CSIR-Centre for Cellular and Molecular Biology, Hyderabad 500007, India
Correspondence should be addressed to A B Siva; Email: [email protected]
*(D K Singh and R K Deshmukh contributed equally to this work)
Abstract
Sperm capacitation is a prerequisite for successful fertilization. Increase in tyrosine phosphorylation is considered the hallmark of capacitation and attempts to understand its regulation are ongoing. In this regard, we attempted to study the role of SRC family kinases (SFKs) in the hamster sperm functions. Interestingly, we found the presence of the lymphocyte-specific protein tyrosine kinase, LCK, in mammalian spermatozoa and further characterized it in terms of its localization and function. LCK was found in spermatozoa of several species, and its transcript was identified in the hamster testis. Autophosphorylation of LCK at the Y394 residue increased as capacitation progressed, indicating an upregulation of LCK activity during capacitation. Inhibition of LCK (and perhaps the other SFKs) with the use of a specific inhibitor showed a significant decrease in protein tyrosine phosphorylation of several proteins, implying LCK/SFKs as key tyrosine kinase(s) regulating tyrosine phosphorylation during hamster sperm capacitation. Dihydrolipoamide dehydrogenase was identified as a substrate for LCK/SFK. LCK/SFKs inhibition significantly reduced the percentage fertilization (in vitro) but had no effect on sperm motility, hyperactivation and acrosome reaction. In summary, this is the first report on the presence of LCK, an SFK of hematopoietic lineage in spermatozoa besides being the first study on the role of SFKs in the spermatozoa of Syrian hamsters.Reproduction (2017) 153 655–669
Introduction
The epididymal mature spermatozoa undergo ‘capacitation’ in the female reproductive tract to become fertilization competent (Chang 1951, Austin 1952). During capacitation, spermatozoa undergo a number of biochemical and biophysical changes, such as increase in membrane fluidity (Davis et al. 1980, Cross 1998), activation of transbilayer signaling events (Visconti et al. 1998), changes in redox status of spermatozoa leading to the generation of reactive oxygen species (ROS) (Aitken et al. 1997, de Lamirande & O’Flaherty 2008) and phosphorylation of proteins (Lefièvre et al. 2002, Shivaji et al. 2007, Kota et al. 2009). Concomitant with these changes, the spermatozoa gain hyperactivity, which refers to a change in the motility pattern of spermatozoa from a progressively motile cell to a more vigorous, but less progressive motile cell (Yanagimachi 1969). Subsequently, capacitation culminates with the ability of the spermatozoa to undergo the acrosome reaction, which facilitates the penetration and fusion of sperm with the egg, leading to fertilization.
At the molecular level, activation of signal transduction cascades leading to increase in tyrosine
phosphorylation of proteins is a characteristic feature associated with capacitation in mammalian spermatozoa (Lefièvre et al. 2002, Ficarro et al. 2003, Shivaji et al. 2007, Kota et al. 2009). Reports from several groups have demonstrated the importance and increase of protein tyrosine phosphorylation during sperm capacitation in various species, including hamster (Kulanand & Shivaji 2001, 2002), mouse (Arcelay et al. 2008, Alvau et al. 2016), cat (Pukazhenthi et al. 1998), pig (Tardif et al. 2001), boar (Kalab et al. 1998), bovine (Galantino-Homer et al. 2004), equine (Pommer et al. 2003), cynomolgus monkey (Mahony & Gwathmey 1999), tammar wallaby, brushtail possum (Sidhu et al. 2004) and human (Osheroff et al. 1999).
Studies of upstream kinases and phosphatases in spermatozoa has been the obvious approach to understand the regulation and importance of tyrosine phosphorylation during capacitation (Leclerc & Goupil 2002, Naz & Rajesh 2004, Baker et al. 2006, de Lamirande & O’Flaherty 2008, Varano et al. 2008, Krapf et al. 2010, Ickowicz et al. 2012). SRC family kinases are one such group of non-receptor tyrosine kinases being studied. SRC family comprises several members, such as SRC, YES, FYN, FGR, LCK, HCK,
10.1530/REP-16-0591
Downloaded from Bioscientifica.com at 02/14/2022 06:46:45PMvia free access
BLK and LYN (Okada 2012). The presence of a few SFK members has been reported in spermatozoa of a few species and has also been implicated in capacitation (Leclerc & Goupil 2002, Baker et al. 2006, Lawson et al. 2008, Varano et al. 2008, Goupil et al. 2011, Bragado et al. 2012). The most studied member of SFKs, SRC, has been implicated in sperm protein tyrosine phosphorylation in human (Lawson et al. 2008, Varano et al. 2008) and mouse (Baker et al. 2006). It also plays an important role in sperm motility (Krapf et al. 2010) and epididymal development (Krapf et al. 2012). In fact, cSRC-null mice have been shown to have compromised fertility in vivo (Schwartzberg et al. 1997). YES, another SFK member, is known to regulate cell adhesion at the apical ectoplasmic specialization blood–testis barrier (Xiao et al. 2013) and acrosome reaction in porcine spermatozoa (Bragado et al. 2012). YES is present in the head portion of human sperm and is responsible for at least a small amount of tyrosine phosphorylation during capacitation (Leclerc & Goupil 2002). FYN has been shown to be present primarily at the inner leaflet of plasma membrane and plays an important part in integrin signaling (Wary et al. 1998). FYN-null mice have small epididymis, and many deformed spermatozoa with less fertilizing capacity (Luo et al. 2012) compared to the controls. FYN plays an important role in proper shaping of the head and the acrosome within the testis (Luo et al. 2012) and also helps in fertilization (Kinsey & Shen 2000). Two other SFKs, LYN and HCK, are considered to be specific to hematopoietic cell lineages (Thomas & Brugge 1997) but these (along with YES) have been reported to be present in haploid germ cells (Lalancette et al. 2006). Yet another important hematopoietic cell-specific SFK member is the 56-kDa lymphocyte-specific protein tyrosine kinase named LCK. Presently, no information is available on the presence and function of LCK in spermatozoa/testis and its role in sperm capacitation. In this study, we have carried out the molecular characterization of LCK in spermatozoa and attempted to explore the functional importance of LCK in sperm capacitation using hamster as the model system. This is the first study of its kind to explore the presence/role of LCK and thus SFKs in hamster spermatozoa.
Materials and methods
Materials
Pharmalytes, nitrocellulose membrane and low-molecular-weight standards were purchased from Amersham. IPG strips were purchased from Bio-Rad. The primary antibodies used were from the following suppliers: monoclonal anti-phosphotyrosine antibody (clone 4G10) was from Millipore; anti-LCK (B-10) and anti-phospho-LCK (Y394) (pLCK) antibodies were from SantaCruz Biotechnology; anti-succinate dehydrogenase antibody was from MitoSciences
(Eugene, Oregon, USA); anti-GAPDH (ab8245), anti-phospho-SRC (Y418) (pSRC), anti- LCK (ab3885) antibodies and the inhibitor peptide (ab13750) were from Abcam. The secondary antibodies conjugated to horse radish peroxidase (HRP) or the fluorophore, fluorescein isothiocyanate (FITC), were from Sigma Aldrich. Secondary antibodies conjugated to the fluorophore Cy3 were from Jackson Immunoresearch Laboratories. LCK inhibitor (sc-204052) was purchased from Santa Cruz Biotechnology. Protein-A/G plus agarose beads were purchased from Santa Cruz Biotechnology. ECL kit was purchased from Pierce. All the other chemicals used were of high analytical grade and were purchased from Sigma Aldrich.
Spermatozoa collection and in vitro capacitation
Fifty male golden hamsters (Mesocricetus auratus) aged 6 months were used for in vitro capacitation studies using TALP-PVA medium (Dow & Bavister 1989, Panneerdoss et al. 2012). Hamster spermatozoa were collected from cauda epididymis in TALP-PVA (Tyrode’s albumin lactate pyruvate–polyvinyl alcohol) medium, pH 7.5 and after counting using a Makler chamber with a HTM-CEROS, version 12.0 L (Hamilton Thorne, Beverly, MA, USA) computer-assisted sperm analyzer (CASA), and they were incubated at 37°C in 5% CO2 in the same medium for 5 h (Kulanand & Shivaji 2001). Spermatozoa collected at 0 h were assigned as uncapacitated and those that were collected at 5 h were assigned as capacitated spermatozoa (Kulanand & Shivaji 2001). The study was approved by the Institutional Animal Ethics Committee (IAEC number 70/2014) of the Centre for Cellular and Molecular Biology (CCMB) – CSIR, Hyderabad, India. All the experiments were performed as per the guidelines of the IAEC, CCMB.
Human sperm collection
Semen samples were collected by masturbation in a sterile container from 3 different fertile donors at the clinic, strictly with 2–3 days of sexual abstinence. After liquefaction for 30 min at 37°C (5% CO2 in air), the entire semen sample was layered on a discontinuous Percoll gradient prepared in medium M (10× concentration having 1.37 M NaCl, 25 mM KCl, 200 mM HEPES and 100 mM glucose). The 100% isotonic Percoll was prepared by adding Percoll to medium M (10× concentration) in a ratio of 12:1 (v/v) (Pixton et al. 2004). Percoll fractions of 30% and 70% were then made by diluting 100% Percoll with medium M (1×), having the final concentration of 137 mM NaCl, 2.5 mM KCl, 20 mM HEPES and 10 mM glucose. In a falcon tube, 1 mL of each 70% Percoll and 30% Percoll was added and overlaid with 1 mL of semen sample and was centrifuged at 800 g for 40 min. The pellet recovered was washed once with medium M (1×) and with PBS to remove Percoll completely. Sperm concentration was evaluated by CASA (Hamilton Thorne Research, ver 12.0L, MA, USA) using a Makler counting chamber. The pellet was processed immediately for the experiment. The study was approved by Institutional Human Ethics Committee (IEC number 33/2008) of the Centre for Cellular and Molecular Biology (CCMB) – CSIR, Hyderabad, India. All participants gave their written informed consent.
Downloaded from Bioscientifica.com at 02/14/2022 06:46:45PMvia free access
An ATP-competitive LCK inhibitor (sc-204052) was used for the study. The inhibitor was reconstituted in DMSO and was used at 1, 50 and 1000 nM concentrations. Inhibitor was added to the media at the beginning of capacitation and assessed for hyperactivation, acrosome reaction and tyrosine phosphorylation at various time points during capacitation. A total of 3 × 106 cells per 250 µL of TALP-PVA were incubated in the CO2 incubator for acrosome reaction count whereas 5 × 106 cells were kept in 1 mL of TALP-PVA for the hyperactivation recordings. Hyperactivation was recorded every hour. For samples to be used for 2D or SDS-PAGE, 1 × 108 cells were added to 3 mL of TALP-PVA in 35 mm dish (Nunc, Denmark). Samples were picked at set time points for Coomassie staining and immunoblot analysis.
Phospho-antibody array analysis of spermatozoa
The phospho-antibody array analysis was performed using the Proteome Profiler Human Phospho-Kinase Array Kit (ARY003) from R&D Systems according to the manufacturer’s instructions (Deharvengt et al. 2012, Olszewski et al. 2012). Although the antibodies were generated against human proteins, we could monitor the phosphorylation status of several kinases/factors in hamster spermatozoa, as these protein phosphorylation sites are conserved and thus the antibodies displayed cross-reactivity with hamster proteins. Briefly, uncapacitated hamster spermatozoa (0 h) were lysed with Lysis Buffer 6 (R&D Systems) and agitated for 30 min at 4°C. Cell lysates were collected after centrifugation at 20,817 g for 5 min, and the protein was estimated in the supernatants using the Amido Black staining method (Schaffner & Weissmann 1973). Pre-blocked nitrocellulose membranes of the Phospho-Kinase Array were incubated with 500 μg of sperm extract overnight at 4°C on a rocking platform. The membranes were then washed three times with 1× wash buffer (R&D Systems) and then incubated with a mixture of biotinylated detection antibodies and streptavidin-HRP antibodies as per the manufacturer’s instructions. Chemiluminescent detection reagents were applied to detect spot densities. Pixel density for each spot (an average of duplicate spots after subtraction of average background density) was determined by densitometry using ImageJ software (NIH). Results were normalized to net integrated pixel density of internal positive controls, which were supplied as part of the kit. The averaged density of three different animals was used for the relative expression of phosphorylated proteins. The details about the array design can be found at http://www.rndsystems.com/pdf/ARY003.pdf. The experiment was also done with capacitated (5 h) hamster spermatozoa and uncapacitated (0 h) human spermatozoa in the same manner as described for hamster spermatozoa.
Reverse transcriptase polymerase chain reaction (RT-PCR) and sequencing
Total RNA was extracted from fresh hamster tissues (testis, liver, brain and spleen) using the TRI reagent according to the manufacturer’s instructions (Sigma).
cDNA synthesis (Reverse transcription, RT) was performed with 5 µg of total RNA, Lck reverse primer (5′ TCAAGGCTGGGGCTGGTACTGGCCC 3′) or anti-GAPDH reverse primer (5′ TGATGGCATGGACTGTGGTCATGA 3′) and Expand RT (Roche) at 42°C for 1 h. PCR conditions after RT were as follows: initial denaturation step of 20 s at 95°C followed by 30 cycles of 45 s at 95°C, 1 min at 53°C and 1 min at 72°C. The sequencing analysis of the amplified product (both partial 278, 505, 602 and 972 bp) was performed on an ABI PRISM 3100 (Applied Biosystems) automated sequencing analyzer. Details of the primers are given in Supplementary Table 1 (see section on supplementary data given at the end of this article). The nested primers strategy used for amplification of full-length Lck cDNA are shown in Supplementary Fig. 2A.
Sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) and immunoblot analysis
Total sperm/tissue proteins (40 µg) were resolved on a 10% SDS-PAGE and electrotransferred onto a nitrocellulose membrane. Subsequently, the membrane was stained with 0.1% Ponceau S to check for equal loading of the proteins and confirmation of protein transfer. After washes, membranes were then blocked with 5% (w/v) non-fat milk in TBST (10 mM Tris, 150 mM NaCl (TBS) containing Tween 0.1% (v/v), pH 7.6) for 1 h at room temperature, washed and incubated overnight at 4°C with the primary antibodies at appropriate dilutions (anti-LCK (B-10) (1:1000), anti-pLCK (1:2000), anti-DLD (antiserum) (1:1000), anti-phosphotyrosine (4G10) (1:10,000) and anti-GAPDH (1:1000)) antibodies prepared in 1% BSA in TBST. After the incubation period, the membranes were washed three times (10 min each wash with TBST) and incubated with the appropriate secondary antibody conjugated to horse radish peroxidase (HRP), prepared in TBST containing BSA 1% (w/v) for 1 h at room temperature. The blots were developed using chemiluminescence detection reagent from Pierce. For the 2-D spot confirmation alone, anti-LCK antibody from Abcam was used for which there exists a inhibitor peptide (residues 200–300 of Human LCK-refer to http://1degreebio.org/reagents/product/1353114/?qid=194967#sthash.URhNYAhS.dpuf). For peptide inhibition experiment, the LCK antibodies (Abcam) were pre-incubated with the inhibitor peptide at 4°C overnight (1 µg peptide in 1:1000 LCK antibody dilution), before incubation with the membrane. LCK (B-10) antibodies were used for all the other experiments in this study.
Isoelectric focusing (IEF) and 2-dimensional polyacrylamide gel electrophoresis (2D-PAGE)
Hamster spermatozoa, both uncapacitated (0 h) and capacitated (3 h and 5 h), were used for 2D-PAGE. A total of 150 × 106 spermatozoa were washed with cold TBS by centrifugation at 10,621 g for 5 min and lysed in rehydration buffer (containing 7 M urea, 2 M thiourea, 50 mM DTT, 0.5% pharmalytes 3–10, 1 mM sodium orthovanadate and protease inhibitor cocktail (Roche)) at 4°C for 2 h. Subsequently, the lysate was centrifuged at 20,817 g for 1 h and the solubilized protein was recovered carefully without disturbing the sediment. Then, 200 µg protein was loaded on to a commercially available IPG strip (7 cm,
Downloaded from Bioscientifica.com at 02/14/2022 06:46:45PMvia free access
pI 4–7, 5–8; Bio-Rad) by passive rehydration for 12 h. Later, IEF was performed at 4000 V for 20,000 VH for 7 cm strip with the current set at 50 µA/IPG strip using a Protean IEF cell (Bio-Rad). After the IEF run was completed, strips were equilibrated in buffer I (containing 6 M urea, 0.375 M Tris, pH 8.8, 2% SDS, 20% glycerol and 2% DTT), followed by a second incubation in buffer II that contained all the ingredients of buffer I except that DTT was replaced with 2.5% iodoacetamide. Each equilibration step was carried out for 20 min under gentle agitation. Strips were then transferred onto a 10% SDS-PAGE gel and embedded into the gel with 1% agarose containing a trace amount of bromophenol blue. SDS-PAGE was performed using vertical gel electrophoresis system at 20 mA/gel. After the gel run, proteins were electrotransferred to a nitrocellulose membrane and processed for immunoblotting as described earlier.
Immunofluorescence
Smears of cauda epididymal spermatozoa from hamsters were prepared on coverslips and immunolocalization was performed. The spermatozoa were permeabilized by dipping the coverslips in ice-cold methanol for 1 min. They were then blocked with 5% BSA in TBS, followed by incubations with the primary antibody anti-LCK (B-10), 1:50 (1 h at RT), anti-phosphotyrosine (4G10) antibody, 1:100 (1 h at RT), pLCK (Y394), 1:50 (1 h at RT) or pSRC (Y418), 1:50 (1 h at RT). After incubation, the smears were given 3 × 10 min washes in TBS, and then incubated with appropriate secondary antibodies in 1% BSA for 1 h at room temperature (donkey anti-rabbit FITC antibodies for pLCK/pSRC (Y418) and goat anti-mouse Cy3 antibody for LCK (B-10)/anti-phosphotyrosine (4G10)). After immunostaining, the coverslips were mounted on clean glass slides using Vectashield containing nuclear stain DAPI (Vector Laboratories, Burlingame, CA, USA) as the mounting medium and viewed with a Confocal Laser Microscope (Leica Microsystems). Dual staining was also carried out for LCK (B-10)/pLCK and 4G10/pLCK using differently tagged secondary antibodies (donkey anti-rabbit FITC antibody for pLCK and goat anti-mouse Cy3 antibody for 4G10/LCK (B-10) antibodies). Appropriate controls slides were always done with secondary antibodies alone.
Sequential extraction of sperm proteins
Spermatozoa (4 × 108) were treated with 2% Triton X-100 in 50 mM Tris, pH 9.0 for 1 h on a rotor torque at room temperature (RT). The spermatozoa were continuously examined for the removal of acrosome in a light microscope during the incubation. Subsequent to it, the spermatozoa were spun at 20,817 g for 10 min. The supernatant was labeled as ‘Triton supernatant’. The pellet was washed twice with 50 mM Tris pH 9.0 and used as the Triton-insoluble fraction. Both, the Triton-soluble and -insoluble fractions were analyzed for LCK presence by immunoblotting.
For sequential extraction of sperm mitochondria, the spermatozoa (4 × 108) were treated with 2% Triton X-100 in 50 mM Tris, pH 9.0 for 1 h on a rotor torque at room temperature (RT). The spermatozoa were continuously
examined for the removal of acrosome in a light microscope during the incubation. Subsequent to it, the sperms were spun at 20,817 g for 10 min. The supernatant was labeled as ‘Triton supernatant’. The pellet was washed twice with 50 mM pH 9.0 and then treated with 5 mM DTT in 50 mM Tris pH 9.0 with 2% Triton X-100 at RT in a rotor torque for 1 h. The suspension was centrifuged again at 20,817 g for 10 min, and the supernatant was labeled as ‘DTT supernatant’. The DTT supernatant contains the mitochondrial proteins. The proteins were precipitated with 100% ice-cold acetone.
To confirm the localization of LCK in the mitochondria, sperm mitochondria were purified using the Pierce’s Mitochondria Isolation Kit. Then, 4 × 108 spermatozoa were picked and washed with TBS and collected at 2655 g. The pellet was used for isolation of mitochondria by using Pierce’s Mitochondria Isolation Kit from Mammalian cell (#89874) as per manufacturer’s protocol and then was used for immunoblotting.
Co-immunoprecipitation experiments
Uncapacitated (0 h) hamster spermatozoa were washed with TBS and were lysed in 300 µL fresh RIPA (150 mM NaCl, 25 mM Tris and 0.1% SDS) lysis buffer. This method is known to be efficient in solubilizing tyrosine-phosphorylated proteins (Ficarro et al. 2003). The samples were then centrifuged at 20,817 g for 10 min, and supernatants were subjected to immunoprecipitation using anti-LCK antibody (1 µg). After overnight incubation, 40 µL (0.5 mL agarose/2.0 mL) of protein-A/G plus agarose beads were then added to the samples and were kept on rotor at 4°C for 4 h. The beads were washed for 5 times with lysis buffer at 1000 g and later boiled in a non-reducing Laemmli buffer (50 mM Tris, pH 6.8, 2% SDS, 10% glycerol, and 0.01% bromophenol blue) for 5 min. Non-reducing conditions (without β-mercaptoethanol) were used to avoid the masking of 56 kDa dihydrolipoamide dehydrogenase (DLD) by the 55 kDa IgG heavy chain. The supernatants were separated on 10% SDS-PAGE and analyzed by immunoblotting using anti-DLD antiserum (1:1000, 1 h at RT). Experiments using mouse IgG (1 µg) were performed as controls.
Assessment of motility and hyperactivation in hamster spermatozoa
Hyperactivation of hamster spermatozoa was assessed using CASA according to the criteria described earlier (Mitra & Shivaji 2004, Panneerdoss et al. 2012). Spermatozoa were categorized as hyperactivated based on the kinematic parameters such as curvilinear velocity (VCL), linearity (LIN) and amplitude of lateral head (ALH) displacement. Spermatozoa with data points ≥15, VCL >300 µm/s, LIN <40% and ALH >12 µm were sorted as hyperactivated (those exhibiting either circular or helical motility pattern) (Odet et al. 2008) and the others were sorted as non-hyperactivated spermatozoa (exhibiting planar motility pattern). The set up values of the CASA were as follows: frames acquired, 50; frame rate (Hz), 60; minimum contrast, 25; minimum cell size (pixels), 3; low average path velocity (VAP) cut off (µm/s), 7.5; medium VAP cut off (µm/s), 12.5; low straight line velocity (VSL) cut off (µm/s), 5; static
Downloaded from Bioscientifica.com at 02/14/2022 06:46:45PMvia free access
SRC family kinases and hamster sperm capacitation 659
head intensity limits, 0.2–1.47; static head-size limits, 0.12–7.37; static elongation limits, 1–98; magnification, 1.43 (4×); video frequency (Hz), 60; bright field, off; slide temperature, 37°C; field selection mode, manual. Motility was assessed for control and LCK inhibitor-treated spermatozoa at different time points during capacitation.
Assessment of acrosome reaction
Spermatozoa were in vitro capacitated and a minimum of 100 viable spermatozoa were scored for acrosome reaction every hour from the 3 h time point. Prior to scoring, the spermatozoa were stained with eosin (0.25% in medium) and then observed for the presence or absence of the acrosome in eosin-negative spermatozoa using a phase contrast microscope (Leitz Messetechnik, Wetzlar, Germany) with a 40× objective (Kulanand & Shivaji 2001, Panneerdoss et al. 2012). The results are expressed as percentage of acrosome-reacted spermatozoa. Each experiment included at least 3 animals.
Superovulation, oocyte collection and in vitro fertilization
Two-month-old cyclic female hamsters were used in this experiment. On day 1 of the estrous cycle (confirmed by postovulatory discharge), before 10:00 h, ovarian hyperstimulation was induced by intra-peritoneal injection of 10 IU equine chorionic gonadotrophin (eCG-Folligon; Intervet, Boxmeer, The Netherlands) and ovulation was induced by 10 IU human chorionic gonadotrophin (hCG-Chorulon; Intervet, Boxmeer, The Netherlands) injected between 48 and 56 h after eCG injection (intra-peritoneal) (Bavister 1989). Animals were anesthetized at 17 ± 1 h after hCG injection. Oviducts were collected in a 35 mm dish (Nunc) containing 1 mL TALP-PVA medium. The cumulus-oocyte complexes (COCs) were collected by gently teasing the ampulla region of the oviducts, and the COC mass was digested using hyaluronidase (1 mg/mL) and the cumulus-free zona intact oocytes were washed three times in TALP-PVA medium and incubated at 37°C in 5% CO2, under mineral oil (embryo-tested, Sigma), until being used for IVF.
Freshly collected oocytes (metaphase II-arrested, 10 oocytes per drop) were placed in a 100 µL fertilization drop of TALP-PVA medium under mineral oil and an aliquot of spermatozoa (3–4 µL) (final count of 10,000–20,000 spermatozoa) previously capacitated for 3 h (both control and LCK inhibited spermatozoa) was added. Co-incubation was carried out at 37°C in 5% CO2 under mineral oil to prevent evaporation and pH changes for at least 3 h. In all in vitro fertilization (IVF) experiments, spermatozoa were capacitated for 3 h under various conditions as indicated and then used for IVF as in preliminary experiments, it was established that in hamster spermatozoa, capacitation (as judged by the occurrence of acrosome reaction) begins at 3 h and reaches a peak by 5 h.
After 3 h of co-incubation, the oocytes were washed in TALP-PVA medium to remove excess of bound spermatozoa, stained with Hoechst 33342 (30 µg/mL, Sigma), and their fertilization status was confirmed in the Axiovert microscope (Carl Zeiss), 40× objective. The various cellular events monitored included meiotic plate reorganization, second polar body release and
formation of both pronuclei. Only those oocytes that showed both 2nd polar body release and pronuclei formation were scored as ‘fertilized’. A total of 20–30 oocytes from at least 3 different females each were used for each determination. All experiments were repeated at least 3 times using spermatozoa from different males. All experiments were carried out along with DMSO controls.
LC–MS/MS analysis
The anti-LCK antibody pull-down samples (for DLD detection) and total sperm lysate (for LCK detection) were resolved on a SDS-PAGE and processed for in-gel digestion according to Shevchenko and coworkers (Shevchenko et al. 2006). The protein bands were manually excised, destained and then processed for trypsin digestion after dehydration. Trypsin-digested peptides were analyzed using nanoflow LC–MS analysis in the Orbitrap Nano analyzer (Thermo). The obtained MS/MS peak list were analyzed using SEQUEST (Thermo proteome Discoverer 1.1 version 1.1.0.263; Thermo Fisher Scientific) search engine against the Mesocricetus auratus UniProt database (whatever available) with a mass tolerance of 10 ppm for the precursor ions and 0.2 Da for fragment ions.
Statistical analysis
The Mann–Whitney U test was performed to analyze the results statistically using the software Graph Pad, Prism, version 3.02. The P < 0.05 were considered significant.
Results
Evidence for the presence of SRC family kinases in hamster spermatozoa
Phospho-antibody array analysis of hamster spermatozoa at the beginning of capacitation revealed constitutively activated SFKs, as inferred from the intensity of the signal of the array spots (Fig. 1A). Capacitated hamster spermatozoa showed expression pattern similar to the uncapacitated one (Supplementary Fig. 1). Among the other members, a high abundance (92.1% of positive controls) of phosphorylated form of LCK (pLCK, Y394) (Fig. 1A) was observed. The activated forms of other members of the SRC family kinases were also present, albeit less. The same analysis done with human spermatozoa revealed higher abundance of activated pSRC (Y418) (90.1% of positive controls) and pYES (Y426) (68.6% of positive controls) tyrosine kinases (Fig. 1B). pLCK revealed only 21.9% signal in human spermatozoa revealing species-specific preference for different SFK members.
Confirmation of the presence of LCK in hamster testis and spermatozoa of various species
At transcript level
Using Lck-specific primers (LCKF2 and LCKR2), 278 bp amplicon of the Lck cDNA was amplified from hamster
Downloaded from Bioscientifica.com at 02/14/2022 06:46:45PMvia free access
testis and other somatic tissues (Fig. 2A). The full-length cDNA of 1530 bp corresponding to 509 amino acids in LCK protein (Fig. 2B) was also PCR amplified from the testis following RT (using nested primers mentioned in Supplementary Table 1 and Supplementary Fig. 2A). Full-length cDNA sequence is shown in Supplementary Fig. 2B. The Lck cDNA sequence was submitted to GenBank and has been assigned the accession no. JN987875. The sequence showed high homology with other species at both cDNA and derived amino acid sequence levels (Supplementary Table 2 and Supplementary Fig. 3). In addition, all the conserved domains of the LCK were found to be present in the derived amino acid sequence (Supplementary Fig. 3).
At protein level
The presence of LCK in the spermatozoa was confirmed by immunoblot analysis using antibodies specific to LCK. LCK at the expected size of 56 kDa was detected in cauda epididymal sperm, cauda epididymis, caput epididymis, testis and liver of hamster (Fig. 2D) and in the spermatozoa of hamster, mouse, rat and human
(Fig. 2C). Immunocytochemical analysis also revealed the localization of LCK primarily in the acrosome (white arrow) and mid-piece (asterisk) region of the sperm tail in the various species studied (Fig. 2E). The human spermatozoa showed an additional staining in the post-acrosomal head. The corresponding IgG controls failed to pick any signal and are shown in the lower panels (Fig. 2E).
LCK was also identified by the LC–MS/MS analysis of the hamster sperm mitochondrial proteome (3 peptides – QGIMSPDAFLAEANLMK, IADFGLAR, SDVWSFGILLTEIVTHGR), albeit with medium (for the 1st peptide) and low (for the 2nd and 3rd peptide) confidence (Supplementary Table 3 and Supplementary Fig. 4).
Subcellular localization of LCK in hamster spermatozoa
Solubilization of hamster spermatozoa with Triton X-100 revealed the presence of LCK in both Triton-soluble (Fig. 2F, lane 2) and Triton-insoluble fractions (Fig. 2F, lane 3). Whole hamster sperm lysate was used as the positive control for LCK presence (Fig. 2F, lane 1). Triton solubilization suggested a membranic/acrosomal localization of LCK. This is in accordance with the immunocytochemical localization of LCK in the acrosome (Fig. 2E).
The presence of LCK in the Triton-insoluble pellet suggested its association with the axoneme, mitochondria, fibrous sheath or ODFs. However, the mid-piece localization of LCK prompted us to see if this protein had mitochondrial localization. Thus, spermatozoa were treated sequentially with Triton X-100 and 5 mM DTT (as described in ‘Materials and methods’ section) to solubilize the mitochondria, and LCK was detected in these extracts (Fig. 2G, lane 2). The presence of succinate dehydrogenase was used as a mitochondrial marker. Mitochondrial preparation further confirmed the presence of LCK in the mitochondria (Fig. 2G, lane 3). The cytosolic marker GAPDH failed to give a signal in the Triton + DTT sample (Fig. 2G, lane 2) and the mitoprep sample (Fig. 2G, lane 3), confirming that the mitoprep was a pure prep without cytosolic contamination. GAPDH band was seen in the whole cell lysate (Fig. 2G, lane 1).
Increase in phosphorylation of LCK during hamster capacitation
LCK, although constitutively active at the beginning of capacitation (Fig. 1A), showed a further increase in phosphorylation as capacitation progressed (until 5 h) (Fig. 3A and A′). However, at the same time, LCK protein levels did not change during capacitation as seen by immunoblot analysis (Fig. 3B and B′), indicating that LCK undergoes capacitation-dependent increase in phosphorylation. A few more proteins in the region
90.1
46.3
21.9 20.8
68.6
17.7
43.9
0
20
40
60
80
100
SRC LYN LCK FYN YES FGR HCK
Human phosphokinase
Rel
ativ
e ph
osph
opro
tein
expr
essi
on (%
of p
ositi
ve c
ontr
ol)
35.944.0
92.1
32.7 34.345.0
33.2
0
20
40
60
80
100
SRC LYN LCK FYN YES FGR HCK
Hamster phosphokinase
Rel
ativ
e ph
osph
opro
tein
expr
essi
on (%
of p
ositi
ve c
ontr
ol) A
B
Figure 1 Histogram for phospho-antibody array analysis showing relative expression of SRC family kinases (SRC, LYN, LCK, FYN, YES, FGR, HCK) in uncapacitated hamster (A) and human (B) spermatozoa.
Downloaded from Bioscientifica.com at 02/14/2022 06:46:45PMvia free access
Figure 2 (A) Tissue -specific expression of Lck analyzed by RT-PCR using total RNA from the liver (Lane 1), spleen (Lane 2), cauda epididymis (Lane 3) and testis (Lane 4) of hamster . Amplification of Gapdh served as a positive control for RT-PCR (514 bp). (B) Lck was amplified full length using nested primers F1/R2, F2/R2, F4/R4 and F3/R4. (C) Immunoblot analysis performed on proteins from human (lane 1), rat (lane 2), mouse (lane 3) and hamster (lane 4) spermatozoa using anti-LCK (B-10) antibody. (D) Tissue -specific expression of LCK protein at 56 kDa as analyzed by immunoblotting using total protein from the caput (lane 1), caput sperm (lane 2), cauda (lane 3), cauda sperm (lane 4), testis (lane 5) and liver (lane 6) of hamster using anti-LCK (B-10) antibody. The corresponding α-tubulin blot is shown. (E) Immunofluorescent localization of LCK in mouse, human and hamster spermatozoa using the anti-LCK (B-10) antibody. Localization is seen predominantly in the acrosome (white arrow) and mid-piece region (asterisk) of the tail in the uncapacitated spermatozoa (upper panels). Magnification used was 400×, bar = 7.5 µm. The corresponding secondary controls (with mouse IgG as primary antibody) are shown in the lower panels. (F) Immununoblot analysis showing the presence of LCK protein in intact hamster spermatozoa (lane 1) and in triton X-100 soluble (lane 2) and insoluble (lane 3) fractions of hamster spermatozoa using anti-LCK (B-10) antibodies. Anti-α-tubulin antibody was used for detection of tubulin, a marker for the triton-insoluble axonemal component. (G) Immununoblot analysis showing the presence of LCK protein in Triton + DTT fraction (lane 2) and purified mitochondria (lane 3). Anti-succinate dehydrogenase antibody was used as the mitochondrial marker and Anti-GAPDH was used as a cytosolic marker (lane 1).
Downloaded from Bioscientifica.com at 02/14/2022 06:46:45PMvia free access
of 50–60 kDa also showed increase in phosphorylation during capacitation (Fig. 3A, double asterisk), as also seen in the array (Fig. 1).
Immunofluorescence studies confirmed the increase in pLCK (Y394) signal in the sperm mid-piece as capacitation progressed (0, 3 and 5 h) (Fig. 4A, asterisk). However, no such increase in LCK signal (Fig. 4B) was seen with the progress of capacitation. Further, confocal studies indicated that LCK and pLCK co-localized in the mid-piece region (Fig. 4C) of the capacitated spermatozoa (5 h). Staining with pLCK antibodies was very strongly seen in the principal piece as well, and it increased with capacitation. The pLCK co-localized with the phosphotyrosine proteins in the principal piece of the spermatozoa (Supplementary Fig. 5).
Inhibition of LCK during capacitation affects tyrosine phosphorylation
To ascertain the role of LCK in sperm capacitation, LCK was inhibited using LCK-specific inhibitor (sc-204052) at 1, 50 and 1000 nM concentrations during capacitation. The LCK protein spot was detected at a pI of ~5 using the anti-LCK antibody and the peptide inhibition experiment (synthetic peptide derived from within residues 200–300 of human LCK was used) (Supplementary Fig. 6A). The protein spot was confirmed by using the anti-pLCK (Y394), anti-phosphotyrosine (4G10) and anti-pSRC (Y418) antibodies (Supplementary Fig. 6B).
Inhibition of LCK by the inhibitor was first confirmed using 2-D immunoblot analysis with anti-pLCK antibodies (Fig. 5A, encircled). Results indicated that autophosphorylation of LCK at Y394 was inhibited in a dose-dependent manner. Using anti-phosphotyrosine (4G10) antibodies, it was found that upon LCK inhibition, there was a simultaneous downregulation of tyrosine phosphorylation of several proteins in the spermatozoa during capacitation (Supplementary Fig. 6B). Tyrosine phosphorylation of a group of proteins in the molecular-weight (Mr) regions between 43 and 67 kDa and 67 and
94 kDa was most affected, suggesting that many of these proteins are likely substrates of LCK. Several of these tyrosine-phosphorylated proteins have been identified in our laboratory earlier (Kota et al. 2009). Further bioinformatics analysis of these previously identified proteins carried out using the PhosphoMotif Finder (http://www.hprd.org/PhosphoMotif_Finder (Keshava Prasad et al. 2009)) revealed that, seven of them appeared as potential substrates of SFKs (Table 1). Furthermore, three of these seven proteins were in the 4–7 pI range and have been marked as pY1, pY2, pY3 (white triangles in Fig. 5B) corresponding to tubulin, alpha 3 succinate-coenzyme A ligase, ADP-forming, beta subunit and succinate dehydrogenase. The remaining four, namely, glycerol kinase 2, A-kinase anchoring protein 4, DLD and glutathione S-transferase, mu 5; have not been depicted in the 2-D immunoblot, either because of a different pI or Mr range.
To validate the information obtained using PhosphoMotif Finder on DLD being a substrate of LCK, co-immunoprecipitation of LCK with DLD was attempted. We did an anti-LCK pull-down and probed with anti-DLD antiserum (Fig. 5C). DLD was detected in the whole sperm lysate (Fig. 5C, lane 1) and anti-LCK pull-down (Fig. 5C, lane 4) but not in the control IgG pull-down (Fig. 5C, lane 2). DLD under these non-reducing conditions still migrates at 56 kDa (Supplementary Fig. 7). This was further supported by the LC-MS/MS data for the IP samples where DLD was identified as an interacting partner of LCK. It was identified by a single peptide (ADGSSQVIGTK) against the Mesocricetus auratus database from UniProt (www.uniprot.org/) with high peptide confidence (data not shown).
Inhibition of LCK does not affect sperm hyperactivation and acrosome reaction
Effect of LCK inhibition on sperm motility was seen only on straight line velocity (VSL) and its derived parameters straightness (STR) and linearity (LIN) (Fig. 6A,
Figure 3 Immunoblot analysis of pLCK (A) and LCK (B) of hamster spermatozoa at different time points (0 h (lane 1), 1 h (lane 2), 3 h (lane 3) and 5 h (lane 4)) during capacitation. A′ and B′ represent the ratio of the intensities of pLCK and LCK with respect to the intensity of α-tubulin.
0 h 1 h 3 h 5 h
pLCK
α-tubulin
A
LCK
α-tubulin
B
**
B’
0
0.5
1
1.5
2
0 1 3 5Rat
io (p
LCK
/α-tu
bulin
)
Time (h)
0
0.4
0.8
1.2
1.6
0 1 3 5
Rat
io (L
CK
/α-tu
bulin
)
Time (h)
**
*A’
0 h 1 h 3 h 5 h
Downloaded from Bioscientifica.com at 02/14/2022 06:46:45PMvia free access
B and C), suggesting an effect on the progression of the spermatozoa. Hyperactivation as judged by curvilinear velocity (VCL) and amplitude of lateral head (ALH) displacement were not affected (Supplementary Fig. 8A and B). No effects were seen on the acrosome reaction (Fig. 7A).
Inhibition of LCK reduces fertilization in vitro
LCK inhibition (using 50 nM inhibitor) revealed a decrease of percentage fertilization from 87% (in control) and 82% (in DMSO control) to 54% in LCK inhibited spermatozoa (P ≤ 0.05); suggesting an importance of this SFK member in fertilization (Fig. 7B).
Figure 4 (A) Immunofluorescent localization of pLCK in hamster spermatozoa. The pLCK localization is altered during capacitation. Magnification used was 400×, bar = 10 µm. (B) Immunofluorescent localization of LCK in hamster spermatozoa. The LCK localization does not change during capacitation. Magnification used was 400×, bar = 10 µm. (C) Co-localization of LCK (Cy3: Red) and pLCK (FITC: Green) in the mid-piece region of the capacitated hamster sperm flagella. The spermatozoa were first labelled with the anti-pLCK antibody (green) followed by the anti-LCK (B-10) antibody (red). Magnification used was 400×, Oil, bar = 10 µm.
Downloaded from Bioscientifica.com at 02/14/2022 06:46:45PMvia free access
In the present study, we provide evidence for the presence of LCK, the lymphocyte-specific SFK member in the spermatozoa of Syrian hamster. Spermatozoa from different species appear to have preference for different SFK members, and these kinases also demonstrate different cellular localizations and functions in different species. Human spermatozoa predominantly reveal the presence of SRC and YES (Lawson et al. 2008, Varano et al. 2008), mouse shows the presence of SRC, LYN and HCK (Baker et al. 2006, Goupil et al. 2011), porcine has LYN and YES (Bragado et al. 2012) and rat has FYN, YES and SRC kinases (Zhao et al. 1990, Kierszenbaum et al. 2009). These varied observations necessitated studies in other species as well to appreciate the role of the SFKs in the male gamete. Accordingly, we anticipated a functional role of SFKs in the hamster spermatozoa as well and used the phospho-antibody
array for identifying the active SFKs in this species. Presence of high levels of constitutively active LCK was found in the hamster spermatozoa. Occurrence of SFK of hematopoietic lineage in spermatozoa was intriguing. In human spermatozoa, the array revealed high levels of phosphorylated SRC and YES substantiating the earlier reports (Leclerc & Goupil 2002, Lawson et al. 2008, Mitchell et al. 2008, Varano et al. 2008).
The presence of LCK (mRNA and protein) in hamster testis and spermatozoa is a novel finding. In fact, Goupil and coworkers (Goupil et al. 2011) demonstrated the presence of Lck transcript in adult mouse testis as compared to juvenile ones and showed that relative abundance of this SFK member in elongated spermatids was relatively higher than any other SFK, supporting the likely presence of LCK protein in the male gamete. SFK members have been reported from several species and found to have varied localizations. Localization of
Figure 5 (A) Immunoblot analysis of pLCK in hamster sperm capacitated in the presence of LCK specific inhibitor (DMSO control, 1, 50 and 1000 nM) using the anti-pLCK antibodies. Proteins were subjected to 2D-PAGE and immunoblot analysis with the anti-pLCK antibody. The pLCK spots (encircled) are apparent in the blots and the phosphorylation decreased with increasing inhibitor concentration. (B) 2-D Immunoblot analysis of hamster sperm proteins by immunoblotting using anti-phosphotyroisne antibody (4G10). The spermatozoa were capacitated in the presence of LCK specific inhibitor (control-DMSO, 1, 50 and 1000 nM) for 5 h. The boxed regions indicate the most affected tyrosine phosphorylated proteins. White triangles indicate those proteins which have been identified as potential SFK substrates by PhosphoMotif Finder. The pLCK spot is encircled. In studies using the LCK inhibitor, DMSO was used as the solvent control. (C) Co-immunoprecipitation of DLD with LCK in uncapacitated sperm lysates. Anti-DLD antiserum was used for probing the blot and anti-LCK antibody was used for a pull-down. The samples run were lane 1- 0 h control sperm lysate as positive control for DLD, lane 2- control IgG pull down, lane 3- empty lane and lane 4- anti-LCK antibody pulldown. DLD was detected in the LCK pull down sample (lane 4).
8 5
8 5
8 5
8 51 nM
50 nM 1000 nM
DMSO
A
CControl
IgGAnti-LCK pulldown
DLDIgG-H
DMSO 1 nM
50 nM 1000 nM
7 4 7 4
7 4 7 4
pY1/HY10
pY3/HY21
pY2/HY06
94 kDa
67 kDa
43 kDa
30 kDa
B
pLCK
pLCKpLCK
pLCKpY4/HY11
0 hcontrol
Empty lane
Downloaded from Bioscientifica.com at 02/14/2022 06:46:45PMvia free access
SRC family kinases and hamster sperm capacitation 665
LCK in hamster spermatozoa was seen in the acrosome and mid-piece of the flagellum. Spermatozoa from other species also show similar localization of various other SFKs. For instance, YES in human and LYN in mouse show acrosomal localization (Leclerc & Goupil 2002, Bragado et al. 2012), SRC in human and mouse spermatozoa shows mid-piece localization (Lawson et al. 2008, Varano et al. 2008, Krapf et al. 2010), whereas YES
was seen in the mid-piece in the human spermatozoa (Leclerc & Goupil 2002).
Presence of LCK in the Triton-soluble and -insoluble fractions indicates an association of LCK with sperm membranes (acrosomal and plasma membrane) as well as mitochondrial/cytoskeletal fractions of spermatozoa (axoneme, outer dense fibers (ODF) or fibrous sheath). It is interesting that although we see the localization
Table 1 List of proteins identified as potential LCK/SFK substrates using PhosphoMotif Finder in the hamster spermatozoa.
Spot codea Protein name Accession numberb
PhosphoMotif Finder output
Position in query protein
Sequence in query protein
Corresponding motif predicted in the substrate protein
pY7 (HY12) Glutathione S-transferase, mu 5 (GSTM5)
gi|6754086 4–9 LGYWDI [I/V/L/S]XpYXX[L/I]
101–106 LTYDVL I/V/L/S]XpYXX[L/I]
aSpot code as per Fig. 7A (spot code as per the earlier lab reference Kota et al. 2009); bAccession numbers are for mouse sp. and are from the NCBI database.
Figure 6 Effect of LCK inhibition with LCK specific inhibitor (1 nM, 50 nM, 1000 nM) on (A) VSL, (B) STR and (C) LIN of hamster spermatozoa. Untreated spermatozoa served as a control and DMSO treated spermatozoa served as solvent control. Values represent mean ± s.d. Values with the same superscript (*) are significantly different at P < 0.05.
40
80
120
160
200
1 2 3 4 5
VSL
(µm
/s)
Time (h)
Control
DMSO
1 nM
50 nM
1000 nM
A
0
40
80
120
1 2 3 4 5
STR
(%)
Time (h)
ControlDMSO1 nM50 nM1000 nM
0
40
80
120
1 2 3 4 5
LIN
(%)
Time (h)
ControlDMSO1 nM50 nM1000 nM
*
**
*
**
B
C
Downloaded from Bioscientifica.com at 02/14/2022 06:46:45PMvia free access
of LCK primarily in the acrosome and mid-piece; the phosphorylated form is seen in the mid- and the principal piece. This additional principal piece localization seen with anti-pLCK antibodies (Fig. 4A) could be due to other phosphorylated SFKs. The Y394 residue of LCK, which also denotes its activity is conserved among the other SFKs as well (Supplementary Fig. 6C). The evidence for this comes from the presence of additional bands seen in the immunoblot analysis with pLCK antibodies (Fig. 3A, double asterisk) and the immunolocalization seen with pSRC antibodies in the principal piece besides the mid-piece (data not shown). The mid-piece localization of LCK in the spermatozoa appears to be a mitochondrial localization for LCK, especially when SFKs have been reported to be localized in the mitochondria in somatic cells (Tibaldi et al. 2011). This observation though preliminary is interesting, and needs investigation on the possible role of LCK in sperm mitochondrial function including tyrosine phosphorylation.
We used an inhibitor of LCK (sc-204052) to elucidate the role of LCK in sperm capacitation. LCK inhibitor and for that matter the most common SFK inhibitors,
PP1 & PP2 (Shah et al. 2002, Shahar et al. 2011), although seem to primarily target LCK, inhibition of other SFK members cannot be completely ruled out. We thus, consider it appropriate to interpret the results obtained with LCK inhibitor, as effects seen by inhibition of the SFK family as a whole.
The role of LCK/SFKs in mediating capacitation-associated tyrosine phosphorylation is dependent on functionally active forms which depends on their auto-phosphorylation at specific tyrosine (‘Y’) residues ((Supplementary Figs 3 and 6C, Boxed Y (Y394) in LCK)) (Amini et al. 1986, Cartwright et al. 1989, Katagiri et al. 1989, Bagrodia et al. 1993, Mustelin & Burn 1993, Boerner et al. 1996, Kralisz & Cierniewski 2000). Phospho-antibody array revealed the presence of such active SFK members in the hamster spermatozoa. Moreover, LCK/SFKs phosphorylation was also positively correlated with capacitation, indicating the functional involvement of LCK/SFKs in this process. Bragado and coworkers (Bragado et al. 2012) too indicated two proteins of the same size as LCK (which they denote as SFK1 and SFK2), which showed increased phosphorylation during porcine sperm capacitation. It is likely that one of these is LCK.
Roles of SFKs in regulating tyrosine phosphorylation in spermatozoa during capacitation has been well studied in human and mouse spermatozoa (Baker et al. 2006, Mitchell et al. 2008, Varano et al. 2008). In hamster spermatozoa too, LCK/SFKs emerge as a key tyrosine kinase(s) regulating tyrosine phosphorylation, as seen by 2-D tyrosine phosphoproteome. The co-localization of pLCK/SFKs with the tyrosine-phosphorylated proteins in the fibrous sheath (Supplementary Fig. 5) further corroborates the role of LCK/SFKs as the key tyrosine kinase(s) in hamster spermatozoa. Downregulation of Ser/Thr phosphatases by SFKs and activation of bicarbonate-dependent protein kinase A (PKA) has been found to be crucial for achieving human and mouse sperm capacitation. Battistone and coworkers (Battistone et al. 2013) mentioned that although the main signaling pathways involved in sperm capacitation is evolutionary conserved, the SFK members and Ser/Thr phosphatases involved in sperm capacitation are probably different in mouse and human, revealing the species specificity of the molecular mechanisms underlying this key sperm phenomenon. In light of these observations, it would be important to study in further details the regulation of tyrosine phosphorylation by SFKs in the hamster species as well.
Of the various tyrosine-phosphorylated proteins identified in hamster spermatozoa during capacitation (Kota et al. 2009), several spots showed reduced phosphorylation upon LCK/SFK inhibition. Using PhosphoMotifTM Finder (we used the proteins sequences from mouse database, since the hamster protein data base is limited), seven of these proteins were predicted to be SRC kinase substrates based on available
Figure 7 Effect of LCK inhibition with LCK specific inhibitor on (A) acrosome reaction (DMSO control, 1, 50 and 1000 nM) and (B) IVF outcomes (50 nM inhibitor). Values represents mean ± s.d. Untreated spermatozoa served as a control and DMSO treated spermatozoa served as solvent control. Statistical significance was seen at P ≤ 0.05.
Downloaded from Bioscientifica.com at 02/14/2022 06:46:45PMvia free access
literature. Some of these substrates namely succinate dehydrogenase (Salvi et al. 2007, Ogura et al. 2012) and AKAP4 (Baker et al. 2006) and tubulin (Matten et al. 1990, Cox & Maness 1993, Talmor-Cohen et al. 2004) have been reported to be SRC family substrates. Of these, we confirmed DLD to be a likely substrate of SRC family kinases, as it co-immunoprecpitated with LCK. From our laboratory, DLD has been shown to undergo capacitation-dependent tyrosine phosphorylation in hamster spermatozoa (Mitra & Shivaji 2004). NetPhos 2.0 (http://www.cbs.dtu.dk/services/NetPhos/) analysis revealed high score for the tyrosine residue Y81 (NNSHYYHLA 0.580 *Y*); suggesting this residue to be a potential tyrosine residue undergoing phosphorylation. Phosphomotif analyzer too shows the same motif as the putative substrate for SRC family kinases (79‘SHYYHL’84) (Table 1).
In summary, we demonstrate for the first time the presence of LCK, a SFK of hematopoietic lineage in the spermatozoa. LCK/SFKs represent one of the key tyrosine kinases regulating tyrosine phosphorylation during hamster sperm capacitation. It is imperative to carry out further studies to understand how LCK/SFKs contribute to signaling in the male gamete and eventually sperm function.
Supplementary data
This is linked to the online version of the paper at http://dx.doi.org/10.1530/REP-16-0591.
Declaration of interest
The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.
Funding
The study was supported by a research grant from the CSIR (Council of Scientific & Industrial Research) Network Project (PROGRAM; BSC0101), Government of India.
Acknowledgements
Durgesh Kumar Singh and Rohit Kumar Deshmukh thank the Council of Scientific and Industrial Research (CSIR) for their fellowships.
ReferencesAitken RJ, Fisher HM, Fulton N, Gomez E, Knox W, Lewis B & Irvine S
1997 Reactive oxygen species generation by human spermatozoa is induced by exogenous 29 NADPH and inhibited by the flavoprotein inhibitors diphenylene iodonium and quinacrine. Molecular Reproduction and Development 47 468–482. (doi:10.1002/(SICI)1098-2795(199708)47:4<468::AID-MRD14>3.0.CO;2-S)
Alvau A, Battistone MA, Gervasi MG, Navarrete FA, Xu X, Sanchez-Cardenas C, De la Vega-Beltran JL, Da Ros VG, Greer PA & Darszon A 2016 The tyrosine kinase FER is responsible for the capacitation-associated increase in tyrosine phosphorylation in murine sperm. Development 143 2325–2333. (doi:10.1242/dev.136499.)
Amini S, Lewis AM Jr, Israel MA, Butel JS & Bolen JB 1986 Analysis of pp60c-src protein kinase activity in hamster embryo cells transformed by simian virus 40, human adenoviruses, and bovine papillomavirus 1. Journal of Virology 57 357–361.
Arcelay E, Salicioni AM, Wertheimer E & Visconti PE 2008 Identification of proteins undergoing tyrosine phosphorylation during mouse sperm capacitation. International Journal of Developmental Biology 52 463–472. (doi:10.1387/ijdb.072555ea)
Austin CR 1952 The capacitation of mammalian spermatozoa. Nature 170 326. (doi:10.1038/170326a0)
Bagrodia S, Taylor SJ & Shalloway D 1993 Myristoylation is required for Tyr-527 dephosphorylation and activation of pp60c-src in mitosis. Molecular and Cellular Biology 13 1464–1470. (doi:10.1128/MCB.13.3.1464)
Baker MA, Hetherington L & Aitken RJ 2006 Identification of SRC as a key PKA-stimulated tyrosine kinase involved in the capacitation-associated hyperactivation of murine spermatozoa. Journal of Cell Science 119 3182–3192. (doi:10.1242/jcs.03055)
Battistone MA, Da Ros VG, Salicioni AM, Navarrete FA, Krapf D, Visconti PE & Cuasnicu PS 2013 Functional human sperm capacitation requires both bicarbonate-dependent PKA activation and down-regulation of Ser/Thr phosphatases by Src family kinases. Molecular Human Reproduction 19 570–580. (doi:10.1093/molehr/gat033)
Bavister BD 1989 A consistently successful procedure for in vitro fertilization of golden hamster eggs. Gamete Research 23 139–158. (doi:10.1002/mrd.1120230202)
Boerner RJ, Kassel DB, Barker SC, Ellis B, DeLacy P & Knight WB 1996 Correlation of the phosphorylation states of pp60c-src with tyrosine kinase activity: the intramolecular pY530-SH2 complex retains significant activity if Y419 is phosphorylated. Biochemistry 35 9519–25. (doi:10.1021/bi960248u)
Bragado MJ, Gil MC, Martin-Hidalgo D, Hurtado de Llera A, Bravo N, Moreno AD & Garcia-Marin LJ 2012 Src family tyrosine kinase regulates acrosome reaction but not motility in porcine spermatozoa. Reproduction 144 67–75. (doi:10.1530/REP-11-0075)
Cartwright CA, Kamps MP, Meisler AI, Pipas JM & Eckhart W 1989 pp60c-src activation in human colon carcinoma. Journal of Clinical Investigation 83 2025–2033. (doi:10.1172/JCI114113)
Chang MC 1951 Fertilizing capacity of spermatozoa deposited into the fallopian tubes. Nature 168 697–698. (doi:10.1038/168697b0)
Cox ME & Maness PF 1993 Tyrosine phosphorylation of alpha-tubulin is an early response to NGF and pp60v-src in PC12 cells. Journal of Molecular Neuroscience 4 63–72. (doi:10.1007/BF02782119)
Cross NL 1998 Role of cholesterol in sperm capacitation. Biology of Reproduction 79 7–11. (doi:10.1095/biolreprod59.1.7)
Davis BK, Byrne R & Bedigian K 1980 Studies on the mechanism of capacitation: albumin-mediated changes in plasma membrane lipids during in vitro incubation of rat sperm cells. PNAS 77 1546–1550. (doi:10.1073/pnas.77.3.1546)
Deharvengt S, Marmarelis M & Korc M 2012 Concomitant targeting of EGF receptor, TGF-beta and Src points to a novel therapeutic approach in pancreatic cancer. PLoS ONE 7 e39684. (doi:10.1371/journal.pone.0039684)
Dow MP & Bavister BD 1989 Direct contact is required between serum albumin and hamster spermatozoa for capacitation in vitro. Gamete Research 23 171–80. (doi:10.1002/mrd.1120230204)
Ficarro S, Chertihin O, Westbrook VA, White F, Jayes F, Kalab P, Marto JA, Shabanowitz J, Herr JC, Hunt DF et al. 2003 Phosphoproteome analysis of capacitated human sperm. Evidence of tyrosine phosphorylation of a kinase-anchoring protein 3 and valosin-containing protein/p97 during capacitation. Journal of Biological Chemistry 278 11579–89. (doi:10.1074/jbc.M202325200)
Galantino-Homer HL, Florman HM, Storey BT, Dobrinski I & Kopf GS 2004 Bovine sperm capacitation: assessment of phosphodiesterase activity and intracellular alkalinization on capacitation-associated protein tyrosine phosphorylation. Molecular Reproduction and Development 67 487–500. (doi:10.1002/mrd.20034)
Goupil S, La Salle S, Trasler JM, Bordeleau LJ & Leclerc P 2011 Developmental expression of SRC-related tyrosine kinases in
Downloaded from Bioscientifica.com at 02/14/2022 06:46:45PMvia free access
the mouse testis. Journal of Andrology 32 95–110. (doi:10.2164/jandrol.110.010462)
Ickowicz D, Finkelstein M & Breitbart H 2012 Mechanism of sperm capacitation and the acrosome reaction: role of protein kinases. Asian Journal of Andrology 14 816–821. (doi:10.1038/aja.2012.81)
Kalab P, Peknicová J, Geussová G & Moos J 1998 Regulation of protein tyrosine phosphorylation in boar sperm through a cAMP-dependent pathway. Molecular Reproduction and Development 51 304–314. (doi:10.1002/(SICI)1098-2795(199811)51:3<304::AID-MRD10>3.0.CO;2-2)
Katagiri T, Ting JP, Dy R, Prokop C, Cohen P & Earp HS 1989 Tyrosine phosphorylation of a c-Src-like protein is increased in membranes of CD4K CD8K T lymphocytes from lpr/lpr mice. Molecular and Cellular Biology 9 4914–4922. (doi:10.1128/MCB.9.11.4914)
Keshava Prasad TS, Goel R, Kandasamy K, Keerthikumar S, Kumar S, Mathivanan S, Telikicherla D, Raju R, Shafreen B, Venugopal A et al. 2009 Human protein reference database-update. Nucleic Acids Research 37 D767–D772. (doi:10.1093/nar/gkn892)
Kierszenbaum AL, Rivkin E, Talmor-Cohen A, Shalgi R & Tres LL 2009 Expression of full-length and truncated Fyn tyrosine kinase transcripts and encoded proteins during spermatogenesis and localization during acrosome biogenesis and fertilization. Molecular Reproduction and Development 76 832–843. (doi:10.1002/mrd.21049)
Kinsey WH & Shen SS 2000 Role of the Fyn kinase in calcium release during fertilization of the sea urchin egg. Developmental Biology 225 253–264. (doi:10.1006/dbio.2000.9830)
Kota V, Dhople VM & Shivaji S 2009 Tyrosine phosphoproteome of hamster spermatozoa: role of glycerol-3-phosphate dehydrogenase 2 in sperm capacitation. Proteomics 9 1809–1826. (doi 10.1002/pmic.200800519)
Kralisz U & Cierniewski CS 2000 Activity of pp60c-src and association of pp60c-src, pp54/58lyn, pp60fyn, and pp72syk with the cytoskeleton in platelets activated by collagen. IUBMB Life 49 33–42. (doi:10.1080/713803580)
Krapf D, Arcelay E, Wertheimer EV, Sanjay A, Pilder SH, Salicioni AM & Visconti PE 2010 Inhibition of Ser/Thr phosphatases induces capacitation-associated signaling in the presence of Src kinase inhibitors Journal of Biological Chemistry 285 7977–7985. (doi:10.1074/jbc.M109.085845)
Krapf D, Ruan YC, Wertheimer EV, Battistone MA, Pawlak JB, Sanjay A, Pilder SH, Cuasnicu P, Breton S & Visconti PE 2012 cSrc is necessary for epididymal development and is incorporated into sperm during epididymal transit. Developmental Biology 369 43–53. (doi:10.1016/j.ydbio.2012.06.017)
Kulanand J & Shivaji S 2001 Capacitation associated changes in protein tyrosine phosphorylation, hyperactivation and acrosome reaction in hamster spermatozoa. Andrologia 33 95–104. (doi:10.1046/j.1439-0272.2001.00410.x)
Kulanand J & Shivaji S 2002 Identification of the major tyrosine phosphorylated protein of capacitated hamster spermatozoa as a homologue of mammalian sperm a kinase anchoring protein. Molecular Reproduction and Development 61 258–270. (doi:10.1002/mrd.1155)
Lalancette C, Bordeleau LJ, Faure RL & Leclerc P 2006 Bull testicular haploid germ cells express a messenger encoding for a truncated form of the protein tyrosine kinase HCK. Molecular Reproduction and Development 73 520–530. (doi:10.1002/mrd.20422)
Lamirande E & O’Flaherty C 2008 Sperm activation: role of reactive oxygen species and kinases. Biochimica et Biophysica Acta 1784 106–115. (doi:10.1016/j.bbapap.2007.08.024)
Lawson C, Goupil S & Leclerc P 2008 Increased activity of the human sperm tyrosine kinase SRC by the cAMP-dependent pathway in the presence of calcium. Biology of Reproduction 79 657–666. (doi:10.1095/biolreprod 108.070367)
Leclerc P & Goupil S 2002 Regulation of the human sperm tyrosine kinase c-yes. Activation by cyclic adenosine 3′,5′-monophosphate and inhibition by Ca(2+). Biology of Reproduction 67 301–307. (doi:10.1095/biolreprod67.1.301)
Lefièvre L, Jha KN, de Lamirande E, Visconti PE & Gagnon C 2002 Activation of protein kinase A during human sperm capacitation and acrosome reaction. Journal of Andrology 23 709–716. (doi:10.1002/j.1939-4640.2002.tb02314.x)
Luo J, Gupta V, Kern B, Tash JS, Sanchez G, Blanco G & Kinsey WH 2012 Role of FYN kinase in spermatogenesis: defects characteristic of Fyn-
null sperm in mice. Biology of Reproduction 86 1–8. (doi:10.1095/biolreprod.111.093864)
Mahony MC & Gwathmey T 1999 Protein tyrosine phosphorylation during hyperactivated motility of cynomolgus monkey (Macaca fascicularis) spermatozoa. Biology of Reproduction 60 1239–1243. (doi:10.1095/biolreprod60.5.1239)
Matten WT, Aubry M, West J & Maness PF 1990 Tubulin is phosphorylated at tyrosine by pp60c-sr3 in nerve growth cone membranes. Journal of Cell Biology 111 1959–1970. (doi:10.1083/jcb.111.5.1959)
Mitchell LA, Nixon B, Baker MA & Aitken RJ 2008 Investigation of the role of SRC in capacitation-associated tyrosine phosphorylation of human spermatozoa. Molecular Human Reproduction 14 235–243. (doi:10.1093/molehr/gan007)
Mitra K & Shivaji S 2004 Novel tyrosine-phosphorylated post-pyruvate metabolic enzyme, dihydrolipoamide dehydrogenase, involved in capacitation of hamster spermatozoa. Biology of Reproduction 70 887–899. (doi:10.1095/biolreprod.103.022780)
Mustelin T & Burn P 1993 Regulation of Src family tyrosine kinases in lymphocytes. Trends in Biochemical Sciences 18 215–220. (doi:10.1016/0968-0004(93)90192-P)
Naz RK & Rajesh PB 2004 Role of tyrosine phosphorylation in sperm capacitation/acrosome reaction. Reproductive Biology and Endocrinology 2 75. (doi:10.1186/1477-7827-2-75)
Odet F, Duan C, Willis WD, Goulding EH, Kung A, Eddy EM & Goldberg E 2008 Expression of the gene for mouse lactate dehydrogenase C (Ldhc) is required for male fertility. Biology of Reproduction 79 26–34. (doi:10.1095/biolreprod.108.068353)
Ogura M, Yamaki J, Homma MK & Homma Y 2012 Mitochondrial c-Src regulates cell survival through phosphorylation of respiratory chain components. Biochemical Journal 447 281–289. (doi:10.1042/BJ20120509)
Okada M 2012 Regulation of the SRC family kinases by Csk. International Journal of Biological Sciences 8 1385–1397. (doi:10.7150/ijbs.5141)
Olszewski U, Deally A, Tacke M & Hamilton G 2012 Alterations of phosphoproteins in NCI-H526 small cell lung cancer cells involved in cytotoxicity of cisplatin and titanocene Y. Neoplasia 14 813–822. (doi:10.1593/neo.12962)
Osheroff JE, Visconti PE, Valenzuela JP, Travis AJ, Alvarez J & Kopf GS 1999 Regulation of human sperm capacitation by a cholesterol efflux-stimulated signal transduction pathway leading to protein kinase A-mediated up-regulation of protein tyrosine Phosphorylation. Molecular Human Reproduction 5 1017–1026. (doi:10.1093/molehr/5.11.1017)
Panneerdoss S, Siva AB, Kameshwari DB, Rangaraj N & Shivaji S 2012 Association of lactate, intracellular pH, and intracellular calcium during capacitation and acrosome reaction: contribution of hamster sperm dihydrolipoamide dehydrogenase, the E3 subunit of pyruvate dehydrogenase complex. Journal of Andrology 33 699–710. (doi:10.2164/jandrol.111.013151)
Pixton KL, Deeks ED, Flesch FM, Moseley FL, Björndahl L, Ashton PR, Barratt CL & Brewis IA 2004 Sperm proteome mapping of a patient who experienced failed fertilization at IVF reveals altered expression of at least 20 proteins compared with fertile donors: case report. Human Reproduction 19 1438–1447. (doi:10.1093/humrep/deh224)
Pommer AC, Rutllant J & Meyers SA 2003 Phosphorylation of protein tyrosine residues in fresh and cryopreserved stallion spermatozoa under capacitating conditions. Biology of Reproduction 68 1208–1214. (doi:10.1095/biolreprod.102.011106)
Pukazhenthi BS, Long JA, Wildt DE, Ottinger MA, Armstrong DL & Howard J 1998 Regulation of sperm function by protein tyrosine phosphorylation in diverse wild felid species. Journal of Andrology 19 675–685. (doi:10.1002/j.1939-4640.1998.tb02077.x)
Salvi M, Morrice NA, Brunati AM & Toninello A 2007 Identification of the flavoprotein of succinate dehydrogenase and aconitase as in vitro mitochondrial substrates of Fgr tyrosine kinase. FEBS Letter 581 5579–5585. (doi.org/10.1016/j.febslet.2007.11.005)
Schaffner W & Weissmann C 1973 A rapid, sensitive, and specific method for the determination of protein in dilute solution. Analytical Biochemistry 56 502–514. (doi:10.1016/0003-2697(73)90217-0)
Schwartzberg PL, Xing L, Hoffmann O, Lowell CA, Garrett L, Boyce BF & Varmus HE 1997 Rescue of osteoclast function by transgenic expression of kinase-deficient Src in src−/− mutant mice. Genes and Development 11 2835–2844. (doi:10.1101/gad.11.21.2835)
Downloaded from Bioscientifica.com at 02/14/2022 06:46:45PMvia free access
Shah OJ, Kimball SR & Jefferson LS 2002 The Src-family tyrosine kinase inhibitor PP1 interferes with the activation of ribosomal protein S6 kinases. Biochemical Journal 366 57–62. (doi:10.1042/BJ20020198)
Shahar S, Wiser A, Ickowicz D, Lubart R, Shulman A & Breitbart H 2011 Light-mediated activation reveals a key role for protein kinase A and sarcoma protein kinase in the development of sperm hyper-activated motility. Human Reproduction 26 2274–2282. (doi:10.1093/humrep/der232)
Shevchenko A, Tomas H, Havlis J, Olsen JV & Mann M 2006 In-gel digestion for mass spectrometric characterization of proteins and proteomes. Nature Protocols 6 2856–2860. (doi:10.1038/nprot.2006.468)
Shivaji S, Kumar V, Mitra K & Jha KN 2007 Mammalian sperm capacitation: role of phosphotyrosine proteins. Society of Reproduction and Fertility Supplement 63 295–312.
Sidhu KS, Mate KE, Gunasekera T, Veal D, Hetherington L, Baker MA, Aitken R & Rodger JC 2004 A flow cytometric assay for global estimation of tyrosine phosphorylation associated with capacitation of spermatozoa from two marsupial species, the tammar wallaby (Macropus eugenii) and the brushtail possum (Trichosurus vulpecula). Reproduction 127 95–103. (doi:10.1530/rep.100073)
Talmor-Cohen A, Tomashov-Matar R, Tsai WB, Kinsey WH & Shalgi R 2004 Fyn kinase–tubulin interaction during meiosis of rat eggs. Reproduction 128 387–393. (doi:10.1530/rep.1.00266)
Tardif S, Dubé C, Chevalier S & Bailey JL 2001 Capacitation is associated with tyrosine phosphorylation and tyrosine kinase-like activity of pig sperm proteins. Biology of Reproduction 65 784–792. (doi:10.1095/biolreprod65.3.784)
Thomas SM & Brugge JS 1997 Cellular functions regulated by Src family kinases. Annual Review of Cell and Developmental Biology 13 513–609. (doi:10.1146/annurev.cellbio.13.1.513)
Tibaldi E, Venerando A, Zonta F, Bidoia C, Magrin E, Marin O, Toninello A, Bordin L, Martini V, Pagano MA et al. 2011 Interaction between the SH3 domain of Src family kinases and the proline-rich motif of HTLV-1
p13: a novel mechanism underlying delivery of Src family kinases to mitochondria. Biochemical Journal 439 505–516. (doi:10.1042/BJ20101650)
Varano G, Lombardi A, Cantini G, Forti G, Baldi E & Luconi M 2008 Src activation triggers capacitation and acrosome reaction but not motility in human spermatozoa. Human Reproduction 23 2652–2662. (doi:10.1093/humrep/den314)
Visconti PE, Galantino-Homer H, Moore GD, Bailey JL, Ning X, Fornes M & Kopf GS 1998 The molecular basis of sperm capacitation. Journal of Andrology 19 242–248. (doi:10.1002/j.1939-4640.1998.tb01994.x)
Wary KK, Mariotti A, Zurzolo C & Giancotti FG 1998 A requirement for caveolin-1 and associated kinase Fyn in integrin signaling and anchorage-dependent cell growth. Cell 94 625–634. (doi:10.1016/S0092-8674(00)81604-9)
Xiao X, Mruk DD & Cheng CY 2013 c-Yes regulates cell adhesion at the apical ectoplasmic specialization blood–testis barrier axis via its effects on protein recruitment and distribution. American Journal of Physiology: Endocrinology and Metabolism 304 E145–E159. (doi:10.1152/ajpendo.00422.2012)
Yanagimachi R 1969 In vitro capacitation of hamster spermatozoa by follicular fluid. Journal of Reproduction and Fertility 18 275–286. (doi:10.1530/jrf.0.0180275)
Zhao YH, Krueger JG & Sudol M 1990 Expression of cellular-yes protein in mammalian tissues. Oncogene 5 1629–1635.
Received 2 November 2016First decision 30 November 2016Revised manuscript received 3 February 2017Accepted 28 February 2017
Downloaded from Bioscientifica.com at 02/14/2022 06:46:45PMvia free access
