)Osteoprotegerin in relation to body weight, lipid par-ameters insulin sensitivity, adipocytokines, and C-reactiveprotein in obese and non-obese young individuals: resultsfrom both cross-sectional and interventional study. EurJ Endocrinol 158, 353–359.

112. Trayhurn P, Drevon CA & Eckel J (2011) Secreted proteinsfrom adipose tissue and skeletal muscle – adipokines,myokines and adipose/muscle cross-talk. Arch PhysiolBiochem 117, 47–56.

113. Berg AH & Scherer PE (2005) Adipose tissue, inflammation,and cardiovascular disease. Circ Res 96, 939–949.

114. Qatanani M & Lazar MA (2007) Mechanisms of obesity-associated insulin resistance: many choices on the menu.Genes Dev 21, 1443–1455.

115. Arner P, Bernard S, Salehpour M, et al. (2011) Dynamicsof human adipose lipid turnover in health and metabolicdisease. Nature 478, 110–113.

116. ArnerE,RydenM&ArnerP (2010)Tumor necrosis factora andregulation of adipose tissue. N Engl J Med 362, 1151–1153.

117. Langin D & Arner P (2006) Importance of TNFa andneutral lipases in human adipose tissue lipolysis. TrendsEndocrinol Metab 17, 314–320.

118. Laurencikiene J, van Harmelen V, Arvidsson Nordstrom E,et al. (2007) NF-kB is important for TNF-a-induced lipolysisin human adipocytes. J Lipid Res 48, 1069–1077.

119. Cawthorn WP & Sethi JK (2008) TNF-a and adipocytebiology. FEBS Lett 582, 117–131.

120. Ryden M & Arner P (2007) Tumour necrosis factor-a inhuman adipose tissue – from signalling mechanisms toclinical implications. J Intern Med 262, 431–438.

121. Gonzalez-Yanes C & Sanchez-Margalet V (2006) Signallingmechanisms regulating lipolysis. Cell Signal 18, 401–408.

122. Botion LM, Brasier AR, Tian B, et al. (2001) Inhibition ofproteasome activity blocks the ability of TNFa to down-regulate Gi proteins and stimulate lipolysis. Endocrinology142, 5069–5075.

123. Xu H & Hotamisligil GS (2001) Signaling pathways utilizedby tumor necrosis factor receptor 1 in adipocytes tosuppress differentiation. FEBS Lett 506, 97–102.

124. Xu H, Hirosumi J, Uysal KT, et al. (2002) Exclusive action oftransmembrane TNF a in adipose tissue leads to reducedadipose mass and local but not systemic insulin resistance.Endocrinology 143, 1502–1511.

125. Zhang HH, Halbleib M, Ahmad F, et al. (2002) Tumor necrosisfactor-a stimulates lipolysis in differentiated humanadipocytes through activation of extracellular signal-relatedkinase and elevation of intracellular cAMP. Diabetes 51,2929–2935.

126. Souza SC, Palmer HJ, Kang YH, et al. (2003) TNF-a induc-tion of lipolysis is mediated through activation of the extra-cellular signal related kinase pathway in 3T3-L1 adipocytes.J Cell Biochem 89, 1077–1086.

127. Jager J, Gremeaux T, Gonzalez T, et al. (2010) Tpl2 kinase isupregulated in adipose tissue in obesity and may mediateinterleukin-1b and tumor necrosis factor-a effects onextracellular signal-regulated kinase activation and lipolysis.Diabetes 59, 61–70.

128. van Hall G, Steensberg A, Sacchetti M, et al. (2003) Inter-leukin-6 stimulates lipolysis and fat oxidation in humans.J Clin Endocrinol Metab 88, 3005–3010.

129. Yang Y, Ju D, Zhang M, et al. (2008) Interleukin-6 stimulateslipolysis in porcine adipocytes. Endocrine 33, 261–269.

130. Jensen MD (2003) Cytokine regulation of lipolysis inhumans? J Clin Endocrinol Metab 88, 3003–3004.

131. Morisset AS, Huot C, Legare D, et al. (2008) Circulating IL-6concentrations and abdominal adipocyte isoproterenol-stimulated lipolysis in women. Obesity (Silver Spring) 16,1487–1492.

132. Holmes AG, Watt MJ & Febbraio MA (2004) Suppressinglipolysis increases interleukin-6 at rest and duringprolonged moderate-intensity exercise in humans. J ApplPhysiol 97, 689–696.

133. Hiscock N, Fischer CP, Sacchetti M, et al. (2005) Recombinanthuman interleukin-6 infusion during low-intensity exercisedoes not enhance whole body lipolysis or fat oxidation inhumans. Am J Physiol Endocrinol Metab 289, E2–E7.

134. Carbo N, Lopez-Soriano J, Costelli P, et al. (2001) Interleu-kin-15 mediates reciprocal regulation of adipose andmuscle mass: a potential role in body weight control.Biochim Biophys Acta 1526, 17–24.

135. Ajuwon KM & Spurlock ME (2004) Direct regulation of lipo-lysis by interleukin-15 in primary pig adipocytes. Am JPhysiol Regul Integr Comp Physiol 287, R608–R611.

136. Quinn LS, Strait-Bodey L, Anderson BG, et al. (2005) Inter-leukin-15 stimulates adiponectin secretion by 3T3-L1 adipo-cytes: evidence for a skeletal muscle-to-fat signalingpathway. Cell Biol Int 29, 449–457.

137. Fruhbeck G, Jebb SA & Prentice AM (1998) Leptin:physiology and pathophysiology. Clin Physiol 18, 399–419.

138. Fruhbeck G (2002) Peripheral actions of leptin and its invol-vement in disease. Nutr Rev 60, S47–S55.

139. Fruhbeck G (2001) A heliocentric view of leptin. Proc NutrSoc 60, 301–318.

140. Fruhbeck G, Aguado M & Martınez JA (1997) In vitro lipo-lytic effect of leptin on mouse adipocytes: evidence for apossible autocrine/paracrine role of leptin. BiochemBiophys Res Commun 240, 590–594.

141. Fruhbeck G, Aguado M, Gomez-Ambrosi J, et al. (1998)Lipolytic effect of in vivo leptin administration on adipo-cytes of lean and ob/ob mice, but not db/db mice. BiochemBiophys Res Commun 250, 99–102.

142. Wang MY, Lee Y & Unger RH (1999) Novel form of lipolysisinduced by leptin. J Biol Chem 274, 17541–17544.


Nut

ritio

n R

esea

rch

Rev

iew

s

143. Fruhbeck G, Gomez Ambrosi J & Salvador J (2001) Leptin-induced lipolysis opposes the tonic inhibition of endogen-ous adenosine in white adipocytes. FASEB J 15, 333–340.

144. Honnor RC, Dhillon GS & Londos C (1985) cAMP-dependent protein kinase and lipolysis in rat adipocytes.I. Cell preparation, manipulation, and predictability inbehavior. J Biol Chem 260, 15122–15129.

145. Honnor RC, Dhillon GS & Londos C (1985) cAMP-dependent protein kinase and lipolysis in rat adipocytes.II. Definition of steady-state relationship with lipolytic andantilipolytic modulators. J Biol Chem 260, 15130–15138.

146. Rice AM, Fain JN & Rivkees SA (2000) A1 adenosinereceptor activation increases adipocyte leptin secretion.Endocrinology 141, 1442–1445.

147. Greenberg AS, Taylor SI & Londos C (1987) Presence ofa functional inhibitory GTP-binding regulatory component,Gi, linked to adenylate cyclase in adipocytes of ob/ob mice.J Biol Chem 262, 4564–4568.

148. Vannucci SJ, Klim CM, Martin LF, et al. (1989) A1-adenosinereceptor-mediated inhibition of adipocyte adenylate cyclaseand lipolysis in Zucker rats. Am J Physiol 257, E871–E878.

149. Martin LF, Klim CM & Vannucci SJ (1990) Alterations inadipocyte adenylate cyclase activity in morbidly obeseand formerly morbidly obese humans. Surgery 108,228–234, ; discussion 234–225.

150. Wang MY, Orci L, Ravazzola M, et al. (2005) Fat storagein adipocytes requires inactivation of leptin’s paracrineactivity: implications for treatment of human obesity. ProcNatl Acad Sci U S A 102, 18011–18016.

151. Gomez-Ambrosi J, Fruhbeck G & Martınez JA (1999) Leptin,but not a b3-adrenergic agonist, upregulates muscleuncoupling protein-3 messenger RNA expression: short-term thermogenic interactions. Cell Mol Life Sci 55,992–997.

152. Fruhbeck G & Salvador J (2000) Relations between leptin andthe regulation of glucose metabolism. Diabetologia 43, 3–12.

153. Elinson N, Amichay D & Birk RZ (2006) Leptin directlyregulates exocrine pancreas lipase and two related proteinsin the rat. Br J Nutr 96, 691–696.

154. Morioka T, Asilmaz E, Hu J, et al. (2007) Disruption of leptinreceptor expression in the pancreas directly affects b cellgrowth and function in mice. J Clin Invest 117, 2860–2868.

155. Ren J, Dong F, Cai G-J, et al. (2010) Interaction between ageand obesity on cardiomyocyte contractile function: role ofleptin and stress signaling. PLoS ONE 5, e10085.

156. Becerril S, Gomez-Ambrosi J, Martin M, et al. (2013) Role ofPRDM16 in the activation of brown fat programming.Relevance to the development of obesity. Histol Histopathol28, 1411–1425.

157. Huynh FK, Neumann UH, Wang Y, et al. (2013) A rolefor hepatic leptin signaling in lipid metabolism via alteredvery low density lipoprotein composition and liver lipaseactivity in mice. Hepatology 57, 543–554.

158. Shapiro L & Scherer PE (1998) The crystal structure of acomplement-1q family protein suggests an evolutionarylink to tumor necrosis factor. Curr Biol 8, 335–338.

159. Bullo M, Salas-Salvado J & Garcia-Lorda P (2005)Adiponectin expression and adipose tissue lipolytic activityin lean and obese women. Obes Surg 15, 382–386.

160. Lavoie F, Frisch F, Brassard P, et al. (2009) Relationshipbetween total and high molecular weight adiponectinlevels and plasma nonesterified fatty acid tolerance duringenhanced intravascular triacylglycerol lipolysis in men.J Clin Endocrinol Metab 94, 998–1004.

161. Wedellova Z, Dietrich J, Siklova-Vitkova M, et al. (2011)Adiponectin inhibits spontaneous and catecholamine-induced lipolysis in human adipocytes of non-obese

subjects through AMPK-dependent mechanisms. PhysiolRes 60, 139–148.

162. Qiao L, Kinney B, Schaack J, et al. (2011) Adiponectin inhi-bits lipolysis in mouse adipocytes. Diabetes 60, 1519–1527.

163. Kovacova Z, Tencerova M, Roussel B, et al. (2012) Theimpact of obesity on secretion of adiponectin multimericisoforms differs in visceral and subcutaneous adiposetissue. Int J Obes 36, 1360–1365.

164. Wedellova Z, Kovacova Z, Tencerova M, et al. (2013) Theimpact of full-length, trimeric and globular adiponectin onlipolysis in subcutaneous and visceral adipocytes of obeseand non-obese women. PLOS ONE 8, e66783.

165. Gaudiot N, Jaubert AM, Charbonnier E, et al. (1998)Modulation of white adipose tissue lipolysis by nitricoxide. J Biol Chem 273, 13475–13481.

166. Andersson K, Gaudiot N, Ribiere C, et al. (1999) A nitricoxide-mediated mechanism regulates lipolysis in humanadipose tissue in vivo. Br J Pharmacol 126, 1639–1645.

167. Elizalde M, Ryden M, van Harmelen V, et al. (2000)Expression of nitric oxide synthases in subcutaneous adi-pose tissue of nonobese and obese humans. J Lipid Res41, 1244–1251.

168. Engeli S, Janke J, Gorzelniak K, et al. (2004) Regulationof the nitric oxide system in human adipose tissue. J LipidRes 45, 1640–1648.

169. Penfornis P & Marette A (2005) Inducible nitric oxidesynthase modulates lipolysis in adipocytes. J Lipid Res 46,135–142.

170. Engeli S, Boschmann M, Adams F, et al. (2007) Dissociationbetween adipose nitric oxide synthase expression andtissue metabolism. J Clin Endocrinol Metab 92, 2706–2711.

171. Fruhbeck G (1999) Pivotal role of nitric oxide in the controlof blood pressure after leptin administration. Diabetes 48,903–908.

172. Fruhbeck G (2006) Intracellular signalling pathways acti-vated by leptin. Biochem J 393, 7–20.

173. Fruhbeck G & Gomez-Ambrosi J (2001) Modulation ofthe leptin-induced white adipose tissue lipolysis by nitricoxide. Cell Signal 13, 827–833.

174. Becerril S, Rodrıguez A, Catalan V, et al. (2010) Deletion ofinducible nitric-oxide synthase in leptin-deficient miceimproves brown adipose tissue function. PLoS ONE 5,e10962.

175. Becerril S, Rodrıguez A, Catalan V, et al. (2012) Transcrip-tional analysis of brown adipose tissue in leptin-deficientmice lacking inducible nitric oxide synthase: evidence ofthe role of Med1 in energy balance. Physiol Genomics 44,678–688.

176. Mehebik N, Jaubert AM, Sabourault D, et al. (2005) Leptin-induced nitric oxide production in white adipocytes ismediated through PKA and MAP kinase activation. Am JPhysiol Cell Physiol 289, C379–C387.

177. Lafontan M, Moro C, Berlan M, et al. (2008) Control oflipolysis by natriuretic peptides and cyclic GMP. TrendsEndocrinol Metab 19, 130–137.

178. Sengenes C, Berlan M, De Glisezinski I, et al. (2000)Natriuretic peptides: a new lipolytic pathway in humanadipocytes. FASEB J 14, 1345–1351.

179. Galitzky J, Sengenes C, Thalamas C, et al. (2001) The lipid-mobilizing effect of atrial natriuretic peptide is unrelated tosympathetic nervous system activation or obesity in youngmen. J Lipid Res 42, 536–544.

180. Sengenes C, Bouloumie A, Hauner H, et al. (2003)Involvement of a cGMP-dependent pathway in thenatriuretic peptide-mediated hormone-sensitive lipasephosphorylation in human adipocytes. J Biol Chem 278,48617–48626.


Nut

ritio

n R

esea

rch

Rev

iew

s

181. Moro C, Crampes F, Sengenes C, et al. (2004) Atrial natriure-tic peptide contributes to physiological control of lipidmobilization in humans. FASEB J 18, 908–910.

182. Moro C, Galitzky J, Sengenes C, et al. (2004) Functionaland pharmacological characterization of the natriureticpeptide-dependent lipolytic pathway in human fat cells.J Pharmacol Exp Ther 308, 984–992.

183. Moro C, Pillard F, de Glisezinski I, et al. (2008) Exercise-induced lipid mobilization in subcutaneous adipose tissueis mainly related to natriuretic peptides in overweightmen. Am J Physiol Endocrinol Metab 295, E505–E513.

184. MoroC, PasaricaM,Elkind-HirschK, et al. (2009)Aerobic exer-cise training improves atrial natriuretic peptide and catechol-amine-mediated lipolysis in obese women with polycysticovary syndrome. J Clin Endocrinol Metab 94, 2579–2586.

185. Birkenfeld AL, Budziarek P, Boschmann M, et al. (2008)Atrial natriuretic peptide induces postprandial lipidoxidation in humans. Diabetes 57, 3199–3204.

186. Moro C & Lafontan M (2013) Natriuretic peptides and cGMPsignaling control of energy homeostasis. Am J Physiol HeartCirc Physiol 304, H358–H368.

187. Horvath TL (2003) Endocannabinoids and the regulation ofbody fat: the smoke is clearing. J Clin Invest 112, 323–326.

188. Di Marzo V (2008) Targeting the endocannabinoid system:to enhance or reduce? Nat Rev Drug Discov 7, 438–455.

189. Moreno-Navarrete JM, Catalan V, Whyte L, et al. (2012) Thel-a-lysophosphatidylinositol/GPR55 system and itspotential role in human obesity. Diabetes 61, 281–291.

190. Cota D, Marsicano G, Tschop M, et al. (2003) The endo-genous cannabinoid system affects energy balance via centralorexigenic drive and peripheral lipogenesis. J Clin Invest 112,423–431.

191. Jbilo O, Ravinet-Trillou C, Arnone M, et al. (2005) The CB1receptor antagonist rimonabant reverses the diet-inducedobesity phenotype through the regulation of lipolysis andenergy balance. FASEB J 19, 1567–1569.

192. Engeli S, Bohnke J, Feldpausch M, et al. (2005) Activation ofthe peripheral endocannabinoid system in human obesity.Diabetes 54, 2838–2843.

193. Matias I, Gonthier MP, Orlando P, et al. (2006) Regulation,function, and dysregulation of endocannabinoids in modelsof adipose and b-pancreatic cells and in obesity and hyper-glycemia. J Clin Endocrinol Metab 91, 3171–3180.

194. Guzman M, Lo Verme J, Fu J, et al. (2004) Oleoylethanola-mide stimulates lipolysis by activating the nuclear receptorperoxisome proliferator-activated receptor a (PPAR-a).J Biol Chem 279, 27849–27854.

195. Martinez de Ubago M, Garcia-Oya I & Perez-Perez A (2009)Oleoylethanolamide, a natural ligand for PPAR-a, inhibitsinsulin receptor signalling in HTC rat hepatoma cells.Biochim Biophys Acta 1791, 740–745.

196. Muccioli G, Pons N, Ghe C, et al. (2004) Ghrelin and des-acyl ghrelin both inhibit isoproterenol-induced lipolysis inrat adipocytes via a non-type 1a growth hormone secreta-gogue receptor. Eur J Pharmacol 498, 27–35.

197. Baragli A, Ghe C, Arnoletti E, et al. (2011) Acylated andunacylated ghrelin attenuate isoproterenol-induced lipoly-sis in isolated rat visceral adipocytes through activationof phosphoinositide 3-kinase g and phosphodiesterase3B. Biochim Biophys Acta 1811, 386–396.

198. Vestergaard ET, Gormsen LC, Jessen N, et al. (2008) Ghrelininfusion in humans induces acute insulin resistanceand lipolysis independent of growth hormone signaling.Diabetes 57, 3205–3210.

199. Rodrıguez A, Gomez-Ambrosi J, Catalan V, et al. (2009)Acylated and desacyl ghrelin stimulate lipid accumulationin human visceral adipocytes. Int J Obes 33, 541–552.

200. Rodrıguez A, Gomez-Ambrosi J, Catalan V, et al. (2012) Theghrelin O-acyltransferase-ghrelin system reduces TNF-a-induced apoptosis and autophagy in human visceraladipocytes. Diabetologia 55, 3038–3050.

201. Carlson LA & Oro L (1962) The effect of nicotinic acid onthe plasma free fatty acid; demonstration of a metabolictype of sympathicolysis. Acta Med Scand 172, 641–645.

202. Carlson LA & Hanngren A (1964) Initial distribution in miceof 3H-labeled nicotinic acid studied with autoradiography.Life Sci 3, 867–871.

203. Karpe F & Frayn KN (2004) The nicotinic acid receptor – anew mechanism for an old drug. Lancet 363, 1892–1894.

204. Oh YT, Oh KS, Choi YM, et al. (2011) Continuous 24-hnicotinic acid infusion in rats causes FFA rebound and insu-lin resistance by altering gene expression and basal lipolysisin adipose tissue. Am J Physiol Endocrinol Metab 300,E1012–E1021.

205. Tisdale MJ (2009) Zinc-a2-glycoprotein in cachexia andobesity. Curr Opin Support Palliat Care 3, 288–293.

206. Bing C, Mracek T, Gao D, et al. (2010) Zinc-a2-glycoprotein:an adipokine modulator of body fat mass? Int J Obes (Lond)34, 1559–1565.

207. Cabassi A & Tedeschi S (2013) Zinc-a2-glycoprotein as amarker of fat catabolism in humans. Curr Opin Clin NutrMetab Care 16, 267–271.

208. Bing C, Bao Y, Jenkins J, et al. (2004) Zinc-a2-glycoprotein,a lipid mobilizing factor, is expressed in adipocytes andis up-regulated in mice with cancer cachexia. Proc NatlAcad Sci U S A 101, 2500–2505.

209. Wargent ET, O’Dowd JF, Zaibi MS, et al. (2013) Contrastsbetween the effects of zinc-a2-glycoprotein, a putativeb3/2-adrenoceptor agonist and the b3/2-adrenoceptor ago-nist BRL35135 in C57Bl/6 (ob/ob) mice. J Endocrinol 216,157–168.

210. Eckardt K, Schober A, Platzbecker B, et al. (2011) Theadipokine zinc-a2-glycoprotein activates AMP kinase inhuman primary skeletal muscle cells. Arch Physiol Biochem117, 88–93.

211. Sarzani R, Salvi F, Dessi-Fulgheri P, et al. (2008) Renin-angiotensin system, natriuretic peptides, obesity, metabolicsyndrome, and hypertension: an integrated view inhumans. J Hypertens 26, 831–843.

212. Goossens GH, Blaak EE, Saris WH, et al. (2004) AngiotensinII-induced effects on adipose and skeletal muscle tissueblood flow and lipolysis in normal-weight and obese sub-jects. J Clin Endocrinol Metab 89, 2690–2696.

213. Fruhbeck G (2004) The adipose tissue as a source of vaso-active factors. Curr Med Chem Cardiovasc Hematol Agents2, 197–208.

214. Juan CC, Chang CL, Lai YH, et al. (2005) Endothelin-1induces lipolysis in 3T3-L1 adipocytes. Am J PhysiolEndocrinol Metab 288, E1146–E1152.

215. Juan CC, Chang LW, Huang SW, et al. (2006) Effect ofendothelin-1 on lipolysis in rat adipocytes. Obesity (SilverSpring) 14, 398–404.

216. van Harmelen V, Eriksson A, Astrom G, et al. (2008)Vascular peptide endothelin-1 links fat accumulation withalterations of visceral adipocyte lipolysis. Diabetes 57,378–386.

217. Eriksson AK, van Harmelen V, Stenson BM, et al. (2009)Endothelin-1 stimulates human adipocyte lipolysis throughthe ET A receptor. Int J Obes (Lond) 33, 67–74.

218. Shichiri M, Fukai N, Ozawa N, et al. (2003) Adrenomedullinis an autocrine/paracrine growth factor for rat vascularsmooth muscle cells. Regul Pept 112, 167–173.

219. Fukai N, Yoshimoto T, Sugiyama T, et al. (2005)Concomitant expression of adrenomedullin and its receptor


Nut

ritio

n R

esea

rch

Rev

iew

s

components in rat adipose tissues. Am J Physiol EndocrinolMetab 288, E56–E62.

220. Harmancey R, Senard JM, Pathak A, et al. (2005) Thevasoactive peptide adrenomedullin is secreted byadipocytes and inhibits lipolysis through NO-mediatedb-adrenergic agonist oxidation. FASEB J 19, 1045–1047.

221. Iemura-Inaba C, Nishikimi T, Akimoto K, et al. (2008) Roleof adrenomedullin system in lipid metabolism and itssignaling mechanism in cultured adipocytes. Am J PhysiolRegul Integr Comp Physiol 295, R1376–R1384.

222. Boucher J, Masri B, Daviaud D, et al. (2005) Apelin, a newlyidentified adipokine up-regulated by insulin and obesity.Endocrinology 146, 1764–1771.

223. Attane C, Daviaud D, Dray C, et al. (2011) Apelin stimulatesglucose uptake but not lipolysis in human adipose tissueex vivo. J Mol Endocrinol 46, 21–28.

224. Yue P, Jin H, Xu S, et al. (2011) Apelin decreases lipolysisvia Gq, Gi, and AMPK-dependent mechanisms. Endocrin-ology 152, 59–68.

225. Than A, Cheng Y, Foh LC, et al. (2012) Apelin inhibitsadipogenesis and lipolysis through distinct molecularpathways. Mol Cell Endocrinol 362, 227–241.

226. Crowe S, Wu LE, Economou C, et al. (2009) Pigmentepithelium-derived factor contributes to insulin resistancein obesity. Cell Metab 10, 40–47.

227. Sabater M, Moreno-Navarrete JM, Ortega FJ, et al. (2010)Circulating pigment epithelium-derived factor levels areassociated with insulin resistance and decrease afterweight loss. J Clin Endocrinol Metab 95, 4720–4728.

228. Borg ML, Andrews ZB, Duh EJ, et al. (2011) Pigmentepithelium-derived factor regulates lipid metabolism viaadipose triglyceride lipase. Diabetes 60, 1458–1466.

229. Yamagishi S, Amano S, Inagaki Y, et al. (2003) Pigmentepithelium-derived factor inhibits leptin-induced angiogenesisby suppressing vascular endothelial growth factor geneexpression through anti-oxidative properties. Microvasc Res65, 186–190.

230. Wang M, Wang JJ, Li J, et al. (2009) Pigment epithelium-derived factor suppresses adipogenesis via inhibition ofthe MAPK/ERK pathway in 3T3-L1 preadipocytes. Am JPhysiol Endocrinol Metab 297, E1378–E1387.

231. Moreno-Navarrete JM, Touskova V, Sabater M, et al. (2013)Liver, but not adipose tissue PEDF gene expression is associ-ated with insulin resistance. Int J Obes (Lond) 37, 1230–1237.

232. Gomez-Ambrosi J, Salvador J, Rotellar F, et al. (2006)Increased serum amyloid A concentrations in morbidobesity decrease after gastric bypass. Obes Surg 16,262–269.

233. Catalan V, Gomez-Ambrosi J, Rotellar F, et al. (2007) Theobestatin receptor (GPR39) is expressed in human adiposetissue and is down-regulated in obesity-associated type 2diabetes mellitus. Clin Endocrinol 66, 598–601.

234. Catalan V, Gomez-Ambrosi J, Ramırez B, et al. (2007) Pro-inflammatory cytokines in obesity: impact of type 2 diabetesmellitus and gastric bypass. Obes Surg 17, 1464–1474.

235. Catalan V, Gomez-Ambrosi J, Rodrıguez A, et al. (2009)Increased adipose tissue expression of lipocalin-2 in obesityis related to inflammation and matrix metalloproteinase-2and -9 activity in humans. J Mol Med 87, 803–813.

236. Catalan V, Gomez-Ambrosi J, Rodrıguez A, et al. (2011)Up-regulation of the novel proinflammatory adipokineslipocalin-2, chitinase-3 like-1 and osteopontin as well asangiogenic-related factors in visceral adipose tissue ofpatients with colon cancer. J Nutr Biochem 22, 634–641.

237. Catalan V, Gomez-Ambrosi J, Rodrıguez A, et al. (2011)Association of increased Visfatin/PBEF/NAMPT circulatingconcentrations and gene expression levels in peripheral

blood cells with lipid metabolism and fatty liver in humanmorbid obesity. Nutr Metab Cardiovasc Dis 21, 245–253.

238. Moreno-Navarrete JM, Catalan V, Ortega F, et al. (2010)Circulating omentin concentration increases after weightloss. Nutr Metab 7, 27.

239. Catalan V, Gomez-Ambrosi J, Rodrıguez A, et al. (2012)Increased tenascin C and toll-like receptor 4 levels invisceral adipose tissue as a link between inflammationand extracellular matrix remodeling in obesity. J ClinEndocrinol Metab 97, E1880–E1889.

240. Catalan V, Gomez-Ambrosi J, Rodrıguez A, et al. (2013)Increased levels of chemerin and its receptor, chemokine-like receptor-1, in obesity are related to inflammation:tumor necrosis factor-a stimulates mRNA levels of chemerinin visceral adipocytes from obese patients. Surg Obes RelatDis 9, 306–314.

241. Gomez-Ambrosi J, Rodrıguez A, Catalan V, et al. (2008)Serum retinol-binding protein 4 is not increased in obesityor obesity-associated type 2 diabetes mellitus, but isreduced after relevant reductions in body fat followinggastric bypass. Clin Endocrinol 69, 208–215.

242. Ding C, Gao D, Wilding J, et al. (2012) Vitamin D signallingin adipose tissue. Br J Nutr 108, 1915–1923.

243. Possenti R, Muccioli G, Petrocchi P, et al. (2012) Character-ization of a novel peripheral pro-lipolytic mechanism inmice: role of VGF-derived peptide TLQP-21. BiochemJ 441, 511–522.

244. Gomez-Ambrosi J, Catalan V, Ramırez B, et al. (2007)Plasma osteopontin levels and expression in adiposetissue are increased in obesity. J Clin Endocrinol Metab92, 3719–3727.

245. Fernandez-Real JM, Izquierdo M, Ortega F, et al. (2009) Therelationship of serum osteocalcin concentration to insulinsecretion, sensitivity, and disposal with hypocaloric diet andresistance training. J Clin Endocrinol Metab 94, 237–245.

246. Bays HE, Gonzalez-Campoy JM, Bray GA, et al. (2008)Pathogenic potential of adipose tissue and metabolic conse-quences of adipocyte hypertrophy and increased visceraladiposity. Expert Rev Cardiovasc Ther 6, 343–368.

247. Wood IS & Trayhurn P (2006) Adipokines and the signalingrole of adipose tissue in inflammation and obesity. FutureLipidol 1, 81–89.

248. Haemmerle G, Lass A, Zimmermann R, et al. (2006)Defective lipolysis and altered energy metabolism in micelacking adipose triglyceride lipase. Science 312, 734–737.

249. Reynisdottir S, Dauzats M, Thorne A, et al. (1997) Compari-son of hormone-sensitive lipase activity in visceral andsubcutaneous human adipose tissue. J Clin EndocrinolMetab 82, 4162–4166.

250. Osuga J-I, Ishibashi S, Oka T, et al. (2000) Targeteddisruption of hormone-sensitive lipase results in male steri-lity and adipocyte hypertrophy, but not in obesity. ProcNatl Acad Sci U S A 97, 787–792.

251. Fredrikson G, Tornqvist H & Belfrage P (1986) Hormone-sensitive lipase and monoacylglycerol lipase are bothrequired for complete degradation of adipocyte triacylgly-cerol. Biochim Biophys Acta 876, 288–293.

252. Osuga J, Ishibashi S, Oka T, et al. (2000) Targeted disrup-tion of hormone-sensitive lipase results in male sterilityand adipocyte hypertrophy, but not in obesity. Proc NatlAcad Sci U S A 97, 787–792.

253. Shi Y & Burn P (2004) Lipid metabolic enzymes: emergingdrug targets for the treatment of obesity. Nat Rev DrugDiscov 3, 695–710.

254. Granneman JG & Moore HP (2008) Location, location:protein trafficking and lipolysis in adipocytes. TrendsEndocrinol Metab 19, 3–9.


Nut

ritio

n R

esea

rch

Rev

iew

s

255. Bezaire V & Langin D (2009) Regulation of adipose tissuelipolysis revisited. Proc Nutr Soc 68, 350–360.

256. Zimmermann R, Strauss JG, Haemmerle G, et al. (2004)Fat mobilization in adipose tissue is promoted by adiposetriglyceride lipase. Science 306, 1383–1386.

257. Zechner R, Kienesberger PC, Haemmerle G, et al. (2009)Adipose triglyceride lipase and the lipolytic catabolism ofcellular fat stores. J Lipid Res 50, 3–21.

258. Schweiger M, Schreiber R, Haemmerle G, et al. (2006)Adipose triglyceride lipase and hormone-sensitive lipaseare the major enzymes in adipose tissue triacylglycerolcatabolism. J Biol Chem 281, 40236–40241.

259. Thompson BR, Lobo S & Bernlohr DA (2010) Fatty acid fluxin adipocytes: the in’s and out’s of fat cell lipid trafficking.Mol Cell Endocrinol 318, 24–33.

260. Schweiger M, Schoiswohl G, Lass A, et al. (2008) TheC-terminal region of human adipose triglyceride lipase affectsenzyme activity and lipid droplet binding. J Biol Chem 283,17211–17220.

261. Lass A, Zimmermann R, Oberer M, et al. (2011) Lipolysis – ahighly regulated multi-enzyme complex mediates the cata-bolism of cellular fat stores. Prog Lipid Res 50, 14–27.

262. Chakrabarti P, Kim JY, Singh M, et al. (2013) Insulin inhibitslipolysis in adipocytes via the evolutionary conservedmTORC1-Egr1-ATGL-mediated pathway. Mol Cell Biol 33,3659–3666.

263. Haemmerle G, Moustafa T, Woelkart G, et al. (2011) ATGL-mediated fat catabolism regulates cardiac mitochondrialfunction via PPAR-a and PGC-1. Nat Med 17, 1076–1085.

264. Chakrabarti P & Kandror KV (2009) FoxO1 controls insulin-dependent adipose triglyceride lipase (ATGL) expressionand lipolysis in adipocytes. J Biol Chem 284, 13296–13300.

265. Chakrabarti P, English T, Shi J, et al. (2010) Mammalian targetof rapamycin complex 1 suppresses lipolysis, stimulates lipo-genesis, and promotes fat storage. Diabetes 59, 775–781.

266. Chakrabarti P, English T, Karki S, et al. (2011) SIRT1 controlslipolysis in adipocytes via FOXO1-mediated expression ofATGL. J Lipid Res 52, 1693–1701.

267. Yin W, Mu J & Birnbaum MJ (2003) Role of AMP-activatedprotein kinase in cyclic AMP-dependent lipolysis in3T3-L1 adipocytes. J Biol Chem 278, 43074–43080.

268. Daval M, Diot-Dupuy F, Bazin R, et al. (2005) Anti-lipolyticaction of AMP-activated protein kinase in rodent adipo-cytes. J Biol Chem 280, 25250–25257.

269. Gauthier MS, Miyoshi H, Souza SC, et al. (2008) AMP-activated protein kinase is activated as a consequence oflipolysis in the adipocyte: potential mechanism and physio-logical relevance. J Biol Chem 283, 16514–16524.

270. Gaidhu MP, Fediuc S, Anthony NM, et al. (2009) ProlongedAICAR-induced AMP-kinase activation promotes energy dis-sipation in white adipocytes: novel mechanisms integratingHSL and ATGL. J Lipid Res 50, 704–715.

271. Gaidhu MP, Bikopoulos G & Ceddia RB (2012)Chronic AICAR-induced AMP-kinase activation regulatesadipocyte lipolysis in a time-dependent and fat depot-specific manner in rats. Am J Physiol Cell Physiol 303,C1192–C1197.

272. Yang X, Lu X, Lombes M, et al. (2010) The G0/G1 switchgene 2 regulates adipose lipolysis through associationwith adipose triglyceride lipase. Cell Metab 11, 194–205.

273. Schweiger M, Paar M, Eder C, et al. (2012) G0/G1 switchgene-2 regulates human adipocyte lipolysis by affectingactivity and localization of adipose triglyceride lipase.J Lipid Res 53, 2307–2317.

274. Mayer N, Schweiger M, Romauch M, et al. (2013)Development of small-molecule inhibitors targeting adiposetriglyceride lipase. Nat Chem Biol 9, 785–787.

275. Okazaki H, Osuga J, Tamura Y, et al. (2002) Lipolysis inthe absence of hormone-sensitive lipase: evidence for acommon mechanism regulating distinct lipases. Diabetes51, 3368–3375.

276. Haemmerle G, Zimmermann R, Strauss JG, et al. (2002)Hormone-sensitive lipase deficiency in mice changesthe plasma lipid profile by affecting the tissue-specificexpression pattern of lipoprotein lipase in adipose tissueand muscle. J Biol Chem 277, 12946–12952.

277. Holm C (2003) Molecular mechanisms regulating hormone-sensitive lipase and lipolysis. Biochem Soc Trans 31,1120–1124.

278. Peyot ML, Nolan CJ, Soni K, et al. (2004) Hormone-sensitivelipase has a role in lipid signaling for insulin secretion but isnonessential for the incretin action of glucagon-like peptide1. Diabetes 53, 1733–1742.

279. Tansey JT, Sztalryd C, Gruia-Gray J, et al. (2001) Perilipinablation results in a lean mouse with aberrant adipocytelipolysis, enhanced leptin production, and resistance todiet-induced obesity. Proc Natl Acad Sci U S A 98,6494–6499.

280. Tansey JT, Sztalryd C, Hlavin EM, et al. (2004) The centralrole of perilipin A in lipid metabolism and adipocyte lipo-lysis. IUBMB Life 56, 379–385.

281. Sztalryd C, Xu G, Dorward H, et al. (2003) Perilipin A isessential for the translocation of hormone-sensitive lipaseduring lipolytic activation. J Cell Biol 161, 1093–1103.

282. Belfrage P, Fredrikson G, Olsson H, et al. (1984) Regulationof adipose tissue lipolysis through reversible phosphoryl-ation of hormone-sensitive lipase. Adv Cyclic NucleotideProtein Phosphorylation Res 17, 351–359.

283. Ray H, Beylot M, Arner P, et al. (2003) The presence of a cat-alytically inactive form of hormone-sensitive lipase is associ-ated with decreased lipolysis in abdominal subcutaneousadipose tissue of obese subjects. Diabetes 52, 1417–1422.

284. Greenberg AS, Shen WJ, Muliro K, et al. (2001) Stimulationof lipolysis and hormone-sensitive lipase via the extracellu-lar signal-regulated kinase pathway. J Biol Chem 276,45456–45461.

285. Kralisch S, Klein J, Lossner U, et al. (2005) Isoproterenol,TNFa, and insulin downregulate adipose triglyceridelipase in 3T3-L1 adipocytes. Mol Cell Endocrinol 240,43–49.

286. Kershaw EE, Hamm JK, Verhagen LA, et al. (2006) Adiposetriglyceride lipase: function, regulation by insulin, and com-parison with adiponutrin. Diabetes 55, 148–157.

287. Scherer T, O’Hare J, Diggs-Andrews K, et al. (2011) Braininsulin controls adipose tissue lipolysis and lipogenesis.Cell Metab 13, 183–194.

288. Taschler U, Radner FP, Heier C, et al. (2011) Monoglyceridelipase deficiency in mice impairs lipolysis and attenuatesdiet-induced insulin resistance. J Biol Chem 286,17467–17477.

289. Soni KG, Lehner R, Metalnikov P, et al. (2004) Carboxyles-terase 3 (EC 3.1.1.1) is a major adipocyte lipase. J BiolChem 279, 40683–40689.

290. Wei E, Ben Ali Y, Lyon J, et al. (2010) Loss of TGH/Ces3 inmice decreases blood lipids, improves glucose tolerance,and increases energy expenditure. Cell Metab 11, 183–193.

291. Kienesberger PC, Oberer M, Lass A, et al. (2009) Mamma-lian patatin domain containing proteins: a family withdiverse lipolytic activities involved in multiple biologicalfunctions. J Lipid Res 50, S63–S68.

292. Polson DA & Thompson MP (2003) Adiponutrin mRNAexpression in white adipose tissue is rapidly induced bymeal-feeding a high-sucrose diet. Biochem Biophys ResCommun 301, 261–266.


Nut

ritio

n R

esea

rch

Rev

iew

s

293. Lake AC, Sun Y, Li JL, et al. (2005) Expression, regulation,and triglyceride hydrolase activity of adiponutrin familymembers. J Lipid Res 46, 2477–2487.

294. Johansson LE, Lindblad U, Larsson CA, et al. (2008) Polymor-phisms in the adiponutrin gene are associated with increasedinsulin secretion and obesity. Eur J Endocrinol 159, 577–583.

295. Basantani MK, Sitnick MT, Cai L, et al. (2011) Pnpla3/adiponutrin deficiency in mice does not contribute tofatty liver disease or metabolic syndrome. J Lipid Res 52,318–329.

296. Brasaemle DL (2007) The perilipin family of structural lipiddroplet proteins: stabilization of lipid droplets and controlof lipolysis. J Lipid Res 48, 2547–2559.

297. Brasaemle DL, Subramanian V, Garcia A, et al. (2009) Peri-lipin A and the control of triacylglycerol metabolism. MolCell Biochem 326, 15–21.

298. Robenek H, Robenek MJ, Buers I, et al. (2005) Lipiddroplets gain PAT family proteins by interaction withspecialized plasma membrane domains. J Biol Chem 280,26330–26338.

299. Robenek H, Robenek MJ & Troyer D (2005) PAT familyproteins pervade lipid droplet cores. J Lipid Res 46,1331–1338.

300. Londos C, Brasaemle DL, Schultz CJ, et al. (1999) Perilipins,ADRP, and other proteins that associate with intracellularneutral lipid droplets in animal cells. Semin Cell Dev Biol 10,51–58.

301. Martınez-Botas J, Anderson JB, Tessier D, et al. (2000)Absence of perilipin results in leanness and reverses obesityin Lepr (db/db) mice. Nat Genet 26, 474–479.

302. Brasaemle DL, Rubin B, Harten IA, et al. (2000) Perilipin Aincreases triacylglycerol storage by decreasing the rate oftriacylglycerol hydrolysis. J Biol Chem 275, 38486–38493.

303. Kovsan J, Ben-Romano R, Souza SC, et al. (2007) Regulationof adipocyte lipolysis by degradation of the perilipinprotein: nelfinavir enhances lysosome-mediated perilipinproteolysis. J Biol Chem 282, 21704–21711.

304. Miyoshi H, Perfield JWII, Souza SC, et al. (2007) Control ofadipose triglyceride lipase action by serine 517 of perilipinA globally regulates protein kinase A-stimulated lipolysis inadipocytes. J Biol Chem 282, 996–1002.

305. Miyoshi H, Souza SC, Zhang HH, et al. (2006) Perilipinpromotes hormone-sensitive lipase-mediated adipocytelipolysis via phosphorylation-dependent and -independentmechanisms. J Biol Chem 281, 15837–15844.

306. Miyoshi H, Souza SC, Endo M, et al. (2010) Perilipin over-expression in mice protects against diet-induced obesity.J Lipid Res 51, 975–982.

307. McDonough PM, Maciejewski-Lenoir D, Hartig SM, et al.(2013) Differential phosphorylation of perilipin 1A at theinitiation of lipolysis revealed by novel monoclonalantibodies and high content analysis. PLOS ONE 8, e55511.

308. Yang X, Heckmann BL, Zhang X, et al. (2013) Distinctmechanisms regulate ATGL-mediated adipocyte lipolysisby lipid droplet coat proteins. Mol Endocrinol 27, 116–126.

309. Skinner JR, Harris LA, Shew TM, et al. (2013) Perilipin 1moves between the fat droplet and the endoplasmicreticulum. Adipocyte 2, 80–86.

310. Takahashi Y, Shinoda A, Furuya N, et al. (2013) Perilipin-mediated lipid droplet formation in adipocytes promotessterol regulatory element-binding protein-1 processingand triacylglyceride accumulation. PLOS ONE 8, e64605.

311. Beller M, Sztalryd C, Southall N, et al. (2008) COPI complexis a regulator of lipid homeostasis. PLoS Biol 6, e292.

312. Guo Y, Walther TC, Rao M, et al. (2008) Functional genomicscreen reveals genes involved in lipid-droplet formationand utilization. Nature 453, 657–661.

313. Takashima K, Saitoh A, Hirose S, et al. (2011) GBF1-Arf-COPI-ArfGAP-mediated Golgi-to-ER transport involved inregulation of lipid homeostasis. Cell Struct Funct 36,223–235.

314. Zhou Z, Yon Toh S, Chen Z, et al. (2003) Cidea-deficientmice have lean phenotype and are resistant to obesity.Nat Genet 35, 49–56.

315. Li JZ, Ye J, Xue B, et al. (2007) Cideb regulates diet-inducedobesity, liver steatosis, and insulin sensitivity by controllinglipogenesis and fatty acid oxidation. Diabetes 56,2523–2532.

316. Qi J, Gong J, Zhao T, et al. (2008) Downregulation of AMP-activated protein kinase by Cidea-mediated ubiquitinationand degradation in brown adipose tissue. EMBO J 27,1537–1548.

317. Ye J, Li JZ, Liu Y, et al. (2009) Cideb, an ER- and lipiddroplet-associated protein, mediates VLDL lipidation andmaturation by interacting with apolipoprotein B. CellMetab 9, 177–190.

318. Tiwari S, Siddiqi S & Siddiqi SA (2013) Cideb protein isrequired for the biogenesis of very low density lipoprotein(VLDL) transport vesicle. J Biol Chem 288, 5157–5165.

319. Nordstrom EA, Ryden M, Backlund EC, et al. (2005) Ahuman-specific role of cell death-inducing DFFA (DNAfragmentation factor-a)-like effector A (CIDEA) in adipo-cyte lipolysis and obesity. Diabetes 54, 1726–1734.

320. Pettersson AT, Laurencikiene J, Nordstrom EA, et al. (2008)Characterization of the human CIDEA promoter in fat cells.Int J Obes (Lond) 32, 1380–1387.

321. Christianson JL, Boutet E, Puri V, et al. (2010) Identificationof the lipid droplet targeting domain of the Cidea protein.J Lipid Res 51, 3455–3462.

322. Puri V, Ranjit S, Konda S, et al. (2008) Cidea is associatedwith lipid droplets and insulin sensitivity in humans. ProcNatl Acad Sci U S A 105, 7833–7838.

323. Laurencikiene J, Stenson BM, Arvidsson Nordstrom E, et al.(2008) Evidence for an important role of CIDEA in humancancer cachexia. Cancer Res 68, 9247–9254.

324. Magnusson B, Gummesson A, Glad CA, et al. (2008) Celldeath-inducing DFF45-like effector C is reduced by caloricrestriction and regulates adipocyte lipid metabolism.Metabolism 57, 1307–1313.

325. Ranjit S, Boutet E, Gandhi P, et al. (2011) Regulation offat specific protein 27 by isoproterenol and TNF-a to con-trol lipolysis in murine adipocytes. J Lipid Res 52, 221–236.

326. Kim YJ, Cho SY, Yun CH, et al. (2008) Transcriptionalactivation of Cidec by PPARg2 in adipocyte. BiochemBiophys Res Commun 377, 297–302.

327. Gong J, Sun Z, Wu L, et al. (2011) Fsp27 promotes lipiddroplet growth by lipid exchange and transfer at lipiddroplet contact sites. J Cell Biol 195, 953–963.

328. GrahnTH,ZhangY, LeeMJ, et al. (2013)FSP27andPLIN1 inter-action promotes the formation of large lipid droplets in humanadipocytes. Biochem Biophys Res Commun 432, 296–301.

329. Nian Z, Sun Z, Yu L, et al. (2010) Fat-specific protein 27undergoes ubiquitin-dependent degradation regulated bytriacylglycerol synthesis and lipid droplet formation. J BiolChem 285, 9604–9615.

330. Barneda D, Frontini A, Cinti S, et al. (2013) Dynamicchanges in lipid droplet-associated proteins in the“browning” of white adipose tissues. Biochim BiophysActa 1831, 924–933.

331. Muller G, Wied S, Walz N, et al. (2008) Translocation of gly-cosylphosphatidylinositol-anchored proteins from plasmamembrane microdomains to lipid droplets in rat adipocytesis induced by palmitate, H2O2, and the sulfonylurea drugglimepiride. Mol Pharmacol 73, 1513–1529.


Nut

ritio

n R

esea

rch

Rev

iew

s

332. Muller G, Jung C, Wied S, et al. (2009) Induced trans-location of glycosylphosphatidylinositol-anchored proteinsfrom lipid droplets to adiposomes in rat adipocytes.Br J Pharmacol 158, 749–770.

333. Muller G (2011) Control of lipid storage and cell sizebetween adipocytes by vesicle-associated glycosylphospha-tidylinositol-anchored proteins. Arch Physiol Biochem 117,23–43.

334. Adeyo O, Goulbourne CN, Bensadoun A, et al. (2012)Glycosylphosphatidylinositol-anchored high-density lipo-protein-binding protein 1 and the intravascular processingof triglyceride-rich lipoproteins. J Intern Med 272, 528–540.

335. Peinado JR, Pardo M, de la Rosa O, et al. (2012) Proteomiccharacterization of adipose tissue constituents, a necessarystep for understanding adipose tissue complexity. Proteo-mics 12, 607–620.

336. Malagon MM, Cruz D, Vazquez-Martinez R, et al. (2005)Analysis of Rab18 and a new golgin in the secretory path-way. Ann N Y Acad Sci 1040, 137–139.

337. Pulido MR, Diaz-Ruiz A, Jimenez-Gomez Y, et al. (2011)Rab18 dynamics in adipocytes in relation to lipogenesis,lipolysis and obesity. PLoS ONE 6, e22931.

338. Pulido MR, Rabanal-Ruiz Y, Almabouada F, et al. (2013)Nutritional, hormonal, and depot-dependent regulation ofthe expression of the small GTPase Rab18 in rodent adiposetissue. J Mol Endocrinol 50, 19–29.

339. Fruhbeck G (2005) Obesity: aquaporin enters the picture.Nature 438, 436–437.

340. Fruhbeck G, Catalan V, Gomez-Ambrosi J, et al. (2006)Aquaporin-7 and glycerol permeability as novel obesitydrug-target pathways. Trends Pharmacol Sci 27, 345–347.

341. Walker CG, Holness MJ, Gibbons GF, et al. (2007) Fasting-induced increases in aquaporin 7 and adipose triglyceridelipase mRNA expression in adipose tissue are attenuatedby peroxisome proliferator-activated receptor a deficiency.Int J Obes (Lond) 31, 1165–1171.

342. Hara-Chikuma M, Sohara E, Rai T, et al. (2005) Progressiveadipocyte hypertrophy in aquaporin-7-deficient mice:adipocyte glycerol permeability as a novel regulator of fataccumulation. J Biol Chem 280, 15493–15496.

343. Hibuse T, Maeda N, Nagasawa A, et al. (2006) Aquaporinsand glycerol metabolism. Biochim Biophys Acta 1758,1004–1011.

344. Rodrıguez A, Catalan V, Gomez-Ambrosi J, et al. (2011)Insulin- and leptin-mediated control of aquaglyceroporinsin human adipocytes and hepatocytes is mediated via thePI3K/Akt/mTOR signaling cascade. J Clin EndocrinolMetab 96, E586–E597.

345. Fruhbeck G, Lopez M & Dieguez C (2007) Role of caveolinsin body weight and insulin resistance regulation. TrendsEndocrinol Metab 18, 177–182.

346. Trigatti BL, Anderson RG & Gerber GE (1999) Identificationof caveolin-1 as a fatty acid binding protein. BiochemBiophys Res Commun 255, 34–39.

347. Meshulam T, Simard JR, Wharton J, et al. (2006) Role ofcaveolin-1 and cholesterol in transmembrane fatty acidmovement. Biochemistry (Mosc) 45, 2882–2893.

348. Meshulam T, Breen MR, Liu L, et al. (2011) Caveolins/caveolae protect adipocytes from fatty acid-mediatedlipotoxicity. J Lipid Res 52, 1526–1532.

349. Cohen AW, Razani B, Schubert W, et al. (2004) Role ofcaveolin-1 in the modulation of lipolysis and lipid dropletformation. Diabetes 53, 1261–1270.

350. Covey SD, Brunet RH, Gandhi SG, et al. (2007) Cholesteroldepletion inhibits fatty acid uptake without affecting CD36or caveolin-1 distribution in adipocytes. Biochem BiophysRes Commun 355, 67–71.

351. Cohen AW, Razani B, Wang XB, et al. (2003) Caveolin-1-deficient mice show insulin resistance and defective insulinreceptor protein expression in adipose tissue. Am J PhysiolCell Physiol 285, C222–C235.

352. Ring A, Le Lay S, Pohl J, et al. (2006) Caveolin-1 is requiredfor fatty acid translocase (FAT/CD36) localization andfunction at the plasma membrane of mouse embryonicfibroblasts. Biochim Biophys Acta 1761, 416–423.

353. Zhou D, Samovski D, Okunade AL, et al. (2012) CD36 leveland trafficking are determinants of lipolysis in adipocytes.FASEB J 26, 4733–4742.

354. Vroegrijk IO, van Klinken JB, van Diepen JA, et al. (2013)CD36 is important for adipocyte recruitment and affectslipolysis. Obesity (Silver Spring) 21, 2037–2045.

355. Scheja L, Makowski L, Uysal KT, et al. (1999) Altered insulinsecretion associated with reduced lipolytic efficiency inaP2 -/- mice. Diabetes 48, 1987–1994.

356. Lan H, Cheng CC, Kowalski TJ, et al. (2011) Small-moleculeinhibitors of FABP4/5 ameliorate dyslipidemia but notinsulin resistance in mice with diet-induced obesity. J LipidRes 52, 646–656.

357. Wei S, Zan L, Wang H, et al. (2013) Adenovirus-mediatedinterference of FABP4 regulates mRNA expression ofADIPOQ, LEP and LEPR in bovine adipocytes. Genet MolRes 12, 494–505.

358. Wu Q, Ortegon AM, Tsang B, et al. (2006) FATP1 is aninsulin-sensitive fatty acid transporter involved in diet-induced obesity. Mol Cell Biol 26, 3455–3467.

359. Richards MR, Harp JD, Ory DS, et al. (2006) Fatty acid trans-port protein 1 and long-chain acyl coenzyme A synthetase 1interact in adipocytes. J Lipid Res 47, 665–672.

360. Liu Q, Gauthier MS, Sun L, et al. (2010) Activation of AMP-activated protein kinase signaling pathway by adiponectinand insulin in mouse adipocytes: requirement of acyl-CoAsynthetases FATP1 and Acsl1 and association with anelevation in AMP/ATP ratio. FASEB J 24, 4229–4239.

361. Lenz LS, Marx J, Chamulitrat W, et al. (2011) Adipocyte-specific inactivation of acyl-CoA synthetase fatty acid trans-port protein 4 (Fatp4) in mice causes adipose hypertrophyand alterations in metabolism of complex lipids under highfat diet. J Biol Chem 286, 35578–35587.

362. Phillips CM, Goumidi L, Bertrais S, et al. (2010)Gene-nutrient interactions with dietary fat modulate theassociation between genetic variation of the ACSL1 geneand metabolic syndrome. J Lipid Res 51, 1793–1800.

363. Rodrıguez A, Catalan V, Gomez-Ambrosi J, et al. (2007)Visceral and subcutaneous adiposity: are both potentialtherapeutic targets for tackling the metabolic syndrome?Curr Pharm Des 13, 2169–2175.

364. Tchkonia T, Thomou T, Zhu Y, et al. (2013) Mechanismsand metabolic implications of regional differences amongfat depots. Cell Metab 17, 644–656.

365. Lafontan M & Berlan M (2003) Do regional differences inadipocyte biology provide new pathophysiological insights?Trends Pharmacol Sci 24, 276–283.

366. Caesar R, Manieri M, Kelder T, et al. (2010) A combinedtranscriptomics and lipidomics analysis of subcutaneous,epididymal and mesenteric adipose tissue reveals markedfunctional differences. PLoS ONE 5, e11525.

367. Martin ML & Jensen MD (1991) Effects of body fatdistribution on regional lipolysis in obesity. J Clin Invest88, 609–613.

368. Nielsen S, Guo Z, Johnson CM, et al. (2004) Splanchniclipolysis in human obesity. J Clin Invest 113, 1582–1588.

369. Ibrahim MM (2010) Subcutaneous and visceral adiposetissue: structural and functional differences. Obes Rev 11,11–18.


Nut

ritio

n R

esea

rch

Rev

iew

s

370. Arner P (1995) Differences in lipolysis between humansubcutaneous and omental adipose tissues. Ann Med 27,435–438.

371. Hoffstedt J, Arner P, Hellers G, et al. (1997) Variation inadrenergic regulation of lipolysis between omental andsubcutaneous adipocytes from obese and non-obese men.J Lipid Res 38, 795–804.

372. Zierath JR, Livingston JN, Thorne A, et al. (1998) Regionaldifference in insulin inhibition of non-esterified fatty acidrelease from human adipocytes: relation to insulin receptorphosphorylation and intracellular signalling through theinsulin receptor substrate-1 pathway. Diabetologia 41,1343–1354.

373. Bolinder J, Kager L, Ostman J, et al. (1983) Differences atthe receptor and postreceptor levels between human omen-tal and subcutaneous adipose tissue in the action of insulinon lipolysis. Diabetes 32, 117–123.

374. Rebuffe-Scrive M, Lonnroth P, Marin P, et al. (1987) Regionaladipose tissue metabolism in men and postmenopausalwomen. Int J Obes 11, 347–355.

375. Pedersen SB, Kristensen K, Hermann PA, et al. (2004)Estrogen controls lipolysis by up-regulating a2A-adrenergicreceptors directly in human adipose tissue through theestrogen receptor a. Implications for the female fatdistribution. J Clin Endocrinol Metab 89, 1869–1878.

376. Fruhbeck G & Gomez-Ambrosi J (2002) Depot-specificdifferences in the lipolytic effect of leptin on isolatedwhite adipocytes. Med Sci Monit 8, BR47–BR55.

377. Dessi-Fulgheri P, Sarzani R & Rappelli A (2003) Role of thenatriuretic peptide system in lipogenesis/lipolysis. NutrMetab Cardiovasc Dis 13, 244–249.

378. Dicker A, Astrom G, Wahlen K, et al. (2009) Primarydifferences in lipolysis between human omental andsubcutaneous adipose tissue observed using in vitro differ-entiated adipocytes. Horm Metab Res 41, 350–355.

379. Karelis AD (2011) To be obese – does it matter if you aremetabolically healthy? Nat Rev Endocrinol 7, 699–700.

380. de Gusmao Correia ML (2013) Is ‘metabolically healthy’obesity a benign condition? J Hypertens 31, 39–41.

381. Ahima RS & Lazar MA (2013) Physiology. The health risk ofobesity – better metrics imperative. Science 341, 856–858.

382. Czaja MJ (2011) Functions of autophagy in hepatic andpancreatic physiology and disease. Gastroenterology 140,1895–1908.

383. Singh R & Cuervo AM (2011) Autophagy in the cellularenergetic balance. Cell Metab 13, 495–504.

384. Singh R (2012) Autophagy in the control of food intake.Adipocyte 1, 75–79.

385. Russell RC, Tian Y, Yuan H, et al. (2013) ULK1 inducesautophagy by phosphorylating Beclin-1 and activatingVPS34 lipid kinase. Nat Cell Biol 15, 741–750.

386. Kanazawa T, Taneike I, Akaishi R, et al. (2004) Amino acidsand insulin control autophagic proteolysis through differentsignaling pathways in relation to mTOR in isolated rathepatocytes. J Biol Chem 279, 8452–8459.

387. Pattingre S, Espert L, Biard-Piechaczyk M, et al. (2008)Regulation of macroautophagy by mTOR and Beclin 1complexes. Biochimie 90, 313–323.

388. Moscat J & Diaz-Meco MT (2012) Feedback on fat:p62-mTORC1-autophagy connections. Cell 147, 724–727.

389. Singh R, Xiang Y, Wang Y, et al. (2009) Autophagy regulatesadipose mass and differentiation in mice. J Clin Invest 119,3329–3339.

390. Zhang Y, Goldman S, Baerga R, et al. (2009) Adipose-specific deletion of autophagy-related gene 7 (atg7) inmice reveals a role in adipogenesis. Proc Natl Acad SciU S A 106, 19860–19865.

391. Wu J, Bostrom P, Sparks LM, et al. (2012) Beige adipocytesare a distinct type of thermogenic fat cell in mouse andhuman. Cell 150, 366–376.

392. Martinez-Lopez N, Athonvarangkul D, Sahu S, et al. (2013)Autophagy in Myf5 þ progenitors regulates energy andglucose homeostasis through control of brown fat and skel-etal muscle development. EMBO Rep 14, 795–803.

393. Kovsan J, Bluher M, Tarnovscki T, et al. (2011) Alteredautophagy in human adipose tissues in obesity. J ClinEndocrinol Metab 96, E268–E277.

394. Nunez CE, Rodrigues VS, Gomes FS, et al. (2013) Defectiveregulation of adipose tissue autophagy in obesity. Int J Obes(Lond) 37, 1473–1480.

395. Ost A, Svensson K, Ruishalme I, et al. (2010) AttenuatedmTOR signaling and enhanced autophagy in adipocytesfrom obese patients with type 2 diabetes. Mol Med 16,235–246.

396. Kawakami M, Murase T, Ogawa H, et al. (1987) Humanrecombinant TNF suppresses lipoprotein lipase activity andstimulates lipolysis in 3T3-L1 cells. J Biochem 101, 331–338.

397. Lopez M, Lage R, Saha AK, et al. (2008) Hypothalamic fattyacid metabolism mediates the orexigenic action of ghrelin.Cell Metab 7, 389–399.

398. Murano I, Rutkowski JM, Wang QA, et al. (2013) Timecourse of histomorphological changes in adipose tissueupon acute lipoatrophy. Nutr Metab Cardiovasc Dis 23,723–731.

399. Giordano A, Murano I, Mondini E, et al. (2013) Obeseadipocytes show ultrastructural features of stressed cellsand die of pyroptosis. J Lipid Res 54, 2423–2436.

400. Hotamisligil GS, Shargill NS & Spiegelman BM (1993)Adipose expression of tumor necrosis factor-91.

401. Mauriege P, Despres JP, Prud’homme D, et al. (1991)Regional variation in adipose tissue lipolysis in lean andobese men. J Lipid Res 32, 1625–1633.

402. Jocken JW, Goossens GH, van Hees AM, et al. (2008) Effectof b-adrenergic stimulation on whole-body and abdominalsubcutaneous adipose tissue lipolysis in lean and obesemen. Diabetologia 51, 320–327.

403. Dahlman I & Arner P (2007) Obesity and polymorphismsin genes regulating human adipose tissue. Int J Obes(Lond) 31, 1629–1641.

404. Terra SG, McGorray SP, Wu R, et al. (2005) Associationbetween b-adrenergic receptor polymorphisms and theirG-protein-coupled receptors with body mass index andobesity in women: a report from the NHLBI-sponsoredWISE study. Int J Obes (Lond) 29, 746–754.

405. Hoffstedt J, Iliadou A, Pedersen NL, et al. (2001) The effectof the beta2 adrenoceptor gene Thr164Ile polymorphism onhuman adipose tissue lipolytic function. Br J Pharmacol133, 708–712.

406. Eriksson P, Dahlman I, Ryden M, et al. (2004) Relationshipbetween b2-adrenoceptor gene haplotypes and adipocytelipolysis in women. Int J Obes Relat Metab Disord 28,185–190.

407. Ryden M, Hoffstedt J, Eriksson P, et al. (2001) The Arg 389Gly b1-adrenergic receptor gene polymorphism and humanfat cell lipolysis. Int J Obes Relat Metab Disord 25,1599–1603.

408. Tafel J, Branscheid I, Skwarna B, et al. (2004) Variants in thehuman b1-, b2-, and b3-adrenergic receptor genes are notassociated with morbid obesity in children and adolescents.Diabetes Obes Metab 6, 452–455.

409. Li LS, Lonnqvist F, Luthman H, et al. (1996) Phenotypiccharacterization of the Trp64Arg polymorphism in theb3-adrenergic receptor gene in normal weight and obesesubjects. Diabetologia 39, 857–860.


Nut

ritio

n R

esea

rch

Rev

iew

s

410. Buettner R, Schaffler A, Arndt H, et al. (1998) The Trp64Argpolymorphism of the b3-adrenergic receptor gene is notassociated with obesity or type 2 diabetes mellitus in alarge population-based Caucasian cohort. J Clin EndocrinolMetab 83, 2892–2897.

411. Snitker S, Odeleye OE, Hellmer J, et al. (1997) No effect ofthe Trp64Arg b3-adrenoceptor variant on in vivo lipolysis insubcutaneous adipose tissue. Diabetologia 40, 838–842.

412. Jocken JW, Goossens GH, Boon H, et al. (2013) Insulin-mediated suppression of lipolysis in adipose tissue andskeletal muscle of obese type 2 diabetic men and men withnormal glucose tolerance. Diabetologia 56, 2255–2265.

413. Mairal A, Langin D, Arner P, et al. (2006) Human adiposetriglyceride lipase (PNPLA2) is not regulated by obesityand exhibits low in vitro triglyceride hydrolase activity.Diabetologia 49, 1629–1636.

414. Large V, Reynisdottir S, Langin D, et al. (1999) Decreasedexpression and function of adipocyte hormone-sensitivelipase in subcutaneous fat cells of obese subjects. J LipidRes 40, 2059–2066.

415. Tinahones FJ, Garrido-Sanchez L, Miranda M, et al. (2010)Obesity and insulin resistance-related changes in theexpression of lipogenic and lipolytic genes in morbidlyobese subjects. Obes Surg 20, 1559–1567.

416. Gandotra S, Le Dour C, Bottomley W, et al. (2011) Perilipindeficiency and autosomal dominant partial lipodystrophy.N Engl J Med 364, 740–748.

417. Gandotra S, Lim K, Girousse A, et al. (2011) Human frameshift mutations affecting the carboxyl terminus of perilipinincrease lipolysis by failing to sequester the adipose trigly-ceride lipase (ATGL) coactivator AB-hydrolase-containing5 (ABHD5). J Biol Chem 286, 34998–35006.

418. Cusano NE, Kiel DP, Demissie S, et al. (2012) A polymorphismin a gene encoding perilipin 4 is associated with height butnot with bone measures in individuals from the FraminghamOsteoporosis Study. Calcif Tissue Int 90, 96–107.

419. Magne J, Aminoff A, Sundelin JP, et al. (2013) The minorallele of the missense polymorphism Ser251Pro in perilipin2 (PLIN2) disrupts an a-helix, affects lipolysis, and is associ-ated with reduced plasma triglyceride concentration inhumans. FASEB J 27, 3090–3099.

420. Lass A, Zimmermann R, Haemmerle G, et al. (2006) Adiposetriglyceride lipase-mediated lipolysis of cellular fat stores isactivated by CGI-58 and defective in Chanarin-Dorfmansyndrome. Cell Metab 3, 309–319.

421. Yamaguchi T & Osumi T (2009) Chanarin-Dorfmansyndrome: deficiency in CGI-58, a lipid droplet-boundcoactivator of lipase. Biochim Biophys Acta 1791, 519–523.

422. Bezaire V, Mairal A, Ribet C, et al. (2009) Contribution ofadipose triglyceride lipase and hormone-sensitive lipase tolipolysis inhMADS adipocytes. J Biol Chem 284, 18282–18291.

423. Rodrıguez A, Catalan V, Gomez-Ambrosi J, et al. (2011)Aquaglyceroporins serve as metabolic gateways in adiposityand insulin resistance control. Cell Cycle 10, 1548–1556.

424. Kishida K, Kuriyama H, Funahashi T, et al. (2000)Aquaporin adipose, a putative glycerol channel in adipo-cytes. J Biol Chem 275, 20896–20902.

425. Yasui H, Kubota M, Iguchi K, et al. (2008) Membranetrafficking of aquaporin 3 induced by epinephrine. Bio-chem Biophys Res Commun 373, 613–617.

426. Rodrıguez A, Catalan V, Gomez-Ambrosi J, et al. (2006) Roleof aquaporin-7 in the pathophysiological control of fataccumulation in mice. FEBS Lett 580, 4771–4776.

427. Catalan V, Gomez-Ambrosi J, Pastor C, et al. (2008)Influence of morbid obesity and insulin resistance ongene expression levels of AQP7 in visceral adipose tissueand AQP9 in liver. Obes Surg 18, 695–701.

428. Lafontan M (2012) Historical perspectives in fat cell biology:the fat cell as a model for the investigation of hormonaland metabolic pathways. Am J Physiol Cell Physiol 302,C327–C359.

429. Zhang Y, Proenca R, Maffei M, et al. (1994) Positional clon-ing of the mouse obese gene and its human homologue.Nature 372, 425–432.

430. Zierler KA, Jaeger D, Pollak NM, et al. (2013) Functionalcardiac lipolysis in mice critically depends on comparativegene identification-58. J Biol Chem 288, 9892–9904.

431. Harant I, Beauville M, Crampes F, et al. (1994) Response offat cells to growth hormone (GH): effect of long term treat-ment with recombinant human GH in GH-deficient adults.J Clin Endocrinol Metab 78, 1392–1395.

432. Miegueu P, Pierre DS, Broglio F, et al. (2011) Effect ofdesacyl ghrelin, obestatin and related peptides on triglycer-ide storage, metabolism and GHSR signaling in 3T3-L1adipocytes. J Cell Biochem 112, 704–714.

433. Granata R, Gallo D, Luque RM, et al. (2012) Obestatinregulates adipocyte function and protects against diet-induced insulin resistance and inflammation. FASEB J 26,3393–3411.

434. Hauner H, Petruschke T, Russ M, et al. (1995) Effects oftumour necrosis factor a (TNF a) on glucose transportand lipid metabolism of newly-differentiated human fatcells in cell culture. Diabetologia 38, 764–771.

435. Path G, Bornstein SR, Gurniak M, et al. (2001) Humanbreast adipocytes express interleukin-6 (IL-6) and itsreceptor system: increased IL-6 production by b-adrenergicactivation and effects of IL-6 on adipocyte function. J ClinEndocrinol Metab 86, 2281–2288.

436. Grisouard J, Bouillet E, Timper K, et al. (2012) Bothinflammatory and classical lipolytic pathways are involvedin lipopolysaccharide-induced lipolysis in human adipo-cytes. Innate Immun 18, 25–34.


Nut

ritio

n R

esea

rch

Rev

iew

s

- 111 -

2. Reduced hepatic aquaporin-9 and glycerol permeability are

related to insulin resistance in non-alcoholic fatty liver disease

Article

Rodríguez A, Gena P, Méndez-Giménez L, Rosito A, Valentí V, Rotellar F, Sola I,

Moncada R, Silva C, Svelto M, Salvador J, Calamita G, Frühbeck G.

Reduced hepatic aquaporin-9 and glycerol permeability are related to insulin resistance

in non-alcoholic fatty liver disease.

Int J Obes 2014;38(9):1213-20.

Hypothesis

The hepatocyte basolateral membrane glycerol permeability as well as the

expression of aquaglyceroporins in the liver of obese patients with varying degrees of

insulin resistance might be related to the onset of NAFLD and NASH.

Objectives

To analyze the prevalence of NAFLD and NASH in a cohort of morbid obese

patients with normoglycemia, impaired glucose tolerance and T2D.

To characterize the expression of aquaglyceroporins AQP3, AQP7, AQP9 and

AQP10 in human liver.

To study the impact of insulin-resistance on hepatocyte glycerol permeability

and AQP9 expression in liver biopsies of morbid obese patients.

To evaluate the impact of obesity-associated NAFLD and NASH on the

expression of AQP9 in human liver according to the degree of steatosis and

lobular inflammation.

Rodríguez A, Gena P, Méndez-Giménez L, Rosito A, Valentí V, Rotellar F, Sola I,

Moncada R, Silva C, Svelto M, Salvador J, Calamita G, Frühbeck G. Reduced hepatic

aquaporin-9 and glycerol permeability are related to insulin resistance in non-alcoholic

fatty liver disease. International Journal of Obesity 2014;38(9):1213-20.

http://metalib.unav.es:3210/unav?url_ver=Z39.88-2004&url_ctx_fmt=info:ofi/fmt:kev:mtx:ctx&ctx_enc=info:ofi/enc:UTF-8&ctx_ver=Z39.88-2004&rfr_id=info:sid/sfxit.com:azlist&sfx.ignore_date_threshold=1&rft.object_id=954925515513&rft.object_portfolio_id=&svc.fulltext=yes

- 113 -

3. Leptin administration restores the altered adipose and hepatic

expression of aquaglyceroporins improving the non-alcoholic

fatty liver of ob/ob mice

Article

Rodríguez A, Moreno NR, Balaguer I, Méndez-Giménez L, Becerril S, Catalán

V,Gómez-Ambrosi J, Portincasa P, Calamita G, Soveral G, Malagón MM, Frühbeck G.

Leptin administration restores the altered adipose and hepatic expression of aquaglyceroporins improving the non-alcoholic fatty liver of ob/ob mice.

Sci Rep 2015;5:12067.

Hypothesis

The beneficial effects of chronic leptin administration in vivo on hepatosteatosis

are mediated via the coordinated regulation of aquaglyceroporins in adipose tissue and

liver in wild type and leptin-deficient ob/ob mice.

Objectives

To evaluate the effect of acute leptin treatment (4 h) in vitro on the expression

and intracellular distribution of aquaglyceroporins in murine adipocytes.

To study the impact of chronic in vivo leptin administration (1 month) on body

weight, adiposity, hepatosteatosis and expression of aquaglyceroporins in

subcutaneous WAT (AQP3 and AQP7) and liver (AQP9) of wild type and

ob/ob mice.

To evaluate the correlation of adipose as well as hepatic aquaglyceroporins

with markers of adiposity, glucose and lipid metabolism and hepatic steatosis

after leptin replacement.

1Scientific RepoRts | 5:12067 | DOi: 10.1038/srep12067

www.nature.com/scientificreports

Leptin administration restores the altered adipose and hepatic expression of aquaglyceroporins improving the non-alcoholic fatty liver of ob/ob miceAmaia Rodríguez1,7,8, Natalia R. Moreno3, Inmaculada Balaguer1, Leire Méndez-Giménez1,7,8, Sara Becerril1,7,8, Victoria Catalán1,7,8, Javier Gómez-Ambrosi1,7,8, Piero Portincasa4, Giuseppe Calamita5, Graça Soveral6, María M. Malagón3,7 & Gema Frühbeck1,2,7,8

Glycerol is an important metabolite for the control of lipid accumulation in white adipose tissue (WAT) and liver. We aimed to investigate whether exogenous administration of leptin improves features of non-alcoholic fatty liver disease (NAFLD) in leptin-deficient ob/ob mice via the regulation of AQP3 and AQP7 (glycerol channels mediating glycerol efflux in adipocytes) and AQP9 (aquaglyceroporin facilitating glycerol influx in hepatocytes). Twelve-week-old male wild type and ob/ob mice were divided in three groups as follows: control, leptin-treated (1 mg/kg/d) and pair-fed. Leptin deficiency was associated with obesity and NAFLD exhibiting an AQP3 and AQP7 increase in WAT, without changes in hepatic AQP9. Adipose Aqp3 and hepatic Aqp9 transcripts positively correlated with markers of adiposity and hepatic steatosis. Chronic leptin administration (4-weeks) was associated with improved body weight, whole-body adiposity, and hepatosteatosis of ob/ob mice and to a down-regulation of AQP3, AQP7 in WAT and an up-regulation of hepatic AQP9. Acute leptin stimulation in vitro (4-h) induced the mobilization of aquaglyceroporins towards lipid droplets (AQP3) and the plasma membrane (AQP7) in murine adipocytes. Our results show that leptin restores the coordinated regulation of fat-specific AQP7 and liver-specific AQP9, a step which might prevent lipid overaccumulation in WAT and liver in obesity.

Non-alcoholic fatty liver disease (NAFLD) comprises a spectrum of liver disorders ranging from non-alcoholic fatty liver (NAFL) and non-alcoholic steatohepatitis (NASH) to NASH-cirrhosis, and even hepatocellular carcinoma1,2. Obesity is a common well-documented risk factor for NAFLD and

1Metabolic Research Laboratory, Clínica Universidad de Navarra, Pamplona, Spain. 2Department of Endocrinology & Nutrition, Clínica Universidad de Navarra, Pamplona, Spain. 3Department of Cell Biology, Physiology, and Immunology, Instituto Maimónides de Investigación Biomédica (IMIBIC)/Reina Sofia University Hospital/University of Córdoba, Córdoba, Spain. 4Clinica Medica “A. Murri”, Department of Biomedical Sciences and Human Oncology University of Bari Medical School, Policlinico Hospital, Bari, Italy. 5Department of Biosciences, Biotechnologies and Biopharmaceutics, University of Bari “Aldo Moro”, Bari, Italy. 6Research Institute for Medicines (iMed.ULisboa), Faculty of Pharmacy, Universidade de Lisboa, Lisboa, Portugal. 7CIBER Fisiopatología de la Obesidad y Nutrición, Instituto de Salud Carlos III, 28029, Madrid, Spain. 8Obesity & Adipobiology Group, Instituto de Investigación Sanitaria de Navarra (IdiSNA), Pamplona, Spain. Correspondence and requests for materials should be addressed to G.F. (email: [email protected])

Received: 27 January 2015

Accepted: 17 June 2015

Published: 10 July 2015

OPEN

mailto:[email protected]

www.nature.com/scientificreports/


NASH3–5. The prevalence of NAFLD and NASH increases from around 20% and 3%, respectively, in the general population to 75% and 25–70%, respectively, in morbid obesity3,6. One of the main contribu-tors leading to obesity-associated NAFLD is the increased adipose tissue lipolysis, the catabolic process leading to hydrolysis of triacylglycerols (TG) into free fatty acids (FFA), and glycerol-3-phosphate7. FFA released from visceral adipose tissue are collected into the portal vein and reach the liver at high con-centrations, a step leading to excessive hepatic TG deposition and, ultimately, hepatocellular damage8. However, scarce is the attention on the relevance of hepatic import of glycerol, the other primary source (as glycerol-3-phosphate) of increased TG in hepatocytes9.

Aquaglyceroporins (AQP3, 7, 9 and 10) are channel-forming integral membrane proteins that facili-tate the movement of water and also small solutes, such as glycerol and urea, across cell membranes9,10. AQP7 is the main gateway facilitating glycerol release from adipocytes10,11, although other glycerol chan-nels such as AQP3, 9, 10 and the most recently described AQP11, also contribute to glycerol efflux from fat depots12–14. Circulating plasma glycerol is then introduced in hepatocytes by the liver-specific AQP9, where glycerol kinase (GK) catalyzes the initial step for its conversion into glucose (gluconeogenesis) and/or TG15–17. Thus, the coordinated regulation of aquaglyceroporins in adipocytes and hepatocytes plays a key role in maintaining the control of fat accumulation in adipose tissue and liver, as well as whole-body glucose homeostasis9,18,19. In this regard both obesity and NAFLD are associated with a dysregulation of aquaglyceroporins in adipose tissue and liver. Obese subjects exhibit high expression of AQP3 and AQP7 in visceral fat and low AQP7 levels in subcutaneous adipose tissue, a condition reflecting increased lipolysis and adipose tissue hypertrophy, respectively, in these fat depots12,19–21. On the other hand, NAFLD is associated with a down-regulation of AQP9 in experimental animals22 and obese patients23, suggesting a compensatory mechanism whereby liver prevents further TG accumulation and reduces hepatic gluconeogenesis.

Leptin is an adipocyte-derived hormone that exerts lipolytic effects by counteracting the adenosine deaminase-induced tonic inhibition24. Previous in vitro studies of our group have shown that leptin repressed AQP7 expression in differentiated human adipocytes via PI3K/Akt/mTOR signalling, suggest-ing a negative feedback regulation in lipolytic states to limit glycerol release from fat cells12. Notably, chronic leptin treatment reverts hepatic steatosis in patients with severe lipodystrophy by stimulating lipolysis in hepatocytes25,26. Thus, the aim of the present study was to analyze whether the beneficial effects of chronic leptin administration in vivo on hepatosteatosis are mediated via the coordinated reg-ulation of aquaglyceroporins in adipose tissue and liver in wild type and leptin-deficient ob/ob mice.

ResultsAcute leptin treatment in vitro regulates the expression and intracellular distribution of aquaglyceroporins in murine adipocytes. Acute leptin treatment increases lipolysis, leading to FFA and glycerol release from the adipose tissue24,27. We12 and others28–30 have reported that aquaglycer-oporins AQP3 and AQP7 facilitate glycerol outflow from adipocytes in response to the lipolysis induced by the β -adrenergic agonist isoproterenol. Thus, in the present study, the direct effect of acute leptin treatment on aquaglyceroporin expression was analyzed by real-time PCR and Western blot in murine differentiated subcutaneous adipocytes. Upon 24-h leptin stimulation, Aqp3 mRNA tended to decrease (P = 0.072) and Aqp7 gene expression was down-regulated (P < 0.05) in murine subcutaneous adipo-cytes (Fig. 1A,B). Moreover, both AQP3 and AQP7 protein levels were reduced (P < 0.05) after leptin treatment (Fig. 1C,D). To gain more insight into the regulation of aquaglyceroporins by leptin, the sub-cellular localization of AQP was studied in differentiated 3T3-L1 adipocytes by confocal immunofluo-rescence microscopy (Fig. 1E). We previously described that after subcellular fractionation of quiescent 3T3-L1 adipocytes, AQP3 was located in the plasma membrane and cytosolic fraction, whereas AQP7 was expressed in the subfractions of lipid droplets and the rest of the cytoplasm12. In the present study, we confirmed that, under basal conditions, AQP3 was present mainly in the cell surface, although some punctuate labelling in the cytoplasm could also be observed, while AQP7 resided predominantly in the cytoplasm, surrounding lipid droplets of differentiated 3T3-L1 adipocytes. After 4-h leptin stimula-tion, AQP3 tended to surround lipid droplets more prominently, whereas AQP7 was translocated to the plasma membrane.

In order to test the functionality of aquaglyceroporins on the lipolytic effect triggered by leptin, murine subcutaneous adipocytes were exposed to leptin 10 nmol/L for 24 h in the presence of HgCl2, a nonspe-cific AQP inhibitor31, or to CuSO4, a more selective AQP3 inhibitor32, prior to determination of glycerol release to the culture media. The inhibition of AQP permeability with 0.3 mmol/L HgCl2 alone induced a modest decrease in glycerol release in murine subcutaneous adipocytes (control 3.18 ± 0.19 vs. HgCl2 3.06 ± 0.30 mg/dL, P = 0.729). Nonetheless, mercury ions abolished around 50% of the leptin-induced glycerol release in murine subcutaneous adipocytes, while copper ions inhibited approximately 20% of the glycerol release caused by leptin (Fig. 1F). These data suggest that the major glycerol channel in murine adipocytes, AQP7 and, to a lesser extent, AQP3 mediate the glycerol efflux triggered by leptin in fat cells.

Chronic leptin administration in vivo reduces adiposity in parallel to a decrease in aquaglyc-eroporins AQP3 and AQP7 in adipose tissue. Leptin is an adipokine that reduces food intake and increases energy expenditure to maintain energy balance33. As expected, leptin-deficient ob/ob mice



exhibited severe obesity and hyperphagia (Table 1). Chronic leptin treatment corrected the obese phe-notype of ob/ob mice, as evidenced by the lower body weight as well as epididymal, subcutaneous and perirenal fat mass via the reduction of food intake and the increase in rectal temperature. In the present study, chronic leptin administration was associated with a decrease in circulating FFA and glycerol, pointing to a lower lipolytic rate in leptin-treated animals.

Figure 1. Effect of in vitro acute leptin treatment on aquaglyceroporins AQP3 and AQP7 expression and subcellular localization in murine adipocytes. Bar graphs show transcript and protein levels of AQP3 (A, C) and AQP7 (B, D) in differentiated murine adipocytes obtained from subcutaneous white adipose tissue (WAT) of wild type mice under basal conditions and after leptin (10 nmol/L) treatment for 24 h. The gene and protein expression in unstimulated cells was assumed to be 1. Representative blots are shown at the bottom of the figure. (E) Immunocytochemical detection of the AQP3 and AQP7 proteins in differentiated murine 3T3-L1 adipocytes (day 10) under basal conditions (upper panels) and after the stimulation for 4 h with leptin (10 nmol/L) (lower panels). Images were taken from the basal planes of the cells. Representative images of at least three separate experiments are shown. (F) Glycerol release from murine subcutaneous adipocytes under basal conditions (control) and after leptin (10 nmol/L)-induced stimulation without or with preincubation with HgCl2 (0.3 mmol/L), a nonspecific AQP inhibitor, or with CuSO4 (0.1 mmol/L), a selective AQP3 inhibitor. Differences between groups were analyzed by Student’s t test or one-way ANOVA followed by Tukey’s test. *P < 0.05 vs. control unstimulated cells; ††P < 0.01 vs. adipocytes stimulated with leptin.



To analyze the potential involvement of aquaglyceroporins in the changes observed on adiposity after chronic exogenous leptin administration (4 weeks), we first assessed the gene and protein expression of AQP3 and AQP7 in subcutaneous WAT of the experimental groups by real-time PCR, Western blot and immunohistochemistry (Fig. 2). As illustrated in Fig. 2A,B, the tissue distribution of AQP3 and AQP7 showed a predominant immunostaining in the stromovascular fraction and lower expression in mature adipocytes, as previously reported by our group and others12,34. In the multiple lineal regression analysis, AQP3 and AQP7 protein levels in subcutaneous WAT contributed independently to 51.0% (P < 0.05) and 51.2% (P < 0.05) to the circulating glycerol concentrations after controlling for body weight, suggesting an important role of these aquaglyceroporins in glycerol efflux from adipose tissue.

Leptin deficiency was associated with higher mRNA and protein levels of AQP3 and AQP7 in sub-cutaneous WAT (Fig. 2C–F). In line with these results, Aqp3 and Aqp7 mRNA levels were positively associated with markers of adiposity [body weight (r = 0.33, P = 0.025 and r = 0.44, P = 0.001) or sub-cutaneous WAT/body weight (r = 0.33, P = 0.025 and r = 0.53, P = 0.001)] and hepatosteatosis [liver/body weight (r = 0.36, P = 0.013 and r = 0.35, P = 0.010 and intrahepatic TG (r = 0.40, P = 0.006 and r = 0.53, P < 0.001)]. No differences in the transcript levels of Aqp3 and Aqp7 were detected after leptin administration, but a tendency towards a down-regulation of both glycerol channels was observed in leptin-treated ob/ob mice. Nonetheless, at the protein level, both leptin administration and caloric restric-tion reduced (P < 0.05) AQP3 and AQP7 in subcutaneous WAT of wild type and ob/ob mice.

Exogenous leptin replacement reduces the hepatic steatosis of ob/ob mice and upregulates AQP9 expression in the liver. Leptin-deficient ob/ob mice showed an increased (P < 0.0001) liver weight that was significantly reduced (P < 0.0001) by either caloric restriction or leptin replacement (Fig. 3A). Histological sections of leptin-deficient ob/ob mice were characterized by the presence of severe macrovesicular steatosis, but not advanced inflammation/fibrosis, that was completely reverted after leptin administration for 28 days (Fig. 3E). The analysis of intrahepatic triacylglycerol content revealed elevated TG levels (P < 0.001) in the liver of ob/ob mice that was prevented by leptin treatment (P < 0.05), but not by caloric restriction (Fig. 3B).

We next analyzed the expression of AQP9, the primary route for glycerol uptake in murine hepat-ocytes, by real-time PCR, Western blot and immunohistochemistry. As previously described by our group22, two immunoreactive bands of 30–32 kDa, corresponding to the core and N-glycosylated forms of AQP9 protein, respectively, were observed in the immunoblots (Fig. 3D). Leptin deficiency was asso-ciated with similar expression of AQP9 mRNA and whole (glycosylated and non-glycosylated) AQP9 protein signal than that observed in wild type mice, with leptin administration and caloric restriction increasing (P < 0.05) AQP9 gene and protein expression (Fig. 3C,D). Aqp9 gene expression was posi-tively associated with markers of adiposity [body weight (r = 0.60, P < 0.001) or subcutaneous WAT/body weight (r = 0.44, P = 0.002)] and hepatic steatosis [liver/body weight (r = 0.69, P < 0.001) and intra-hepatic TG (r = 0.28, P < 0.05)]. Liver sections showed a strong immunoreactivity for AQP9 after leptin infusion, which was mainly localized in the plasma membrane of hepatocytes around the central veins (Fig. 3E).

Wild type ob/ob

Control Pair-fed Leptin Control Pair-fed Leptin

n 9 10 9 10 10 9

Body weight (g)a,b,c 25.4 ± 0.2 22.6 ± 0.1* 22.6 ± 0.1* 49.2 ± 0.8* 33.6 ± 0.4*,† 24.9 ± 0.2†,$

Cumulative food intake (g)a,b,c 94 ± 2 88 ± 1 88 ± 1 191 ± 5* 66 ± 5*,† 66 ± 5*,†

Rectal temperature (°C)c 35.4 ± 0.2 36.0 ± 0.2 35.4 ± 0.1 35.7 ± 0.2 34.7 ± 0.3† 36.0 ± 0.2$

Epididymal WAT (g)a,b,c 0.19 ± 0.01 0.13 ± 0.02 0.04 ± 0.01 1.64 ± 0.10* 1.04 ± 0.05*,† 0.46 ± 0.06*,†,$

Subcutaneous WAT (g)a,b,c 0.17 ± 0.01 0.15 ± 0.02 0.09 ± 0.05 3.07 ± 0.32* 1.85 ± 0.11*,† 0.47 ± 0.06*,†,$

Perirrenal WAT (g)a,b,c 0.05 ± 0.01 0.03 ± 0.01 0.01 ± 0.01 0.92 ± 0.05* 0.51 ± 0.04*,† 0.09 ± 0.01*,†,$

Total white adiposity (g)a,b,c 0.42 ± 0.04 0.31 ± 0.01 0.14 ± 0.05 5.62 ± 0.38* 3.40 ± 0.23*,† 1.03 ± 0.13*,†,$

FFA (mg/dL)b 44 ± 8 45 ± 5 32 ± 4 39 ± 5 55 ± 11 24 ± 2

Glycerol (mmol/mL)a,b,c 0.05 ± 0.01 0.03 ± 0.01 0.02 ± 0.01* 0.07 ± 0.01* 0.05 ± 0.01 0.01 ± 0.01*,†,$

Table 1. Markers of adiposity, body temperature and lipolysis of experimental groups. FFA, free fatty acids; WAT, white adipose tissue. Values presented as the mean ± SEM. Differences between groups were analyzed by two-way ANOVA or one-way ANOVA followed by Tukey’s post-hoc test when an interaction between factors was detected. aP < 0.05, effect of genotype; bP < 0.05 effect of treatment; cP < 0.05 interaction between genotype and treatment. *P < 0.05 vs. vehicle-treated wild type mice; †P < 0.05 vs. vehicle-treated ob/ob mice; #P < 0.05 vs. pair-fed wild type mice; $P < 0.05 vs. pair-fed ob/ob mice.



Positive association of PPARγ with changes observed in the expression of aquaglyceroporins in adipose tissue and liver after leptin replacement. Peroxisome proliferator-activated recep-tor γ (PPARγ ) represents a well-known lipogenic factor and, importantly, putative peroxisome pro-liferator response elements (PPRE) are present in the promoters of Aqp3 and Aqp7 genes35,36. In line with the observed excess adiposity and hepatic steatosis, leptin-deficient mice exhibited higher Pparg mRNA levels in the adipose tissue and liver that were reduced by leptin replacement and, to a lesser extent, by caloric restriction (Fig. 4A,B). As expected, gene expression levels of Pparg in subcutaneous WAT and liver were positively associated with markers of obesity [body weight (r = 0.43, P < 0.001 and

Figure 2. Effect of in vivo chronic leptin administration on aquaglyceroporins AQP3 and AQP7 expression and tissue distribution in adipose tissue of wild type and ob/ob mice. Immunohistochemical detection of AQP3 (A) and AQP7 (B) in subcutaneous white adipose tissue (WAT) of wild type (left panels) and ob/ob (right panels) mice (magnification 200X, scale bar = 50 μ m). Bar graphs show transcript and protein levels of AQP3 (C, E) and AQP7 (D, F) in subcutaneous WAT obtained from vehicle-treated, pair-fed and leptin-treated wild type and ob/ob mice. The gene and protein expression in vehicle-treated wild type mice was assumed to be 1. Representative blots are shown at the bottom of the figure. Differences between groups were analyzed by two-way ANOVA.



r = 0.70, P < 0.0001) or subcutaneous WAT/body weight (r = 0.35, P = 0.010 and r = 0.70, P < 0.0001)], fatty liver [liver weight/body weight (r = 0.43, P < 0.001 and r = 0.65, P < 0.0001) and intrahepatic TG (r = 0.40, P = 0.003 and r = 0.45, P = 0.001)]. Moreover, a strong positive association was found between Pparg transcript levels and Aqp7 mRNA in the adipose tissue as well as with Aqp9 mRNA in the liver (Fig. 4C,D). Pparg mRNA was also correlated with Aqp3 gene expression in subcutaneous WAT but to a lower extent (r = 0.43, P < 0.001).

To gain further insight into the plausible association of PPARγ with these glycerol channels after leptin treatment, we examined the effect of leptin stimulation on basal and PPARγ agonist rosiglitazone-induced expression of aquaglyceroporins in murine subcutaneous differentiated adipocytes and AML12 hepat-ocytes. As expected, rosiglitazone stimulation for 24 h upregulated 1.4- and 2.0-fold the transcription of Pparg gene in murine subcutaneous adipocytes and AML12 hepatocytes, respectively, although no

Figure 3. Effect of in vivo chronic leptin administration on fatty liver and hepatic aquaglyceroporin AQP9 expression in experimental animals. Bar graphs show the liver weight (A) intrahepatic concentrations of triacylglycerols (TG) (B) as well as gene (C) and protein (D) expression levels of AQP9 in the liver of vehicle-treated, pair-fed and leptin-treated wild type and ob/ob mice. The gene and protein expression in vehicle-treated wild type mice was assumed to be 1. Representative blots are shown at the bottom of the figure. (E) Inmunohistochemical detection of AQP9 protein in histological sections of liver of wild type (upper panels) and ob/ob mice (lower panels) (magnification, 200X; scale bar, 50 μ m). Differences between groups were analyzed by two-way ANOVA or one-way ANOVA followed by Tukey’s post-hoc test, if an interaction was detected. **P < 0.01; ***P < 0.001 vs. vehicle-treated wild type mice; †P < 0.05; †††P < 0.001 vs. vehicle-treated ob/ob mice.



Figure 4. Positive association of Pparg transcript levels with aquaglyceroporins Aqp7 and Aqp9 in adipose tissue and liver of experimental animals. Bar graphs illustrate the changes in Pparg mRNA levels in subcutaneous white adipose tissue (WAT) (A) and liver (B) obtained from vehicle-treated, pair-fed and leptin-treated wild type and ob/ob mice. A positive correlation was found between Pparg and Aqp7 mRNA in subcutaneous WAT (C) as well as between Pparg and Aqp9 transcript levels in liver (D) of experimental groups. The Pearson’s correlation coefficient (r) and P values are indicated. Effect of leptin stimulation for 24 h on basal and thiazolidinedione (TZD) rosiglitazone (10 μ mol/L)-induced expression of Pparg (E, F) and aquaglyceroporins Aqp7 and Aqp9 (G, H) in murine differentiated subcutaneous adipocytes and AML12 hepatocytes. The gene expression in vehicle-treated wild type mice or unstimulated cells was assumed to be 1. Differences between groups were analyzed by two-way ANOVA or one-way ANOVA followed by Tukey’s post-hoc test, where appropriate. *P < 0.05; **P < 0.01 vs. control unstimulated cells.



statistical differences between groups were found in fat cells (P = 0.269) (Fig. 4E,F). Moreover, the treat-ment with this TZD also increased the transcription of Aqp7 in subcutaneous fat cells and of Aqp9 in AML12 hepatocytes (Fig. 4G,H). The co-incubation with leptin tended to reduce both basal and TZD-induced mRNA expression of Pparg and Aqp7 genes in subcutaneous adipocytes, although changes fell out of statistical significance (P = 0.083 and P = 0.125, respectively). A similar trend was observed for the effect of leptin on basal and rosiglitazone-induced expression of Aqp3 gene in subcutaneous adipocytes (control 1.0 ± 0.4 A.U.; leptin 0.4 ± 0.1 A.U.; TZD 4.3 ± 1.6 A.U.; TZD + leptin 2.7 ± 0.8 A.U.; P = 0.003). However, leptin co-treatment induced a slight down-regulation of Pparg transcript levels (P = 0.292), while increasing (P < 0.05) the transcription of Aqp9 in AML12 hepatic cells.

DiscussionAdipocyte lipolysis is the process that controls the breakdown of TG into glycerol and FFA, which are released into the circulation and used as energy substrates in metabolic organs7,37. AQP3 and AQP7 facil-itate glycerol outflow from adipocytes in response to β -adrenergic receptor-stimulated lipolysis via its translocation from the cytosolic fraction (AQP3) or lipid droplets (AQP7) to the plasma membrane12,28,29. Basal lipolytic activity of adipocytes is conditioned not only by catecholamines, but also by other factors, such as atrial natriuretic peptides, insulin, leptin, adenosine, tumor necrosis factor α (TNF-α ) or neuro-peptide Y, among others7. The adipokine leptin exerts an autocrine/paracrine lipolytic effect on murine adipocytes27. In this sense, acute leptin treatment (1 h) reportedly increases basal lipolysis of wild type and ob/ob mice27. Here, we found that acute leptin treatment (4 h) stimulated AQP3 translocation from the plasma membrane to lipid droplets, a step that might reflect the glycerol efflux from lipid droplets after lipolytic response in differentiated subcutaneous murine adipocytes. Upon leptin stimulation, AQP7 was translocated from lipid droplets to the plasma membrane, and this finding suggests that this glycerol channel constitutes the main gateway for glycerol secretion to the bloodstream. Thus, we speculate that acute leptin treatment induces the translocation of AQP3 and AQP7 to lipid droplets and the plasma membrane, respectively, to facilitate glycerol mobilization after lipolysis. Nonetheless, the existence of further operative glycerol channels in subcutaneous adipocytes cannot be discarded.

Obesity is associated with increased lipolysis due to higher lipolytic activity of β 3-adrenergic recep-tors and reduced anti-lipolytic action of insulin, leading to elevated circulating concentrations of FFA and glycerol38,39. In the present study, we found that leptin-deficient obese ob/ob mice showed increased circulating glycerol together with higher subcutaneous fat expression of AQP3 and AQP7. Both chronic leptin treatment and caloric restriction significantly decreased circulating glycerol and AQP3 and AQP7 proteins in subcutaneous adipose tissue in ob/ob mice. The adipose tissue is composed not only by adipocytes, but also by SVFCs (i.e., macrophages, T lymphocytes, endothelial cells, fibroblasts, vascular smooth muscle cells or mesenchymal stem cells). Because SVFCs might contribute to the reduction of aquaglyceroporins in adipose tissue, we also studied the direct effect of leptin treatment on differentiated murine subcutaneous adipocytes. In line with the results obtained with the whole adipose tissue, 24-h leptin treatment decreased the gene and protein expression of AQP3 and AQP7 of differentiated murine subcutaneous adipocytes. In this regard, in a previous study, we found that in vitro 24-h leptin treatment downregulated AQP7 protein expression in differentiated human adipocytes via the PI3K/Akt/mTOR signalling pathway12. Taken together, both in vivo chronic leptin administration and caloric restriction limit glycerol release from adipocytes through the down-regulation of AQP3 and AQP7, suggesting a negative feedback regulation in lipolytic states to maintain intracellular glycerol and, therefore, to avoid the depletion of fat stores (Fig. 5).

Liver steatosis is a multi-factorial disease where abnormal TG accumulation in the hepatocytes can be triggered by metabolic, toxic, pharmacological or viral insults across a genetic predisposition1,2. Glycerol-3-phosphate constitutes a key metabolite for de novo synthesis of TG and derives from glyc-olysis, glyceroneogenesis as well as recycling of glycerol by GK40,41. AQP9 represents the main facilita-tive pathway for glycerol uptake as a substrate for gluconeogenesis and lipogenesis in hepatocytes15–17. Interestingly, a decrease in hepatic AQP9 and glycerol permeability has been observed in murine and human NAFLD, suggesting a defensive mechanism to prevent further development of hyperglycemia and hepatosteatosis19,22,23. Moreover, a dysregulation of AQP9 has been observed in several hepatic inflamma-tory derangements, such as extrahepatic cholestasis, alcoholic steatohepatitis and NASH23,42–44. However, little is known about the regulation of AQP9 in the context of NAFLD/NASH. In the present study, AQP9 was mainly localized in the sinusoidal domain of the plasma membrane of hepatocytes, which is in agreement with previous results45,46 including ours12,23. Leptin-deficient mice, a murine model of NAFLD, displayed macrovesicular steatosis without changes in hepatic AQP9 mRNA and protein. In a previous study, a lower expression of AQP9 was found in liver samples of ob/ob mice22. In this regard, AQP9 expression in the liver is influenced by the degree of hepatic steatosis and inflammation23 that might change the expression of this aquaglyceroporin during the ongoing NAFLD in adult ob/ob mice. Short-term leptin administration has been reported to exert profound effects on hepatic lipid metabolism of ob/ob mice by reducing de novo lipogenesis via repressing acetyl-CoA carboxylase (ACC), fatty acid synthase (FAS) or stearoyl-coenzyme A desaturase 1 (SCD1) expression, and through the activation of β -oxidation by increasing the transcript levels of acetyl-coenzyme A acetyl-transferase 1 (ACAT1) or carnitine palmitoyl transferase 1 (CPT1)47. We herein show that chronic leptin administration com-pletely rescues the hepatosteatosis of ob/ob mice as evidenced by the normalization of intrahepatocellular



hepatocytes and liver morphology. Moreover, a valuable result of this work regards the up-regulation of AQP9 after chronic leptin treatment in wild type and ob/ob mice. Taken together, similar or lower levels of AQP9 associated to leptin deficiency appear to reflect a defensive cell reaction of the steatotic hepatocyte. Interestingly, chronic leptin administration not only rescues the fatty liver, but also increases AQP9 in order to facilitate glycerol import into hepatocytes for maintaining the glycemia as well as an appropriate lipid metabolism.

The adipose tissue and liver from leptin-deficient ob/ob mice showed an induction of PPARγ , which is a critical transcription factor for the development of obesity and hepatic steatosis as previously reported by other authors48–50. In a previous study of our group51, we found that the downregulation of PPARγ in adipose tissue and liver of diet-induced obese rats after bariatric surgery was strongly associated with a reduction in the transcription of aquaglyceroporins in these tissues. Nonetheless, the molecular mechanisms underlying this association were unclear. In the present study, we found that chronic leptin administration significantly decreased Pparg transcript levels in parallel with the improvement of adi-posity and fatty liver. Interestingly, the promoters of Aqp3 and Aqp7 genes present putative PPRE with the expression of these aquaglyceroporins being up-regulated by PPARγ agonists35,36. In line with this observation, Pparg transcript levels were positively correlated with Aqp3 and Aqp7 in adipose tissue, but also with Aqp9 in the liver. Moreover, leptin co-treatment tended to reduce the transcription of PPARγ and AQP7 induced by rosiglitazone stimulation, a well-known PPARγ -selective agonist, in murine sub-cutaneous adipocytes. Our results are in agreement with other reports showing that pioglitazone and rosiglitazone administration to rodents increase the expression of AQP7 in adipose tissue35,52. However, leptin increased both basal and rosiglitazone-induced transcription of Aqp9 in AML12 hepatocytes, despite inducing a slight reduction Pparg mRNA levels in these hepatic cells. Thus, the mild action of leptin on rosiglitazone-induced up-regulation of aquaglyceroporins in adipocytes and hepatocytes sug-gests that other upstream molecules in addition to PPARγ might be involved in the regulatory effect of this adipokine.

The coordinated regulation of adipose and hepatic aquaglyceroporins is extremely relevant to main-tain the control of fat accumulation and glycemia (Fig. 5)12,18. We herein report, for the first time, that chronic leptin administration regulates the altered expression of the adipose glycerol channels AQP3 and AQP7 and the liver-specific AQP9 in leptin-deficient obese ob/ob mice. Since glycerol is a key metabolite for lipid accumulation in fat depots and liver, the improvement of glycerol availability might be involved in the beneficial effects of leptin on obesity and NAFLD. Nonetheless, future in vivo studies are needed to fully demonstrate the requirement of AQP proteins for the improvement of these pathologies. Moreover, the time functional link between the regulation of AQP and leptin-dependent changes in lipid flux at the clinical level require the exact characterization of NAFLD and more advanced liver damage stages in patients with respect to weight changes and diet.

MethodsAnimals. Ten-week-old male wild type (C57BL/6J) (n = 30) and genetically obese ob/ob mice (C57BL/6J) (n = 30) (Harlan Laboratories Inc., Barcelona, Spain) were housed in a room with controlled

Figure 5. Proposed working model for the coordinated regulation of aquaglyceroporins in adipose tissue and liver by leptin.


1 0Scientific RepoRts | 5:12067 | DOi: 10.1038/srep12067

temperature (22 ± 2 °C), and a 12:12 light-dark cycle (lights on at 08:00 am). Wild type and ob/ob mice were divided in control, leptin-treated (1 mg/kg/d) and pair-fed groups (n = 10 per group), as previously described26. The control and pair-fed groups received vehicle (PBS), while leptin-treated groups were intraperitoneally administered with leptin (Bachem, Bubendorf, Switzerland) twice a day at 08:00 and 20:00 for 28 days. Control and leptin-treated groups were provided with water and food ad libitum with a rodent maintenance diet (12.1 kJ: 4% fat, 82% carbohydrate and 14% protein, Diet 2014S, Teklad Global Diets, Harlan, Barcelona, Spain), while the daily food intake of the pair-fed groups was matched to the amount eaten by the leptin-treated groups the day before to discriminate the inhibitory effect of leptin on appetite. All experimental groups had an isoproteic intake consuming similar amounts of sodium and phytates53. Body weight and food intake were daily registered and rectal temperature was measured using a thermoprobe (YSI 4600 Series Precision Thermometers, YSI Temperature, Dayton, OH, USA) at the end of the experiment. Animals were sacrificed on the 28th day of treatment by CO2 inhalation. Epididymal, subcutaneous and perirenal white adipose tissue (WAT) as well as the liver were rapidly dis-sected out, weighed, frozen in liquid nitrogen, and stored at − 80 °C until mRNA and protein extraction. A piece of the tissues was fixed in 4% formaldehyde for immunohistochemical analyses. All experimental procedures conformed to the European Guidelines for the Care and Use of Laboratory Animals (directive 2010/63/EU) and were approved by the Ethical Committee for Animal Experimentation of the University of Navarra (041/08).

Blood and tissue assays. Blood assays were determined as previously described26. Intrahepatic TG content was measured by enzymatic methods, in accordance with previously published procedures12. Briefly, liver biopsies were homogenized and diluted in saline at a final concentration of 50 mg/mL. Homogenates were diluted (1:1) in 1% deoxycholate (Sigma, St. Louis, MO, USA) and incubated at 37 °C for 5 min. For TG measurements, samples were diluted 1:100 in the reagent (Infinity™ Triglycerides Liquid Stable Reagent, Thermo Electron Corporation, Melbourne, Australia) and incubated for 30 min at 37 °C. The resulting dye was measured based on its absorbance at 550 nm. Concentrations were determined compared with a standard TG curve (Infinity™ Triglycerides Standard, Thermo Electron Corporation). The protein content of the preparations was measured by the Bradford method, using bovine serum albumin (BSA) (Sigma) as standard. All assays were performed in duplicate.

RNA extraction and real-time PCR. RNA isolation and purification was performed as described earlier19. Transcript levels for Aqp3 (NM_016689.2), Aqp7 (NM_007473.4), Aqp9 (NM_022026.2) and Pparg (NM_001127330.1) were quantified by real-time PCR (7300 Real Time PCR System, Applied Biosystems, Foster City, CA, USA). Primers and probes (Supplementary Table S1) were designed using the software Primer Express 2.0 (Applied Biosystems) and purchased from Genosys (Sigma). Primers or TaqMan® probes encompassing fragments of the areas from the extremes of two exons were designed to ensure the detection of the corresponding transcript avoiding genomic DNA amplification. The cDNA was amplified at the following conditions: 95 °C for 10 min, followed by 45 cycles of 15 s at 95 °C and 1 min at 59 °C, using the TaqMan® Universal PCR Master Mix (Applied Biosystems). The primer and probe concentrations were 300 and 200 nmol/L, respectively. All results were normalized for the expres-sion of 18 S rRNA (Applied Biosystems), and relative quantification was calculated using the Δ Δ Ct formula19. Relative mRNA expression was expressed as fold expression over the calibrator sample. All samples were run in triplicate and the average values were calculated.

Western blot studies. Tissues and cells were harvested and homogenized in ice-cold lysis buffer (0.1% SDS, 1% Triton X-100, 5 mmol/L EDTA∙2 H2O, 1 mol/L Tris-HCl, 150 mmol/L NaCl, 1% sodium deoxycholate, pH 7.40) supplemented with a protease inhibitor cocktail (CompleteTM Mini-EDTA free, Roche, Mannheim, Germany). Lysates were centrifuged at 16,000 g at 4 °C for 15 min to remove nuclei and unbroken cells. Total protein concentrations were determined by the Bradford assay. Thirty micrograms of total protein were diluted in loading buffer 4X (20% β -mercaptoethanol, 40 mmol/L dithiothreitol, 8% SDS, 40% glycerol, 0.016% bromophenol blue, 200 mmol/L Tris-HCl, pH 6.80) and heated for 10 min at 100 °C. Samples were run out in 10% SDS-PAGE, subsequently transferred to nitrocellulose membranes (Bio-Rad Laboratories, Inc., Hercules, CA, USA) and blocked in Tris-buffered saline (TBS) (10 mmol/L Tris-HCl, 150 mmol/L NaCl, pH 8.00) with 0,05% Tween 20 containing 5% non-fat dry milk for 1 h at room temperature (RT). Blots were then incubated overnight at 4 °C with goat polyclonal anti-AQP3, rabbit polyclonal anti-AQP7, goat polyclonal anti-AQP9 (Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA) or murine monoclonal anti-β -actin (Sigma) (diluted 1:5,000 in blocking solution). The antigen-antibody complexes were visualized using horseradish peroxidase (HRP)-conjugated anti-goat, anti-rabbit or anti-mouse IgG antibodies (diluted 1:5,000 in blocking solution) and the enhanced chemi-luminescence ECL Plus detection system (Amersham Biosciences, Buckinghamshire, UK). The intensity of the bands was determined by densitometric analysis with the Gel DocTM gel documentation system and Quantity One 4.5.0 software (Bio-Rad) and normalized with β -actin density values. All assays were performed in duplicate.

Immunohistochemistry. The immunodetection of AQP3, AQP7 and AQP9 in histological sections of subcutaneous adipose tissue and liver was performed by the indirect immunoperoxidase method12.



Sections of formalin-fixed paraffin-embedded adipose tissue (6 μ m) or liver (4 μ m) were dewaxed in xylene, rehydrated in decreasing concentrations of ethanol and treated with 3% H2O2 (Sigma) in abso-lute methanol for 10 min at RT to quench endogenous peroxidase activity. Slides were blocked during 1 h with 1% goat serum (Sigma) diluted in TBS (50 mmol/L Tris, 0.5 mol/L NaCl; pH 7.36) to prevent nonspecific adsorption. Sections were incubated overnight at 4 °C with goat polyclonal anti-AQP3, rabbit anti-AQP7 (Santa Cruz Biotechnology) or rabbit anti-AQP9 (#AQP91-A, Alpha Diagnostic International, San Antonio, TX, USA) antibodies diluted 1:100 for AQP3 and AQP7 in subcutaneous WAT and 1:500 for AQP9 in liver in TBS. After washing three times (5 min each) with TBS, slides were incubated with HRP-conjugated anti-goat IgG diluted in TBS (1:500) or Dako RealTM EnVisionTM HRP-conjugated anti-rabbit/mouse (Dako, Glostrup, Denmark) for 1 h at RT. The peroxidase reaction was visualized using a 0.5 mg/mL diaminobenzidine (DAB)/0.03% H2O2 solution diluted in 50 mmol/L Tris-HCl, pH 7.36, and Harris hematoxylin solution (Sigma) as counterstaining. Negative control slides without primary antibody were included to assess non-specific staining.

Cell cultures. Murine stromovascular fraction cells (SVFC) were isolated from subcutaneous adi-pose tissue from wild type mice as previously described12. SVFC were seeded at 2 × 105 cells/cm2 and grown in adipocyte medium [DMEM/F-12 [1:1] (Invitrogen, Paisley, UK), 16 μ mol/L biotin, 18 μ mol/L panthotenate, 100 μ mol/L ascorbate and antibiotic-antimycotic] supplemented with 10% newborn calf serum (NCS). After 4 days, the medium was changed to adipocyte medium supplemented with 3% NCS, 0.5 mmol/L 3-isobutyl-1-methylxanthine (IBMX), 0.1 μ mol/L dexamethasone, and 10 μ g/mL insu-lin. After a 3-day induction period, cells were fed every 2 days with the same medium but without IBMX supplementation for the remaining 7 days of adipocyte differentiation.

The non-tumorigenic mouse hepatocyte cell line AML12 was purchased from ATCC (Manassas, VA). Murine AML12 hepatocytes were maintained in DMEM/F-12 medium (Invitrogen) supplemented with 10% fetal bovine serum (FBS), 5 μ g/mL insulin, 5 μ g/mL transferrin, 5 ng/mL selenium (Invitrogen), 40 ng/mL dexamethasone (Sigma), and antibiotic-antimycotic (Complete Growth Medium). AML12 cells were seeded at 2 × 105 cell/cm2 and grown in Complete Growth Medium.

Differentiated subcutaneous adipocytes and AML12 hepatocytes were serum-starved for 24 h and quiescent cells were stimulated with recombinant murine leptin (10 nmol/L) (450-31, PeproTech EC, Inc., Rocky Hill, NJ, USA) or with TZD rosiglitazone (BRL49653, Cayman Chemical Ann Arbor, MI) 10 μ mol/L for 24 h. One sample per experiment was used to obtain control responses in the presence of the solvent.

Measurement of glycerol release. Glycerol release to the culture media was evaluated according to previously described methods12. Briefly, differentiated murine subcutaneous adipocytes were stim-ulated with leptin 10 nmol/L for 24 h at 37 °C in the presence or absence of HgCl2 (0.3 mmol/L) or CuSO4 (0.1 mmol/L). The glycerol concentration in the culture media was measured by a quantitative enzymatic determination assay (Sigma). Intra- and inter-assay coefficients of variation were 1.5% and 4.2%, respectively.

Confocal immunofluorescence microscopy. 3T3-L1 cells were differentiated into adipocytes as previously described12, grown on glass coverslips and stimulated with leptin (10 nmol/L) for 4 h. Cells were fixed in cold methanol (− 20 °C), washed with PBS, permeabilized with blocking solution (PBS containing 0.1% Triton X-100 and 5 mmol/L glycine) for 1 h at RT and then incubated with goat poly-clonal anti-AQP3 or rabbit polyclonal anti-AQP7 (Santa Cruz Biotechnology) antibodies diluted 1:100 overnight at 4 °C. After washing with PBS, cells were incubated with Alexa Fluor® 488-conjugated don-key anti-goat IgG or Alexa Fluor® 594 chicken anti-rabbit (Invitrogen) diluted 1:200 for 2 h at RT. After washing, coverslips were mounted on microscope slides and examined under a TCS-SP2-AOBS confocal laser scanning microscope (Leica Corp., Heidelberg, Germany).

Statistical analysis. Data are expressed as the mean ± SEM. Statistical differences between mean values were analyzed using two-way ANOVA (genotype x treatment) or one-way ANOVA followed by Tukey’s post-hoc test, if an interaction was detected. Pearson correlation coefficients (r) and step-wise multiple linear regression analysis were used to analyze the association between variables. A P value < 0.05 was considered statistically significant. The statistical analyses were performed using the SPSS/Windows version 15.0 software (SPSS Inc,. Chicago, IL, USA).

References1. Chalasani, N. et al. The diagnosis and management of non-alcoholic fatty liver disease: practice guideline by the American

Gastroenterological Association, American Association for the Study of Liver Diseases, and American College of Gastroenterology. Gastroenterology 142, 1592–1609 (2012).

2. Krawczyk, M., Portincasa, P. & Lammert, F. PNPLA3-associated steatohepatitis: toward a gene-based classification of fatty liver disease. Semin Liver Dis 33, 369–379 (2013).

3. Clark, J. M. The epidemiology of nonalcoholic fatty liver disease in adults. J Clin Gastroenterol 40 Suppl 1, S5–S10 (2006).4. Machado, M., Marques-Vidal, P. & Cortez-Pinto, H. Hepatic histology in obese patients undergoing bariatric surgery. J Hepatol

45, 600–606 (2006).



5. Frühbeck, G. & Gómez-Ambrosi, J. Control of body weight: a physiologic and transgenic perspective. Diabetologia 46, 143–172 (2003).

6. Boza, C. et al. Predictors of nonalcoholic steatohepatitis (NASH) in obese patients undergoing gastric bypass. Obes Surg 15, 1148–1153 (2005).

7. Frühbeck, G., Méndez-Giménez, L., Fernández-Formoso, J. A., Fernández, S. & Rodríguez, A. Regulation of adipocyte lipolysis. Nutr Res Rev 27, 63–93 (2014).

8. Zhang, J. et al. Association between serum free fatty acid levels and nonalcoholic fatty liver disease: a cross-sectional study. Sci Rep 4, 5832 (2014).

9. Rodríguez, A., Catalán, V., Gómez-Ambrosi, J. & Frühbeck, G. Aquaglyceroporins serve as metabolic gateways in adiposity and insulin resistance control. Cell Cycle 10, 1548–1556 (2011).

10. Frühbeck, G. Obesity: aquaporin enters the picture. Nature 438, 436–437 (2005).11. Hara-Chikuma, M. et al. Progressive adipocyte hypertrophy in aquaporin-7-deficient mice: adipocyte glycerol permeability as a

novel regulator of fat accumulation. J Biol Chem 280, 15493–15496 (2005).12. Rodríguez, A. et al. Insulin- and leptin-mediated control of aquaglyceroporins in human adipocytes and hepatocytes is mediated

via the PI3K/Akt/mTOR signaling cascade. J Clin Endocrinol Metab 96, E586–E597 (2011).13. Laforenza, U., Scaffino, M. F. & Gastaldi, G. Aquaporin-10 represents an alternative pathway for glycerol efflux from human

adipocytes. PLoS One 8, e54474 (2013).14. Madeira, A. et al. Human aquaporin-11 is a water and glycerol channel and localizes in the vicinity of lipid droplets in human

adipocytes. Obesity, 22, 2010–2017 (2014).15. Rojek, A. M. et al. Defective glycerol metabolism in aquaporin 9 (AQP9) knockout mice. Proc Natl Acad Sci USA 104, 3609–3614

(2007).16. Jelen, S. et al. Aquaporin-9 protein is the primary route of hepatocyte glycerol uptake for glycerol gluconeogenesis in mice. J Biol

Chem 286, 44319–44325 (2011).17. Calamita, G. et al. Biophysical assessment of aquaporin-9 as principal facilitative pathway in mouse liver import of glucogenetic

glycerol. Biol Cell 104, 342–351 (2012).18. Kuriyama, H. et al. Coordinated regulation of fat-specific and liver-specific glycerol channels, aquaporin adipose and aquaporin

9. Diabetes 51, 2915–2921 (2002).19. Catalán, V. et al. Influence of morbid obesity and insulin resistance on gene expression levels of AQP7 in visceral adipose tissue

and AQP9 in liver. Obes Surg 18, 695–701 (2008).20. Marrades, M. P., Milagro, F. I., Martínez, J. A. & Moreno-Aliaga, M. J. Differential expression of aquaporin 7 in adipose tissue

of lean and obese high fat consumers. Biochem Biophys Res Commun 339, 785–789 (2006).21. Ceperuelo-Mallafré, V. et al. Adipose tissue expression of the glycerol channel aquaporin-7 gene is altered in severe obesity but

not in type 2 diabetes. J Clin Endocrinol Metab 92, 3640–3645 (2007).22. Gena, P. et al. Liver glycerol permeability and aquaporin-9 are dysregulated in a murine model of non-alcoholic fatty liver

disease. PLoS One 8, e78139 (2013).23. Rodríguez, A. et al. Reduced hepatic aquaporin-9 and glycerol permeability are related to insulin resistance in non-alcoholic fatty

liver disease. Int J Obes 38, 1213–1220 (2014).24. Frühbeck, G., Gómez-Ambrosi, J. & Salvador, J. Leptin-induced lipolysis opposes the tonic inhibition of endogenous adenosine

in white adipocytes. FASEB J 15, 333–340 (2001).25. Petersen, K. F. et al. Leptin reverses insulin resistance and hepatic steatosis in patients with severe lipodystrophy. J Clin Invest

109, 1345–1350 (2002).26. Sáinz, N. et al. Leptin administration favors muscle mass accretion by decreasing FoxO3a and increasing PGC-1a in ob/ob mice.

PLoS One 4, e6808 (2009).27. Frühbeck, G., Aguado, M., Gómez-Ambrosi, J. & Martínez, J. A. Lipolytic effect of in vivo leptin administration on adipocytes

of lean and ob/ob mice, but not db/db mice. Biochem Biophys Res Commun 250, 99–102 (1998).28. Kishida, K. et al. Aquaporin adipose, a putative glycerol channel in adipocytes. J Biol Chem 275, 20896–20902 (2000).29. Yasui, H. et al. Membrane trafficking of aquaporin 3 induced by epinephrine. Biochem Biophys Res Commun 373, 613–617

(2008).30. Walker, C. G., Holness, M. J., Gibbons, G. F. & Sugden, M. C. Fasting-induced increases in aquaporin 7 and adipose triglyceride

lipase mRNA expression in adipose tissue are attenuated by peroxisome proliferator-activated receptor alpha deficiency. Int J Obes 31, 1165–1171 (2007).

31. Preston, G. M., Jung, J. S., Guggino, W. B. & Agre, P. The mercury-sensitive residue at cysteine 189 in the CHIP28 water channel. J Biol Chem 268, 17–20 (1993).

32. Zelenina, M., Tritto, S., Bondar, A. A., Zelenin, S. & Aperia, A. Copper inhibits the water and glycerol permeability of aquaporin-3. J Biol Chem 279, 51939–51943 (2004).

33. Rodríguez, A. Novel molecular aspects of ghrelin and leptin in the control of adipobiology and the cardiovascular system. Obes Facts 7, 82–95 (2014).

34. Skowronski, M. T. et al. AQP7 is localized in capillaries of adipose tissue, cardiac and striated muscle: implications in glycerol metabolism. Am J Physiol Renal Physiol 292, F956–F965 (2007).

35. Kishida, K. et al. Enhancement of the aquaporin adipose gene expression by a peroxisome proliferator-activated receptor γ . J Biol Chem 276, 48572–48579 (2001).

36. Jiang, Y. J., Kim, P., Lu, Y. F. & Feingold, K. R. PPARγ activators stimulate aquaporin 3 expression in keratinocytes/epidermis. Exp Dermatol 20, 595–599 (2011).

37. Méndez-Giménez, L., Rodríguez, A., Balaguer, I. & Frühbeck, G. Role of aquaglyceroporins and caveolins in energy and metabolic homeostasis. Mol Cell Endocrinol, 397, 78–92 (2014).

38. Arner, P. Differences in lipolysis between human subcutaneous and omental adipose tissues. Ann Med 27, 435–438 (1995).39. Jocken, J. W. et al. Insulin-mediated suppression of lipolysis in adipose tissue and skeletal muscle of obese type 2 diabetic men

and men with normal glucose tolerance. Diabetologia 56, 2255–2265 (2013).40. Reshef, L. et al. Glyceroneogenesis and the triglyceride/fatty acid cycle. J Biol Chem 278, 30413–30416 (2003).41. Prentki, M. & Madiraju, S. R. Glycerolipid metabolism and signaling in health and disease. Endocr Rev 29, 647–676 (2008).42. Calamita, G. et al. Altered expression and distribution of aquaporin-9 in the liver of rat with obstructive extrahepatic cholestasis.

Am J Physiol Gastrointest Liver Physiol 295, G682–G690 (2008).43. Potter, J. J. et al. Effects of acetaldehyde on hepatocyte glycerol uptake and cell size: implication of aquaporin 9. Alcohol Clin Exp

Res 35, 939–945 (2011).44. Portincasa, P. & Calamita, G. Water channel proteins in bile formation and flow in health and disease: When immiscible becomes

miscible. Mol Aspects Med 33, 651–64 (2012).45. Elkjaer, M. et al. Immunolocalization of AQP9 in liver, epididymis, testis, spleen, and brain. Biochem Biophys Res Commun 276,

1118–1128 (2000).



46. Nicchia, G. P., Frigeri, A., Nico, B., Ribatti, D. & Svelto, M. Tissue distribution and membrane localization of aquaporin-9 water channel: evidence for sex-linked differences in liver. J Histochem Cytochem 49, 1547–1556 (2001).

47. Prieur, X. et al. Leptin regulates peripheral lipid metabolism primarily through central effects on food intake. Endocrinology 149, 5432–5439 (2008).

48. Vidal-Puig, A. et al. Regulation of PPARγ gene expression by nutrition and obesity in rodents. J Clin Invest 97, 2553–2561 (1996).49. Memon, R. A. et al. Up-regulation of peroxisome proliferator-activated receptors (PPAR-α ) and PPAR-γ messenger ribonucleic

acid expression in the liver in murine obesity: troglitazone induces expression of PPAR-γ-responsive adipose tissue-specific genes in the liver of obese diabetic mice. Endocrinology 141, 4021–4031 (2000).

50. Matsusue, K. et al. Hepatic steatosis in leptin-deficient mice is promoted by the PPARγ target gene Fsp27. Cell Metab 7, 302–311 (2008).

51. Méndez-Giménez, L. et al. Sleeve gastrectomy reduces hepatic steatosis by improving the coordinated regulation of aquaglyceroporins in adipose tissue and liver in obese rats. Obes Surg, doi: 10.1007/s11695-015-1612-z (2015).

52. Lee, D. H. et al. The effects of thiazolidinedione treatment on the regulations of aquaglyceroporins and glycerol kinase in OLETF rats. Metabolism 54, 1282–1289 (2005).

53. Frühbeck, G., Alonso, R., Marzo, F. & Santidrián, S. A modified method for the indirect quantitative analysis of phytate in foodstuffs. Anal Biochem 225, 206–212 (1995).

AcknowledgementsThe authors gratefully acknowledge Patricia Autonell for her technical assistance. This work was supported by Fondo de Investigación Sanitaria-FEDER (FIS PI10/01677, PI12/00515 and PI13/01430) from the Spanish Instituto de Salud Carlos III, the Department of Health of the Gobierno de Navarra (61/2014) as well as by the Plan de Investigación de la Universidad de Navarra (PIUNA 2011-14). CIBER de Fisiopatología de la Obesidad y Nutrición (CIBERobn) is an initiative of the Instituto de Salud Carlos III, Spain.

Author ContributionsA.R. and G.F. designed the study. A.R., N.M., I.B., L.M.-G., S.B., V.C., J.G.A., M.M.M. and G.F. researched data. A.R. and G.F. wrote the manuscript. A.R., N.M., S.B., V.C., P.P., G.C., G.S., M.M.M. and G.F. contributed to the Discussion. A.R., N.M., I.B., L.M.-G., S.B., V.C., J.G.A., P.P., G.C., G.S., M.M.M. and G.F. reviewed/edited manuscript. A.R. and G.F. acquired funding for this study. G.F. is the guarantor of this work, had full access to all the data, and takes full responsibility for the integrity of data and the accuracy of data analysis.

Additional InformationSupplementary information accompanies this paper at http://www.nature.com/srepCompeting financial interests: The authors declare no competing financial interests.How to cite this article: Rodríguez, A. et al. Leptin administration restores the altered adipose and hepatic expression of aquaglyceroporins improving the non-alcoholic fatty liver of ob/ob mice. Sci. Rep. 5, 12067; doi: 10.1038/srep12067 (2015).

This work is licensed under a Creative Commons Attribution 4.0 International License. The images or other third party material in this article are included in the article’s Creative Com-

mons license, unless indicated otherwise in the credit line; if the material is not included under the Creative Commons license, users will need to obtain permission from the license holder to reproduce the material. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/

http://www.nature.com/srep

http://creativecommons.org/licenses/by/4.0/

- 115 -

4. Aquaporins in health and disease: new molecular targets for

drug discovery

Article

Rodríguez A, Méndez-Giménez L, Frühbeck G.

Aquaporins in health.

Aquaporins in health and disease: new molecular targets for drug discovery (ISBN:

9781498707831). Chapter 6. Ed. CRC Press Taylor & Francis Group, Publishing 2016.

Editor Graça Soveral, Søren Nielsen and Angela Casini. DOI: 10.1201/b19017-9.

Main objective

This book chapter focuses on the functional relevance of aquaporins in

mammalian physiology and pathophysiology.

Specific objectives

To describe the main expression sites and biological functions of aquaporins,

aquaglyceroporins and superaquaporins.

To review murine and human phenotypes of aquaporin deficiency.

To outline the relevance of aquaporins in human metabolism and disease.

Rodríguez A, Méndez-Giménez L, Frühbeck G. Aquaporins in health. In: Soveral G,

Nielsen S, Casini A, editors. Aquaporins in health and disease: new molecular targets

for drug discovery. CRC Press, 2016, p. 103-124.

http://metalib.unav.es:3210/unav?genre=bookitem&isbn=9781498707831&issn=&title=Aquaporins%20in%20Health%20and%20Disease%20:%20New%20Molecular%20Targets%20for%20Drug%20Discovery&volume=&issue=&date=20160101&atitle=Aquaporins%20in%20Health%20and%20Disease%20%3A%20New%20Molecular%20Targets%20for%20Drug%20Discovery&aulast=&spage=&rft_id=info:doi/&id=info:Unika:1136147&sid=EBSCO:eBook%20Index&pid=

http://metalib.unav.es:3210/unav?genre=bookitem&isbn=9781498707831&issn=&title=Aquaporins%20in%20Health%20and%20Disease%20:%20New%20Molecular%20Targets%20for%20Drug%20Discovery&volume=&issue=&date=20160101&atitle=Aquaporins%20in%20Health%20and%20Disease%20%3A

Date post:	14-Aug-2021
Category:	Documents
Upload:	others
View:	1 times
Download:	0 times

ROLE OF AQUAPORINS IN THE IMPROVEMENT OF ......I would like to thank the University of Navarra and...

Documents