+ All Categories
Home > Documents > Spaghetti Junction- Summer 2011

Spaghetti Junction- Summer 2011

Date post: 26-Mar-2016
Category:
Upload: birmingham-city-university-students-union
View: 224 times
Download: 8 times
Share this document with a friend
Description:
Spaghetti Junction is the official Birmingham City Students' Union magazine. Written by students for students; it offers the latest on Union-related news, cross-campus news and entertainment!
Popular Tags:
44
Spaghetti Junction Summer 2011 NEW TEAM, SWANKY NEW LOOK! PLUS! BCU Cross-Campus News, Reviews, Events and much, much more! Written by BCU students, for BCU students.
Transcript
Page 1: Spaghetti Junction- Summer 2011

SJPage

SpaghettiJunction

Summer 2011

NEW TEAM, SWANKY NEW LOOK!

PLUS! BCU Cross-Campus News, Reviews, Events and much, much more!

Written by BCU students, for BCU students.

Page 2: Spaghetti Junction- Summer 2011

SJPage

Editor-in-ChiefKAT HIGGS

[email protected]

Design EditorDANBI LEE

[email protected]

News and Features EditorAMANDA [email protected]

Arts and Ents Editor:IYANU ONALAJA

[email protected]

PRIDE OF BCUARCADIAN BAR CRAWL

FINISHING AT FUZZY LOGIC, OCEANA

MONDAY 16TH MAY

TICKETS

£6WITH FREE T-SHIRT

BUY YOURS NOW FROM UNION RECEPTIONS,

BARS & SHOPS

Birmingham City Students’ Union presents...

Page 3: Spaghetti Junction- Summer 2011

SJPage

Editor’s Note

Well guys, we’re almost at the end of the year now, so here is our offering of summer reading for you all. With the exam season upon us I hope this goes

someway to cheering you up! Everyone here at SJ, myself included, wish you all a brilliant summer and we’ll be here with a new issue ready by the time you return in September for Freshers ’11. All the best from the SJ Team.

Steven SkerrittEditor

SpaghettiJunction

Editor-in-ChiefKAT HIGGS

[email protected]

Design EditorDANBI LEE

[email protected]

News and Features EditorAMANDA [email protected]

Arts and Ents Editor:IYANU ONALAJA

[email protected]

EditorSTEVEN SKERRITT

[email protected]

Online EditorMELISSA REYNOLDS-LAWRENCE

[email protected]

We’ll be getting fancy emails soon, but for the time being, please use these!

3

ContentsPage 4 Union News

Page 8 Student of the MonthPage 10 VC’s View on BCU Fee Rise

Page 24 Cookery CornerPage 26 Conservatoire Move

Page 34 ReviewsCover Design: Danbi Lee

Page 4: Spaghetti Junction- Summer 2011

SJPage

UnionN

ews

..............................Your O

fficial Union UpdateSum

mer 2011

Don’t forget to visit

ww

w.birm

inghamcitysu.com

May

Tue 10thM

EET THE VC and A

GM

@C

ity North

Wed

11thScratch Rad

io by-elections @C

ity North SU

Fri 13th Scratch Rad

io Picnic/ Toons reunion@ Bar42

Sat 14th D

oug Ellis Cup/ Eurovision Party @

Bar42/ Stud

ent Activities Ball @

Villa Park.

Mon 16th

Pride of BC

U Bar Craw

l (Big Squeeze) @ The

Arcad

ian, City C

entre.

Wed

18thJaguar Land

Rover Gad

uate Event @Kend

rick Lecture Theatre, C

ity North, 11am

-1pm

Fri 20th D

eadline for Freshers C

rew applications

Mon 30th

Bank Holiday (yay!)

Tue 31stStud

ent Council @

TBC

Sat 4th G

raduation Ball 2011

Fri 17th JuneEnd

of Term! Have a great Sum

mer!

What’s O

n.............................

Jun

e

0121 202 4696www.birminghamcitysu.com/homes

Supported bySolely operated by

*Through its subsidiary Birmingham City Enterprises Ltd. Company Registration No. 3595006.

*

No Fees Protected Deposits Accredited Landlords Property Alerts Simple Paperwork Free Housemate Finder

News

4

UnionNews..............................Your Official Union UpdateSummer 2011

Don’t forget to visit

www.birminghamcitysu.com

MayTue 10thMEET THE VC and AGM @City North

Wed 11thScratch Radio by-elections @City North SU

Fri 13th Scratch Radio Picnic/ Toons reunion@ Bar42

Sat 14th Doug Ellis Cup/ Eurovision Party @Bar42/ Student Activities Ball @Villa Park.

Mon 16th Pride of BCU Bar Crawl (Big Squeeze) @ The Arcadian, City Centre.

Wed 18thJaguar Land Rover Gaduate Event @Kendrick Lecture Theatre, City North, 11am-1pm

Fri 20th Deadline for Freshers Crew applications

Mon 30th Bank Holiday (yay!)

Tue 31stStudent Council @TBC

Sat 4th Graduation Ball 2011

Fri 17th JuneEnd of Term! Have a great Summer!

What’s On.............................

June

Based in the Students’ Union Building, City North Campus, Birmingham City Student Homes offers Students and landlords a unique approach to letting property. Supported by the University, their main objective is to enhance the student experience. They are not for profit and we aim to offer students reliable, safe and decent accommodation; a place to call ‘Home’. They will only deal with reputable and accredited landlords, ensuring that your time here at Birmingham City University is as trouble free and as close to home as it can get.Kat Higgs Communications Officer said: “One of the biggest issues and problems some students face when at Uni is to do with accommodation. It can involve finding accommodation, problems with landlords or

lettings agencies, the state of the property or just getting ripped off.

“So we decided enough was enough and we set up our own lettings Agency run by the Union! The service and satisfaction of BCU students is our main priority, not making profit. Plus, you’re far more likely to get your deserved deposit back!”

There’s property available that’s suitable for all campuses goers, spread accross Birmingham. There’s still a few properties available before the summer so be quick to make sure you get the home you really want!

0121 202 4696www.birminghamcitysu.com/homes

Supported bySolely operated by

*Through its subsidiary Birmingham City Enterprises Ltd. Company Registration No. 3595006.

*

No Fees Protected Deposits Accredited Landlords Property Alerts Simple Paperwork Free Housemate Finder

Hurrah! No More Dodgy Landlords.......................................................

UnionNews..............................Your Official Union UpdateSummer 2011

Don’t forget to visit

www.birminghamcitysu.com

MayTue 10thMEET THE VC and AGM @City North

Wed 11thScratch Radio by-elections @City North SU

Fri 13th Scratch Radio Picnic/ Toons reunion@ Bar42

Sat 14th Doug Ellis Cup/ Eurovision Party @Bar42/ Student Activities Ball @Villa Park.

Mon 16th Pride of BCU Bar Crawl (Big Squeeze) @ The Arcadian, City Centre.

Wed 18thJaguar Land Rover Gaduate Event @Kendrick Lecture Theatre, City North, 11am-1pm

Fri 20th Deadline for Freshers Crew applications

Mon 30th Bank Holiday (yay!)

Tue 31stStudent Council @TBC

Sat 4th Graduation Ball 2011

Fri 17th JuneEnd of Term! Have a great Summer!

What’s On.............................

June

Page 5: Spaghetti Junction- Summer 2011

SJPage

UnionNews..............................Your Official Union UpdateSummer 2011

Don’t forget to visit

www.birminghamcitysu.com

MayTue 10thMEET THE VC and AGM @City North

Wed 11thScratch Radio by-elections @City North SU

Fri 13th Scratch Radio Picnic/ Toons reunion@ Bar42

Sat 14th Doug Ellis Cup/ Eurovision Party @Bar42/ Student Activities Ball @Villa Park.

Mon 16th Pride of BCU Bar Crawl (Big Squeeze) @ The Arcadian, City Centre.

Wed 18thJaguar Land Rover Gaduate Event @Kendrick Lecture Theatre, City North, 11am-1pm

Fri 20th Deadline for Freshers Crew applications

Mon 30th Bank Holiday (yay!)

Tue 31stStudent Council @TBC

Sat 4th Graduation Ball 2011

Fri 17th JuneEnd of Term! Have a great Summer!

What’s On.............................

June

5

UnionNews..............................Your Official Union UpdateSummer 2011

Don’t forget to visit

www.birminghamcitysu.com

MayTue 10thMEET THE VC and AGM @City North

Wed 11thScratch Radio by-elections @City North SU

Fri 13th Scratch Radio Picnic/ Toons reunion@ Bar42

Sat 14th Doug Ellis Cup/ Eurovision Party @Bar42/ Student Activities Ball @Villa Park.

Mon 16th Pride of BCU Bar Crawl (Big Squeeze) @ The Arcadian, City Centre.

Wed 18thJaguar Land Rover Gaduate Event @Kendrick Lecture Theatre, City North, 11am-1pm

Fri 20th Deadline for Freshers Crew applications

Mon 30th Bank Holiday (yay!)

Tue 31stStudent Council @TBC

Sat 4th Graduation Ball 2011

Fri 17th JuneEnd of Term! Have a great Summer!

What’s On.............................

June

Do You Love BCU?

We want to find out your views on Birmingham City University and if you take pride in being a BCU student.So please take a couple of minutes to share your views of the University by filling in our short survey so we can find out how to make it better!Visit www.birminghamcitysu.com/lovebcu to share your views and to be in with a chance of winning £25 if your survey is randomly selected!We Love BCU and we want you to love it too!

......................

A Greener UnionFor the second year running we have been awarded Bronze in the National Union of Students (NUS) Green Impact Environmental Award scheme. The Green Impact Awards seek to capture the positive green innovations in students’ unions and promote them to the general public. With great help from the University’s Environmental Officer, Rebecca Barnett, work is under way to bag us a Silver next year.

......................

PRIDE OF BCUARCADIAN BAR CRAWL

FINISHING AT FUZZY LOGIC, OCEANA

MONDAY 16TH MAY

TICKETS

£6WITH FREE T-SHIRT

BUY YOURS NOW FROM UNION RECEPTIONS,

BARS & SHOPS

Birmingham City Students’ Union presents...

UnionNews..............................Your Official Union UpdateSummer 2011

Don’t forget to visit

www.birminghamcitysu.com

MayTue 10thMEET THE VC and AGM @City North

Wed 11thScratch Radio by-elections @City North SU

Fri 13th Scratch Radio Picnic/ Toons reunion@ Bar42

Sat 14th Doug Ellis Cup/ Eurovision Party @Bar42/ Student Activities Ball @Villa Park.

Mon 16th Pride of BCU Bar Crawl (Big Squeeze) @ The Arcadian, City Centre.

Wed 18thJaguar Land Rover Gaduate Event @Kendrick Lecture Theatre, City North, 11am-1pm

Fri 20th Deadline for Freshers Crew applications

Mon 30th Bank Holiday (yay!)

Tue 31stStudent Council @TBC

Sat 4th Graduation Ball 2011

Fri 17th JuneEnd of Term! Have a great Summer!

What’s On.............................

June

Page 6: Spaghetti Junction- Summer 2011

SJPage

News

6

The Academic Year 2010 to 2011 has been both challenging and rewarding for the Union and the Higher Education Sector

as a whole. With large scale changes to fees and University funding cuts; the talking (indeed marching!) point of the year. The Browne Review and Government have undoubtedly changed Higher Education for the foreseeable future, drastically increasing the cost of education for students.The Union has been active (perhaps more so than ever before) in campaigning against the fees and cuts. What has been evident is the period of uncertainty the impact of these changes will have on Birmingham

City University and the Union.Last year the Union discussed the deficit (loss) the Union was predicting and how the Union was going to break even by reducing costs and generating more income.I’m pleased to say we have achieved this somewhat, although due to rising costs, less money from the University and an uncertain future challenges still remain and the Union needs the support of students more than ever.This can be through getting involved as a Course Rep, attending Student Council (so the best decisions are made for you) or even making a Union Coffee Bar your outlet of choice on campus.Together we can make ourselves a better student life!

Tom Tom (Union President)

A Year In the Union!As the academic year draws to a close, the Exec Officers would like to thank every student who has been involved with the Union from being a Faculty Rep to just buying a coffee from Lounge or reading this magazine!

Page 7: Spaghetti Junction- Summer 2011

SJPage

A List of just some of the stuff the Union has achieved this year:• The BudgetStaff and the Officer team turned around a predicted deficit into a breakeven budget!• Campaigning We marched in November, December and again in March as well as around Birmingham! • RefurbishmentNew Union Building refurbishment has seen a dramatic increase in footfall and student involvement.• Sports and SocietiesMore members than ever! Our sports teams are doing really well including Netball and Men’s Basketball who won their leagues.• Media GroupsA new Media Centre and Scratch Radio Studio as well as dedicated student and community volunteers have increased membership and involvement.• EntertainmentsFreshers ’10 was a success and had more student involvement than ever before making it officially ‘the biggest Freshers yet!’• RepresentationFaculty Reps and Course Reps have been doing a great job of communicating your student views. These guys are our insight into the ins and outs of the University! • Campus EngagementThe introduction of a Campus Engageent Exec Officer has worked well. The current Exec Officer team are also the first

team to actively visit BCU campuses every Tuesday to engage with students.• Lettings AgencyOne of the biggest student concerns is finding accommodation and difficulties with landlords and agencies. Therefore we decided to set up our own Lettings Agency which provides an honest, reliable service to all students.• Advice CentreThe Union Advice Centre has provided a free and independent service for over 3000 student enquiries this year! • Times Higher AwardThe first joint Union and University Times Higher award given for our collaberation on the Student Achademic Partnership Scheme.

This is literally a report ‘in a nutshell’! Read the full Directors’ Report at:www.birminghamcitysu.com

7

Page 8: Spaghetti Junction- Summer 2011

SJPage

News

8

I was honoured to be able to interview our Student of the Month, Amit Ghose who is a Marketing and Economics student here at BCU. Amit suffers from an incurable condition called neurofibromatosis – which has disfigured his face on one side. He’s recently been filmed for Channel 4’s ‘Katie: My Beautiful Friends’, a documentary that has captivated and stirred thousands of viewers around the country.

Amit’s condition is incurable and despite having numerous operations to remove the tumours on his face, they just grew back again. Amit and his family moved from India to Birmingham when he was two years old to seek special medical treatment for his condition. When he was 14, Amit had his left eye removed and now has a prosthetic one in place.Having dealt with his facial disfigurement for many years and the passing of his father last year, the programme followed Amit as he became the first of his family to go to university as well as gain confidence and overcome prejudice.

Although he was recovering from surgery at the time of interview, he still had time to speak to us for a quick interview.

Student of the Month:

Amit Ghose

SotM

Page 9: Spaghetti Junction- Summer 2011

SJPage 9

So, can you tell me a bit about the charity work you’ve been involved with recently?

At the moment, I’m working under Islamic Help but my main aim is to have my own charity and work on my own projects. I’m actually planning a charity ball to be held at BCU at the end of the year for the charity which is [going towards] helping acid survivors and acid victims in Asia.

Do you feel any pressure because you’re the first

of your family to go to university?

Yes, in terms of doing a degree and from family; uncles, cousins and everybody. So there is a little pressure to actually get the degree.

What is it that motivates you to keep going, when things get tough?

I think basically, it’s my dad. My dad especially wanted me to get my degree.

So, despite losing him, his legacy keeps you going?

Yeah. He used to take me to all my appointments

and was the main guy in my life, basically.

You’ve obviously come very far. What would you say is your biggest achievement, being someone who has to deal with neurofibromatosis?

I think my greatest achievement would be that I’m currently at university and also, the charity work that I’ve recently done to raise money and go on to buy a [skin grafting] machine. I think that would be one of the greatest achievements that I’ve had so far. What are your goals and aspirations for the future, near and distant?

My main goal is to set up a charity by myself to help acid survivors in Asia.

Amazing! Thank you for your time and take care

No problem and thank you very much.

Written by: Melissa Reynolds- LawrenceDesign by: Kat Higgs

Page 10: Spaghetti Junction- Summer 2011

SJPage

News

10

o

o

o

o

Vice Chancellor’s Stance on the Tuition Fee Rise

The President’s Letter

With universities around the country declaring their proposed new undergraduate fee charges of up to £9000, we sent a formal letter to BCU’s Vice Chancellor Professor David Tidmarsh, asking what BCU are going to charge and how will he lead the University into insuring that students simply won’t be paying more money for less of an experience.

Page 11: Spaghetti Junction- Summer 2011

SJPage 11

o

o

o

o

o

Read the VC’s response on the next page!

Page 12: Spaghetti Junction- Summer 2011

SJPage

The Vice Chancellor’s Response

Read the President’s original letter on the previous page!

News

12

Page 13: Spaghetti Junction- Summer 2011

SJPage

Students Question the VC!In the time this magazine has gone to print, the Union has held its Annual General Meeting where students were invited to question David Tidmarsh about BCU’s fee proposals and details would have gone to national press. The Students’ Union Executive Officers have also been in meetings with University’s Directorate, discussing fees and the concerns and questions asked by students since the government vote.

13

Page 14: Spaghetti Junction- Summer 2011

SJPage

CREW WANTEDWe are recruiting outgoing, enthusiastic students to join...

Make a difference to the lives of thousands of new students during their first few weeks at BCU!

This Year’s events are set to be Bigger and Better than ever! Join the Freshers Ents Crew and earn £1 on every ticket sold!

Application deadline: 4th April

For details or to apply visit Students’ Union reception or www.birminghamcitysu.com/crew

PAID POSITION!

Page 15: Spaghetti Junction- Summer 2011

SJPage

All students at BCU are invited to the student society picnic on Friday 13th May. This event is going to be packed full of fun things to do and if all goes well it’ll be a sunny day too!The line-up has finally been announced, and alongside the amazing bands and DJs they’ve also got a BBQ, ICE CREAM VAN, BOUNCY CASTLE, FACE PAINTING, RED BULL, KRISPY KREMES and more!!

There’s music from loads of music from acts including...- FUNKTION- NEW DIRECTION - PETE & SHAGGY MARCHANT - DJ LOVETT - FUNKED UP - JUNCTION 12 - ONE SIXTH OF TOMMY - THE BLUEBEAT ARKESTRA - And Scratch Radio’s very own DJs JAMIE PETERS & ALEX TAYLOR-BEAL!!

They’ve also got BRMB’s Dan Morfitt coming along to DJ and compere the day and possibly a few special guests...!

Entry to all of this will be free but if you want to carry on the party late at the Toons reuinion night in Bar42 then you can buy a wristband for £3 and get

money off entry and drinks (all day and night) in the SU.The fun starts at 4pm and Toons carries on ‘til 3am so if this appeals to you then get down to City North Campus pronto!

Written by: Alexandra HarrisonDesign by: Kat Higgs

Picnics and Toons Back From the Dead?!

15

Page 16: Spaghetti Junction- Summer 2011

SJPage

One of the attracting factors about BCU is the chance to go to the USA and experience their Criminal Justice System. The only downside is you have to be a Law student.

Before the opportunity arises to go to the US, training is undertaken to understand just a little about American law. Also, BCU is lucky enough to have guest speakers from the US come and talk to students about the death penalty and cases they have worked on. Some of the lecturers at BCU have strong links with the US and have worked on death penalty cases giving students greater insight about how it works and the

complex issues surrounding the penalty.

Students get the opportunity to participate in an internship from six weeks to three months depending on where you go. Of course, most students want to go to New York, LA and Florida, yet many students who have previously been on such internships said those weren’t the places to go. It is best to go to smaller, less holiday orientated states as there is more work to do and more realistic in terms of the death penalty.

Most past participants said it as an opportunity of a lifetime. Some

USA Student InternshipBCU’s Law students have the opportunity to work in the US and learn about their justice system. This includes the

controversial death penalty…

16

News

Page 17: Spaghetti Junction- Summer 2011

SJPage

did say it was quite up close and personal because they actually got to meet murderers and question them.

However, it is usually not as fast paced as I have made it out to be, sometimes cases are made longer by lack of evidence and money. Interestingly, if all but one of the jury votes for the death penalty then the death penalty no longer becomes the punishment. This is what defence lawyers aim to do, change at least one juror’s mind.

The death penalty is a sensitive issue with many pros and cons and although it has been pretty much removed from most countries, some American states have refused to abolish it. The death penalty definitely isn’t a deterrent to committing crimes, it’s also extremely expensive and resources are running out.

Overall, it is a fantastic opportunity and a great learning experience and BCU has great links with the US to ensure that students get the most out of their time by learning about justice systems both in the UK and internationally. BCU has been running this internship for the

USA Student Internshiplast 15 years. Who knows, maybe in the next 15 years the death penalty may be completely abolished in the US.

Written by: Iyanu OnalajaDesign by: Kat Higgs

17

Page 18: Spaghetti Junction- Summer 2011

SJPage

News

NUS Conference; Worthwhile Debate or Waste of Money?

Unless you’re heavily involved with the Union or politically motivated, the thought of going to NUS’ three-day-long conference probably doesn’t even register. So what is it all about? Six elected delegates attend conference from BCU (plus the President who is mandated to attend as delegate leader) every year, joining hundreds of other delegates from universities around the U.K to vote on NUS’ policies for the forthcoming year.It costs NUS a lot to run and being up in Newcastle this year, costs our Union a lot to get everyone there and back. So off we all set in a mini bus picking up local students from University of Birmingham, South Birmingham Collage and Bournville Collage, leaving early for our five hour drive. The format of NUS Conference sounds straightforward, kind of like a large student council; motions are brought forward and debated upon before finally being passed or thrown away as well as electing the new NUS leaders, a similar process to our

own Exec elections. Instead you’re faced with more bickering than debate, conference members standing up and giving speeches and not adding anything of substance to a debate just so they can say something, be photographed standing at the podium to use for their manifestos or Facebook profiles. All they need is a picture wearing a florescent jacket shouting into a megaphone to complete their look. Ok, ok, so activism is good, we love Union activists, they fight for rights and what they believe in. But then you kinda need the well thought-out speech and counter argument to appear credible. Otherwise you look a bit naff.So aside from timewasters who bring unnecessary parts to the table, give speeches against when its their turn to speak for, bring forward pointless procedural motions of ‘vote of no confidence in the chair’ just to stir up trouble and waste time because they’re not in ‘Club Labour’, there are some worthwhile speeches from those who do understand what

Kat Higgs tells us about the positives and negatives of NUS National Conference 2011.

18

Page 19: Spaghetti Junction- Summer 2011

SJPage

they are talking about and do want to benefit the worthwhile debate and purpose of National Conference. Two of our own delegates, WIll Vincent and Benjy Sanford made BCU proud with their worthwhile speeches.

This is the third conference I’ve attended and if anything, the timekeeping is worse. Those motions that don’t get discussed at conference are usually referred to NUS’ National Executive Committee for discussion and decision later. So I can’t help wondering what’s the point in us all turning up in the first place?

Bitter much? Well all that aside, I believe NUS Conference does have its setbacks but then again, this is a democracy. There has to be a forum for student representatives from each institution to come forward and have their views recognised, heard and debated upon. Otherwise there wouldn’t be a ‘Union’ part to ‘National Union of Students’. If you’ve never been

before, it is worth going for the parts that are worthwhile, even if they are few and far in-between.

Written by: Kat HiggsDesign by: Kat HiggsPhotos: Kirat Raj Singh

19

Page 20: Spaghetti Junction- Summer 2011

SJPage

News

Is Uni Really Worth the Money?! With University Getting More Expensive, is it really worth going?With the news that undergraduate tuition fees are rising up in 2012 to triple the amount paid by current undergraduate students, Spaghetti Junction has decided to evaluate whether a university education really is value for money.

Currently the Government funds the universities and this allows them to buy equipment, textbooks and whatever else is needed to ensure your course is fully equipped to be the best it possibly can. The more students each course has enrolled the greater the funding that’s assigned to it.

However, with the new fees the government won’t be offering this aid to universities and this means that the students will be paying for these resources with their fees. Some might say there’s nothing wrong and that it seems only logical as those who will never go to University still help fund the UK’s education system through their own taxes.

However when you look at it, this isn’t really economical. In fact it

will more than likely mean cuts all round to resources and perhaps to the number of teaching staff. Last year saw the University make some staff cuts and that was while we had it good.

So most likely you’ll find that students will in fact be getting less for more money. However, with the current job climate like it is and the fact that a lot more employers expect you to have a degree, I think accepting a place to University shouldn’t be taken lightly.

Written by: Steven SkerrittDesign by: Kat Higgs

20

Page 21: Spaghetti Junction- Summer 2011

SJPage

News

21

Changing the Way We VoteSo what’s all this ‘AV’ business about? SJ explains...

On the 5th May the government held a referendum to see what we think about the current system of voting. At the time this issue went to print, we don’t know the results, but here’s a run down on what this referendum means for the UK.

Currently the candidate who gets the most votes in their constituency is elected as the MP. If one party gets an overall majority in Parliament they form the government. If no party gets an overall majority it is called a hung parliament, as with the 2010 general election which resulted in the coalition government.

A key weakness of the current system is that two thirds of MPs are now elected with less than 50% of support of voters and this undermines democracy. It’s argued a different system will provide voters with more choice, force candidates to appeal to a broader section of the public and work harder to get elected.

The alternative vote (AV) system sees voters rank candidates in order of preference. People can

nominate as many preferences as they like. Only first preference votes are counted initially.

Anyone getting more than 50% of these is elected automatically. If that doesn’t happen, the candidate with the fewest votes is eliminated and their second choices allocated to the remaining candidates in a second round of counting.

If one candidate then has more than 50% of the votes in this round they are elected. If not, the remaining candidate with the fewest votes is eliminated and their second preferences reallocated which continues until one candidate has 50% or more of the vote.

Written by: Iyanu OnalajaDesign by: Kat Higgs

Page 22: Spaghetti Junction- Summer 2011

SJPage 22

News

BCU currently has a fantastic opportunity for its students. ‘Inspiring Futures’ allocates you a mentor in the field of work that you wish to progress into. For example, if you want to be a lawyer you are paired with a solicitor and so on.

Once paired up, your mentor can help with any situations which you feel could be improved in a range of ways.

I’m involved in Inspiring Futures and I have been able to contact my mentor when needed and she always responds. My mentor is able to give me specific advice on how to make myself stand out from other applicants and what employers are looking for.

One of the organisers, Marcus Andrews, said: “Inspiring Futures’ professional mentoring gives you the opportunity to interact with business professionals whilst you are studying. It will

allow you to expand your network of contacts, which can really help when you are looking for employment.”

I also spoke to Ezighode Urieto who said: “I have developed a good relationship with my mentor who is always happy to provide advice, discuss applications and conduct mock interviews”.

Hopefully, I’ve convinced you to find out some more about this programme because this really is too good an opportunity to miss.

For more information visit Student Services either in person or online at www.askbcu.org or via (0)121 331 7245.

Written by: Iyanu Onalaja Design by: Kat Higgs

Inspiring FuturesGet ahead in the employment game by entering a mentoring scheme.

Page 23: Spaghetti Junction- Summer 2011

SJPage 23

Amnesty International is an organisation that campaigns to raise awareness on some of the injustices in the World. Some of

the campaigns include; the fair

treatment of homosexuals, child marriage, and freedom of speech to name just a few.

At BCU we have a society for Amnesty International who run local campaigns and try to raise awareness here in Birmingham. And that’s exactly what they’re planning to do in May at the Students Union at City North Campus. The exact date will be confirmed soon so keep a look out!

This event is a celebration about the freedom of speech we have here in the UK and to raise awareness about the terrible censorship in other countries. As a nation we are very lucky and Cesca Berlen aims to celebrate this by organising an event called “Express Yourself”. Activities include an open mic session, face

painting and graffiti painting for everyone to enjoy.

So if you fancy having a bit of fun with a few good mates then get down to the SU and enjoy the freedom of expression we take for granted here in the UK.

Written by: Alexandra HarrisonDesign by: Kat Higgs

Express Yourself!Amnesty International Society encourages you to celebrate your freedom of speech!

Page 24: Spaghetti Junction- Summer 2011

SJPage 24

The barbeque season is finally upon us so for those of you who are planning to fire one up in your back garden, here’s a few recipes and top tips to make yours the best there is.

There’s nothing better than a baked potato and they’re so simple. Wrap up a few potatoes in foil and put them right next to the hot coals. Then just leave them there for a good while, turning them occasionally to cook them all the way around. Make sure before you serve that they’re cooked right to the centre.

Top tip – Get your coals white hot before putting any food on the barbie Otherwise it won’t cook your food properly. Also disposable BBQ’s are a quick an easy alternative if you don’t have a metal one.

Meat products are tricky to cook on a BBQ because they need to be cooked thoroughly to avoid getting ill. As long as you make sure it’s cooked through then you can have a large range of things. Burgers and sausages always go down well, but why not try something different like kebabs on sticks? Just get some meat, possibly chicken, and stick it onto a skewer. You could also put on mushrooms, chunks of red pepper, and even onion for a bit of variety.

Vegetarian options can be a crowd pleaser too because not everyone wants their plates stacked full of meat. For example, my mum loves whole onions that you can cook in the same way as the spuds until soft. You could do meat free skewers, which don’t take long to cook at all. Use your imagination because most things work really well. I’ve even had pineapple once before and, trust me, it was pretty good!

Top tip – The thinner the product, the quicker it’ll cook. So if your sausages are big old fat ones then they’re going to take longer than a thin sausage. Consider this when stocking up.

Side dishes can be just as important as the main in a BBQ; coleslaw is always a winner and can be kept in the fridge 'til you’re ready. You could try adding a splash of HP sauce to some baked beans to give them a brilliant smoky taste.

So they’re my tips for a perfect BBQ, as well as a bit of sun of course, and I hope you all have a brilliant summer! Written by Alexandra Harrison

Designed by Danbi Lee

SJPage 24

Cookery Corner

Page 25: Spaghetti Junction- Summer 2011

SJPage 25

The barbeque season is finally upon us so for those of you who are planning to fire one up in your back garden, here’s a few recipes and top tips to make yours the best there is.

There’s nothing better than a baked potato and they’re so simple. Wrap up a few potatoes in foil and put them right next to the hot coals. Then just leave them there for a good while, turning them occasionally to cook them all the way around. Make sure before you serve that they’re cooked right to the centre.

Top tip – Get your coals white hot before putting any food on the barbie Otherwise it won’t cook your food properly. Also disposable BBQ’s are a quick an easy alternative if you don’t have a metal one.

Meat products are tricky to cook on a BBQ because they need to be cooked thoroughly to avoid getting ill. As long as you make sure it’s cooked through then you can have a large range of things. Burgers and sausages always go down well, but why not try something different like kebabs on sticks? Just get some meat, possibly chicken, and stick it onto a skewer. You could also put on mushrooms, chunks of red pepper, and even onion for a bit of variety.

Vegetarian options can be a crowd pleaser too because not everyone wants their plates stacked full of meat. For example, my mum loves whole onions that you can cook in the same way as the spuds until soft. You could do meat free skewers, which don’t take long to cook at all. Use your imagination because most things work really well. I’ve even had pineapple once before and, trust me, it was pretty good!

Top tip – The thinner the product, the quicker it’ll cook. So if your sausages are big old fat ones then they’re going to take longer than a thin sausage. Consider this when stocking up.

Side dishes can be just as important as the main in a BBQ; coleslaw is always a winner and can be kept in the fridge 'til you’re ready. You could try adding a splash of HP sauce to some baked beans to give them a brilliant smoky taste.

So they’re my tips for a perfect BBQ, as well as a bit of sun of course, and I hope you all have a brilliant summer! Written by Alexandra Harrison

Designed by Danbi Lee

SJPage 25

Page 26: Spaghetti Junction- Summer 2011

SJPage

Cross-Campus News

26

BCU campus upgrade; Out with the old and in with the new!

As I write our Conservatoire is negotiating relocation. It is all part of a great plan to make Birmingham more cultured and I am assuming overall prettier and more perfect. Although exact information will not be available until at least a months’ time I managed to talk with James Tallentire from University Marketing, about the Conservatoire regarding costs and where us students fit in. Once again he told me that he does not know the exact numbers as these are yet to be confirmed however they are ensuring that the Conservatoire offers students a facility that will match the amount of fee’s they will be paying.

One University student seems to have done pretty well with the Conservatoire the way it is. Josh Lomas plays drums, guitar and piano amongst others yet limits himself to playing guitar with his band Of Kings and Captains.

As a music technology student, Josh is receiving all of the practical education he needs and has recently been approached by producer Gavin Monaghan. Gavin has produced bands such as the Editors, Kings of Leon and Wreckless Eric.

And all this is before even mentioning that Of Kings and Captain’s mastering engineer is David Mitson who has worked with the likes of the Rolling Stones and Michael Jackson.

Josh has said that one positive part of the Conservatoire moving is that when recording in the studio you often hear a rumbling from the island below.

He also had a little something to say about the current Conservatoire: "The Adrian Boult Hall is the main concert hall at the Conservatoire, and apart from being a great place to record, it is a fantastic place to go see a show. I hope that the new building offers a similar, if not better facility. At the same time it would be a shame to see the ABH at the paradise forum site going to waste after the move, especially with the ties it had to the Town Hall."

Josh and his band are currently playing gigs around the country. Tickets can be booked via their facebook or their myspace page. Alternatively, if you want Josh to produce your band within the Conservatiore he can be contacted at [email protected]. Here's a tip; If you want to get into Josh’s good books then nothing says “I love your band” more than Ben and Jerry’s ice-cream!

Written by Rebekah DunneDesigned by Danbi Lee

SJPage 26

Page 27: Spaghetti Junction- Summer 2011

SJPage 27

BCU campus upgrade; Out with the old and in with the new!

As I write our Conservatoire is negotiating relocation. It is all part of a great plan to make Birmingham more cultured and I am assuming overall prettier and more perfect. Although exact information will not be available until at least a months’ time I managed to talk with James Tallentire from University Marketing, about the Conservatoire regarding costs and where us students fit in. Once again he told me that he does not know the exact numbers as these are yet to be confirmed however they are ensuring that the Conservatoire offers students a facility that will match the amount of fee’s they will be paying.

One University student seems to have done pretty well with the Conservatoire the way it is. Josh Lomas plays drums, guitar and piano amongst others yet limits himself to playing guitar with his band Of Kings and Captains.

As a music technology student, Josh is receiving all of the practical education he needs and has recently been approached by producer Gavin Monaghan. Gavin has produced bands such as the Editors, Kings of Leon and Wreckless Eric.

And all this is before even mentioning that Of Kings and Captain’s mastering engineer is David Mitson who has worked with the likes of the Rolling Stones and Michael Jackson.

Josh has said that one positive part of the Conservatoire moving is that when recording in the studio you often hear a rumbling from the island below.

He also had a little something to say about the current Conservatoire: "The Adrian Boult Hall is the main concert hall at the Conservatoire, and apart from being a great place to record, it is a fantastic place to go see a show. I hope that the new building offers a similar, if not better facility. At the same time it would be a shame to see the ABH at the paradise forum site going to waste after the move, especially with the ties it had to the Town Hall."

Josh and his band are currently playing gigs around the country. Tickets can be booked via their facebook or their myspace page. Alternatively, if you want Josh to produce your band within the Conservatiore he can be contacted at [email protected]. Here's a tip; If you want to get into Josh’s good books then nothing says “I love your band” more than Ben and Jerry’s ice-cream!

Written by Rebekah DunneDesigned by Danbi Lee

SJPage 27

Page 28: Spaghetti Junction- Summer 2011

SJPage

Cross-Campus News

28

• Takewhatyouneed,notwhatyouthinkyou’llneedThere’s nothing worse than having to lug everything from the car to where you’ll be camping, especially in hot weather. Take only the essentials to save yourself some hard work carrying everything to your spot.

• MakealistofthingstotakebeforeyougoThat way you can check it. It would be awful to get to your chosen festival then find out you’ve forgotten your tickets! You’ll need wet wipes, toilet paper, hand sanitizer, ear plugs and plasters. Make sure you can pitch your tent too, it’s incredible how many people you’ll see struggling with their tent.

• PrepareforallweathersDon’t take a chance! Take sun lotion and a hat, and your wellies and a light raincoat in case it chucks it down. Tents can get freezing at night, so make sure you take a woolly hat and hoodie to keep you warm overnight.

• ConsidertakingsomeofyourownfoodBurger vans and drinks stalls will rip you off for the convenience of having instant refreshment, but you can end up paying up to four times as much. Taking biscuits and cereal bars will get you through the day so long as you have some water too.

• KeepyourvaluablescloseOr just don’t take them at all. You can buy a £5 pay as you go phone and a disposable camera. Don’t take too much money either, and don’t keep it in the same place- some in your pocket, wallet, bag, even down your sock or in your bra!

• BeopenandfriendlyMake friends with the people you’re camping next to, that way you can all look out for each other and minimise the risk of things being stolen from your tent whilst you’re out.

• CheckthetimesandstagesyourfavouritebandswillplayYou might have come a long way to the festival and you wouldn’t want to miss your favourite band, so check before you go!

• Arrangeameet-uppointwithyourfriendsIt’s really easy to lose your friends in a huge crowd so agree a meeting point beforehand. Make sure every member of your group knows where this is and how to get help if someone is unwell.

Staysafe,seeyourfavouritebandsandhavetheweekendofa lifetime.Byfollowingthesetipsyou’resuretobeahappycamper.

WrittenbyKellyPurpleDesignedbyDanbiLee

SJPage 28

Page 29: Spaghetti Junction- Summer 2011

SJPage 29

• Takewhatyouneed,notwhatyouthinkyou’llneedThere’s nothing worse than having to lug everything from the car to where you’ll be camping, especially in hot weather. Take only the essentials to save yourself some hard work carrying everything to your spot.

• MakealistofthingstotakebeforeyougoThat way you can check it. It would be awful to get to your chosen festival then find out you’ve forgotten your tickets! You’ll need wet wipes, toilet paper, hand sanitizer, ear plugs and plasters. Make sure you can pitch your tent too, it’s incredible how many people you’ll see struggling with their tent.

• PrepareforallweathersDon’t take a chance! Take sun lotion and a hat, and your wellies and a light raincoat in case it chucks it down. Tents can get freezing at night, so make sure you take a woolly hat and hoodie to keep you warm overnight.

• ConsidertakingsomeofyourownfoodBurger vans and drinks stalls will rip you off for the convenience of having instant refreshment, but you can end up paying up to four times as much. Taking biscuits and cereal bars will get you through the day so long as you have some water too.

• KeepyourvaluablescloseOr just don’t take them at all. You can buy a £5 pay as you go phone and a disposable camera. Don’t take too much money either, and don’t keep it in the same place- some in your pocket, wallet, bag, even down your sock or in your bra!

• BeopenandfriendlyMake friends with the people you’re camping next to, that way you can all look out for each other and minimise the risk of things being stolen from your tent whilst you’re out.

• CheckthetimesandstagesyourfavouritebandswillplayYou might have come a long way to the festival and you wouldn’t want to miss your favourite band, so check before you go!

• Arrangeameet-uppointwithyourfriendsIt’s really easy to lose your friends in a huge crowd so agree a meeting point beforehand. Make sure every member of your group knows where this is and how to get help if someone is unwell.

Staysafe,seeyourfavouritebandsandhavetheweekendofa lifetime.Byfollowingthesetipsyou’resuretobeahappycamper.

WrittenbyKellyPurpleDesignedbyDanbiLee

SJPage 29

Page 30: Spaghetti Junction- Summer 2011

SJPage

Cucumber sandwiches were at the ready, as Royal Wedding Fever gripped the nation these past few weeks. We’ve seen bunting being stapled everywhere, posters decorating towns and even lookalike ‘Wills and Kate’ couples plastering the cities.

Prince William is finally married to his fiance Kate Middleton. Many people are jealous at how she bagged herself the best bachelor in the country to become a real life Princess. It gives a girl hope that one-day she too can be made into a Princess with the kiss of her very own Prince Charming. It was a true fairytale

wedding, with class and elegance and will go on to be a part of history.

It seemed that whether you’re a royalist or not, you couldn’t help

but get involved in the big day. Villages came together to have

street parties, with homemade cakes and sandwiches, as

well as plenty of music and dance. Communities

and households joined together to share the magic of the day.

Some places of work held themed competitions for employees' children, such as poster making and cake decorating. The wedding has established a new sense of British pride so who can be blamed for wanting to get outside and celebrate in style.

Written by Jennie CoshDesigned by Danbi Lee

90s_AD_74x105mm.indd 1 19/8/10 19:11:56

BRUMS BEST ROCK NIGHT

£10 ENTRY...

10 FREE

DRINKS!!!

B4 10.30PM

Ress_anarchy_ad_74x105.indd 1 19/8/10 19:12:48

Oceana Birmingham Half Page:Layout 1 3/9/10 16:05 Page 1

THE HOUSING F IR2011

Looking for a house next year?Speak to accredited landlords & agents, get advice and get your contracts checked...

Friday 28th January 2011, 11am-3pmBaker Hall, City North Campuswww.birminghamcitysu.com/housing

Coming next year...

BIRMINGHAM NIA

Wednesday 17th November

0844 338 8000

BUY TICKETS AT LIVENATION.CO.UK

A Live Nation presentation by arrangement with X ray & CMO management

JOIN SUB DIVISION TODAY - GO TO GORILLAZ.COM FOR DETAILS

GET UP TO THE MINUTE GORILLAZ INFORMATION FROM THE FREE GORILLAZ PLASTIC BEACH APP. INCLUDES GORILLAZ NEWSFEED, TOUR TICKETS, AUGMENTED REALITY AND A COMPASS LOCATOR FEATURE FOR PLASTIC BEACH!

ESCAPE TO PLASTIC BEACH TOUR NOVEMBER 2010

A 13 & ZOMBIE PRODUCTION

ESCAPE TO PLASTIC BEACH TOUR

PLUS SPECIAL GUESTS LITTLE DRAGON & DE LA SOUL

90s_AD_74x105mm.indd 1 19/8/10 19:11:56

BRUMS BEST ROCK NIGHT

£10 ENTRY...

10 FREE

DRINKS!!!

B4 10.30PM

Ress_anarchy_ad_74x105.indd 1 19/8/10 19:12:48

Oceana Birmingham Half Page:Layout 1 3/9/10 16:05 Page 1

Page 31: Spaghetti Junction- Summer 2011

SJPage

Cucumber sandwiches were at the ready, as Royal Wedding Fever gripped the nation these past few weeks. We’ve seen bunting being stapled everywhere, posters decorating towns and even lookalike ‘Wills and Kate’ couples plastering the cities.

Prince William is finally married to his fiance Kate Middleton. Many people are jealous at how she bagged herself the best bachelor in the country to become a real life Princess. It gives a girl hope that one-day she too can be made into a Princess with the kiss of her very own Prince Charming. It was a true fairytale

wedding, with class and elegance and will go on to be a part of history.

It seemed that whether you’re a royalist or not, you couldn’t help

but get involved in the big day. Villages came together to have

street parties, with homemade cakes and sandwiches, as

well as plenty of music and dance. Communities

and households joined together to share the magic of the day.

Some places of work held themed competitions for employees' children, such as poster making and cake decorating. The wedding has established a new sense of British pride so who can be blamed for wanting to get outside and celebrate in style.

Written by Jennie CoshDesigned by Danbi Lee

Page 32: Spaghetti Junction- Summer 2011

SJPage

For the third year running Birmingham’s NEC has been selected to showcase the newest, coolest and fastest gadgets around at The Gadget Show Live. Every year this event gives gadget enthusiasts the chance to gain some valuable hands-on experience with all of the latest tech available on the British market.

This year is promised to be bigger and better than ever! Audiences was treated to over 100 companies showcasing their latest products, live performances from all of the presenters at The Gadget Show, tech demos from industry professions and an entire games hall including 3D gaming experience. And if that doesn’t tickle your fancy, there was a food court, the original Batmobile and a test track to test out remote control toys, Segway’s and bikes! There was also a lot of workshops people could get involved with such as photography and DJing.

This year The Gadget Show Live run from 13th – 17th April and they had to add an extra date due to such a high demand. And I can completely see why, anyone who is a fan of the show would have adored this live event. Everything was painted in the classic powder blue colour to match The Gadget Show logo, and as soon as you walked through the doors there was tech as far as the eye could see. There was also a chance to meet the wonderful presenters and get your Gadget Show Live guide signed!

Birmingham has been home to The Gadget Show for six years and is the perfect place to host The Gadget Show Live. They also offer a lot of work experience for student folk like you! If you fancy working in PR, Media or anything technology related I would definitely get involved in next year’s event.

Written by Amanda Johansson Designed by Danbi Lee

The Gadget ShowLive 2011

SJPage 32

Page 33: Spaghetti Junction- Summer 2011

SJPage

For the third year running Birmingham’s NEC has been selected to showcase the newest, coolest and fastest gadgets around at The Gadget Show Live. Every year this event gives gadget enthusiasts the chance to gain some valuable hands-on experience with all of the latest tech available on the British market.

This year is promised to be bigger and better than ever! Audiences was treated to over 100 companies showcasing their latest products, live performances from all of the presenters at The Gadget Show, tech demos from industry professions and an entire games hall including 3D gaming experience. And if that doesn’t tickle your fancy, there was a food court, the original Batmobile and a test track to test out remote control toys, Segway’s and bikes! There was also a lot of workshops people could get involved with such as photography and DJing.

This year The Gadget Show Live run from 13th – 17th April and they had to add an extra date due to such a high demand. And I can completely see why, anyone who is a fan of the show would have adored this live event. Everything was painted in the classic powder blue colour to match The Gadget Show logo, and as soon as you walked through the doors there was tech as far as the eye could see. There was also a chance to meet the wonderful presenters and get your Gadget Show Live guide signed!

Birmingham has been home to The Gadget Show for six years and is the perfect place to host The Gadget Show Live. They also offer a lot of work experience for student folk like you! If you fancy working in PR, Media or anything technology related I would definitely get involved in next year’s event.

Written by Amanda Johansson Designed by Danbi Lee

The Gadget ShowLive 2011

Page 34: Spaghetti Junction- Summer 2011

SJPage

Summer 2011 is going to be phenomenal for film. You may find yourself spending summer in the cinema. By Iyanu Onalaja

Super 8

Directed by JJ Abrams and produced by Steven Spielberg. A group of friends manage to capture footage of a train crash that also holds a government secret. This is JJ’s homage to the sci-fi works of early Spielberg.

X Men: First Class

The movie is about the relationship between Professor X and Magneto in their younger days as they set up the institute for young mutants. One to look out for.

Captain America

The film centres around a young American soldier who volunteers to become a super soldier. Along the way there have been failed subjects and it’s up to him to bring them down. The Hangover Part 2

The first was hilarious and this summer the wolf pack return for another drunken adventure. Hopefully there’s not too much of a good thing when it comes to the hangover.

Transformers 3: Dark of the Moon

Director Michael Bay has promised that number 3 will make up for the lacklustre number 2. With its usual robots or autobots, explosions, and thrilling chases, who will win the ultimate battle of good and evil? Rise of the Planet of the Apes

The prequel to Planet of the Apes, starring James Franco, the film is about Apes in a scientific institution gaining intellectual knowledge and taking over the entire human race.

Thor

There’s another ‘Marvel’ superhero getting a solo film this summer, in preparation for next year’s ‘Avengers’ movie. This hero is an outcast God that has been banished to live out his days on Earth. The Smurfs

I’m sure all of us are old enough to remember the Smurfs! And now they are hitting the big screen. So, if you fancy some light relief this summer then this is the one to watch. Cowboys and Aliens

Starring Daniel Craig and Harrison Ford it’s a traditional western that just happens to have aliens as the protagonists, according to director Jon Favreau. He also directed Iron Man 1&2.

Pirates of the Caribbean: On Stranger Tides

And last but not least, Johnny Depp reprises his role as Captain Jack Sparrow.

There are too many films to mention but certainly keep your eyes peeled for some excellent summer movies!

34

Page 35: Spaghetti Junction- Summer 2011

SJPage 35

Summer 2011 is going to be phenomenal for film. You may find yourself spending summer in the cinema. By Iyanu Onalaja

Super 8

Directed by JJ Abrams and produced by Steven Spielberg. A group of friends manage to capture footage of a train crash that also holds a government secret. This is JJ’s homage to the sci-fi works of early Spielberg.

X Men: First Class

The movie is about the relationship between Professor X and Magneto in their younger days as they set up the institute for young mutants. One to look out for.

Captain America

The film centres around a young American soldier who volunteers to become a super soldier. Along the way there have been failed subjects and it’s up to him to bring them down. The Hangover Part 2

The first was hilarious and this summer the wolf pack return for another drunken adventure. Hopefully there’s not too much of a good thing when it comes to the hangover.

Transformers 3: Dark of the Moon

Director Michael Bay has promised that number 3 will make up for the lacklustre number 2. With its usual robots or autobots, explosions, and thrilling chases, who will win the ultimate battle of good and evil? Rise of the Planet of the Apes

The prequel to Planet of the Apes, starring James Franco, the film is about Apes in a scientific institution gaining intellectual knowledge and taking over the entire human race.

Thor

There’s another ‘Marvel’ superhero getting a solo film this summer, in preparation for next year’s ‘Avengers’ movie. This hero is an outcast God that has been banished to live out his days on Earth. The Smurfs

I’m sure all of us are old enough to remember the Smurfs! And now they are hitting the big screen. So, if you fancy some light relief this summer then this is the one to watch. Cowboys and Aliens

Starring Daniel Craig and Harrison Ford it’s a traditional western that just happens to have aliens as the protagonists, according to director Jon Favreau. He also directed Iron Man 1&2.

Pirates of the Caribbean: On Stranger Tides

And last but not least, Johnny Depp reprises his role as Captain Jack Sparrow.

There are too many films to mention but certainly keep your eyes peeled for some excellent summer movies!

Page 36: Spaghetti Junction- Summer 2011

SJPage

Written by Rebekah DunneDesign by Luke Kennedy.

On hearing the title “Pan’s Labyrinth” I automatically thought about Peter Pan, wanting to fl y, fairy dust, fun and never growing old. This fi lm is the complete opposite, which originally surprised me.

The fairies are ugly, the guide is a deformed fawn and the whole plotline takes place in the middle of military combat. Not the best choice for a fairy tale however it’s the uncomfortable atmosphere throughout the fi lm that creates the positive response I had to the fi lm. I loved it.

The whole fi lm is in Spanish so you won’t be able to take your eyes off the screen, except for the slightly gory bits, but don’t let that put you off. The story is beautifully written, amazingly acted and really draws you in.

Although technically a fairy story I would not recommend this fi lm to younger viewers. The gore and soldiers throughout the fi lm can attract all the “manly” men to the fi lm as well as the ladies to the remarkable storyline of a girl trying to discover if she is really a princess to the underground land while moving into her step-father’s house practically on the door-step to a battle.

It ends in a mixture of reality and fairy tale where good conquers evil (of course) and yet it is the supernatural ending that really makes this fi lm.

yyy wwwwririririiitttttttttttenenenenen,,,, amamammazazazzazzzinininninglglggglyyyyyyy aaaaaaannnn.n.nn.

yyyyyyy aaaaaaa ffffffffaiaiaiaaiaiaaaiairyryryryryryy sssssstotototototoooryryryryyryyyryry III wwwwwwwwwwwwoooooooooototototototo yyyyyyyouououuuungngngngngngngnggggererererereer vvvvvvvvieieieeieieeieeeeeeeeeeeeeewwwwwwwwwwwwwwwwwwwwwwwwwwwwwwuuuuuuutttttttttt ththththhhtttheeeeeeeee fififififififilmmlmlmlmlmlmm ccccccccananaaanananananana aaaammmmmm asasasasassasasaasss wwwwwwwwwwweleleleelelelllle llllll asasasasasasasassasassasasaassasass tttttttthehehhhehehehheeeeee ooooofffffffff aaaaaaa gigiggigiggiigigggigggiggggggiggigggiggigggigiggigggig rrrrlrlrlrlrlrlrlrrr tttttttttttttryrryryryryryryryryryryyininininininininiinnnn

ttototototoooooo ttttttttheheeheheheheheheeeeeeeeeeeeeeeehe uuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuundndndndndndndnddnddnddndndndndndndddddndddndndddndndndererereereeererereereeeererrrrerereeeeeeerreereereerererrererrerereeeererererrrrreer ssssssssssssssssssssssssssteteteteteteteetetetetteteteteteteteteteteteet p-p-p-p-p-p-p-ppp ffafafafafafaffaafathththhhhhtthhthhhhhhheeeeeeeeeepepepppppepppppppeppppppppppppppppppppp tttttttttttttttooooooooo aaaaaaaaaaaaa baababbbabbabababbabababbababbbabbbabbabababababababaababaababaabb tttttttttttt

aananananananannanaanananana ddddddddd fafafafafafaaafafaaafafafafafafaafaaaaaaaiiiriririiriiiririrse)e)e)e)e)e)e))e)e)e)e)e)e)e)e)e)e)e)ee)ee)eeeee) aaaaaaaaaaaaaandndndnndndndndddnddddndndndnddddnddnddddddaaaaaaaaaaaaaaaaaaaaaaaaaaaaallllllllllllllllllllllllllllllllllyyyyyyyyyyyyyyyyyyyyyyyyyyy mamamamamamamamamamamamamamaamamamamamamamamamamaammmammmmmmamm kkkkkkkkkkkkkkkkkkkkkkkkkkkkk

kkkkkkkahhahahhahahhhahh DDDDDDDDDDDDDDDDDDunununuununununununununnunnnnnnunnneneneneneneneeeeeeeeeeneneeeneneneneeeeeeeeeeneeeneeneneneeeneneneneneennnnneneennnnneeeennnnnneenenneneeeeeeeeeeeneeeeeeenenenenneneenennnnnnnneneneneneneneneneneneneeneneneeeneeneneneeneeneenenenenneeenen dydyddydydydydydyddydydydydydydydyddydydydydydydydydydydydydydydddyydddydddddddddy....

aaacaccaccaaccaa tttetetettteeeddddddddddd anananananannnaannannddddddddd

uouououuuouuuuuldldldldlddldlddddddldldddldddldldldddlll nnnnnnnnnnnnnnnnnnnnnnnnotototototototototootototototoototoototoooowweweweweweweweweweweeeeweweweweweeweeweweeew rsrsrsrsrsrsrsrsrsrsrsrsrsrrsrsrsssrssrssrsrssss..... ThThThThThThhTTThThTThTThThThThThThThhThThTThTT eeeeeeeeeeeeeee gogogogogogogogogooogogogooogoooooooogogooogoorererereeererererereerererererereereeereerererereeeereee

aaaaaaaaaaaattttttttttttttttttttttttttttttt rarararaararararararararrrrr ctcctctctctctctctctctctctcct aaaaaaaaaaaaallllllllllllllllllll tttttttttttheheheheheheheeeeeeeeeheeeeheheeeeheheeeeeeeee llllllllllllllladadadadadadadadaaadddddddddddddddddddiiiieieeieiieiieieieieieieesssssssss totototototototototottoooo

nnnnnnnnnngggggggggg tototottootototototototototottto ddddddddddddddddddisisisisisisisisisisissisccocococococoococcocoooooocooveveveveveveveveveveveveeeveevevvvv rrrrrrrrrrrrrrrrrrrggggrgrgrgrrrggrrgrrrrrououooououououooouuundndndnndndndndndndddddddddereeeerererrrrrreererrrr’s’s’s’s’s’ss’s’’ss’s hhhhhhhhhhoououououououuououououuououoouououuououuusesesesesesesesesesesesesesesesesesesesseeseeeeeeeeeeeeeseeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeetttttttttttttttttttttttttttttt leleleeeeleleleellele.....

rrrrrrrrrrrrryyyyyyyyyyyyyyyyyyyyyyyy tatatatatatatatattatatatattttttttttttttt leleleleeeeeeeeleellee wwwwwwwwwwwwwwwwwwwwwwheheheheheheheheheheheheheheheheheheheheheheheeeeheheeeeeeehheheheeeeeeheheheeeeeeeeeeeeeeeeeeeeeeeeeeeererrerrerereererereeereeeeereeereerereeeeeererereeerereerereerereeeeeereeerererrreyyyyyyyyyyyyyyeeeteteeteteteteteeeeteteteteeeetetetetettee iiiiiiiitttttttttttttttttt isisisissssiss ttttttttttttttttttttttttthehehheheheheheheheheheheheeheheeeheheeheheheheeeheeheeehehehheheeeeeeeee

kekekekekekekekeeeeekekekeeekeeeekeekekekekeeeeeesssssssss ttttttthtththttthththttthththththhhhhhiisisisisissssss fifififififififififififififilllllllllmmm.m.m.m.mmm

ttttthehehehheee ttttitittittittttleleeeleleleeeeeleeee “““““““PaPaPaPaPaPPaPaPaan’n’n’n’n’n’n’n sssssss LaLaLaLaLaLaLaLaLaLaabybybybybybybybybybybybyrriiriiririririrrintnttntntntntnnn h”h”h”h”h””h IIIIIIIIotoootoommamamammmaaaam tititittitticacacacacacaaaalllllllllllllyyyyyyy thththththththhoouououuoo ghghggghghg tttt abababbouououuttt PePePeteteteterrrrrrrrrrr PaPaPaPaPaPPaPaPaPaPaannnnnnnnyyyyyyyyy,,,,, faffafafafafafafafaf iririririrrrrryyyyyyyyy dudududddduststststt,, fufufuff nnn ananannddd neneeevevevev rrr grgrgrgrowowowowininininggggggg

thththththththhhheeeee ccococompmpmpleleleetetetete oopppposositite,e, wwhihiichchch oooririrreeeeeeeeeeeeedddddd mememe...

eeeesssssss ararareee uguglyy, the guide is aa defefoowhwhwhw ololee plp otline takes placec iinn tt

cocombmbmmmmmmmmmm at. Not the best choiciceevverer iit’s the uncomfortablb e atat

ttthehe fifillm that creates tthe ppooadada ttoo ththee fififilmmm.. II lol vev dd itit..

is inin SSpapaninishsh ssoo yoyouu wowowowonnnneesss ofofff ththee scscrereenenenn,, exexxxexexcececcecce

bbububuutttt doddododon’n’n ttt leleetttt thththhatatata ppppppputututttutut

nnnn,n,n,n,n,, wwwwwwwwwwananannnnnanannaa titititttititittititititiit ngngngnnngngngggnggngngnggngnnngololoololoo d.dddd.dd.dddddd TTTTTThihihiihihhih sssss

iigigigigigggg nananaaanallllllllllllllll yyyyyyyyyyyy

rrmemeeeedddddddd fafafaafaaaafawnwnwnwnwwnwnwnwwththee mimimimiiddddddddddddddddddleleleeleeleleee foforrrr aaaa fafaaafaafaaiririririrrriryyyyyyyttmomoospspspsppphehehehehererererererereeososittiviviveeeeeee

n’n’n’n’tttttt bbbbebebebebebebbebebebbb aaaaaaaaaaaablbblblblblblbb eeeeeeeeeeeeptptptptptptt fffffffffffffororororororoor tttttttttthhehehehehehetttt yyyyyyyyyyooououououuouououo ooooooooooffffffffffffff.. ThThTTThThThheeeeeeeeee

nnnnnn hhhhhhhheaeaeaeaaeaririririr ngngngngngng

sststststsstststtooooororoorororrororooorororroroooroorroo yyyyyy isisisisiis bbbbbbbeeaeaeaaaeaaeae utututututttutuutifififififififfulululluluululuu lylylyyylylylyyyrerrererererererereererer aaaalalaalalala lylylylylylyyy ddddddrarararaarar wswswsssww yyyyyyououououououoou iiiiiiinnnnnnnn

AlAlAAAAlA ththththhououououououghghghghghhghggg ttttttececececcecchnhnhnhnhnhnhnicicicicicalalalaalallylylyylylyrrrerererrereeerrrerrreeeccocococooc mmmmmmmmmmmmmm eneneneneneneee ddddd thththththhhisisisisisiss fififififififillllmmmmmm tttt

nnddddddd sosososooooldlddlddddddieieieiiersrsrssrsr ttttthrhrhrhrhrhrh ouououououuoughghghghghghhhghg ououooooooonnnnnnnnnnnnlylyyylylyylylylyyylylylyylyyyyyyyyy”””””””””””””” memememmmemmennnn tototoooo ttttthehehehehehe fifififififillllmmmmm

aaaaaaaarkrkrkkrkrkkkrkrkrrrrrr ababababababableleeleleee ssssssssstototototoryryryryyylilililiiilineneneneneneennaalaalllllll ylyyylylylyyylyylylylyylylylyyyyyyyyyyy aaaaaaaaaaaa pppppppppppppppppppririririririririrriirriincncncncnncncccncncccncccncncnncncceseseseseseseseseeseseeseseseseseeeeee sssssssssss ttttttototottt

ovovovovovoovovovovvvvvvvvvinininnininnininininininnininininingggggggggggggggggggggg ininnnininininininininiinininininninnntototoototottotototototootototototototootottotoooootooooto hhhhhhhhhhhhhhhhhhhhhhhhhhhheeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeheeeeheheeeheheheeeeeeeeeeeeeeeeeeee dddddddddddddoooooooooooooooooooooooorrrrr-r-r-r-r-r-rr-r-r-rrrrrr ststststsstsstss eeeeeeeeeppepp

rerererereeeeereerrereeeeeerereeeaalalalalalalalalalalaaaaaalalaalalalalalalaallalalalalalaalaaaaaaaa itititititittititititiitititititttttititititittitiiitititii yyyyyyyyyyyyyyyyyyyyyyyyyyyyyouououououououououuuuursrssssrssrsrrsrsrsrssrsrssrsrsr eeeeeeeeeeeeeeeeee

auauauauuauttotttototototoo flflflflflflflflflyyyyyyyyyyyfififififififififilmlmlmlmmlmlmmmmm iiiiiiisssssssssssssususususuusuus rprprprprprprpppririririririrririr sesesesesesesees

ThTThThThhheeeeeeee fafaaaafafafafairiririi ieieieananananananananndddddddddddd ttththththeeee wwwwofofofofooofooo mmmmmmmmmmmmmmililililititittitititittararararaaaa yyyyytatatatatataaataleleleleeleleleleleeellee hhhhhhhhowowoowowwoowwevevethttththhhht rororororororrr ugugugugugguggugghhhohohohohhh ututt trereeeerreer spspspppspsppss onononononononononseseseseseseseesee IIIII hhhhaaa

TThThThhhhhThheeeeeee whwhwhwhwhhwhwhhololololoolololoolo eeeeeee fififififilmlmlmll itototototototototttooototototootototototooottttotooott ttttttakakakakakakaakeeeeeeee yyoyoyoyoooooyoyyy ururuururuuu eeeeeeyeyeyslslslssssllslslllllligiggigigigggggigigggigigigggigggggggggggggggghthththththtlyylyyylyyyyy ggggggggggorororororoooooroo yyyyyyyyyy bibibibib tststststs,,,

OOnOnOnOnOnOOOn

WrWrWrWWrrrWrititittitititittitteteteteteetetett nnnnnnnnn bybybybyybybybyyybbbybyyy RRRRRRDeDeDeDeDeeDeeeeeDeDDDeDeeDDDDeDDDDDeDeDDDDDeDesissisisisisisisisisisisisisis gngngngngngngngggnnngngngnggggggng bbbbbbbbbbbbbbbbbbbyyyyyyyyyyy

hhhhhhhhhhhhhatatatatattatataataatattaa rrrrrrrrrreeeaeeaeeeeeaeaeeaeaeaeaeeeaeaeeaeaeaeaeaeeeeea

RRRRRRRRRRRRRebebebebebebebebebebebbebebee ekekkkekkekekekeeeekeee aayyyyyyy LuLuLuLuLuLuuLuLuLuLuLLuLuLuLuLuuLuLLuLLuLuLuL kekekekekekekekkekkke KKKKKKeneneneeneneeeeeenee

rrereraaanananaaaananananannananaaanaaaaanaanaanaanana ddd“m“m“m“mm“m“m“m“m“mm““m““mmmanaanananananananananananannnanannnanannanannnnnnanaannlllylylllyllylylllththththththttthththttthththhhthhhhhtt eeeeeeeeeeee rerrerrerererreererereeeeemmamamamamamamamamamammmamamaamamamamamaaaaaifififffffiifffffififiiiifiiifiiififf sssssssssheheheheheheheheeeeheheheheheheheheheheheheheheheheheheheheeeeheeee iiiiiiiiiiiiiiiiiiiiiissssssssss rerererererereererereereereeereereeereeeealalalallalaaalalalalaaalaaaaaaalaaaaaaaaaalaa llylyylllylyyllllylyyylyyllyyylalaaaaalalalalaaalalaalal ndndndndndndddndddddddddddddddddndddnnd wwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwhihihhihihhihhihhihhhh leleleleleeeeeee mmmmmmmmmmmmmmovovovovovoooovooovovooopppppprprprprpppprppprpp acacacacacacacaccctttttititiitititititittittiticccacacaacacaacaaacaccaccccaacacaccaacacacaaac lllllllllllllllllllllllllllllllll yyyyyyyyyyyyyyyyy onooooononononoononononnoononoononononoooononononoonononononn tttttttttttttttttttttthehhehhehehehehehehehehhehehhehhehhhhhhhhheeh

ItItIttttttItIttIttItItItItItItttttt eeeeeeeeeeeeeeeeeeeeeeeeeendndndndndndndndndnddndndndnndnndndndnnndndnnddndndssssssssssssssss ininininininninnniinninnninn aaaaaaaaaaaa mmmmmmmmmmmmmmmmmmmmmmmmmixixixixixixxxixixixixixixxxixxixxtututututuutututututuuutttt rererererererererereeererereeereee oooooooooooooooffffffffffffffffff rerererererreerrerrerrrerrrrggggggogogogogogogogoggooggoggggoggogogggggooogggggggggggggggg odododdodoodooddooododododo ccccccccccccccononononononononononononononononnnnnnnquququququuququququuququqquququqqqqq ererererererererrrreererereerrrerrrrerererersssssssssssssssss evevevevevevevevevveveeeeevveeeeee ilililililliliiliillll (((((((((((((((oooofofofofofofofofooofofofofoofo cccccccccccccooooooooosusssssususuuuusssssssssuuusussuuusuuuuuupepepepepepepeppernrnrnrnnrnrnnrnnrnr atatatatattttatattaaaaaaaa urururururrurruuralalaaalalalalaalaaa eeeeeeeeeeeeeendndnndnndddddddddddddddndndndnddndndnddndddininininininininininininininnnininnninnnngggggggggggggggggggggggg ththththththththththththththththttttttt atatatatatataaataaaaaaa

36SJPage

Page 37: Spaghetti Junction- Summer 2011

SJPage

3 Course Meal, Live Band, DJ & After Party at Panic, HMV Institute

Join us to celebrate our students’ outstanding work through societies, sports teams, media and volunteering groups.

Buy your tickets now atwww.birminghamcitysu.com/activitiesball

KERRANG HERE!!Would you like to earn money in

your spare time?

Become a Kerrang! Roadie!For info visit:

www.kerrangradio.co.uk

Alternatively speak to our friendsaat Fierce Monkey about

becoming an agent:www.fiercemonkey.co.uk

- Official Clothing Partner of Kerrang! Radio

Page 38: Spaghetti Junction- Summer 2011

SJPage

Kate-Style Princess (book)

Every girl knows the set-up of a good fairy story; girl falls in love with a boy, whether it is a human to a mermaid or a prince to a servant girl. The prince proposes and the girl’s life is changed forever. That’s great when you’re five, but how do we get teenagers and adults interested in the story? It’s simple: add fashion. This book details the fashion decisions of the lovely Kate Middleton and other princesses too for good measure. Not to mention tips on how to get that natural yet groomed Middleton look.This book is fun, interesting and every fairy-tale loving girls dream book.

Written by Rebekah Dunne

‘The Beach’ by Alex Garland (book)

Traveller Richard is tired of treading the same beaten track, so a perfect opportunity presents itself when a fellow traveller in Thailand leaves him a map to ‘the beach’. The beach is hidden on a secret island and it’s said that a close-knit community lives there, cut off from the rest of the world. Curiosity attracts Richard and two friends who to try and find the beach, but will its secret harmony last?This is an excellent debut novel from Alex Garland and it’s a real page-turner. The accompanying film is unimpressive compared to the novel. It is a worthwhile read, especially for the summer holidays.

Written by Kelly Purple

Sucker Punch (film) The plot centres on 'Baby-Doll', institutionalised by her stepfather. The audience is shown different realities where the inmates take on different roles as dancers- including Sweet Pea, Rocket, Blondie and Amber.The girls are transported to a world of high paced fight sequences believing that once they find five items they can escape the hold of the Brothel owner Blue Jones.The opening scene is shot very well but the overall plot is tricky to follow and never commits to a message: is it about female empowerment or a male fantasy of girls in skimpy outfits fighting bad guys? Overall, an okay film; both well directed and acted, so worth a watch.

Written by Lauren Kierans

Meet the Parents: Little Fockers (film)

Greg (Stiller) and Pam (Polo) have been together for ten years, and now they're the proud parents of adorable twins. With money tight, dedicated nurse Greg takes a second job. As usual Jack (De Niro) is still not happy with his son-in-law. The twins' birthday fast approaching, the proud parents invite the entire family over to celebrate. As the festivities get under way, Greg has one last chance to prove that he's trustworthy. With both new and familiar faces, this DVD is one to watch after a hard day of work.

Written by Iyanu Onalaja

Designed by Danbi Lee

Page 39: Spaghetti Junction- Summer 2011

SJPage

Kate-Style Princess (book)

Every girl knows the set-up of a good fairy story; girl falls in love with a boy, whether it is a human to a mermaid or a prince to a servant girl. The prince proposes and the girl’s life is changed forever. That’s great when you’re five, but how do we get teenagers and adults interested in the story? It’s simple: add fashion. This book details the fashion decisions of the lovely Kate Middleton and other princesses too for good measure. Not to mention tips on how to get that natural yet groomed Middleton look.This book is fun, interesting and every fairy-tale loving girls dream book.

Written by Rebekah Dunne

‘The Beach’ by Alex Garland (book)

Traveller Richard is tired of treading the same beaten track, so a perfect opportunity presents itself when a fellow traveller in Thailand leaves him a map to ‘the beach’. The beach is hidden on a secret island and it’s said that a close-knit community lives there, cut off from the rest of the world. Curiosity attracts Richard and two friends who to try and find the beach, but will its secret harmony last?This is an excellent debut novel from Alex Garland and it’s a real page-turner. The accompanying film is unimpressive compared to the novel. It is a worthwhile read, especially for the summer holidays.

Written by Kelly Purple

Sucker Punch (film) The plot centres on 'Baby-Doll', institutionalised by her stepfather. The audience is shown different realities where the inmates take on different roles as dancers- including Sweet Pea, Rocket, Blondie and Amber.The girls are transported to a world of high paced fight sequences believing that once they find five items they can escape the hold of the Brothel owner Blue Jones.The opening scene is shot very well but the overall plot is tricky to follow and never commits to a message: is it about female empowerment or a male fantasy of girls in skimpy outfits fighting bad guys? Overall, an okay film; both well directed and acted, so worth a watch.

Written by Lauren Kierans

Meet the Parents: Little Fockers (film)

Greg (Stiller) and Pam (Polo) have been together for ten years, and now they're the proud parents of adorable twins. With money tight, dedicated nurse Greg takes a second job. As usual Jack (De Niro) is still not happy with his son-in-law. The twins' birthday fast approaching, the proud parents invite the entire family over to celebrate. As the festivities get under way, Greg has one last chance to prove that he's trustworthy. With both new and familiar faces, this DVD is one to watch after a hard day of work.

Written by Iyanu Onalaja

Designed by Danbi Lee 39SJPage

Page 40: Spaghetti Junction- Summer 2011

SJPage

The Foo Fighters are back with possibly their best album to date. I’m a huge fan of The Foo and theirs’ was the fi rst concert I ever went to. This June I will be seeing them at Milton Keynes Bowl for the 6th time.

The Foo’s have gone back to basics with this album by recording the whole album to tape. Which is impressive nowadays in what is considered a digital age. Not only this but the album was recorded in Dave Grohl’s Garage rather than a fancy studio. Butch Vig, the man who produced the legendary ‘Nevermind’ by Nirvana, produced this album, which also boasts the musical talent of Krist Novoselic (Nirvana Bassist) on the Track ‘I Should Have Known’. This is the fi rst time the three have worked together since the ‘Nevermind’ recording sessions.

With all that said how does the album actually hold up? Well from the fi rst track it’s apparent that the Foo’s aren’t easing themselves into the process. ‘Bridge Burning’ is possibly the best opening track of any Foo release. ‘All My Life’ being it’s main contender. ‘White Limo’ is another stand out track that seems to take infl uence from their self-titled album. A great track with old school Grohl Vocals.

T

Classic

Album

aaaaaaarerr n t eaeaaeaaaaasssisis ngnn themselves intossis blblyy ththe

nr

m.l

Designed by Luke Kennedy

FOO FIGHTERS:WASTING LIGHT

40

Page 41: Spaghetti Junction- Summer 2011

SJPage

The asthmatic, the inventor, the wise guy, the fat one, the trying-too-hard-to-be-cool kid, the cheerleader, the cheerleaders friend, the lovable yet misunderstood hero and of course some pirates. Sounds just crazy enough to work right?

When the Goondocks are

about to be demolished, this

group of misfits set out to find One-eyed-

willy’s mythical treasure. But will they get there before

the evil Fratelli family? And can the buccaneers get to

the treasure in time to save the town and get out with their lives?

Those of you who spent your childhood glued to this film will know that watching it years later, the jokes are funnier and the plot more touching, not to mention all those times as a

youngster where you may have played pirates and treasure hunts (or was that just me).

Directed by Richard Donner and written and produced by Stephen Spielberg. I guarantee that you will rewatch and quote

these unforgettable set of characters. “I’m setting Booty-traps.” “You mean Booby-traps?” “That’s what I said!”

This is without a doubt one of the films that you need to watch within your life-time and you won’t be sorry when you do. So get practicing your pirate-talk, map-reading, truffle-shuffle and tune into a classic film. Written by Rebekah Dunne

Design by Luke Kennedy.

FOO FIGHTERS:WASTING LIGHT

Page 42: Spaghetti Junction- Summer 2011

SJPage

Media Groups Aren’t Going Away This Summer...

That’s right! We’ll be here over the summer months, working away to make sure you’re kept in the loop.

Scratch Radio will remain on your airwaves this summer and with a new committee in place, expect some changes. They’ll be keeping you up to date with all the hits, new and breaking band tracks, specialist shows and interviews.

Scratch will be playing all your favourite music and bringing you the soundtrack for your summer. Listen online at:www.scratchradio.co.uk.

Tiger TV are back and better then before. The recently resurrected Tiger TV will be producing several videos in preparation for Freshers ‘11. So if you want to get involved, please do! They’ll need everyone from presenters to editors.

And last but not least, us lot

here at Spaghetti Junction will be keeping the blog updated; keeping you in the loop with all your student news and all the latest from the world of Arts and Entertainment. Oh yeah, and preparing for the epic Freshers Issue.

All three groups will be working together to make sure that the Media Groups presence will be bigger than previous years and ensuring the same great quality is continued all year long.

So from everyone here at Scratch, Tiger and Spaghetti Junction- hope you have an enjoyable summer and we’ll see you in September!

SpaghettiJunction

Wanna get involved with Media Groups? Email [email protected]

Adios Amigos!

42

Page 43: Spaghetti Junction- Summer 2011

SJPage

0121 202 4696www.birminghamcitysu.com/homes

Supported bySolely operated by

*Through its subsidiary Birmingham City Enterprises Ltd. Company Registration No. 3595006.

*

No Fees Protected Deposits Accredited Landlords Property Alerts Simple Paperwork Free Housemate Finder

Page 44: Spaghetti Junction- Summer 2011

SJPage

Saturday 4th JuneThe Paragon Hotel

7pm - 2amFormal Dress / Tickets £40

For details & tickets visitwww.birminghamcitysu.com/gradball

Go out in style...

This is a fundraising event.


Recommended