ambiti ons issue no. 1 Myths & Legends: Why miners underground believe in the protection granted by Saint Barbara and other patron saints of miners. Page 22 Big Potential Sika’s head of R&D gets inspiration from the new Technology Center where he works. Page 14 Impressive Contrast Hollywood actress Uma Thurman posed for a Louis Vuitton advertising campaign in front of raw concrete. Page 19 Interview: Valerio Olgiati on provocative architecture. Page 8 customer magazine Concrete Oasis The sculpture park of Swiss artist Bruno Weber is a fantasy world made of concrete – enriched by Sika products. Page 25 The Virtues of Concrete Durability
Transcript
ambitionsissue no. 1
Myths & Legends:
Why miners underground
believe in the protection
granted by Saint Barbara and
other patron saints of miners.
Page 22
Big Potential
Sika’s head of R&D
gets inspiration from
the new Technology
Center where he works.
Page 14
Impressive Contrast
Hollywood actress Uma Thurman
posed for a Louis Vuitton
advertising campaign in front
of raw concrete.
Page 19
Interview: Valerio Olgiati
on provocative architecture.
Page 8
customer magazine
Concrete Oasis
The sculpture park of Swiss
artist Bruno Weber is a fantasy
world made of concrete –
enriched by Sika products.
Page 25
The Virtues of Concrete
Durability
Letzigrund Stadium Zurich,
Switzerland: Sika Solutions
from Basement to Roof.
intro
ambitions | no. 1
editorial 3
Dear Readers,
Concrete stands for durability. And Sika has contributed to that standing signifi cantly in the course of
its almost 100-year history. If there is a need for concrete with special characteristics, Sika products
are there. At the tunnel construction site for a new railway through the Gotthard massif in Switzerland
(called NEAT), for example, retarders prevent concrete from hardening on its long journey into the
depths of the mountain. After placing, accelerators speed hardening and shorten work cycles, while
special powders boost the material’s strength. Superplasticizers grant easy application during all this
time. They all contribute to the durability of the structure.
For the most part, concrete is made of natural, raw materials and “green concrete” is now an industry
buzzword. It is all about using a maximum of renewable materials or materials that greatly improve
energy effi ciency during production. Sika pays close attention to ensure that the materials we use for
our international production are local. Sustainability is also a form of durability.
Sika’s rise and constant growth as an enterprise is as durable as the concrete we produce.
Sika has the right chemistry. And it is precisely that chemistry that we wish to communicate
through our publication ambitions. This fi rst edition of our customer magazine stands – how could
it be anything else – under the motto “durability”.
Contributors to this issue: Bastian Bicher, Reto Clenin, Laura Egli,
Ricardo Gomez, Jeannette Kaufmann,
Don Lewis Kirk, Kathrin Müller, Silvia
Schärer, Jürg Schlumpf, Martin Stutz,
Andreas Turner
All trademarks used or mentioned
herein are protected by law.
Reproduction is permitted with the
written consent of the publisher.
Ernst Bärtschi,
CEO
Sika AG
Ernesto Schümperli,
President of
Business Unit Concrete
04 Commitment
Dependable Innovations
06 Sika Local
The Dubai Metro Project
08 Interview
Architect Valerio Olgiati
12 Focus
The Gotthard Base Tunnel
13 Retro
The Order Called for a Sealing!
14 Know-how
Sika’s New Technology Center
18 Fascination
Spotlight on Concrete
22 People
Patron Saints of Miners
24 Success Story
Dissipating Earthquake Forces
25 Events
A Fantasy World Made of Concrete
26 Exceptional
Concrete Truck Drivers Competition
27 You
Do You Speak Sika?
Dear Customers,
It is with great pleasure that we present Sika’s new international customer magazine. In addition to
our good local relations, this magazine will give you the opportunity to learn more about Sika’s
cutting-edge technology. The magazine’s title is our agenda: You will read about exceptional building
projects that were achieved with Sika products, but also about ambitious company developments,
such as our new Technology Center in Zurich that will strengthen our innovation capabilities. In every
issue, the magazine will focus on a Sika product segment, such as concrete or adhesives for
industrial use. This current issue is dedicated to concrete. We will also concentrate on a different
aspect of the Sika brand and show you the values that we share as a company and the principles
we stand for.
I hope you enjoy reading ambitions!
4
Concrete shapes emotion. Adaptable, colorful, a medium of change, it trans-
forms our cityscapes into beautiful environments for social contacts,
business and cultural events.
As a building material of choice, concrete is used more than any other
man-made building material. Its strength and workability make it ideal for the
construction of roads, bridges, airports, railways, tunnels, public buildings and
other major infrastructure projects.
Some of the most spectacular structures in the world, including the
thousand-foot Shanghai World Finance Center, are only possible because of
concrete’s virtues. The result is a symbol of human ingenuity, engineering skill
and concrete’s versatility. Advancements in chemical admixtures have in-
creased concrete’s adaptability, making it a foundation for everything – a
medium that connects people through form, texture, structure, light and shad-
ow. Every innovation unlocks new hidden qualities of this material. Concrete has
a bright – and aesthetic – future ahead.
No other material has so many forms of expression. With recent concrete
innovations, this building material can be shaped into any structure, turning
shelter and space into a comfortable and beautiful environment to live in.
Concrete enriches human life and forms the world around us.
Dependable InnovationsConcrete brings beauty,
form and durability to our changing world.
constructivcommitment
Turning Torso, Town Landmark
of Malmö, Sweden
Star architect Santiago Calatrava used a combination of art, geometry and modern technology to turn an unusual idea into reality. Spiraling 90 degrees, Europe’s tallest residential tower was built with Sika ViscoCrete® Technology.
San Bernardino Road Tunnel,
Grisons, Switzerland
Sika played a signifi cant role in the new construction of the San Bernardino Tunnel in Switzerland and ensured the protection of concrete as well as waterproofi ng under the roadway during reconstruction.
Freeway Bypass Brunau,
Zurich West, Switzerland
Underground tunnel passages were secured
with high-performance Sika shotcrete and
waterproofed with controlled tunnel
membrane systems. Durable concrete
solutions were used to build tunnel and
bridging structures.
The Dolder Grand,
Zurich, Switzerland
Sika furnished synthetic resin fl oor-covering systems, parquet systems and façade waterproofi ng as well as a concept for the concrete: the reconstruction required a concrete that was impermeable as well as caulking.
ambitions | no. 1
Schoolhouse Hinter Gärten,
Riehen, Switzerland
Artist Jörg Niederberger and the
architect’s offi ce in charge, Marques AG,
created a special color concept for
this elementary school building in Riehen
near Basel, Switzerland.
Pho
tos:
Ric
ardo
Gom
ez (1
), P
ablo
Fac
cine
tto
(1),
Uni
que
Airp
ort Z
uric
h (1
), S
ika
5ve commitment
Wilson Bridge
near Washington D.C., USA
The old bridge threatened to collapse under its heavy load of traffi c and therefore a new construction had to be built. Sika offered a solution that included admixtures, adhesives and grout for cable duct post-tensioning and anchorage protection.
Road and Train Bridge,
Winterthur, Switzerland
A weak supporting structure, leaky bridge slabs, as well as cracked and corroded concrete made bridge repairs necessary. Sika furnished the grouting mortar, repair grout and protective concrete coating needed to preserve the structure.
Unique Airport, Zurich–Kloten,
Switzerland
Work in progress since 1999: Sika provided the rapid cure cement, quick mortar and post-treatment products used to repair the runway. Construction work was done at night and the runway had to be ready for planes to land the next day.
Dam near Düdingen,
Canton Fribourg, Switzerland
Continuous maintenance works such as Sika caulking systems and Sika concrete reconstruction systems are being carried out.
ambitions | no. 1
6
Dubai Metro – a Project with PromiseDubai traffi c snarl is the brunt of jokes,
but for people on the ground it’s no
laughing matter. Gridlock and traffi c chaos
are an everyday event, made worse
by the highest accident rate per capita in
the world. But relief is in sight.
worldwidesika local
ambitions | no. 1
Pho
tos:
iSto
ckph
oto/
Dav
e Ev
eritt
(1),
Sik
a
7
Dubai Municipality is about a year away from putting a
€2.7 billion fully automated train system into motion that
will help remedy traffi c congestion, but also keep pace with
the fastest-growing urban populations in the Middle East.
When completed, the Dubai Metro will run underground
in the city and on elevated viaducts elsewhere. Two lines, the
Red and Green Lines, are now under construction, and two
more (the Blue and Purple Lines) are proposed that will
eventually transport up to 1.2 million passengers a day.
The Dubai Metro project. Driverless and fully automated,
the Dubai Metro will dramatically improve travel options for
city residents and visitors who are currently limited to taxis,
busses and abras (the traditional boat made of wood, used
to transport people across Dubai Creek). A trip downtown at
rush hour, which now takes four hours, will take only a mat-
ter of minutes.
Scheduled to begin operations in September 2009, the
Red Line will connect 28 stations, including Jebel Ali Port,
the American University in Dubai, the city center and connect
Dubai International Airport Terminals 1 and 3 with Rashidiya.
The second, more critical Green Line, which is scheduled for
completion in 2010, will start at Festival City, through a
7.9-kilometer tunnel under the central business district, and
end in Al Qusais. The fi nal proposed stages, the Purple and
Blue Lines, will link Dubai International Airport with Al
Maktoum International Airport.
State-of-the-art train travel. Traveling at speeds of up to
110 kilometers an hour, a total of 87 fi ve-car trains will
transport passengers in luxury. Designed to carry 643 seated
and standing passengers, the trains will have three classes
of accommodation: Gold Class, Women and Children Class,
and Silver Class. Monitors in every train inform passengers
about upcoming stop, but also about cultural events and
current topics of interest in Dubai. Metro stops will be timed
so that trains arrive every 90 seconds during rush hour, re-
ducing waiting time for passengers to a maximum of 160
seconds. Dubai Municipality expects so many people will be
attracted to luxury train cars, prevalence of taxi stands, park
and ride parking spots and metro stations that it will make a
major impact on traffi c congestion, but also contribute to
noise reduction and reduce air pollution.
A construction challenge. The Dubai Metro project,
which began construction in 2006, is a considerable chal-
lenge for engineers and builders with a total volume of three
million cubic meters of concrete. Huge Tunnel Boring
Machines (TBM) are needed to excavate and construct train
tunnels. 370,000 cubic meters of concrete are applied for
the excavation and security reasons. Sika’s powerful admix-
ture technology ViscoCrete®-3110 is used to extend concre-
te workability for up to 4 hours.
The overland elevated sections will cover a distance of
58.7 kilometers. Just for the viaduct support units, it was
necessary to set up a special production plant to mix 700,000
cubic meters of concrete.
So much of construction depends on fast, effi cient and
effective use of concrete that Sika has become a major fac-
tor in the Metro’s construction. Sika is providing admixtures
that cover the entire range of concrete grades and technical
requirements, which has made it a major contributor to the
fast and economic production of all concrete types for this
ambitious undertaking.
A project of promise for millions of people in Dubai, the
Dubai Metro should revolutionize public transport in the UAE
Emirate and could even make gridlock and traffi c chaos a
thing of the past.
sika local
Ready-mix concrete plant.
Precast part erection of elevated Metro station.
Testing of fresh concrete properties.
Finalized elevated section.
ambitions | no. 1
ambitions | no. 1
8
“In Connection with Bronze,
Concrete Has an Almost
Jewel-like Quality He seeks the tension between mathematics and emotion: Valerio Olgiati,
one of Switzerland�s most distinguished architects,
on provocative architecture and the fascination of concrete.
architecturinterview
”
ambitions | no. 1
Pho
tos:
Ald
o Ta
daro
, Ate
lier
Olg
iati
Ambitions | No. 1
9
Mr. Olgiati, what makes an architect good? I think a
good architect creates something with every new building
that did not exist before.
What is your main objective when you take on a new
task? My work should create a prototype, something original
and new from the ground up. This approach is something I
expect of my students as well. I fi nd it interesting, because
it’s the most important creative motivation.
You have a radical, often monumental architectural
style. What are the ideals behind them? Among
architects in this country the only thinkable construction is
contextual construction. To do that, you study the area
where a structure is to be built, try to complement it, and
enter into a dialogue. But there have always been structures
produced by architects who follow their own principles.
Stables, churches and temples for example. I am more
interested in this kind of thinking and turn automatically to
isolated structures that are called radical and monumental.
Temple-like structures and forms, resembling cult
places of worship, seem to appeal to you. The cult
concept relates to questions of speculation, memory and
emotion. If I were only able to erect three-dimensional geo-
metric forms, they would only be anemic and cold. They
would have no poetic aspects.
Are the ergonomics, the practical utility of a house,
introduced subsequent to radical form? No. Every
intellectual engagement with a building is a practical thinking
process. How doors open, how one looks from darkness into
light – these sensual components are perceived by reason.
These are important aspects of the thinking that affects
planning, but it is not the foundation of a good building.
Anyone can build a practical house; any real estate broker
can plan it. But that has nothing to do with good architecture.
Did fame allow you to cast off the normal require-
ments of your occupation, like time pressure and
profi tability? Does an architect gain more freedom as his
when a builder thinks the architect is a servant who can al-
ways change his product at any time. It doesn’t work like that.
An architect works like a watchmaker – and cannot function
as a service provider.
You are keeping track of projects in Asia. Are you
looking for commonality in Asian and European cul-
ture? Together with my wife, I travel to a different country
every year for four weeks. Our most recent destinations were
Cambodia, Burma, Peru and India. Islamic architecture fas-
cinates me the most at the moment. It is unbelievably inspir-
ing – really something you cannot ignore. These infl uences
are also evident in my projects.
e interview
The architect
Valerio Olgiati (50) is one of the most prominent, but also one of the most radical Swiss architects. He studied architec-ture at the Swiss Federal Institute of Technology Zurich (ETH) and opened an offi ce in Zurich in 1996 and later in Chur in 2005. Today, he lives and works in Flims, Switzerland.
Olgiati taught in Zurich, London and New York. Since 2002, he has been a full professor at the Accademia di architettura at the Università della Svizzera italiana, in Mendrisio. About his work Olgiati says: “My buildings are not designed as a statement, but rather for dialogue. My intention is to create an architecture that leaves room for interpretation. Houses with a clear statement always have a didactic element to them, which is basically very boring.”
1998
School, Paspels,
Switzerland
Made entirely of concrete, but lined with larch wood on the inside. Ingenious: the fl oor plan consists of bent right angles that are compressed by fi ve degrees.
1999
Museum Yellow House,
Flims, Switzerland
The old building was reduced to a skeleton, left without plaster, and painted with white chalk. The roof is made of stone plates.
2003
Peak Gornergrat,
Zermatt, Switzerland
Located 3100 meters above sea level, this concrete monolith uses large-format ornamenta-tion to emphasize the unusual dimension of the landscape.
ambitions | no. 1
ambitions | no. 1
architectur10
Is that why your path is becoming increasingly inter-
national? Yes. In the German-speaking part of Switzerland,
there is a normal inclination towards consensus – even in
questions for which there can be no consensus – that is
almost absurd.
How do you deal with disappointment when you are
working on a project and suddenly the decisive fi nal
door standing between you and implementation is
suddenly closed? It is crucial for an architect to deal with
that situation. In the early years, talented people, in particular,
may crack when faced with this problem. Just consider that
the ratio of my completed building projects versus my
uncompleted projects is about 1:10. But I just accept that.
Do you sense greater triumph when you succeed in
spite of considerable opposition? No, you get used to
winning, too. Building makes me feel good in a very natural
way. I like construction sites. It is simply a nice feeling when
something is being built.
Is it important for an architect to have an individual
style to achieve international success? No, there is no
connection between style and international acclaim. The fact
that I don’t have my own style is a result of the fact that I do
not prescribe to any persuasion, believe or truth.
Don’t your buildings have recognizable attributes?
No. When someone works the way I do, they are always
looking for new possibilities. It’s about fi nding the truth in
constantly different ways – even when you know that the
ultimate truth does not exist.
The architect profession has long recognized the
power and fascination of concrete. Why does a large
portion of the public have such a hard time with it?
I’m often asked that question. Even so, I can’t give you a
conclusive answer. It can’t be the material – if you look at it
from a value-free perspective. My attempt at an explanation
is that people often speak negatively of “concrete environ-
ments” – even when concrete is completely absent or every
gram of it is hidden under build-overs. I think that the term
concrete is associated with a lot of the nonsense that was
built when it was perhaps the most dominate building
material.
Is concrete the “philosophers stone” as architecture
critic Christoph Hackelsberger called it 20 years
ago? That would go too far, even though concrete is unbe-
lievably versatile. There is so much potential in concrete that
someone outside of our discipline really can’t understand
how great this building material really is. I can think in terms
of pouring rooms and structures. And fi nally I can solve
almost any technical problems with concrete.
To what respect are you also a construction engi-
neer? Even though I can’t calculate the forces systems in a
structure, I do understand them. In my view, the way forward
today is not through the poetries of material and form. I think
that architecture can only develop out of what is already tech-
nically grounded. That is why technical knowledge is so
important.
What is your favorite material to combine with con-
crete? My answer is very personal – I like concrete in con-
interview
2004
National Palace
Museum, Taipei, Taiwan
A “Buddhist pagoda” with an oddly crazed and distorted building form. The area of the levels gets wider at the top.
2005
Ardia Palace, Tirana,
Albania
Façade elements serve as shields against sun, heat and glare, creating an impression of “soft” concrete.
2008
Visitors Center Swiss
National Park, Zernez
Connected at one corner, the two white cubes form a unit – the home of the Swiss National Park Center.
2004
Learning Center EPFL,
Lausanne, Switzerland
The structure has a random and disjointed appearance, but is in fact the result of precise structural calculations.
“ There is so much potential in concrete that someone outside of our discipline really can’t understand how great this building material really is.”
Ambitions | No. 1
e 11
nection with bronze very much. If applied liberally, bronze
catapults concrete into another sphere. Together, they have
an almost jewel-like quality.
Concrete is an extremely formable and a versatile
material. Isn’t it also the most cost-effi cient materi-
al? By far, concrete is not always the least expensive building
material. I hope very much that the manufacturing cost for
concrete production can be kept within competitive limits.
Many things are possible with concrete, which is why it is
used so often, sometimes extensively.
How do you explain design demands for raw con-
crete with its unevenness compared to a homoge-
neous material like steel, which permits share edges
and fi ne-lined structures? It is only a matter of price. If
you can pay for it, you can build a structure as precisely with
concrete as you can with steel. In Brazil, I found architecture
made of concrete with unbelievably fi ligreed and light struc-
tures. Thick concrete is something architects like to use. The
choice of rough concrete is a budget choice. I think it’s
remarkable that raw concrete is not considered as aesthetic
as fi ne concrete in Switzerland.
What advances in construction chemicals do you
fi nd particularly interesting at the moment? Self-
compacting concrete is well-suited to fulfi ll the aspiration for
emotionality in today’s architecture. I think light and insulat-
ing concrete is exciting. I built the Swiss National Park build-
ing in Zernez, Switzerland, with this material. This wouldn’t
have been possible ten years ago. You had to think in terms
of layers to solve construction physics and energetic prob-
lems. Today, it is possible to pour an entire house without
seams using this material, and thereby fulfi ll the newest
energetic requirements.
What kinds of projects give you the greatest satis-
faction? Those that I am allowed to build without making
any compromises in the design.
Does an architect need to be ahead of his time to
avoid being overtaken by it one day? That would be
nice. Still, I am primarily a child of my time and take part in
it, consciously – not as an interpreter of the future, nor a
conjurer of the past. Interview: Andreas Turner
interview
Valerio Olgiati: “One can
build a structure as
precisely with concrete as
one can with steel. It is
only a matter of price.”
ambitions | no. 1
2007
Atelier Bardill, Scharans,
Switzerland
A playful treatment of empty space
and volume: The only entrance
is an unglazed breach at
the front of the building,
leading from the alley
and opening to
a view of open
sky through
the terracotta-
red concrete
sculpture.
otthard12
ambitions | no. 1
Railway through the Rocks
An enormous rocky cavern, 1000 meters under a Swiss
massif of slate and gneiss. Workers are spraying shot-
crete onto a freshly excavated surface in order to secure the
rock. In a matter of minutes, the concrete hardens supporting
the tunnel wall.
In this eerie environment, far below the Alpine city of
Sedrun in the Canton of Grisons, the Swiss are building the
Gotthard Base Tunnel, the world’s longest train tunnel. Since
1993, work has been going on at fi ve sites that will eventu-
ally connect a mega two single-track tunnel system.
When completed in 2016, the Gotthard Base Tunnel will
provide passage for fast trains, weighing twice the maximum
weight of existing freight trains, which will traverse Europe’s
main axis between North and South at speeds of up to 250
km/h, reducing travel time by 50 minutes.
The Gotthard Base Tunnel, the world’s
longest train tunnel, currently being built through
the Swiss Alps, is a pioneering journey
through 13 million cubic meters of rock –
a spectacular 153-kilometer, 23-year passage
made possible also by Sika innovation.
The project owner, AlpTransit Gotthard AG, a subsidiary
of the Swiss Federal Railways, hopes the €5.5 billion project
will take cargo off the road and relieve other chronically
congested Swiss tunnels.
Construction of the Gotthard Tunnel is a journey through
changing strata that requires strength and durability of the
project’s most important building material: concrete.
Progressing at a rate of many meters a day, workers
depend on concrete that activates “just in time” for various
applications, including inverts and inner lining of the tunnel.
In some cases, sprayed concrete must be workable for
up to eight hours and pumpable for long distances. To achieve
this, a special admixture, called SikaTard®, is used to stabilize
concrete, while accelerators (Sigunit®-AF) ensure that
strength development starts on time.
gfocus
Construction of the
Gotthard Base Tunnel
is a journey through
changing strata that
requires concrete’s
strength and durability.
Pho
tos:
Sik
a
13
Kaspar Winkler’s formula of success when he founded
the company in 1910 was sealing, and sealing still is the
formula of Sika Group’s worldwide success today. For almost
100 years the company’s success was the result of providing
durable solutions to Sika’s customers. Of course, during the
past decades countless new products and systems for vari-
ous challenges and customers have been developed, how-
ever, always driven by the will to manufacture high quality
products, also for sealing.
At the time the company was founded, Kaspar Winkler
developed a product (Sika®-1) as protection against water
and moisture. During the war years, adapted to economic
hardship, Sika made the economic break through with this
product in 1916. As a result of a shortage of coal reserves
due to the length of the war, the idea to electrify the railways
gained momentum. To realise this objective, the masonry
walls of the tunnel needed to be sealed against water
ingress. Sika®-1 or Sika®-3 proved to be the right solution.
These solutions speak for themselves since in many parts of
the world they are still successfully used even today.
The system used to seal masonry walls during the early
years of Sika developed into complex sealing systems used in
the construction of the new alp transit NEAT at the Gotthard
Base Tunnel (see opposite page). What began as a simple,
ingenious product to improve mortar, eventually became a
wide range of systems to improve concrete and shotcrete,
the sealing of large areas with waterproofi ng membranes or
the connection of different building parts with sophisticated
joint sealing profi les. However, then as well as today the
mission is sealing and the solution is durable.
1916retro
ambitions | no. 1
Keeping water from
seeping through, Sika
was already improving
mortar in 1916. The
original sealing
compound Sika®-1
is still being used all
over the world.
The high temperatures and humidity underground call
for concrete that is workable for long time, or has quick
early strength characteristics. These opposite effects are
achieved with “custom-designed” Sika admixtures. Behind
the scenes, Sika scientists have been part of the project from
the very beginning. The discovery of high-range water reduc-
ers (Sika® ViscoCrete®) based on polycarboxylate ethers
(PCE) has made concrete more workable and stronger than
was inconceivable only a few years ago.
As huge machines drill their way through the Alp’s rocky
sediments, and eventually remove over 13 million cubic me-
ters of rock – equivalent to fi ve Cheops pyramids – workers
continue to depend on fast, effi cient and safe building mate-
rials. Virtues made possible by Sika.
The Order Called for a Sealing!
ambitions | no. 1
14
Sika expects to unlock new potential in research and de-
velopment by bundling the resources of 180 employees
from all segments of R&D and Operations (production and
logistics). “Scientists who used to work at different locations
in Switzerland can work more effi ciently at one location,”
explains Urs Mäder, head of R&D. “This is also part of our
strategy for 2010, which envisions the expansion, strength-
ening and reinforcing of R&D and Operations in Zurich.”
Research on fi ve fl oors. Research at the new facility
focuses on adhesives and sealants, based on polyurethanes,
silane modifi ed polymers, polyacrylates and epoxyhybrids.
A chemical synthesis laboratory has facilities for fundamen-
tal research of adhesive and sealant technologies, including
design and synthesis of complex polymers, new curing
mechanisms and surface-active substances to improve ad-
hesion.
Technology for the FutureMade in Switzerland
Scientists also synthesize different components, such as
prepolymers, and combine them with diluents, fi llers, pig-
ments, additives or catalysts to achieve the effect they desire.
Once a composition is ready for a practical test, it is sent to
the testing laboratory and later to the pilot laboratory that can
produce larger quantities of the formula for customer tests.
The same pilot laboratory can also similate large-scale pro-
duction.
The surface analysis laboratory contains state-of-the-art
equipment, will include an energy-dispersive spectroscopy
machine (EDX) that is used to analyze surface characteristics
and reveal causes of bond defects. Surfaces such as glass
or ceramics can be classifi ed and modifi ed through plasma
treatment. Scientists conduct corrosion measurements and
defi ne dielectric properties for products such as Sika’s
window adhesives.
Meeting high standards. Located on the north side of
the building, the laboratories are protected from sunlight
and heat with state-of-the-art equipment in rooms for
analysis, storage and climatization that meet the high stan-
dards of the chemical industry. “Our chemists appreciate
the high laboratory quality,” says Urs Mäder. We are
able to increase the attractiveness of Sika Technology
through the new building, and it is also easier to fi nd highly
trained employees. We currently hire about twenty scientists
every year.”
Innovative, future-oriented, but conscious of its traditions, Sika recognizes the value of
Switzerland’s technology environment: A new Technology Center, located in Zurich, has opened its
doors where Sika began business almost one hundred years ago.
potentialknow-how
The new R&D building is Sika’s homage to its roots,
but also to the Swiss Technology landscape.
Pho
tos:
Ric
ardo
Gom
ez, S
ika
ambitions | no. 1
15know-how
ambitions | no. 1
The façade of the Technology Center: Sika’s advancements in structural glass adhesives were directly put into practice.
With their high bonding strength, Sika adhesives enable window manufacturers to reduce the thickness of wood sashes and increase the thermal-insulating and noise-reducing glass surface. The result is a greater reduction of heat loss, much more light but also more effective sound insulation.
New window frame profi les are now possible that allow glass to cover wood, protecting it from the ravages of wind and weather.Expensive aluminum covers as weather protection on the sash are no longer necessary. With only one aluminum cover on the frame, this new system is very competitive, with more value for the end user such as heat and sound insulation and light transmission. Stronger ad-hesives also make break-ins more diffi cult compared to traditional window building techniques.
This window system with high thermal insulation and noise reduction was developed by the Swiss window manu-facturer Baumgartner. Sika supported Baumgartner with a special fast-curing adhesive for use in a highly automated manufacturing process. The solution was the acrylate-based adhesive SikaFast®-5201 which cures within six minutes.
All window sashes in the Technology Center are now ultra-thin, but can hold tons of stress and strain with a minimum seam of only 2 mm by 10 mm. As an added benefi t adhesives can withstand long-term UV affects of the sun, adding to the 30- year life expectancy of the windows.
Sika Adhesives Advance Window Technology
ambitions | no. 1
potential16
Overall the building is a Sika concept “from basement to
roof.” Sika products are used for sealing underground, seal-
ing and anchoring the glass façade on the court side, fl oor
and wall coverings, and in the fair-faced concrete and on the
roof. The research building has six fl oors above ground, a
ground fl oor and a roof center. The conference area is on the
ground fl oor, together with testing laboratories and a pilot
facility. The building has 10,000 m2 of fl oor space and a total
volume of 40,000 m3.
Sika merges – two laboratory buildings become
one. The Tüffenwies Area has a history of growth. The way
the buildings stand, their heights and their façades create a
look that is both heterogeneous and typical for the industrial
sector. The new Technology Center stands above the other
buildings, which gain from this new accent. The new building
also blends nicely into the Tüffenwies Area through its con-
nection with the older laboratory building.
The architecture, with its strict geometric shapes and
clear-cut dimensions, is clearly committed to a classic,
rational style – that contrasts the artifi cial-world style of the
labora-tories. Materials express the way they are made;
they are not disguised and follow their own essence: clear
white walls and ceilings, staircases and elevator cores of
smooth concrete and untreated oak windows and oak
carpentry.
In this confi guration, the Technology Center can meet its
operational and commercial needs, but also benefi t from
architecture that refl ects the area’s transformation into a
location for research. The prominent central free space at the
core of the facility brings together different working and
meeting environments. This is a place that encourages team
spirit among the employees and refl ects the openness of
corporate culture which is Sika’s goal.
know-how
Building chronology | Plan of concept April 2004 | Approval of the top management December 2005 | Application for planning permission January 2006 | Building license March 2006 | Laying of the foundation stone October 2006 | Beginning of the building construction November 2006 | Topping-out ceremony June 2007 | Opening April 2008
The analysis laboratories contain state-of-the-art equipment.
Surrounded by Sika Technology. Sika scientists get
inspired by the building in which they work. The fair-faced
appearance of the building’s façade with its self-compacting
concrete and thin-wall construction of only ten centimeters
was made possible by Sika’s concrete admixtures, which
give some idea of the pioneering achievement of this new
tech-nology. Thomas Hirschi, a Sika employee, was one of
the people who provided technical support. “The façade was
made with self-compacting cast-in-place concrete and not
with prefabricated elements,” he explains. “The concrete is
beautiful to look at because of the excellent surface quality.”
At the same time, the method resulted in very little shrinkage
in mass, and a fl awless edifi ce with few seams, which is
particularly diffi cult to achieve with self-compacting con-
crete. “We were able to reach this high standard through
constant quality control during the construction phase and
profession in concrete production and placing,” he says.
Another innovation that came from the Sika laboratory
was the window adhesive. Sika’s direct-glazing technology
was used for the glass façade of the Technology Center,
which maximized the window surface and enhanced the view
out of the windows. But that’s not all. The higher rigidity of
windows mounted by adhesives makes it possible to install
thinner window frames, which allows more light into the of-
fi ces. New adhesive and cement technology contributes to
the luster on the Sika Technology Center.
ambitions | no. 1
17know-how
ambitions | no. 1
New applications for concrete, unimaginable a few decades ago, are being found every day as scientists build on the discovery of a new generation of admixtures called PCE (polycarboxylate ether), which make concrete more workable, pliable and even more beautiful. Mixed with fi ne fi lament, self compacting concrete (SCC) becomes “fair-faced,” a term used by the industry to describe the fi ne fi nish they can achieve.
With SCC it is possible to build delicate and geometrically complex construction modules, and it opens new possibilities for building designers. The accelerated application process and the elimination of the compacting process generate an additional benefi t in reducing the time needed for construction and cost optimization. An additional benefi t of SCC is the fact that it does not need to be vibrated to pack, which reduces noise, something that is appreciated by workers on site and the public. With a specially designed SCC mixture, based on Sika® ViscoCrete® Technology, the contractor was able to create an exceptionally delicate façade for the Sika Technology Center.
SCC Self Compacting Concrete
“ Our chemists appreciate
the high laboratory
quality,” says Urs Mäder,
Sika’s head of R&D.
Modern concrete is a product that stems from material that has kept the mason cladding of Roman bath houses, aqueducts and the Pantheon in place for centuries. Admired for its strength and durability over the years, concrete is today more beautiful, better workable and faster or slower drying – depending on the need.
The discovery of PCE (polycarboxylate ether), a polymer that reduces the water content of concrete, has greatly improved performance. A building or tunnel may need different lengths of time to work with concrete; this can be the case when concrete is transported through pipes over a distance or has to set quickly to seal water leaks.
Scientifi c research has improved PCE to the point that it can be placed more easily and meet every requirement, including aesthetic needs. A product called “fair-faced concrete” uses water reduction and durability to achieve fl awless surfaces, such as the façade of Sika Group’s new Technology Center in Zurich, which was built with a self-compacting Sika® ViscoCrete® PCE Technology.
PCE Polycarboxylate-Ether
ambitions | no. 1
attraction18
The innovative fl air of concrete is
diffi cult to resist: When it comes to
premium brand advertising, few back-
grounds serve as well as concrete to
bring out the “coolness” of products.
fascination
“Concrete does not steal the show, but
ThT e innnnonovavav tivevv fl airir oof f concreretete isis
did ffiffi cculuu t t to rrresist: WWWhen n it comomeses ttoo
prprpp ememium m brana d ada vevertrtisisssinininninnningggggggg,g ffffff feweweweweweweweweww bbbbb bbbacacaaa k-k-
grgrg ououndndds ssss seeseservrvr e asasaa wwelell l asaasas conncrrcrretetee e e totoo
brbrb ining ggggg ouout t ththttthe e e e “c“c“c“ccccooooooooooooooooolnlnlnllnlnlnlneses ””””s”” ooffffff f prpr dddddoddod ccucccucucuctststststststsss.
The more posh and pricey, the clearer the trend: The look
of concrete heightens attention and image building. Just
ask advertising agencies and the marketing professionals
who develop campaigns for high-tech companies such as
Bang & Olufsen, or car manufacturers Audi, BMW and Daim-
ler. Even luxury fashion designers Louis Vuitton, Giorgio
Armani and Hugo Boss like to use concrete sceneries to stage
their creations in advertisements and poster campaigns.
Concrete provides a discreet, neutral background that
sells, and for good reason: This “cool” building material
stands for stability and durability, and – more importantly –
innovation and intellectual urban feeling. Concrete does not
steal the show, but gives a product additional strength and
contour. No distraction from refl ective chrome glass or blaz-
ing colors. In an otherwise shrill advertising world, concrete
offers a calm, relaxed center of gravity that lends a product
its own strong qualities.
When French luxury brand Louis Vuitton signed a con-
tract with the American actress Uma Thurman (Kill Bill), Art
Director Marc Jacobs knew nothing but praise for the Hol-
lywood star: “Uma is an unbelievably beautiful woman – the
perfect choice to capture the power of enigmatic attraction,“
he said in an interview published by the German women’s
magazine Amica. In choosing a background for a photo shoot
with Thurman and a Louis Vuitton handbag, Jacobs opted for
a raw industrial background. “We had the idea to show this
very feminine woman in a surrounding of concrete and raw
architecture,” he explains. “The contrast was truly impres-
sive.”
In return, concrete got a little free publicity. And there is
every indication its time is far from over. Concrete architec-
ture is as timeless as good design. Andreas Turner
Spotlight on Concrete
Pho
tos:
Ban
g &
Olu
fsen
(3);
Loui
s Vu
itton
(1);
Dai
mle
r (1
); R
olf B
enz
(1)
19fascination
ambitions | no. 1
gives a product additional strength and contour.”
Concrete in the background strengthens
the design effect: Bang & Olufsen
audio-video system. And Sika supplies
the screen adhesives.
ambitions | no. 1
attraction20 fascination
“ Concrete Gives You Time and Space to Refl ect”Interview with Kasper Eis,
Head of Marketing Bang & Olufsen, Denmark.
Looking at Bang & Olufsen advertisements, one can
sense B&O’s strong affi nity for cool, modern ar-
chitecture. Why do you often choose concrete sur-
roundings for your product photos? There are a cou-
ple of reasons. Concrete, as we perceive it, is an honest
material, made of the basic earth elements: water and sand.
At fi rst glance it seems simple, but when you look closer,
every surface has a different story to tell with the many pat-
terns ingrained in the material. Not unlike a product from
Bang & Olufsen which is simple on the outside but holds
many inner qualities.
Does concrete have other qualities that help you
“stage” your products? Though rough on the surface,
concrete signals a pure and minimalistic way of life. That’s
what we strive to build into our products by removing unnec-
essary clutter, buttons and functions, allowing our clients to
live a simpler and more harmonious lifestyle. Again you have
this connection between our products and what concrete
stands for. You don’t fi nd many other materials that are so
honest in the way they are built. This product philosophy is
something we really strive to refl ect in all of our systems.
Will you continue to use concrete backgrounds for
your product photos and advertising campaigns?
Most defi nitely. I have just come from a photo shooting ses-
sion with brand-new B&O products. Unfortunately I can’t
show them to you yet, but we used concrete surfaces as a
natural backdrop to some of our newest audio and video
systems. And it was an easy choice because the very nature
of concrete allows our products to stand out and show their
best side. Concrete enhances our products in a way that no
other surface can. It represents our core qualities such as
design, craftsmanship, performance and ease of use.
The relationship between Bang & Olufsen and con-
crete seems to be a close one. Just look at pictures of
our headquarters in Struer, Denmark. Concrete is part of our
heritage and our daily life. Our headquarters has many ar-
chitectural elements. One is glass, which opens the view to
nature that surrounds us: the water, the grass, the woods,
the sky. On the other hand, most or all of our surfaces, even
the ceiling, are made of concrete. And we feel that these
surfaces give our employees a soothing working environ-
ment. Room to think. We left the concrete bare and raw.
Concrete doesn’t take away anything, it rather gives you time
to refl ect. And that is also part of our heritage and corporate
culture. So it is not only because concrete makes our prod-
ucts look better. It gives our employees the chance to come
up with unique concepts and long-lasting products.
Interview: Andreas Turner
Bang & Olufsen headquarters in Struer, Denmark.
Kasper Eis of B&O:
“Concrete enhances
our products
in a way that no
other surface can.”
21fascination
Concrete and glass façades
contrast with living room coziness:
a couch combination by Rolf Benz.
The power of female attraction
in contrast to raw architecture: Uma
Thurman models for Louis Vuitton.
Cool, elegant and reserved:
concrete sets the perfect
stage for Mercedes-Benz
automobiles. ambitions | no. 1
Heavy machinery, dust and sweat. Men, rubble and seep-
ing water. A mountain is hollowed out with all the power
and strength that technology and humans can muster. And
there is danger: despite all state-of-the-art equipment and
stringent safety precautions, experienced tunnel workers, in
particular, know nature can unleash powers beyond anyone’s
control.
Courage, faith and sometimes superstition are the
companions of miners underground. While much safer than
it was in previous decades, mining accidents continue
to happen. Miners live with heavy machinery, drills and
explosives used for exploration and development, and
extraction of minerals, rock and other geological materials
of diverse hardness. In this environment, danger is as
constant as tunnel air.
In Europe, some miners strengthen their resolve under-
ground with the veneration of Saint Barbara, the Roman
Catholic patron saint of all those who face the danger of
sudden and violent death in work. Typically, patron saints like
Courage, faith and sometimes superstition are the companions of
miners underground. Sika looks at an unusual religious tradition in Europe and
South America that encourages the use of shrines at the entrance of tunnels.
mythspeople
ambitions | no. 1
Patron Saints of Miners
Saint Barbara have shrines at the entrance of mines and
tunnels. According to legend, Saint Barbara died for her faith,
beheaded by her own father, who was subsequently struck
down by lightning. Besides protecting miners, she is there-
fore invoked against thunder and lightning and all gunpowder
explosions.
In South America, similar veneration is paid to San
Lorenzo, or Saint Lawrence, as he is more widely known in
the English-speaking world, a Christian martyr who in 285
B.C. protected Church treasures with his life. Both saints
have wide appeal in the Roman Catholic, Eastern Orthodox
and Oriental Orthodox Churches.
Living with mining danger is as old as civilization. The
world’s oldest mines date back to 4000 B.C. when iron min-
erals were excavated from “Lion Cave” in Swaziland and fl int
was mined in Hungary for weapons and tools. Whether
driven by money, courage, faith or superstition, miners are a
special breed of explorers who continue to bring the earth’s
riches to light.
Vittorio Oro,
Job Site Manager
Franzensfeste Pilot Tunnel,
Brenner Base Tunnel, Italy
“I’ve seen tough miners bow their heads to Saint
Barbara or bring her fl owers. Some will stop to
pray at our small chapel. I was 18 when I fi rst saw
a shrine to Saint Barbara and believe that she
has been protecting me ever since.”
22
“Saint Barbara is a very special saint to the mining
community. She protects those who work
underground in order to support their families. Her
image is always at the entrance of the mine and a
lot of miracles are attributed to her.”
José Perpétua, Filling Operator,
Almodovar, Spain
Alberto Rey, Mining Engineer,
Sika SA, Spain
“I’m a 36-year-old mining engineer from Asturias,
Spain, a traditional coal, gold and metals mining
region. During the last fi ve years, my job has taken
me to hundreds of tunnels, and an image of Saint
Barbara was at the entrance of all of them. This
Catholic patroness is even more important today
for people who believe she takes care of us while
we work.”
Alessandro Marchetti, Operations Foreman,
CSC AG, Lugano, Switzerland
Project: AlpTransit Gotthard
“My faith and veneration for Saint Barbara
has changed over the last ten years. She is sacred
to me and I suspect to all Catholic miners.
But the traditions surrounding this patron saint
are more commercial today. Unfortunately, her
celebration is more an event for construction site
management, squad workers and the builders.”
people
ambitions | no. 1
“For me, Saint Barbara is the patron saint of
mining and tunnel construction. I trust her
completely and believe that she protects me while
I am working underground.”
Florian Habit, Chief Construction Foreman
Hochtief AG, Essen, Germany
Project: AlpTransit Gotthard
“The celebration of Saint Barbara on the fourth
of December is like Christmas. I am very grateful
to her when I or other miners escape catastrophe,
and my gratitude grows every time I leave
the tunnel safely. I have a card or small statue
of Saint Barbara with me almost all the time.”
Ferdinand Amlacher, TBM Driver,
Alpine Mayreder Bau GmbH, Salzburg
Hans Gammel, Amberg Engineering AG,
Switzerland
“I don’t cross myself or put a candle in the
niche every time I enter the tunnel, but I do believe
Saint Barbara protects us. I fi nd it interesting to
see how attitudes change over time. It used to be
unthinkable that women could enter a tunnel,
because it meant bad luck. Today, it’s a lot more
relaxed.”
23
strength24 success story
A supportive wall has
been secured with CFRP
plates. They form a
pattern of squares and
are made mostly of
carbon fi bers that have
the same strengthening
effect as steel plates –
at a small fraction of
their weight.
ambitions | no. 1
Most buildings in Switzerland have not been designed to
withstand earthquakes and require upgrades. Industri-
elle Werke Basel (IWB), one of the country’s leading urban
energy and utility providers, decided to act and called upon
Sika to help with a seismic upgrade for a central dispersion
station, Wasgenring in Basel.
Sika technologies are helping architects, engineers and
builders make structures safer before and after earthquakes
upgrades with lighter than conventional steel reinforcements
that have the same strength and durability necessary to bring
greater structural integrity to bridges, roofs and walls.
Dispersion station Wasgenring is a major electricity
source for hospitals, an airport, trains, as well as other utili-
ties companies, including water, natural gas and telecom-
munications – and located in one of the country’s most
endangered earthquake zones.
Electricity is a vital, life-sustaining commodity. Experi-
ence with earthquake catastrophes shows that damage to
power supply stations, like Wasgenring, can have serious
effects on infrastructure, impacting the lives of more people
than other utilities.
When the Earth ShakesEarthquakes send shockwaves far beyond their epicenters. Besides endangering human lives, one
single quake can cause severe damage to vital elements of infrastructure, making it understandable
that builders are turning more often to Sika for seismic upgrades and earthquake recovery.
In 2004, structural assessment concluded that only 30%
of the building above ground would survive an earthquake.
Sika helped builders stabilize two brick structures above
ground with reinforced concrete shear walls and used pre-
stressed carbon fi ber reinforcement polymer plates (CFRP)
to connect buildings above ground with a larger tract under-
ground.
CFRP plates are made mostly of carbon fi bers, are very
lightweight (a 10-m-long plate, 50 mm wide and 1.2 mm
thick weighs less than 1 kg), but have the same strengthen-
ing effect as steel plates. Once anchored above and below
ground, they dissipate the force of an earthquake, should it
occur. With very high ductility, they bend, the force is trans-
mitted to structure and a higher strengthening effect is
achieved, reducing the likelihood of structural collapse.
With seismic upgrading and earthquake recovery now a
major industry worldwide, Sika technologies are at the
forefront of efforts to improve structural integrity in earth-
quake zones. Covering a wide range of strengthening op-
tions, Sika solutions are making structural bonding and seal-
ing of cracked concrete, stiffening and increased ductility a
viable and cost-effective way to prepare for earthquakes.
Earthquakes send shockwaves
far beyond their epicenters.
Sika technologies make building
structures safer.
Pho
tos: R
ené R
uis
; iS
tock/F
urc
hin
artevents
Ambitions | 1 | 2008
A wonderful fairy-tale castle –
and a marvel of technological
structural achievements.
The sculpture park of the
Swiss artist Bruno Weber is a
fantasy world for the playful.
A world of nymphs,
demons and sorcerers.
Nature and fantasy blend
perfectly at the park.
Artist, sculptor and architect
Bruno Weber.
An Oasis of Color and Concrete
25
What do a giant 17-meter owl, a double-faced night-
and-day gate, and a cow-shaped living area with glass
dome have in common? How do they fi t with a snaking slide,
a dolphin-barbecue eating table and other countless fantasy
fi gures, including fl ying dogs and froglike pond sentinels?
The answer is that they all come from the sheer boundless
imagination and creative hand of Bruno Weber. For 40 years,
Weber has been toiling to fi nish his life’s work – a 20,000-
square meter sculpture park at the edge of the forest near
the village of Dietikon by Zurich, Switzerland.
Another thing these sculptures have in common is that
most of them are made of concrete enriched by Sika prod-
ucts. “Sika supported me very much in the beginning,” says
the 77-year-old artist. Besides donating admixtures, Sika
also sought Weber’s advice on how best to develop Sika
products to meet his needs. “Collaboration was very valu-
able from a human perspective as well,” says Weber who
also speaks very fondly of former Board of Directors Presi-
dent, Hans Peter Ming.
Weber has not quite reached his fi nal objective and be-
gan work in July 2007 on new additions, including “Wasser-
garten” (Water Gardens) and “Haus des Wandels” (House of
Change). Three 8-meter concrete caterpillars are planned as
the highlight of the project. Sika concrete admixtures will also
serve him for those projects and others, giving the artist al-
most endless means to express himself. The park is sche-
duled to open in spring 2009.
hahahhhahhahah t t tttttt dodoododdddod aaaaaaaaaaaaaaaa g gggggggggggggiaiiiiaiaiaiaaiiaaantntntntntntnttntnttntttnttntnt 1 1111 11111117-7-7-7-7-7-7-77-7-77 mememmmmmeeeeteeeeteeter r rrrrrr r owowowowowowowwowowowowwowowwowowowooooowo ll,l,l,l,l,ll,llll,l,l,lll,,l,l,, a aaa aaaa aaaaaa aaa d d d d d d ddd ddd dddddououououououououououooououououo blblblblblblbblblbllblblblblblblble-ee-e-e-ee-e-e-e-e-e-e-e-e-e--ee fafafafafafafafafafafafaffaafafaafafaff cececececececececeececececccecececed d d d d dddddd dddddddddd ninininininnnininininninin ghghghghghhghghghghghhghghhghghhghht-t-t-t-t-t-t-ttt-t-tt-tt
aaaanananaaaaaaa d-d-d-dd-dd dadadadadadadadd yyy yyyyyyy gagagagagagagaagaaagaagaaaaggg tetetetetetettetetetetetetteteteteett ,, , anaaaananaananaaaa d d d dddddd a a a a a coocoocoooocow-wwwwww-wwww-ww-ww shhhshhs apaaaappaapppeddeddeddedededddddd ll l lll l ll lllllivivivvivivvvivivivvvvininninininininninnnnnininnniningg g g gg g g g g ggg arararararararaaarararaaaa eaeaeaeaeaeaeeeaeeaeeaeaeaeeaae w w ww w wwwwwwwwitititititititititittittitttttth h hh h h hhh hhhhh glglglglgllglglglgllllglgllasasaasasasasasasasasassasasasasassaaasssss s ssssssss
doddddddd meeeememememmemeeeememmee hhh hhhhhhhaavavaaavavava e e eeee inininiiininn cccccc ccc ccccomomomomomommomomommommmmomoomomommmmmmooommmomommm n?n?n?n?n?n?n???n??n?n?n??n??? H HHHHHH H HHHHHooooowowowo dddo o ththththhthhhtht eyeyeyeyeyeeyeyeyeyeyeeeeeyeyeeyeee fi fi fifi fi fifififi fi fi fifi fifififit ttt t ttt tt w ww w wwwwww wwwwwww wititititititititittititith h h h hhhh hhhhhh hh a a aa a a aa aaa aaaaaaaaaa snsnsnsnsnssnsnsnsnsnsnsnsnnnnsnakakakakakakakakakakkakakkakinininininininnining g g g gg gg g g gg ggg gggg slslslslssslslslslslslsss idididididididididididiiddde,e,ee,e,e,e,ee,e,eeeeee,eeee,e
a aaaa dodododododododdddoddodoolplplpplplllplplplppppppllppplppphihihiihhhhihhhhhihih nn-n-n--nnn-n bbabb rbececueueueeeeeeeeueeeeeeeeeueeeeee eee ee e e eeeeee eeeeatatatatatatataattttatatatatataaaaa iininnnninninniiniiinininng ggggggggggggg table eeeee annnannnnnananananananaaannanaanaa d dd d d dddd ddd ototototototototo heheheheheheheheheheheeer r rr r rr rr r rr cocococococococococoocococoocccococcoununuunununununununununnununununununuunununnuuuu tltltltltltlttltttttttlttltlttttttttt eseseseseseseseseseseseseseseseeseee s ss ss s s ssss s fafafafafafafafafafafaafafaaaantntntntntntntntnttntntnttntntasasasasaasassaassasasasasssyy y y yyy yyyyyyyy yyy
fi fifififi fifififififififififigugugugugguguuuguuuugggureerererrerereerereeer s,s,ss,ss,s,ss,s,ss,s,s,s,s i ncludinggng flflflflflflflflflflflflflfl yy y yyyy y yyyyyyyinnininininnng g g g dooooodoooodooooooooooooooggsgsgsgsgsggggggggggsgssgg a a a aaaaaaa ndndnddndndnddndnndnnnnnnnnnnnnd f f ff fffffffrorororororororoglglglglglglglglglg ikikikikkkkikkikkkikkkkkkke e e eeee eeeeeeeeee popopoppopopoopopopopopoppppop ndnndndndndndnndndndndndnddndnn ss s ss s seneneneneneneneneneneneeenenntititititititititiitititiititiinenenenenenennenenenneneneneneelslslslsssslslssssslsss??????? ?? ?? ?? ????????
ThhThThThTTThhhThThThTTThe e ee e eeee ananaaanannnannnaa swswswsswwwswswwsswsswswswswwsws er iis ssssssss thtththhthththhthtththhthhhhththtt atatatatttatataatatatattaa theeheeeeeeey y y yyyy yy yyyyyyyyy alalaaaaaaaalaaa lll cooooooooomemememememmmemmememememememmemmemeemmemmm f f fff fff f ff f frorororrorororororooroorom m m m m m m m mmmmmmmmmmmm thththththtththhtttththththththhe e eeeeee e eeeee shshshshshshshshshshshshshshshshshhshshshhhshheeeeeeeeeeeeeeeeeeeeeeeeer rrr rr rr bobobbbobobobobobobobobobobboboobb unununununnununununnununu dldldldldldldldldldldddddld eseseseseeseseseeeesesesse s s ss ssssssssss
imimmmmimmimimmmmagaggagaggagagagaagaaagininnniniinnininatatataataatata ioioioioioioioion n nnnn anananannanananana d ddddddddddd crcrrrrrrreeeaeee tiveeeeeeeee h h hanaaaaaaaaaaaaaaa d dddd dddddddddddddd ofoofoooofofoofofofooofooooo B B BBBB B B BBBBBBBrurururuururururuuruururuunonnononononoooonnoooonononnnonnoo W W W W W WW WWWWW W WWWWW W bebeebeebebebbebbebbe eerereerererereeerereeerere . .. FoFoFoFoFoFoooFoFoFooFoFoFoooorrr r rrr r 40440404040404040404040404040004 y y y yy yyyyyyyyyyeaeaeaeaeaeaeaeeaeaeaeaeaeaeaeaearrsrsrrsrsrsrsrsrsrsrsrsrrs, ,, ,,,,,
WeWeWeWWeWeWeWWeWeeWebebbebebebbbebbebebebebeb r rrrrr rrr hhahahahaaahh s sss ssss ssssss bebeebebebbebebbebebbebebbbebeeebebbeeeeeeeeneeeeeeeeee ttttoioioioioioio lililiillililiiiingnngngngngnngngngnggggggng t ttttt to ooooooooo fi fifinnninnininnnnninnnnnininnniisssshshshshsshssss h hhhhhhhhhiisississssissssss ll lll l l l lllllififfifififfififififffffe’e’e’e’e’e’e’e’e’e’e’e’eeeeee ssssss s s s sss s ssss wowowwwowowowowowowowoowoowoooww rkrkrkrkrkrkrkrkrkrkrkkrrkkkk – – – – –––– – – a aaa a a a aaa 2 2 2 22 222222222220,0,00,0,0,00,00,0,0,0,0,00,,00000000000000000000000000000000000000000000-00-0-0-00-0-0-0-000--0--0-0-0-0-0-00
sqsqsqqqqqqqquauauauuauaaauaauuuuauaarererererereeeree m m mmmmmm mmmmeteeetteteteteteeee ererererrrererrrrrerr s ss ss ss sccccucucuccuucccccccc lplllpptutututttttttuuurerereereerereeererererereeee p ppppp ppppp p ppppppppararararaaaaraaaaark k k k k kk kkk kkkkkkkk kk atatataatatatatatatatatatatataatattatataa t t t ttt ttt tttttttttttttthehehehehehehehehehehehehhehehehehe e eeeeee eeeeeddgdgdgdgdggdgdgggdggdgddgddgd e eeee ofofooffffoffofooofof t tttttt t tttt tthehehehehehehehehhehehehehehehehhehhhhheehh f f f f ff ff fff f fffffffffororororororororororororoooororooorreseseseseseseseseseseseeseseest t t tttttttttttt nenenenenennenneneneenennn arararaaraaararraaaraaraarararrarararr
thththhhhthhht eeee e eeeeeeeeee viviviviviviivivvilllllllllllllllllllllllaagaaaagaaaaagaaaa e ee e offoffofffofoffofooofofooff D DDDDDDDDDDDDDieeeeeeeeeeeeeetitttitiitittittitititiitittikkkkokokkkkokkkoookkkoon n nn nnnnnnnn bybyybybbyyybybybybybybbyyyyyyy Z Z Z Z ZZ ZZZZZ ZZ ZZZ ururururururururuururururururururrururuururiciciciciciciccicicicciccicciccichhhh,hhhh,hhh S S SSSSSSSSSSSSSSwiwiwwwwwwwwwwwww tztzzt ereerlaalaaandnddddndddnddddd. ..
AnAnAnAnAnAnAnAnAnAA otototototototototoo hhhhhehhheher tthhing g g g ggg ththhthesesesesesesesesesesesessesesessssese e ee e e e e eee ee ee ee eeee scscscscscscscscscscsccscssccsccssscssculululuulullululululululuuuuuuu pptpptpppptpptptptpttpp urururururururuurururururururruresesesesesessesseseseseeeess h h hh h hhhhhhhhhhaaavaaaaa e innnnnnn cccccc c ccccccccccccomomomomomomomomomommomomommmomomommo momomomomomomommmmomommommmommmon n nn nnnnnnnnn nnn isisisisisisisisisisisississss ttttttt tttt ttttthahahahahaahahahahahahahaahahh ttttttttttttt tt t
momomomomomomommmmostststtsttsssssssst o oo oooooo o ooooffffff thtththththtthththhhthhhemeemeememmemeememeeememeemmee aa aaa a aaa aaa aaaaaaareerererereererererrerereer mmmmmmmmmmmmmmadadadadadadddadadadddadaddadadddddaddde e eeeee eeeeee ofofofofofoffofofofooofoofoffofo c c c c c ccc cc cccccccononoononononononononoonooo crcrcrcrcccrcrcrcccrcrccrccc eeeteeteteteteteteeetetetttee ee e eee e e eee eee eeee eeeeeneneneeeneeeeee ririririririchchchchchchhchchedededd bbbbbbbbbb by y yyyyy y SiSiSiSiSiSiSiSSiS kakakakaakakkkaa pppp pp pppp ppprororororororooodd-dd-ddd
ucuucucucucuccccctstststststsstststtttt . . . SS“SS“SS“S“S“SSSSSSikikikikikikkkikikkkikka a aaaaa aaa aa a aa sussusususususususususuussuppppppppppppppppppppppporororororoorororororororro tetetetetetetetetetetetetetetett d d d d ddd ddd dddd memememememememememmememeee v v v vv vv v v vvvvv v vvverererererererererererrrrrry y y y y y y y y yy y y yyy mumumumumumumummumumumumumummmumm chchchchchchchchchchchchchchchhccchchhcch ii ii ii i ii iiin n n n nn n n n nnnnnn tthtttttt e begiinnnnnnnnnnnninininnininininnnggggg,g,ggg,g ”””””” ”” says
ththththththththththhthtththtthe ee eeeeeeee 77777 -y-y-yyyy-yyy-yyyyeaeaeaeaeaeaeaeaaeaeeaeaaar-r-r-r--r-r-r-r-r-r-rr olololololololoooooololololololoooo ddddd d ddddd dddd ararrrrrrrrrrttitititititittitititiitttttiststststststststsss .. . BeBeBeBeBeBeBeBeBeeBeeBeBBeBeeBeeBB sisissisisisisissisisisssis dededededededeeedededededededdeees s s s s ss ss ssssssss dodododododododododdodododdoddodoonananananaananaaaaaanaaaanananatitititititititititittititititititingngngngngngngngngngnngngngngngngngn a a a a a aadmmmmmmmixixi tutututututututut rererrerereresssss,s,s,s S S Sikikkka aaa
alaa ssssosss sououghghghghghghhhghghhhhghhghhghttttt ttttttttt ttt WWeWeWeWeWeWeWeebebebebebebeebebebebebbbebebbebebbeeeb r’r’r’r’r’r’r’’r’’r’’r’’’’ss s s s ss ssssssssss adadadadadaddaddadadddvivivivivivivivvvivivvivvv cecececececececeecececececece o o o o oo o o oo ooooo on n n nn n n nnn nn nnnn hohohohohohoohohoohohohohohhohohohhoohhh www w wwww w w w wwww w wwwww bebebebebebebebebebebebebebebebebebeebeestststststtstststststststtstststs t tt t tt t t tt tttt tttto o o oo ooo oooo o o oo dededeedededeeedededddddeddedd veveveveveveeveeloooooopp p p pppp SiSiSiSiSiiSiSiSiSikakakakakkk
prprppppprpppp odododododododododoo ucuu tss tttto o o o o o o o o memememememmmemmememememememememememememeeeeeteteteteteteteteteteteteteteetteetteteet h hh hh hhhhh isisisisisisissisissssss n n n n nn n nnnnn neeeeeeeeeeeeeeeeeeeeeeeeeedsdsdsdsdsdsdsddsdsdsdsdsdsdssdds.. . . . “C“C“C“C“C“C“C“C“C“C“C“CC“CC“CCCColololololololooololloloololooolollalalalalalalalalalaalalalaaalalaaaaabobobobobobobobobboboboboobooboboboborararararararararararararaaarar titititititittitittititittitiitititiit onononononononononononoonononnonononnonn w w w w w w w w w ww w wwwwwwasaasasasasasssasaaasasassasasasaasaaaa v v vv v v v vvv vv v v vererererereeereererereerererreree yy yy y y y yyyyy vavavavavavavavaavaluluululullllll ---
abababababaaaababbleleeleeeee fffff f frororororororororoorororooom m mmmmmmmm mmm mmmmm a a a a a aa hhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhuhhuuh mamammmmmamamamamammammmmmam n nn n n n nnnnnn pepepepepepepepepepeepeepep rsrsrsrrsrrrsrsrsrsrsrsrsrsrsspepepepepepepepepepepepeppeppeepeectctctctctctctctctctctctctctccccctcccctivivivivvivivivivivvivvvvee e e e e eeeeeeeeeee asasasassasasasasasasassasasasaassss w www w w w wwww w ww wwwwweleleleleleleleeleleleleleleell,l,l,l,l,l,l,,l,l,ll,l,,,””””” ” ” ” ””” ” ”” ” sasasasasasasasasasasasasaasaaaaysysysysysysysysysysysysysysysysysyssysy W W W WW WW WW WWWWWW WWWWWWebebebebeebebebebebebebebebbebebbebeeberererereereerererereeeee ww wwww wwww wwwhohhhohoooooohohohohohh
alalaalalalaalalalalla sssososososososoossososso s s sssssssssssssspepepepepepeppepeepepeppeppeppp akakakakakakaakaakakakaaakks s s ssssssss veveveveveeveveevevveveveeeryryryryryryryrryryyy f f f f f f f ff fonononononononoononoonoonooondldldldldldldldldlddlddly y yy yyy y y y yyyyyy ofofofofofofofofoofofofofofoffoo f f ff f f f f f f fffffforororororororororoorooororoo mememememememememememmmemeemm r r rr r rrrrrr rrrrr BoBoBoBoBoBoBoBoBBoBooBoBoBoBoBoBoBooBoBBoaarararararararararararararararrarraa d ddd dddd ddd d d dddddd dddd ofofofofofofofofofofofofofoffof DD D D D D DDDDDDDDDDiriririririririririririririrririirirrecececeececececececeecececececeectototototototototototototototoorsrrsrsrsrsrsrsrssrsrsrssrsssrsrss P PP PPPP P PPPPPPPP Prerereerererererrerererereeeereeesisssisisisisisssssiisisissss ----
dededdddeeenttntntntntntt, , ,, HaHaHaHHaHaHaHaHaHaHaHaaHaHaaaH nsnsssnnsssnssssns PPPPPPPPPPetetetetetetetetetetetttererererererererererererererer MMMM MMMM M MM MMMMMMinininninininininninnng.g.g.g.ggg.ggg.g.g.gg.g.g
WeWeWeWeWeWeWeWeWeWeWWeWWeWeWWWWWW bebebebbebbebebebbbebebeber r rrrrrrr hahahahahahahahahhahahahahaaaaahaaas s s s s sss ssss sss nonononononononononononononnnnnnot t t ttt tt t tttt quququququququququququququququuuququq ititittitititititititititititittttee eee eee e eeeeeeeee ee rerererererererererererereer acacacacacacacacacacacacaccacacaaachehehehehehehehehehehhehehehehehheheheddd dd d d d dddddddddd hihihihihihihihiihihihihihhihhhh s ssssss sss s s ss ss fi fifi fi fifififi fifi fi fi fifi fifififififinananananananananananananananaannnanananaaalllll l l l l ll l lll oboboboboboboboboboboboboboboboboboobbjejejejejejejejejejejectctctctctctctctctctctctccttcccccctivivvivivivvvvivivvvivvivivve eee e e ee e eeeeeee ananananaananananananannannanannanananana d d d dd d dd ddd d dddddddd bebebebebebebebebebebebeebebebebebbee-------
gagagagagagagagaagagaggagagaagaagg nn n nnn n n nnnn n wowwwowowowowowowowoowwowowwwoorkrkrkrkrkrkrkrkkrkrkkkrkrkkr i ii iii i n n nnnn nnn nnn nnn JuJuJuJuJuJuJuJuuJuJuJuJuJuJuJulylylyllylylylylylylylylyyyyy 2 2 2 2 22 2222220000000000000000000000000000000 7 7 7 7 7 7 777 77777 onononoononononononononononnnnnonnon n n nnnn nnn n n nnnneweweweweweweweweweweweewwwwewee a aa a aaaaa a aaaaa aadddddddddddddddddddddddddddddddddddddddditititittitititittititititioioioioiooioooiooooonnsnsnsnsnsnsnssnsnnsnsssssss, , ,,, inininnnnnnnninnininininiiiininnclcclclclclclccclclclclclclcccccludududududududududududdudududdududududududududdininininininninnininininiininnining ggg g g g gg ggg ggggg “W“W“W“W“WW“W“WW“W“WWW“W“WWW“W“Wasasasasasasasasasasasasasaasasaa seseseseseseseseseseseseseseeseseer-r-r-r-r-r-r-r-rr-r-r-r
ggagagaagagaggagagagaaagaggagaggag rtrtrteennnnnnn” ” ” ” (W(W(W(W(W(W(W(W(W(WW(W(W(W(W(WWWWW(W(WWWatatataatatatatataatatattataa ererererererererererererererererererer G G GG G G GGGGGGGGG G G arararararararararrrararararrrrrdededdededededeedededededeeddeddensnsnsnnsnsnsnsnsnsnsnsnsnsnsnnnn ))) ) )) ) )))) anananananannnanannannanannnnd dd d dddd dd dddddd ddddd “H“H“H“HHH“H“H“H“H“HHHHHauauauauauauauauauuauauauauaaa s s s s ss deddeddeddeddddddd s s s sssssss WaWaWaWaWWaWaWaWaWW ndndndndndndndndndndndndndndndddddeleleleleleleleleelelellelele s”s”s”s”s”s”s”s”s””s”s”s””s”s”s”s”ss ( ( ( ((( (( ( (( (( ((((((((HoHoHoHoHoHoHoHoHoHoHoHoHoHHooHoHHooHoususususususususususussususu e eee eeeeeeee ofofofofoffofofofofofofofofofofofofo
ChChChChChChhCChChCChChChCChChhhChhaananaaaa gegegegegee).).).))).))) TTTTTTT T T TTT TTTThrhrhrhrhrhrhrhrhrhrhrhrh eeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeee 88 8 888 888 8 8888888888-m-m-m-m-m-mm-m-m-m-m-m-m-mmmmetetetetetetetetetetetetetetetee ererererererererererereerererrreee c ccc cccccccccccconoonnonononononononoonononooono crcrcrcrcrcrcrccrcrcrrcrcrcrcrc eteteeteetetetetetetetetteeteeee e ee e e eee eee ee e eeeee cacacacacacacaccacacacacacacacacacccacatetetetettettetttetet rprprpppppppppppilliiliiii lalarsss aa a aaaaa aaaaarerererererererererrereerrerereerre p pp p p p pp p pp pp pp p ppplalalalaalalaalaalalaaaaaaaaannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn ededededededededddededededddddddede a a aa aaaa a aaaaasssss s ssssssss
ttthhththhhthtttttht ee eeeee eeeee hihiih ghghghghhlililiililighghggghghghghhghghghghhhgghght t tt ttttttt t tt tt ofofofoffofofofofofofoffofoffoffo t t tt t t tt t t t ttttttheheheheheheheheheheheheheeehehe p p pppppppppppppppprororororroroorororororororoororroor jjejejejejejeejeejjejejeeejjejjjejeectctccttctctctctcttccc . . SiSiSiSiSiiSSiSiSiiiS kakkakakakakakakakkakakakaakkaaa ccc cccc ccc cccconononononononononnnnonnooo crcrcrcrcrcrccrcrccrrcrccretetetetetetete e e ee eeee adadadadadadaadadaaaaadmimimimiimmm xtxtxtxtxtxtxtxtxx ururrurururureseseseeseseseseseeseseesssese w wwww wwww wwwwwwwilliliilililillilillll l alalalalalalallllsosososososoososoososososso
sesesesesesessesesesssseervrvrvrvrrrrr ee e ee eee hihihihhhhhhihim mm mmmmm fofofofofoooooofoofofooooorrrrrr rrr rrrrrrr thththththththththththtthththththt ososososososossossosososoosososse e ee eeeeeeee prprprprprrprprrprrprpprprprrprp ojojojojojjjojojojoojojojojojoojo ececececececcecececceecececececctststststsstsstsststtstt aaa aa a aaaandndndndndnddndndndndnddndd o o ooo ooooooo thththhhthhhthhththththererereeeeererererrerrs,s,s,,s g g g ggg ggivivivvivininininnng g g g ththe ee arrrrrrrrttitititt sssttst aaaaaaaaaaaaal-l-l--l-l-ll-
momomomomooomoooststststsststt e eee eeeeeeeeendndnddndnnndnddndddnnnnnn llelllellel ssssssssssssssssssssssssss m mmmmmmmmmmeaeaeaeaeaeaeaeaeaeeaeeaeansnsnsnsnnsnsnsnsnsnsnsnssss t ttttt t tttttooo o ooo o o exexexexexxxexexxexxeexxeeexee ppppprprprprppppppppprpprpprprresesesesesesessssssssss s sssss hhihihihiiiih msmsmsmsmsmsmsmmsmsmsmsmmmm elelelelelleleeelf.f.ffff. TTTThehehehehe pp pparara k k issisississssssss s sssschhe-e-e-
duduuuuuuuleleleelelleleleleeddddd ddd totoooo o ooo ooopepepepepepppepepppp n nn n n nnn nn in sprprprini g g g g gggggg g g 2020220200202202020222009000909090990999009099999..
More information under:
www.bruno-weber-skulpturenpark.ch
26
ambitions | no. 1
Driving can be diffi cult enough under everyday circum-
stances – congested traffi c, demanding schedules and
tight spaces to maneuver. But suppose you are responsible
for delivering a product that only lasts for 90 minutes, in a
vehicle that can weigh 60,000 pounds and has a very high
center of gravity plus severe limitations on speed, braking
and turning. If you add to that the fact that your heavy cargo
is constantly spinning around, that would make you a
concrete truck driver working to deliver this versatile and
essential building material.
The top U.S. concrete delivery professionals recently put
their skills to a challenging test. Maneuvering ever so gently
through a merciless obstacle course of narrow reverse driv-
ing lanes, 38 of America’s best mixer drivers competed for
$4000 in prize money at the NRMCA National Mixer Driver
Championship in Phoenix, Arizona.
Contestants had to pass six themed stations, including
the stations “Up Against the Wall” and “Truck Stop” that chal-
lenged driver ability to stop before hitting a barricade. A per-
fect stop in reverse or forward required centimeter-exact
driving control that simulates maneuvers in situations like
those at a normal plant or site conditions.
Beside driving skills, contestants also competed a rigor-
ous multiple choice exam of detailed technical questions,
and a fi ve-minute “walk around” inspection of a truck that
had been specifi cally prepared with dozens of safety viola-
tions. A special competition, “Chute Hoops,” challenged
driver timing and aim at the cement chute. Stopping in front
of a basketball hoop, drivers had to drop a basketball through
the chute normally used to deliver cement.
This year marked the second NRMCA competition for
U.S. competitors. First-place winner was 23-year veteran
Kenneth Blair who was awarded $2500 in prize money.
The annual competition is decided by a panel of judges
who represent some of the industry’s most experienced
drivers.
Concrete ChallengesExperience is imperative! Top U.S. concrete truck drivers put their skills to a demanding test.
Contestant Dana
Prisbrey, eager to
participate at America’s
leading mixer drivers
event.
Precise maneuvering: An obstacle course was set up for measuring drivers’ abilities.
precisionexceptional
identity27
When it comes to large construction projects,
product quality is essential for durability and
cost effi ciency. The same can be said about smaller
projects: Someone who renovates a bathroom wants
the same high quality which is granted by the Sika
brand. Ambitions spoke to two distributors who share
a particular affi nity for Sika’s corporate design. They
were chosen from a long list of successful distributors
on fi ve continents.
Sika products are easy to obtain at construction sites or at Sika’s almost 100,000 distribution partners’
outlets worldwide. While they may have different packaging sizes, Sika’s technology is
behind every product. Two distributors – in China and the Ukraine – talk about their Sika experiences.
ambitions | no. 1
Do You Speak Sika?
As a Sika distributor, my business covers distribution to
hardware stores, paint shops and other small shops.
I am confi dent about the future of my business with Sika.
We are growing together.
I think that Sika represents professionalism and quality.
An authorized dealership is a sign of authenticity to
the customers.
Sika is a more professional brand that does not have the
run-of-the-mill consumer goods image.
I am going to improve my service level to customers
beyond sales. Also, I am looking forward to receiving
specifi c training from Sika in order to pass on the knowl-
edge and know-how to my customers.
Our business in Odessa is developing dynamically.
Yes. Even if the business suffers at the moment due to
high infl ation, we still have a big potential for growth.
The Sika brand is a guarantee for products with high
quality. It is nice to see when people are satisfi ed with
the products they use.
Sika doesn’t sell products, Sika sells systems. We can
offer solutions to the client. That’s a better service than
competitors have.
We want to make the brand well known in the region.
A lot of people still don’t know that Sika products have
the same advantages for the home user as for the work-
ers on big construction sites.
How does
your business work?
Are you satisfi ed with how
business is going?
Your place of business is
carrying the Sika logo.
Why do you identify yourself
with this brand?
How does Sika distinguish
itself from other brands
in the construction industry?
Which goal would you like
to achieve professionally?
you
Ms. Han Meixia,
Tianjin Lian Zhong Jie,
Tianjin City, China.
Aleksey Viktorovisch Shelkov
(1st from right), Sistemotechnika,
Odessa, Ukraine.
www.sika.com
Sika Marine Ensuring Durability with Watertight Solutions.
