STRUCTURAL AND FUNCTIONAL STUDIES OF VP9,
A NOVEL NONSTRUCTURAL PROTEIN FROM
WHITE SPOT SYNDROME VIRUS
LIU YANG
(B.Sc., Xiamen University)
A THESIS SUBMITTED FOR
THE DEGREE OF DOCTOR OF PHILOSOPHY
DEPARTMENT OF BIOLOGICAL SCIENCES
NATIONAL UNIVERSITY OF SINGAPORE
2007
ii
Dedicated to My Family
Table of Contents
Table of Contents i
Acknowledgement viii
Abstract x
List of Figures xi
List of Tables xiii
List of Abbreviations xiv
Chapter 1 Literature Review 1
1 Introduction 2
1.1 Introduction to virus 2
1.2 Introduction to crustacean virus 4
1.3 Introduction to WSSV 5
1.3.1 Background 5
1.3.2 Structural features of WSSV 6
1.3.3 Classification of WSSV 6
1.4 Research progress of WSSV 7
1.4.1 Sequence determination and analysis 7
1.4.2 Viral proteins identification 7
1.4.2.1 Latency-related genes identification 7
1.4.2.2 Immediate-early genes identification 9
i
1.4.2.3 Structural genes identification 10
1.4.2.4 Nonstructural genes identification 11
1.5 Introduction to methodology 14
1.5.1 Protein purification techniques 14
1.5.1.1 Affinity chromatography 14
1.5.1.2 Ion exchange chromatography 15
1.5.1.3 Size exclusion chromatography 15
1.5.2 Quantitative real-time RT-PCR 16
1.5.3 X-ray crystallography 17
1.5.4 NMR spectroscopy 21
1.6 Objectives of this project 26
Chapter 2 Materials and Methods 27
2.1 Materials 28
2.1.1 Enzyme and other proteins 28
2.1.2 Kit and reagents 28
2.1.3 Media 28
2.1.3.1 LB medium 28
2.1.3.2 M9 medium 29
2.1.4 Stock solutions and buffers 29
2.1.4.1 IPTG stock solution 29
2.1.4.2 Ampicillin stock solution 29
ii
2.1.4.3 Buffers for Ni-NTA purification under
native conditions 30
2.1.5 E.coli strains
2.1.6 Plasmid for protein expression 30
2.1.7 NMR chemicals and sample tube 30
2.2 Methods 31
2.2.1 Molecular biology techniques (DNA related) 31
2.2.1.1 PCR 31
2.2.1.2 Agarose gel electrophoresis 31
2.2.1.3 PCR products purification 31
2.2.1.4 Enzyme digestion, dephosphorylation
and purification 31
2.2.1.5 Ligation and transformation 32
2.2.1.6 Positive clone screening and plasmid
preparation 32
2.2.1.7 Cycle Sequencing Reaction 33
2.2.1.8 Sequence determination 33
2.2.1.9 Transformation 34
2.2.2 Protein manipulation techniques 34
2.2.2.1 Small scale test 34
2.2.2.2 Large scale production of recombinant
protein 35
iii
2.2.2.3 SDS-PAGE 35
2.2.2.4 Cell storage 36
2.2.2.5 Production of polyclonal antibodies 36
2.2.2.6 Western blot 36
2.2.2.7 Silver staining 37
Chapter 3 Characterization of VP9 38
3.1 Introduction 39
3.2 Materials and methods 39
3.2.1 Materials 39
3.2.2 Construction of the expression plasmid 41
3.2.3 Expression and purification of VP9 41
3.2.4 Mass spectrometry analysis 42
3.2.5 Dynamic light scattering study 42
3.2.6 Circular dichroism study 43
3.3 Results 43
3.3.1 Hydrophobicity plot 43
3.3.2 Protein purification profiles of VP9 43
3.3.3 Mass spectrometry analysis 44
3.3.4 Dynamic light scattering study 44
3.3.5 Circular dichroism study 44
3.4 Discussion 52
iv
Chapter 4 Functional Studies of VP9 53
4.1 Introduction 54
4.2 Materials and methods 55
4.2.1 Materials 55
4.2.2 Shrimp infection with WSSV 55
4.2.3 WSSV purification 55
4.2.4 Real-time RT-PCR 56
4.2.4.1 RNA extraction 56
4.2.4.2 Reverse transcription 57
4.2.4.3 Real-time PCR 57
4.2.5 Localization by Western blot 58
4.2.6 Localization by immuno-electron microscopy 59
4.2.7 Pull down assay 60
4.2.7.1 Bait protein preparation 60
4.2.7.2 Prey protein preparation 61
4.2.7.3 Pull down by Ni-NTA agarose beads 61
4.3 Results and discussions 62
4.3.1 Real-time RT-PCR 62
4.3.2 Localization 63
4.3.3 Pull down assay 63
v
Chapter 5 Structural Studies of VP9 75
5.1 Introduction 76
5.2 Materials and methods 76
5.2.1 Materials 76
5.2.2 X-ray studies 77
5.2.2.1 SeMet VP9 preparation 77
5.2.2.2 Crystallization 77
5.2.2.3 Data collection 77
5.2.3 NMR studies 78
5.2.3.1 Sample preparation 78
5.2.3.2 NMR experiments and data process 78
5.2.3.3 NMR relaxation studies 79
5.2.3.4 NMR metal titration 80
5.3 Results and discussions 80
5.3.1 X-ray studies 80
5.3.1.1 SeMet VP9 preparation 80
5.3.1.2 Crystallization 81
5.3.1.3 Data collection 81
5.3.1.4 Structure solution and refinement 82
5.3.1.5 Crystal structure of VP9 83
5.3.2 NMR studies 89
5.3.2.1 Sample preparation 89
vi
5.3.2.2 NMR structure 89
5.3.2.3 NMR relaxation studies 90
5.3.3 VP9 interacts with metals 95
5.3.3.1 Metal binding sites 95
5.3.3.2 NMR metal titration 99
5.3.4 Comparison of crystal structure vs. NMR
structure 101
5.3.5 Sequence and structural homology 101
5.3.6 Functional implications 104
Chapter 6 Summary and Future Studies 107
6.1 Summary 108
6.2 Future studies 109
6.2.1 Establishment of cell line 109
6.2.2 RNAi 109
6.2.3 Structural genomics 110
6.2.4 Structure-based drug design 112
Coordinates 114
References 115
Appendices 126
Publications 127
vii
Acknowledgements
I would like to thank all the people who contribute to this project.
In particular I am grateful to Professor Hew Choy Leong for giving me the opportunity to pursue my PhD degree in the Department of Biological Sciences, National University of Singapore. My supervisor: Professor Hew Choy Leong to whom I am indebted for his guidance, encouragement and support. My deepest gratitude to my co-supervisor: Dr Sivaraman Jayaraman for his patience, guidance and trust. My special thanks to Dr Song Jianxing for his help and support for my training in protein NMR. I am grateful to my friends, Dr Lin Zhi and Dr Chen Zhaohua (Riken, JP) for their valuable discussion and help on the NMR work; Dr Wu Mousheng (IMCB, SG) for the technique guidance and discussion for protein crystallography study; Dr Fan Jingsong for the NMR data collection; Dr Anand Saxena (Brook Haven Laboratory, NY) for the help on protein crystal data collection; Dr Li Shaowei(Xiamen University, China) for the help on the AUC experiment; Dr Song Wenjun, Dr Lin Qingsong, Dr Li Zhengjun, Dr Asha, Dr Huang Canhua, Dr Wu Jinlu, Ms Tang Xuhua, Ms Sunita and, Mr. Jobi and the rest of the lab mates for the valuable discussion and friendship and the present and former members of Functional Genomics Laboratory as well as Structural Biology Laboratory. Special thanks to Lim Daina and Thomas Hegendoerfer (Munich, Germany) for their contribution to the functional studies of VP9. I would like to thank Professor Wong Sek Man and A/P Lin Tianwei (Scripps Research Institute, USA) for the guidance on Cowpea Mosaic Virus project. Special thanks go to Mr. Shashi Joshi for his help, advice and friendship. My thanks also go to the service and facilities provided by the Protein and Proteomic Center (PPC), Department of Biological Sciences, National University of Singapore.
viii
My apologies to those whom I have not mentioned by name I am indebted to them in many ways they had helped me. I would like to pay tribute to my family whose love and support can never be repaid. Lastly, I would like to thank National University of Singapore for providing me with research scholarship to pursue my PhD degree in NUS.
ix
Abstract
White Spot Syndrome Virus (WSSV) is a major pathogen in shrimp
aquaculture. VP9, a full length protein of WSSV, encoded by ORF WSV230, was
identified for the first time, in the infected Penaeus monodon shrimp tissues, gill and
stomach as a novel, nonstructural protein by western blot, mass spectrometry and
immuno-electron microscopy. Real-time RT-PCR demonstrated that the transcription
of VP9 started from the early to the late stage of WSSV infection as a major mRNA
species. The structure of full length VP9 was determined by both X-ray and NMR
techniques. It represents the first structure to be reported for WSSV nonstructural
proteins. The crystal structure of VP9 revealed a ferredoxin fold with divalent metal
ion binding sites. Cadmium sulphate was found to be essential for crystallization. The
Cd2+ ions were bound between the monomer interfaces of the homodimer. Various
divalent metal ions were titrated against VP9 and their interactions were analyzed
using NMR spectroscopy. The titration data indicated that VP9 binds with both Zn2+
and Cd2+. VP9 adopts a similar fold as the DNA binding domain of the E2 protein
from human papillomavirus. Based on our present investigations, we hypothesize that
VP9 might be involved in the transcriptional regulation of WSSV, a function which is
similar to the E2 protein during papillomavirus infection of the host cells.
x
List of Figures
Figure 1.1 Electron micrographs of purified virions 12
Figure 1.2 Circular representation of the WSSV genome 13
Figure 3.1 VP9 amino acid sequence, WSSV and
expression vector information 40
Figure 3.2 Hydrophobicity plot of VP9 46
Figure 3.3 Purification profile of His-VP9 47
Figure 3.4 MS result of native VP9 48
Figure 3.5 DLS result of VP9 49
Figure 3.6 CD result of VP9 50
Figure 3.7 CD profiles upon pH changes 51
Figure 4.1 Transcriptional analysis of WSSV proteins by
Real-time RT-PCR 65
Figure 4.2 Localization analysis of VP9 by Western
Blotting and IEM 66
Figure 4.3 Confirmation of molecular weight of VP9 by
mass spectrometry 67
Figure 4.4 His-VP9 Bait protein purification profiles 71
Figure 4.5 12 % SDS-Page analysis (maxi-gel) of prey
capture (silver stain) 72
Figure 4.6 MS results for protein (band 1) 73
xi
Figure 4.7 MS results for protein (band 3) 74
Figure 5.1 Final purification profile of VP9 85
Figure 5.2 Crystals images of VP9 86
Figure 5.3 Ribbon diagram of crystal structure of VP9 88
Figure 5.4 SDS-PAGE of NMR samples 91
Figure 5.5 Ribbon diagram of NMR structures of VP9 92
Figure 5.6 NMR relaxation results 94
Figure 5.7 Simulated-annealing Fo-Fc omit map in the
dimerization region of VP9 97
Figure 5.8 Stick representation for the cadmium
coordination sphere 98
Figure 5.9 Dual 1H-15N HSQC spectra of VP9 in the
absence and presence of Zn and Cd 100
Figure 5.10 Crystal structure vs. NMR mean structure 103
Figure 5.11 Proposed DNA binding model 106
xii
List of Tables
Table 1 Phasing methods in protein crystallography 19
Table 2 Programs and program packages commonly used
in protein crystal structure determination 20
Table 3 2D and 3D NMR experimental methods and
their purposes 25
Table 4 Primer sequences for real-time RT-PCR 68
Table 5 Legend for prey protein samples 69
Table 6 Real-time RT-PCR analysis of vp9, vp28 and
dnapol from 0 to 72 h.p.i. 70
Table 7 Data collection and refinement statistics 87
Table 8 NMR structural statistics 93
xiii
List of Abbreviations
1D one-dimensional
2D two-dimensional
3D three-dimensional
Å Ångstrom (10-10m)
a.a. amino acid
ATPase adenosine triphosphatase
AUC analytical ultracentrifugation
bp base pair
B0 magnetic field
BSA bovine serum albumin
CCP4 collaborative computational project No.4
CD Circular Dichroism
cDNA complementary DNA
CNS crystallography and NMR system
COSY correlation scpectroscopy
cryo-EM cryo-electron microscopy
δ chemical shift
Da Dalton (g mol-1)
DMSO dimethyl sulfoxide
DNase deoxyribonuclease
DNA deoxyribonucleic acid
dsDNA double-stranded DNA
Dicer dimer cleaves RNAi
DTT dithiothreitol
E.coli Escherichia coli
EDTA ethylenediamine tetraacetic acid
F1 the acquired frequency dimension in an NMR spectrum
xiv
F2/F3 indirectly detected frequency dimension in an NMR spectrum
HEPES 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid
HSQC heteronuclear single-quantum coherence
Hz hertz
HIV human immunodeficiency virus
IPTG isopropyl-β-D-thiogalactopyranoside
kbp kilo base pair
kDa kilo Dalton
LB Luria-broth medium
M mol l-1
MAD multiple wavelength anomalous dispersion
MALDI matrix assisted laser desorption/ionization
Mbp mega-base pair
MCP major capsid protein
MIR multiple isomorphous replacement
ml milliliter
mM millimolar
mg milligram
MS mass spectrometry
ms millisecond
MW molecular weight
NCS non-crystallographic symmetry
ng nanogram
Ni-NTA nickel-nitrilotriacetic acid
nm nanometer
NMR nuclear magnetic resonance
NOE nuclear overhauser effect
NOESY nuclear overhauser effect spectroscopy
OD optical density
ORF open reading frame
xv
PAGE polyacrylamide gel electrophoresis
PCR polymerase chain reaction
pH potential of hydrogen
PMF peptide mass fingerprinting
PMSF Phenylmethylsulphonylfluoride
ppm parts per million
Q-TOF quadrupole-TOF
RISC RNA-induced silencing complex
RMSD root mean square deviation
RNAi RNA interference
RNase A ribonuclease A
S second
SAD Single-wavelength anomalous diffraction
SDS sodium dodecyl sulfate
Se Selenium
TEMED N,N,N’,N’-tetramethylethylendiamine
TOCSY total correlation spectroscopy
TOF time-of-flight
Tris tris (hydroxymethyl) aminomethane
µl microliter
µM micromolar
UV ultraviolet
Ala alanine
Arg arginine
Asn asparagines
Asp aspartic acid
Cys cysteine
Gln Glutamine
Glu glutamic acid
xvi
Gly glycine
His Histidine
Ile isoleucine
Leu leucine
Lys lysine
Met methionine
Phe phenylalanine
Pro proline
Ser serine
Thr threonine
Trp tryptophan
Tyr tyrosine
Val valine
xvii
1
Chapter 1 Literature Review
1
1 Introduction
White Spot Syndrome Virus (WSSV) is a major pathogen in shrimp
aquaculture, causing loss of billions of dollars every year. There is no effective
treatment for the WSSV infection up to date, thus leading to its prevention and
treatment being the utmost importance for this disease. The aim of this thesis is to
provide structural and functional insights into one of the nonstructural viral proteins
of this pathogen. This study would be valuable in understanding the critical roles such
as viral transcriptional and host-pathogen interactions. This information obtained will
thus provide the structural basis for the design of small molecule inhibitors as
potential drugs to against WSSV infection.
1.1 Introduction to virus
In 1898, Friedrich Loeffler and Paul Frosch found evidence that the causative
agent of foot-and-mouth disease in livestock was an infectious particle smaller than
any bacteria. This was the first clue to the nature of viruses, genetic entities that lie in
the grey area between living and non-living organisms.
Viruses depend on the host cells that they infect for reproduction. When
found outside of host cells, viruses exist as a protein coat or capsid that sometimes
enclosed within a membrane. The capsid encloses either DNA or RNA that codes for
viral elements. When a virus comes into contact with a host cell, it can inject its
genetic material into its host cells, taking over the host's replication machinery and
2
other cellular activities. An infected cell often produces more viral proteins and
genetic materials than its usual products. Some viruses can remain dormant inside
host cells for a long period of time, causing no obvious change in their host cells (a
stage known as the lysogenic phase). But when a dormant virus is stimulated, it can
enter the lytic phase where new viruses are formed, self-assembled, rupturing the host
cell and eventually killing the host cell before infecting other cells (Emiliani, 1993).
Viruses are ubiquitous and abundant in nature and can infect and parasitize
all living organisms from bacteria to mammals. They are considered to be simple
biological entities composed of a small number of macromolecules produced by, and
thus derived from, the organism they infect. There are more than 3000 families of
viruses. Viruses can differ greatly in their physical form. They can be round,
string-like, or can even resemble an elegant snow-crystal as does adenovirus. A
feature shared by all viruses is their highly compact structure. There is also a great
variability in the make up of their genome. Their genome can be RNA or DNA, single
or double stranded, positive or negative sense, monomeric or dimeric (or fragmented ),
naked or in complex with proteins. The genomes of two related viruses can
complement each other through structural, enzymatic and parasitic functions, thus
contributing to augment virus diversity. This notion of viral diversity by
trans-complementation within a virus population is important to our understanding of
viral dynamics and should always be kept in mind when studying single molecular
clones of a given virus or a part of it (Jean-Luc DARLIX et al., 2005).
The gene products of viruses generally are comprised of structural proteins
3
(SPs), which are the components of virus particles and nonstructural proteins (NPs),
which act as regulators or cofactors controlling the viral infection process.
1.2 Introduction to crustacean virus
The first report of a crustacean virus was in the crab Macropipus depurator
by Vago in 1966 (Vlak et al., 2004). Crustacean viruses are currently known to consist
of a wide range of viral families, including Baculoviridae, Birnaviridae, Bunyaviridae,
Herpesviridae, Piconaviridae, Parvoviridae, Reoviridae, Rhabdoviridae, Togaviridae,
Iridoviridae, Nodaviridae and Nimaviridae. Crustacean viral diseases listed by the
OIE (Office International Des Epizooties; the World Organization for Animal Health)
include Taura Syndrome (TS), White Spot Disease (WSD), Yellowhead Disease
(YHD), Tetrahedral Baculovirosis (Baculovirus penaei [BPV] infection), Spherical
Baculovirosis (Penaeus monodon-type baculovirus [MBV] infection), Infectious
Hypodermal and Haematopoietic necrosis (IHHN) and Infectious Myonecrosis (IMN).
Spawner-isolated Mortality Virus Disease (SMVD) was removed from the OIE
Aquatic Animal Health Code (2005) because the etiology is not well defined.
Infection with Mourilyan Virus (MoV), White Tail Disease (WTD), and
Hepatopancreatic Parvovirus (HPV) are listed as emerging diseases (Vlak et al.,
2004). As a crustacean virus, WSSV (Family: Nimaviridae, Genus: Whispovirus) is
very unique because its infection strategy does not match the infection models of any
other known virus (Lo, 2005).
4
1.3 Introduction to WSSV
1.3.1 Background
As seafood is a much desired delicacy around the globe, large scale
production of shrimps has become a major industry worldwide. Intensive cultivation
of shrimp as well as breeding of shrimps under artificial conditions, e.g. temperature
control and high population density, provide an ideal environment for the propagation
of viral pathogens. The situation is worsened by the worldwide trade of the life-stock
of shrimp, which tremendously facilitates the spread of these pathogens. One of the
most serious pathogens that causes mass mortality in shrimp is the White Spot
Syndrome Virus (WSSV) (Wang et al, 1999). The total economic loss due to WSSV
has averaged more than billions of U.S dollars per year.
WSSV not only infects shrimp species such as Penaeid monodon, but also
many other species of crustaceans including crab and crayfish (Wang et al., 1999).
The disease typically occurs in juvenile shrimp but sometimes manifests itself in later
adult stages. Clinical signs include white spots on the shell from abnormal deposits of
calcium salts, and occasionally a reddish discoloration due to expansion of cuticular
chromatophores. When farmed shrimps are infected, they become lethargic, stop
feeding, swim slowly near the pond surface and eventually sink to the bottom and die.
WSSV-positive shrimps are now routinely found in the U.S. retail markets
(Donald 1999) and also in the Singapore markets based on our testing (unpublished
data). With the information to-date, WSSV does not appear to endanger human health
(Donald 1999).
5
1.3.2 Structural features of WSSV
The WSSV virion is a nonoccluded and enveloped particle (Figure 1.1) of
approximately 275 by 120 nm with an olive-to-bacilliform shape. It has a
nucleocapsid (300 by 70 nm) with periodic striations perpendicular to the long axis
(Wang et al., 1995; Wongteerasupaya et al., 1995). The most prominent feature of
WSSV is the presence of a tail-like extension at one end of the virion (Durand et al.,
1997; Wongteerasupaya et al., 1995) which gives this virus the family name
Nimaviridae ("nima" is Latin for "thread") (Mayo, 2002). With a genome size of over
300 kbp, WSSV is the largest animal DNA virus sequenced to date and second in size
after Chlorella virus PBCV-1 (331kbp) (Li et al., 1997).
1.3.3 Classification of WSSV
Since most of the putative WSSV ORFs bear no homology with known genes
in the GenBank, the International Committee on Taxonomy of Viruses approved a
proposal to erect WSSV as the species of the genus Whispovirus, family Nimaviridae
(Tsai et al., 2004).
6
1.4 Research progress of WSSV
1.4.1 Sequence determination and analysis
The complete genome sequences of three WSSV isolates have been
determined (Yang et al., 2001) and 181 open reading frames (ORFs) which encode
more than 60 amino acids long have been identified (Figure 1.2). These analyses were
consistent among the three isolates from different geographical regions (Yang et al.,
2001; Hulten et al., 2001; Leu et al., 2005). All the three WSSV isolates that have
been sequenced contain a genome of about 300 kb, and genetic comparisons have
shown a high degree of genetic similarity (Marks et al., 2004). Homology searches
against sequence databases suggested possible functions for only a few of these ORFs
and most of them shown no significant similarity to any other known proteins.
1.4.2 Viral proteins identification
The availability of the complete WSSV sequence facilitated the global
molecular characterization of the virus by genomic and proteomic approaches and has
recently led to the discovery of many important WSSV genes (Sritunyalucksana et al.,
2006) including latency-associated genes, immediate-early genes, structural genes and
nonstructural genes.
1.4.2.1 Latency-related genes identification
Uninfected shrimp populations are an essential control for the study of
WSSV infection and they are also generally important in the shrimp industry.
7
However, given the highly infectious nature of WSSV, such populations had been
historically difficult to establish (Khadijah et al., 2003). Fortunately,
specific-pathogen-free (SPF) shrimps without WSSV are commercially available
(BIOTEC, Bangkok, Thailand). These shrimps have been successfully grown for 6
generations in a well-controlled environment without any disease outbreak. Routine
diagnosis performed at BIOTEC by using an IQ2000 WSSV detection kit (Farming
IntelliGen Technology Corporatoin, Taipei, Taiwan) also has confirmed that the
cultured shrimps were WSSV-free (Lo et al., 1998). However, it has been suggested
that WSSV could exist in an asymptomatic carrier state. Certain stress conditions such
as transportation and poor water quality can induce the virus from a carrier state to
infective state and initiate an outbreak (Tsai et al., 1999). Other researchers have also
observed the symptoms of WSSV infection in normal shrimps that were thought to
result from environmental stress rather than viral contamination (Chen et al., 2000;
Magbanua et al., 2000; Thakur et al., 2002). This raised the question of whether these
normal shrimps carried the virus in a latent state. Khadijah and his co-workers
reported for the first time the identification of three WSSV latency-related genes in
shrimp after comparing the expression of viral gene in WSSV-infected and SPF
shrimps using DNA microarray technology (Khadijah et al., 2003). A year later, the
same group further characterized that one of these three genes encoded for a nuclear
regulatory protein (Hossain et al., 2004).
8
1.4.2.2 Immediate-early (IE) genes identification
The expression of viral IE genes depends on the host cell machinery and
occurs independently of any viral de novo protein synthesis, which means that the IE
genes are especially important in determining host range (Friesen, 1997). For example,
during infection by large DNA viruses, such as baculoviruses and herpesviruses, gene
expression is regulated such that the immediate-early (IE) genes are transcribed first,
followed by the expression of the early (E) and late (L) genes, respectively (Blissard,
1996; Blissard and Rohrmann, 1990; Friesen and Miller, 1986; Hoess and Roizman,
1974). To study the transcription of viral IE genes, viral infection is induced in the
presence of a protein synthesis inhibitor, usually cycloheximide (CHX), which
prevents de novo protein synthesis by inhibiting translation. As only translation but
not transcription of the IE genes is prevented, this blocks the infectious cycle at the IE
stage. IE genes are rigorously classified as viral genes that are actively transcribed
during a viral infection in the presence of CHX (Liu et al., 2005). Microarray and
RT-PCR screening for WSSV IE genes in CHX-treated shrimp has identified a total of
six potential IE genes. Of which, ie1 showed very strong promoter activity in Sf9
insect cells using enhanced green fluorescence protein (EGFP) as a reporter (Liu et al.,
2005). It was shown recently that STAT (signal transducer and activator of
transcription) directly transactivates WSSV ie1 gene expression and contributes to its
high promoter activity (Liu et al., 2005).
9
1.4.2.3 Structural genes identification
Structural proteins are particularly important in the characterization of any
virus because they are the first molecules to interact with the host, therefore playing
critical roles in targeting host cell as well as triggering host defenses (Tsai et al.,
2004). All animal DNA viruses, except poxviruses (Wittek, 1982) and irridovirus
(Tidona and Darai, 1997) replicate in the cell nucleus (Kasamatsu and Nakanishi,
1998). In the first step of infection, viruses import their genomic DNA into the nuclei
of infected cells where the viral proteins are synthesized (Chen et al., 2002). Most
viruses utilize the nuclear import system of the cell, including microtubules (Sodeik et
al., 1997; Suomalainen et al., 1999), nuclear pore complex (Greber et al., 1996, 1997),
receptors and import factors (Marsh and Helenius, 1989; Whittaker and Helenius,
1998; reviewed in Kasamatsu and Nakanishi, 1998) to access the nucleus. Viruses that
are too large to easily enter the nucleus will often locate to the nuclear pore to release
their DNA for transport to the nucleus by associating with one or more mediating viral
proteins. Examples include canine parvovirus (Vihinen-ranta et al., 2000), Hepatitis B
virus (Kann et al., 1999), adenovirus (Greber et al., 1997) and simian virus 40
(Wychowski et al., 1986, 1987; Nakanishi et al., 1996).
In the case of WSSV, SDS-PAGE coupled with Western blotting and/or
protein N-terminal sequencing identified only six structural proteins: VP35, VP28,
VP26, VP24, VP19, and VP15 (Hameed et al., 1998; van Hulten et al., 2000a; van
Hulten et al., 2000b; Chen et al., 2002). Recently, a more comprehensive approach
was available by using a combination of proteomics and mass spectrometry with
10
database searches of sequenced genomes (Liu et al., 2006). The identification of
WSSV structural proteins is particularly amenable to this approach with the complete
known genome sequence of WSSV (Yang et al., 2001) and viral particles consist of a
relatively narrow range of proteins that have constant stable profiles. Due to the
introduction of proteomic methods, the total number of known WSSV viral structural
proteins has been increased to 39 (Huang et al., 2002a; Huang et al., 2002b, Li et al.,
2004; Tsai et al., 2004), and Li et al. further increased to 55 (unpublished data).
However, little is known about the functions of these structural proteins except that
there was an identification of PmRab that binds directly to VP28 (Sritunyalucksana et
al., 2006).
1.4.2.4 Nonstructural genes identification
Besides structural proteins, nonstructural proteins are also required for
replication of the viral genome, production of virus particles and inhibition of certain
host cell functions. These proteins are therefore potential targets for drug design and
the development of vaccines (Liu et al., 2006). Although considerable progress has
been made in characterizing the WSSV viral proteins, little attention has been paid to
nonstructural proteins. To date, reports on the functional characterization of
nonstructural genes in WSSV are only limited to a few ORFs with high homology to
ribonucleotide reductase (Tsai et al., 2000), thymidine kinase (TK) and thymidylate
kinase (TMK) (Tzeng et al., 2002) genes. The functional studies of WSSV proteins
have been greatly hampered by the lack of a suitable cell line to act as the virus host.
11
Consequently, functional analysis of WSSV proteins still remains challenging.
FIGURE 1.1 Electron micrographs of purified virions. (A) The white outlines indicate (i) a complete mature virion with a characteristic tail, (ii) a ruptured mature virion with more than half of the nucleocapsid exposed outside of the envelope and (iii) a completely exposed mature nucleocapsid. (B) Immature, naked nucleocapsid prior to being enveloped. (Adapted from Leu et al., 2005)
12
FIGURE 1.2 Circular representation of the WSSV genome. Arrows, positions (outer ring) of the 181 ORFs (red and blue indicate the different directions of transcription); green rectangles, 9 hrs. B, sites of BamHI restriction enzymes (inner ring; their positions are in parentheses). (Yang et al., 2001)
13
1.5 Introduction to methodology
This section gives an overview of the major methods employed in this study
which include protein purification techniques, real-time RT-PCR, x-ray
crystallography and nuclear magnetic resonance (NMR).
1.5.1 Protein purification techniques
Purification of sufficient amounts of proteins is commonly thought to be one
of the most important steps in protein research, especially for functional study and
structure determination. The purity of the protein is always a big concern when
conducting protein-related researches. Theoretically, proteins can be purified to
homogeneity by standard chromatographic techniques such as affinity
chromatography, ion exchange chromatography and gel filtration chromatography.
The following introduction is adapted from Rajni (2003).
1.5.1.1 Affinity chromatography
Affinity chromatography (AF) separates proteins based on reversible
interaction between a protein and a specific ligand coupled to a chromatographic
matrix. One of the most common applications of AF is to purify recombinant proteins.
Proteins that are genetically modified so as to allow them to be selected for affinity
binding are known as fusion-tagged proteins. Tags include His-tags and GST
(glutathione-S-transferase) tags. His6-tags have an affinity for nickel or cobalt ions
14
which are covalently bound to NTA (nitrilotriacetic acid). For elution, an excess
amount of a compound such as imidazole, that is able to act with the nickel ligand, is
used. GST has an affinity for glutathione, which is commercially available as
immobilized glutathione sepharose. For elution, excess amount of reduced glutathione
is used to displace the tagged protein.
1.5.1.2 Ion exchange chromatography
Proteins have numerous functional groups that can have both positive and
negative charges. Ion exchange chromatography (IEC) separates proteins according to
their net charge, which is dependent on the composition of the mobile phase. By
adjusting the pH or the ionic concentration of the mobile phase, various protein
molecules can be separated. For instance, if a protein has a net negative charge at pH
7, then it will bind to a column of positively-charged beads, whereas a positively
charged protein would not. The bound proteins can be eluted by decreasing the pH of
the mobile phase so that the net charge on the protein becomes postive. However,
elution by changing the ionic strength of the mobile phase has a more subtle effect.
Ions from the mobile phase interact with the immobilized ligand in preference over
the bound proteins. This "shields" the stationary phase from the protein, (and vice
versa) and allows the protein to be eluted.
1.5.1.3 Size exclusion chromatography (SEC)
15
Size exclusion chromatography (SEC) separates particles based on their sizes,
or in a more technical term, their hydrodynamic volumes. When an aqueous solution
is used to transport a sample through a chromatographic column the technique is
known as gel filtration chromatography. The name gel permeation chromatography is
used when an organic solvent is used as the mobile phase. SEC is a widely used
technique for the purification and analysis of synthetic and biological polymers, such
as proteins, polysaccharides and nucleic acids. The advantage of this method is that
the various solutions can be applied without interfering with the filtration process,
while preserving the biological activity of the particles to be separated.
1.5.2 Quantitative real-time RT-PCR
The real-time reverse transcription polymerase chain reaction (RT-PCR)
exploits fluorescent reporter molecules to monitor the production of amplified
products during each cycle of the PCR reaction. It is one of the technologies of the
genomic age and has become the method of choice for detection of gene expression at
the mRNA level. Several factors have contributed to the transformation of this
technology into a mainstream research tool: (i) as a homogeneous assay it avoids the
need for post-PCR processing; (ii) a wide (>107-fold) dynamic range allows
straightforward comparison between RNAs that differ widely in their abundance; and
(iii) the assay realizes the inherent quantitative potential of the PCR, making it a
quantitative as well as a qualitative assay. This has resulted in its extensive
applications in functional genomics, molecular medicine, virology, and biotechnology.
16
The above introduction is adapted from Bustin (2005).
1.5.3 X-ray crystallography
Protein X-ray crystallography employs the fact that X-ray can be diffracted
by protein crystals to discrete patterns. Crystals can be interpreted as an infinite array
in which building blocks (symmetric units) are arranged according to a well-defined
symmetry into the unit cell which is translationally repeated in the three-dimensional
space. Growth of single and well defined diffracting crystals forms the basic and
essential prerequisite for X-ray crystallography protein structures determination (Blow,
2002). Producing high quality crystals has always been the bottleneck to structure
determination, and it is still not understood why some proteins crystallize with ease
while others stubbornly refuse to produce suitable crystals (Chayen, 2004). It requires
a protein to be purified to homogeneity and concentrated to a supersaturated state to
generate crystals. Crystal growth basically takes three steps: nucleation, growth and
cessation of growth. However, searching for crystallization conditions for a new
protein has been compared with looking for a needle in a haystack. A major aid is
using multi-factorial trials. Different techniques are employed for setting up
crystallization trials which include sitting drop vapor diffusion, hanging drop vapor
diffusion, sandwich drop and batch, micro batch under oil, micro dialysis and free
interface diffusion. Although microbatch is the simplest method, it is a relatively new
technique. Vapor diffusion has been very popular and successful for the past 40 years.
17
Sitting and hanging drop methods are easy to manipulate, require a small amount of
sample, and allow large amount of flexibility during screening and optimization. Once
a lead is obtained as to which conditions may be suitable for crystal growth, the
conditions can generally be fine-tuned by making variations to the parameters
including precipitant, pH, salt, temperature, etc (Bergfors, 1999). Once good crystals
are obtained they are harvested either in a capillary or loop and mounted on an X-ray
source. When a beam of X-ray passes through the crystal they are diffracted in all
directions and recorded on the X-ray detector with a particular pattern, which is
known as the diffraction pattern. A number of such diffraction patterns from different
orientations of the same crystal are recorded to give a data set. The next step is to
calculate the electron density map so as to ascertain the exact position of each atom in
the asymmetric unit of the crystal. Calculation of electron density is dependent on two
main factors; the amplitude and the phase of the diffracted beam. These two factors
are then Fourier transformed to give the electron density map. The amplitude of the
beam can be derived from the measured intensity of reflections, but information about
the phase angle is lost. Due to the lack of phase information in the diffraction pattern,
direct reconstruction of the electron density of the molecules via Fourier transforms is
not generally possible. This leads to the so-called phase problem in X-ray
crystallography. There are a few methods, to date, which can help to circumvent the
phase problem (Table 1). The actual phase calculation, electron density reconstruction,
model building, and structure refinement are conducted in silico with computer
programs (Table 2).
18
TABLE 1 Phasing methods in protein crystallography
Phasing Method Phasing Marker Derivatization Method Remarks SAD via sulfur atoms (S-SAD)
S in Met, Cys, residues, combined with solvent density modification
None, native protein Requires highly redundant data collection
MAD/SAD via naturally bound metals
Naturally bound metal ion, cofactor
None, native protein
MAD via Se Se in Se-Met residues Incorporated during expression in Met deficient cells or via metabolic starvation
1 Se phases 100-200 residues
MAD via isomorphous metals
Heavy metal ion specifically bound
Soaking or co-crystallization
Hg, Pt, Au, etc Strong signal on L-edges
SIR(AS) via isomorphous metals
Heavy metal ion specifically bound, density modification
Soaking or co-crystallization
Phasing power proportional to z back soaking necessary
MIR(AS) via isomorphous metals
Heavy metal ion specifically bound
Soaking or co-crystallization
Multiple derivatives needed back soaking necessary
SIR(AS) via anions Heavy anion specifically bound, Br_,, I_,
Mostly brief soaking, or co-crystallization
I derivatives are also suitable for Cu source, possibly back soaking
SIR(AS) via noble gas
Noble gas specifically bound, Xe, Kr
Pressure apparatus Xe XAS edge unsuitable for most MAD beam lines
MR via model structure
None None Needs a homology model with close coordinate r.m.s.d.
Direct Methods None None Atomic resolution, small size
Notes: SAD: Single-wavelength Anomalous Diffraction; MAD: Multi-wavelength Anomalous Diffraction; SIR: Single Isomorphous Replacement; MIR: Multiple Isomorphous Replacement; (AS): with Anomalous Scattering.
19
TABLE 2 Computer programs and program packages commonly used in protein crystal structure determination Program Website Functions CCP4 Program Suite
www.ccp4.ac.uk Data collection, data processing, phasing, ML refinement, model building, validation.
XPLOR/CNS cns.csb.yale.edu Program pioneering SA and MD in refinement of X-ray and NMR data. Complete package including phasing and MR
MOSFLM www.mrc-lmb.cam.ac.uk/harry/mosflm
Data image processing, integration, reduction and scaling via CCP4.
HKL2000 /DENZO
www.hkl-xray.com Data collection, integration, reduction, scaling (SCALEPACK module)
SOLVE /RESOLVE
www.solve.lanl.gov Combined ML HA solution, phasing, reciprocal space density modification, NSC, and model building program. Interfaces with CCP4.
SHARP/AUTOSHARP
www.globalphasing.com ML HA refinement, excellent phasing, density medication. Interfaces with CCP4
ARP/wARP warpNtrace
www.embl-hamburg.de/ARP
Map improvement via dummy atom refinement and model building. Works best at higher resolution
XPREP, SHELXD, SHELXE
shelx.uni-ac.gwdg.de HA data processing (XPREP), HA substructure solution by combined Patterson and direct methods, simpler but fast phasing and density modification for maps
BnP www.hwi.buffalo.edu./SnB Direct methods full structure or HA substructure solution via reciprocal-direct scape cycling
O alpha2.bmc.uu.se/~alwyn/ Descendant of first generation of pioneering graphic modeling programs
Notes: HA: Heavy Atom; ML: Maximum Likelihood; MD: Molecular Dynamics; SA: Simulated Annealing;
20
1.5.4 NMR spectroscopy
In 1946, Purcell et al. (Purcell et al., 1946) and Bloch et al. (Bloch et al.,
1946) reported for the first time the nuclear magnetic resonance (NMR) phenomenon.
In 1953, Overhauser defined the concept of nuclear overhauser effect (NOEs), which
formed the basis for structure determination by NMR. However, only after two
decades, the first application of NMR in solving protein structure was achieved by
Ernst and Wüthrich in 1983. Since then, NMR spectroscopy became an alternative
method to X-ray crystallography for the structure determination of small to medium
sized proteins (<25 kDa) in aqueous or micellar solutions. The recent progress in
computational and experimental NMR techniques has improved the efficiency of
biological NMR research (Bax, 2003). Generally, structure determination by NMR
involves sample preparation, data acquisition, data processing, data assignments and
structural calculations.
Sophisticated NMR experiments only rarely can compensate for an
ill-behaved or ill-prepared NMR sample. Accordingly, in nearly all investigations,
preliminary experiments must be performed to determine sample conditions to satisfy
the following criteria: (i) the protein must be in a native, functional conformation
(unless unfolded or intermediate states of protein are of interest; (ii) solubility must be
sufficient to permit spectra with satisfactory signal-to-noise ratios to be acquired in
reasonable time periods. Normally, 0.4-0.6 ml of protein solution of approximately 1
mM concentration is required; (iii) Protein samples used must be free of contaminants
arising from the NMR tube or the protein preparation. The protein should be
21
monodisperse (unaggregated) at the concentration required for NMR spectroscopy
and stable for time periods longer than those required for desired NMR experiments;
(iv) temperature, pH, concentration, and buffer composition affect the solubility,
aggregation state, and stability of proteins dramatically, and must be optimized
empirically (Oppenheimer, 1989; Primrose, 1993).
A simple one-dimensional proton experiment is the most basic spectrum in
NMR spectroscopy that can be acquired in a short period of time (usually not more
than a few minutes) for samples with 0.01 mM concentration and contains great
amount of information. It is able to show the folding status of the proteins (whether a
protein is folded or unfolded) which is important for any further functional or
structural studies on the protein. This is because only folded proteins retain their
functional activity and three dimensional structures (Rehm et al., 2002).
Unfortunately, one-dimensional spectra of protein molecules contain overlapping
signals from many hydrogen atoms because the differences in chemical shifts are
often smaller than the resolving power of the experiment (Freeman et al., 1962).
Due to the greatly improved resolution of two-dimensional experiments,
these are frequently used for screening and binding studies. The simplest and most
powerful among them is the heteronuclear single-quantum coherence (HSQC)
experiment. For this kind of spectrum 15N-labeled protein samples are required. The
HSQC shows one peak for every proton bound directly to a nitrogen atom and thus
exactly one signal per residue in the protein (apart from proline residue which is
devoid of proton bound nitrogen and some additional side chain signals from
22
asparagine and glutamine residues which can also be identified). However, 2D NMR
data is not sufficient to determine the structure of proteins with larger sizes due to the
overlapping of signals.
Given the vast improvement in effective resolution between 1Da and 2D
NMR spectra, 3D NMR spectroscopy is a logical approach to increase the effective
resolution still further. The first example of a 3D NMR experiment useful in the study
of proteins was reported in 1988 (Oschkinat et al., 1988). Heteronuclear 3D
experiments have tremendously expanded the complexity problems of 2D NMR
methods (Fesik et al., 1990). The heteronuclear 3D experiments involve at least two
types of nuclei. It consists of correlating the various nuclei either through scalar
coupling (COSY, TOCSY, HMQC, HSQC) or through space (NOESY) - spreading
this crucial (and overlapping) homonuclear information along the X chemical shift
(either Carbon or Nitrogen) by combining two "classical" 2D experiments (Clore et
al., 1991). Many choices of 2D or 3D NMR experiments are available for different
purposes as shown in Table 3.
The final result of the sequence-specific assignment of NMR signals is a list
of distance constraints from specific hydrogen atoms in one residue to hydrogen
atoms in a second residue. This list immediately identifies the secondary structure
elements of the protein molecule because both α helices and β sheets have very
specific sets of interactions of less than 5Å between their hydrogen atoms. It is
therefore possible to calculate models of the three-dimensional structure of the protein
(Branden & Tooze, 1999). Eventually, a set of possible structures (usually more than
23
10) rather then a unique structure will be determined.
Nuclear magnetic resonance spectroscopy complements X-ray
crystallography for small and medium size proteins (below 30 kDa) (Montelione et al.,
2000; Prestegard et al., 2001). Its major advantages are that it does not require
crystals and allows the investigator to study the protein in the solution state. It can
work in physiologically similar conditions, such as pH, temperature and salt
concentration, to mimic the in vivo environment, which has been employed in the
studies of the structure-function relationships (Shuker et al., 1996), comparative
studies on metabolic pathways from different organisms (Bruggert et al., 2003) and
identification of binding partners and study of their binding sites (Stoll et al., 2001). It
was also reported that a series of NMR spectra taken under different conditions can be
used to monitor aggregation and formation of amyloid fibrils (Zurdo et al., 2001).
Further, NMR can also be used to investigate dynamics of proteins to distinguish
multiple conformations (Muhlhahn et al. 1998). Its ability to detect weak ligand
binding to target molecules has made it an increasingly important technology in drug
discovery.
24
TABLE 3 2D and 3D NMR experimental methods and their purposes NMR Experiments
Labeling
Purposes
1H1H NOESY 2D No NOE constraints and aromatic side chain assignment
1H1H TOCSY 2D No Backbone and side chain assignment 15N1H HSQC 2D 15N Structural fingerprint studies
Backbone and side chain assignments
HNCO 3D 15N, 13C Intra-residue for sequential connectivity HN(CO)CA 3D 15N, 13C Intra-residue for sequential connectivity HN(CA)CO 3D 15N, 13C Intra-residue, used with HNCO HNCA 3D 15N, 13C Intra-residue with weaker inter-residue
correlations between Cα CBCACONH 3D 15N, 13C Sequential connectivity and assignment HN(CO)CACB 3D 15N, 13C Sequential connectivity and assignment HNCACB 3D 15N, 13C Intra-residue with weaker inter-residue
correlations between Cα and Cβ HN(CA)CB 3D 15N, 13C Distinct Ser and Thr HA(CACO)NH 3D 15N, 13C, 2H Hα assignment HCCH-TOCSY 3D 15N, 13C Side chain assignment 3D 15N, 13C, 2H Side chain assignment
Distance NOE measurement and sequential assignments
15N-edited NOESY-HSQC
3D 15N, 13C, 2H NOE constraints and aromatic side chain assignment
13C-edited NOESY-HSQC
3D 15N, 13C, 2H NOE constraints and aromatic side chain assignment
This table is adapted from Lundstrom (2006).
25
1.6 Objectives of this project
Structure-based functional analysis is an important approach for elucidating
the function of proteins. It is of fundamental importance to develop a good expression
system for unknown proteins to produce a large amount of samples for X-ray, NMR
and functional studies. These experiments will be the key to a deeper understanding of
the biology of WSSV, in terms of mechanisms of host-pathogen protein-protein
interactions, as well as viral assembly. No such analysis has been reported so far for
the WSSV proteins. Nonstructural proteins are required for the replication of the viral
genome, assembly of the virus particle and inhibition of certain host cell functions.
These proteins are therefore potential candidates for drug design and the development
of vaccines. From many nonstructural proteins in WSSV, viral protein VP9 was
chosen as the target of this project. This viral protein is coded by ORF wsv230 and it
is of unknown function and structure. However, its expression during WSSSV
infection in Penaeid monodon was detected early by RT-PCR. The abundance of this
protein throughout infection indicated that it might be an important protein (Liu et al.,
2006). Furthermore, it has been reported that VP9 has been patented as a biomarker
for WSSV infection (Taiwan, 2005). The focus of this project is the structural and
functional characterizations of VP9.
26
Chapter 2 Materials and Methods
27
In this chapter, some of the generally-used materials and methods are
introduced. The rest of the methodologies will be elaborated in the following
individual chapters.
2.1 Materials
All chemicals were of analytical grade and were purchased from Sigma and
Merck companies, unless otherwise stated.
2.1.1 Enzymes and other proteins
Enzymes for molecular biology were mainly purchased from New England
Biolabs, and other proteins were mainly from Sigma. Refer to appendices for details.
2.1.2 Kit and reagents
Kits for molecular biology are mainly from QIAGEN (refer to appendices for
details).
2.1.3 Media
2.1.3.1 LB medium
One liter LB medium consists of 10 g Bacto-tryptone, 5 g yeast extract and
10 g NaCl. The pH of the LB medium was adjusted to neutral with 2 N NaOH and
made up to a final volume of 1 liter with ddH2O. The medium was then sterilized by
autoclaving (For plates, medium was supplemented with 15 g/l agar and sufficient
amount of appropriate antibiotics).
28
2.1.3.2 M9 medium
One liter M9 medium consists of 7.5 g Na2HPO4, 3 g KH2PO4, 0.5 g NaCl,
1.0 g (NH4)2SO4, 2 g D-glucose, 10 mg thiamine, 10 mg biotin, 2 ml of MgSO4
solution (1 M), 0.1 ml of CaCl2 solution (1 M), 100 µg ampicillin. It was made up to 1
L with ddH2O. All chemicals were either sterile filtered or autoclaved.
2.1.4 Stock solutions and buffers
All stock solutions and buffers, if not mentioned here, were prepared as
described by Sambrook and Russell (2001).
2.1.4.1 IPTG stock solution
IPTG was dissolved in sterile water to a final concentration of 1 M (2.38 g
per 10 ml). The stock solution was sterile-filtered and stored in aliquots at –20 °C
until use. The stock solution was diluted 1:1000 when added to the medium, unless
otherwise indicated.
2.1.4.2 Ampicillin stock solution
Ampicillin was dissolved in sterile water (1 g/ 10 ml) to a final concentration
of 100 mg/ml. The stock solution was sterile-filtered and stored in aliquots at –20 °C
until use. The stock solution was diluted 1:1000 when added to the medium.
29
2.1.4.3 Buffers for Ni-NTA purification under native conditions
i. Lysis buffer: 50 mM Tris pH 8.0, 300 mM NaCl, 10 mM β-mercaptoethanol,
10 mM imidazole, and EDTA-free protease inhibitor cocktail.
ii. Wash buffer: 50 mM Tris, 300 mM NaCl, 10 mM β-mercaptoethanol, 20
mM imidazole, pH 8.0.
iii. Elution buffer: 50 mM Tris, 300 mM NaCl, 10 mM β-mercaptoethanol, 250
mM imidazole, pH 8.0.
2.1.5 E.coli strains
E.coli strains used in this study include DH5α (Invitrogen) and BL21 Star
(DE3) (Invitrogen).
2.1.6 Plasmid for protein expression
Vector used in this study was pET15b (Amersham Biosciences)(Figure 3.1).
2.1.7 NMR chemicals and sample tube
All chemicals in NMR studies were purchased from Cambridge Isotope
Laboratories, Inc., which include Deuterium oxide, D2O (99.99 %), 15N ammonium
sulfate, (NH4)2SO4 (99.9 %), 13C glucose (99.99 %) and 5 mm emperor thin wall 7740
pyrex tube. Figure in the bracket indicates the purity.
30
2.2 Methods
2.2.1 Molecular biology techniques (DNA related)
2.2.1.1 PCR
200 – 300 ng of template DNA/cDNA was incubated with a PCR mix with a
final concentration of 15 pmol of each of the corresponding forward and reverse
primers, 100 mM of dNTPs, and 1 µl of Pfu DNA polymerase in 1 X pfu buffer made
up with sterile ddH20 to a final volume of 60 µl. The PCR reaction was then
performed by thermal cycler under the program of four steps: (i) 94 °C for 2 min; (ii)
30 cycles of 95 °C for 30 sec, 50 °C for 30 sec and 72 °C for 60 sec; (iii) 72 °C for 15
min. The parameters are needed to be optimized to overcome nonspecific or
unsuccessful reactions.
2.2.1.2 Agarose gel eletrophoresis
The amplified PCR products were analyzed by agarose gel electrophoresis
(1.5 % agarose dissolved in TAE buffer containing 10 µg/ml ethidium bromide).
2.2.1.3 PCR products purification
Desired PCR amplified products were purified with QIAquick PCR
purification kit following the manufacturer’s instructions.
2.2.1.4 Enzyme digestion, dephosphorylation and purification
10 µl of PCR products or vector pET15b were incubated with 1 µl of
restriction enzymes in 1X BSA solution and 1X reaction buffer, made to a total
volume of 20 µl with sterile ddH20 and incubated at 37 °C in a 50 µl reaction for 1-2
31
hours. The restriction digested vectors were then dephosphorylated by treating with 5
units of calf intestinal phosphates at 37 °C for 1 hour. All reactions were terminated
by incubation at 85 °C for 20 min. Desired digested products were then excised from
the agarose gel and purified using QIAquick gel extraction kit following the
manufacturer’s instruction.
2.2.1.5 Ligation and transformation
The mixture of PCR products and the dephosphorylated pET15b vector at a
ratio of 1:3 to 1:5 was incubated with 3 µL of T4 DNA ligase (400U/µL) at 16 °C
overnight. The reaction mixture was inactivated at 65 °C for 20 min followed by
purification. The ligation products were eluted to a final volume of 30 µL with sterile
Milli-Q water and were ready to be transformed into the competent cell DH5α.
100 µl competent cells were thawed on ice before the diluted DNA was
added. The cells were kept on ice for 30 min. After heat shock at 42 °C for 60 sec, the
cells were kept on ice for an additional 2 minutes. 800µl LB medium (Amp free) was
added to the cells and mixed by gently inverting up and down. The cells were then
incubated at 37 °C for 1 hour before plating onto LB agar plate with 100 µg/ml
ampicillin. The plates were incubated at 37 ºC until colonies shown.
2.2.1.6 Positive clone screening and plasmid preparation
Clones were picked up and incubated in 3 ml LB medium with 100 µg/ml
ampicillin at 37 ºC for O/N. PCR as well as double enzyme digestion were carried out.
The products were separated on a 1.0 % agarose gel. The positive clones were
32
selected for plasmid preparation using QIAprep spin miniprep kit following the
manufacturer’s instructions.
2.2.1.7 Cycle sequencing reaction
Cycle sequencing was performed based on the standard protocol supplied by
Applied Biosystems with minor modifications. The concentration of all the plasmid
was determined. Cycle sequencing reactions were run on a 96-well PCR plate. Each
reaction was composed of 2 µL of Terminator Ready Reaction Mix (BigDye™ v3.1),
3 µL of 5 x sequencing buffer, 3.2 pmol of primer, 300-400 ng recombinant plasmids
with inserted viral DNA fragment to give a final volume of 20 µL. The entire reaction
was subjected to 27 cycles of 96ºC for 30 s, 50ºC for 15 s, and 60ºC for 4 min in a
thermal cycler. The products of the cycle sequencing were transferred to a 1.5 mL
eppendorf tube and precipitated for 15 min with 80 µL of ethanol/sodium acetate
solution. The supernatant was carefully removed after 20 min of centrifugation at the
maximal speed. To remove any trace of unincorporated dye, the DNA pellet was
washed with 500 µL of 70 % alcohol. After standing for 15 min, the contents of the
tube were spun down at 13,000 rpm for 5 min. After the supernatant was decanted, the
tube was inverted and dried overnight at room temperature.
2.2.1.8 Sequence determination
Each cycle sequencing product was dissolved in 12 µL Hi-Di formamide and
mixed with brief vortexing. The tubes containing dissolved DNA fragments were
transferred to a 96-well sample plate or a PCR plate and covered with a piece of
33
transparent stick tape. After heated at 95 ºC for 2 min, the plate was placed into a
96-well rack and quickly centrifuged to ensure that the samples were positioned
correctly at the bottom of the wells. Prior to sequencing, the plate was placed on ice or
4 °C. The sequencing was carried with ABI PRISMTM 3100 Genetic Analyzer.
2.2.1.9 Transformation
The sequence verified plasmids were transformed into BL21 star cells (DE3)
using the protocol described previously for protein expression.
2.2.2 Protein manipulation techniques
VP9 proteins used in this study were all expressed using the E. coli system.
2.2.2.1 Small scale test
A small scale test for protein expression is to identify the optimal condition
for protein production. 5 ml LB containing 100 µg/ml ampicillin was inoculated with
a fresh single bacterial colony and incubated overnight at 37 °C with vigorous shaking
(220 rpm) in a 50 ml sterile tube. Pre-warmed 50 ml LB medium in 250-500 ml flask
was inoculated with 1 ml of the overnight culture, supplemented with appropriate
antibiotic, and incubated at 37 °C with shaking (180 rpm) until the OD600 reached 0.6
to 0.8 values. Induction by IPTG with 1 mM final concentration was usually used.
The cells were then grown for another 2-6 hrs or overnight depending on the
temperature (15-37 °C). 1 ml of the sample was then taken at regular intervals, the
cells were pelleted and lysed by sonification, separated on a SDS-PAGE gel and
visualized by Coomasie Blue staining to examine the levels of protein induction.
34
2.2.2.2 Large scale production of recombinant protein
Once the conditions were optimized for protein expression, large-scale
production of recombinant proteins from E. coli was carried out by culturing cells at
the previously optimized conditions. 50 ml LB enriched media were inoculated with a
fresh single bacterial colony and incubated overnight at 37 °C with shaking (220 rpm)
in a 100 ml flask. For minimal medium, 50 µl culture grown in LB media was used as
inoculum, instead of a single bacterial colony. 10-15 ml of the overnight culture was
then pelleted and cells were resuspended in fresh media containing antibiotic and this
culture was then used to inoculate 1 l flasks with the desired medium containing an
appropriate antibiotic, which was then incubated at 37 °C with shaking (180 rpm)
until the OD600 reached 0.7 to 0.8 values (OD was measured using a
spectrophotometer). Once cells reached the desired OD they were induced with upto 1
mM IPTG (final concentration). Cells were harvested 3-4 hrs post-induction and
purified immediately or frozen at -80 °C until further use.
2.2.2.3 SDS-PAGE
SDS polyacrylamide gel electrophoresis (SDS-PAGE) was performed
following Laemmli’s method (Laemmli, 1970). Discontinuous SDS-PAGE with a
stacking gel (pH 6.8, 0.125 M Tris-HCl, 0.1 % SDS and 5 % acrylamide/Bis solution)
and a resolving gel (pH 8.8, 0.375 M Tris-HCl, 0.1 % SDS and 15 % acrylamide/Bis
solution) was performed in 1X SDS running buffer (20 mM Tris Base, 200 mM
glycine, 0.1 % SDS) at 70 volts for 30 min followed by 200 volts for 30-60 min. After
35
electrophoresis, the gel was stained in the Coomassie staining solution (45 %
methanol, 10 % acetic acid and 0.25 % Coomassie Brilliant Blue R-250) for 30-60
min, and then destained with 5 % methanol and 7.5 % acetic acid.
2.2.2.4 Cell storage
The cells that express the fusion protein are stored at -80 °C in the LB
medium with 30-40 % glycerol.
2.2.2.5 Production of polyclonal antibodies
To produce specific antibodies against any protein, normally, 2 mg of protein
will be injected to a 2kg-rabbit for five times with two weeks interval. Finally, the
serum is purified by agarose A (Roche) using the manufacturer’s protocol.
2.2.2.6 Western blot
Two identical SDS-PAGE gels are run side-by-side. One of them was stained
and used as a control. The other one was placed in the electro-blotting buffer for the
transfer of the proteins to a nitrocellulose membrane (GE Osmonics Labstore) at 30
volt for overnight. The nitrocellulose membrane was then blocked with 2.5 % fat-free
milk with 0.5 % BSA in 1X TTBS buffer for 1 h at room temperature. After that, the
membrane was washed three times in 1X TTBS buffer. 15 ml of 15,000X diluted
antibodies was added to the membrane and incubated for 1 h at the room temperature.
The membrane was then washed three times with 1X TTBS buffer. 10 ml of 5000X
diluted goat anti-rabbit IgG was added to the membeane. This was washed three times
with 1X TTBS buffer and stained with the ECL stain (Amersham Biosciences). The
36
film was then developed in the dark room for 5 to 15 minutes depending on the
background.
2.2.2.7 Silver staining
Silver-staining is used to detect proteins with extremely low concentration
(nanogram range). The procedure is given below.
(1) Soak gel for 30 min in fixing solution containing 50 % methanol (CH3OH) and
10 % acetic acid (CH3COOH). Wash gel in water three times for 5 min each.
(2) Soak gel for 1 min in 0.02 % sodium thiosulfate (Na2S2O3). Wash gel in water
three times for 20 sec each.
(3) Soak gel for 10 min in 0.1 % silver nitrate (AgNO3). Rinse with water three
times for 1 min each.
(4) Soak gel in fresh developing solution (add formalin fresh) containing 3 %
sodium carbonate (Na2CO3) and 0.02 % formalin (HCHO) until band intensities
are adequate (1-3 min). Development continues a little after adding acetic acid.
(5) Add 1.4 % EDTA or 5 % acetic acid. Continue shaking for 10 min. Wash gel 10
min in water, then soak in water for 30 min or longer before drying.
37
Chapter 3 Characterization of VP9
38
3.1 Introduction
The complete sequence of WSSV has greatly facilitated the molecular
characterization of this virus and has led to the identification of many WSSV
structural genes. However studies on nonstructural proteins that are required for the
replication of the viral genome, the production of the viral particle, and the inhibition
of the host cell functions are still not available. This report represents the first study
on a novel WSSV nonstructural protein.
In this chapter, molecular cloning, protein expression, and preliminary
characterization of VP9 will be described. Briefly, gene vp9 was cloned into pET15
with six histidine residues at the N-terminus and over expressed in the E. coli system
as a His-tag fusion protein. VP9 was then purified and subjected to biophysical
characterization prior to functional (Chapter 4) and structural studies (Chapter 5).
3.2 Materials and methods
3.2.1 Materials
VP9 specific primers 5’ CGCGCGCATATGGCCACCTTCCAGACTGAC 3’
and 3’ CGCGGATCCTTATTCTGTTGTTGGCAC 5’ (underlines indicate the enzyme
restriction sites) was ordered from 1st Base (Singapore). Nickel-nitrilotriacetic acid
(Ni2+-NTA) agarose was purchased (Qiagen). Figure 3.1 shows the sequence
information of VP9 and pET15b.
39
FIGURE 3.1 WSSV VP9 amino acid sequence and expression vector information. (A) Single-letter amino acid sequence of VP9 protein of WSSV. (B) The pET-15 vector carries an N-terminal His-Tag sequence followed by a thrombin site and three cloning sites, with unique sites shown on the circle map. (C) pET-15b cloning/expression region. Nde I and BamH I are selected for cloning plasmid encoding wild type VP9. (Vector information is derived from Novagen).
40
3.2.2 Construction of the expression plasmid
The full length DNA coding sequence (residues 1-82) of VP9 was amplified
by PCR from the purified WSSV virion and the PCR products were further cloned
into the pET15b vector. The sequence was verified by DNA sequencing. The resulting
construct was transformed into E. coli strain BL-21 (DE3) for protein expression.
3.2.3 Expression and purification of VP9
Initial small scale test indicated that VP9 was a soluble protein. Subsequently,
large scale expression of VP9 was carried out following the protocol mentioned in
Chapter 2. The transformed cells were cultured in LB with 100 µg/ml of ampicillin,
and 1 mM IPTG was added when OD600 value of cells reaches 0.6-0.8. After
subsequent culture at 37 °C for another 4-5 hours, the cells were harvested by
centrifugation at 6000 rpm for 30 min and kept at -20 °C prior to purification (Refer
to Chapter 2 for details).
VP9 was purified under native conditions by Ni-NTA chromatography (AF)
following the manufacturer’s protocol (Qiagen). The cells were lysed by sonication
followed by centrifugation at 18,000 rpm at 4 ºC for 30 min. The supernatant of the
lysate was loaded onto Ni-NTA resin, which was pre-equilibrated with at least 5
column volume of the lysis buffer, with gently shaking for 60 min at 4 °C. The
VP9-bound resin was then washed substantially and eluted with the elution buffer
(chapter 2) containing 250 mM imidazole. For structural study of VP9, his-tag was
cleaved off by thrombin. Basically, after washing of VP9-bound resin, thrombin
41
(100-200 units per 2 mg protein) was added to the resin to cleave the His-tag. The
eluted VP9 fractions from the Ni2+-NTA column were collected and combined for
further purification.
VP9 was further purified using Mono Q ion exchange chromatography. The
starting buffer contains 20 mM Tris (pH 8.0) and the elution buffer comprised of 20
mM Tris (pH 8.0) and 1 M NaCl. The eluted VP9 fractions were collected and
combined prior to size exclusion chromatography (SEC) purification. The combined
VP9 sample was concentrated to a sample volume of less than 2 ml using a
concentrator (Millipore, Singapore). Subsequently, SEC was performed using
Superdex™30 prepgrade (Pharmacia) with the buffer containing 10 mM sodium
phosphate buffer pH 6.8 and 150 mM NaCl.
3.2.4 Mass spectrometry analysis
Protein was desalted using desalting column (Invitrogen) and subjected to
MALDI-TOF mass spectrometry (Protein and Proteomics Center, Department of
Biological Sciences, NUS, Singapore) to verify the molecular weight of VP9.
3.2.5 Dynamic light scattering study
To assess the homogeneity of VP9, the protein was characterized using
dynamic light scattering (DLS) with DynaPro instrument (Protein Solutions Inc). The
concentration of VP9 was adjusted to 1-5 mg/ml range prior to measurement. The
experiment was conducted at room temperature (20-25 °C) and the data were
42
analyzed using Dynamics 5.0 (Moradian-Oldak et al., 1998).
3.2.6 Circular dichroism study
The secondary structure of VP9 was studied by circular dichroism. VP9 was
prepared in 10 to 20 mM sodium phosphate buffer, pH 6.8. The experiment was
conducted in the far UV range (190-260 nm) with Jasco spectropolarimetrer J-720.
Different pH or temperature was applied to access the stability of VP9 under various
conditions.
3.3 Results
3.3.1 Hydrophobicity plot
Figure 3.2 showed the hydrophobicity profile of VP9, which was plotted
using an online software http://www.vivo.colostate.edu/molkit/hydropathy/index.html.
Kyte-Doolittle scale (Kyte & Doolittle, 1982) was applied for the plot to delineate the
hydrophobic character of VP9. The terminal regions were relatively hydrophobic and
the remaining regions of the protein had only two small hydrophobic regions at amino
acid positions 43-49 and 52-59. This profile indicated that overall VP9 is a typical
soluble protein.
3.3.2 Protein purification profiles of VP9
VP9 was cloned into pET15 vector, expressed as a soluble form, purified
43
with AF, IEC, and SEC to achieve the appropriate homogeneity level for downstream
studies. As shown in Figure 3.3, the purity of VP9 reaches 90 % after AF and was
further improved to above 95 % with the use of IEC (Figure 3.3a). The final purity of
VP9 obtained was to approximately 99 % after SEC gel filtration purification (Figure
3.3b).
3.3.3 Mass spectrometry analysis
The result showed that the molecular weight (M.W.) of VP9 was 9499 Da,
which matched the theoretical M.W. of 9492.69 Da (Figure 3.4). The sequence here is
referring to the full length of VP9 (9211.42 Da) plus GSH residues (299.29 Da) at the
N-terminal, which was left after thrombin cleavage.
3.3.4 Dynamic light scattering study
The DLS data showed that VP9 behaved as a 16 kDa protein at the given
condition, possibly undertaking an equilibrium state between monomer (9 kDa) and
dimer (18 kDa) (Figure 3.5).
3.3.5 Circular dichroism study
The CD spectrum measured in the far UV region (190-260 nm) in 20 mM
sodium phosphate buffer (pH 6.8) at 25ºC showed that the secondary structure of VP9
consisted of a mix of α and β structures (Figure 3.6). Interestingly, its secondary
structure remained nearly unchanged when the pH was dropped from 6.8 to 5.2.
44
However when the pH gradually dropped to below 4.2, this conformation was
destroyed and this disruption seemed irreversible because only part of the secondary
structure could refold back (Figure 3.7) when the pH was brought back to 7.2. This
may indicated that VP9 has a comparatively rigid globe structure.
45
FIGURE 3.2 Hydrophobicity plot of VP9 with window size 7. Regions with values above 0 are hydrophobic in character.
46
FIGURE 3.3 Purification profile of His-VP9. (a) 15 % SDS-PAGE shows the purity of His-VP9 after AF and IEC, respectively. Lane M is for protein maker, lane 1 for protein sample after AF purification and lane 2 for protein sample after IEC purification. (b) Gel filtration profile of His-VP9 on Superdex-30 gel filtration column (Amersham).
47
FIGURE 3.4 MS result of native VP9. The result shows the molecular weight of native VP9.
48
FIGURE 3.5 DLS result of VP9. The left window showed that in the given solution, VP9 behaves as a 16kDa protein possibly undergoing equilibrium between the monomer (9 kDa) state and the dimer (18k Da) state. The right window indicates that the signal (unit: count) was within the normal range.
49
FIGURE 3.6 CD result of VP9. Spectrum of circular dichroism in the far UV region (190-260 nm) in 20 mM sodium phosphate buffer (pH 6.8) at 25 ºC.
50
FIGURE 3.7 CD profile of VP9 upon pH changes. pH was decreased gradually from pH 6.8, 6.22, 5.23, 4.11, 3.32, 2.33, 1.67, 1.22 and finally raised to 7.26 at 25 °C.
51
3.4 Discussion
In this chapter, we have elucidated several biophysical and structural
properties of VP9 that provide important information for further studies. Results from
gel filtration (data not shown) and dynamic light scattering indicated that apparent
molecular mass was around 16 kDa, whereas analytical ultracentrifuge (data not
shown) measured the apparent molecular mass to be around 11 kDa. These results
indicated that in solution, VP9 protein might undergo equilibrium between monomer
and dimer states. This interesting feature will be further explored in Chapter 5.
52
Chapter 4 Functional Studies of VP9
53
4.1 Introduction
Currently there are no approved vaccines or antiviral drugs available to
prevent and/or treat WSSV infections. A better understanding of the molecular aspects
of WSSV replication and pathogenesis will be crucial for the development of effective
vaccines and/or antivirals.
A large amount of work has been carried out on the identification and
characterization of WSSV structural proteins, including envelope and other capsid
proteins. However, the functions of most WSSV proteins remain unclear, which is
mainly due to two major reasons: (i) most of the WSSV genes bear poor sequence
homology with other known proteins, and thus the function of these genes cannot be
predicted; (ii) a stable cell line capable of culturing WSSV is not available, making
the cell-based assay impossible.
In this chapter, the functional studies of VP9 will be discussed. Multiple
approaches had been applied to gain a better understanding on the functional nature of
this viral protein. The goals of the conducted experiments were (i) to examine the
gene profiling of vp9 at the mRNA level through the real-time reverse transcription
polymerase chain reaction (RT-PCR); (ii) to reveal the localization pattern of VP9 (VP
for protein name) by immuno-electron microscopy (IEM) in conjunction with western
blot analysis; (iii) to identify the binding partners using pull-down assays.
A better understanding of viral protein function and structure (Chapter 5) will
ultimately boost the development of novel treatments and prevention strategies for
WSSV infections.
54
4.2 Materials and methods
4.2.1 Material
The first strand cDNA synthesis kit and SYBRgreen reagents used for
real-time RT-PCR were purchased from Invitrogen and Qiagen respectively. Healthy
crayfishes were purchased locally (Singapore). The gold-labeled secondary anti-rabbit
antibodies for IEM studies were purchased from Sigma. Other materials were
described in Chapter 2.
4.2.2 Shrimp infection with WSSV
Infected tissue from a Penaeus monodon (P. monodon) shrimp with a
pathologically confirmed infection was homogenized in TN buffer (appendix) at 0.1
g/ml. After centrifugation at 10000 rpm for 10 min, the supernatant was diluted to
1:100 with 0.9 % NaCl and filtered using 0.4 µm filters (Millipore). Aliquots (0.2 ml)
of the filtrate were injected intramuscularly into healthy shrimps (determined by PCR)
in the lateral area of the fourth abdominal segment. At various times post-infection,
specimens were selected at random and their haemolymph was collected and snap
frozen at -80 °C.
4.2.3 WSSV purification
Infected tissue from P. monodon shrimp was homogenized and centrifuged as
mentioned above. The supernatant was injected (1:100 dilution in 0.9 % NaCl)
intramuscularly into healthy crayfish Cherax quadricarinatus (Singapore) in the
55
lateral area of the fourth abdominal segment. After four to five days, freshly extracted
haemolymph from the infected crayfish was layered on the top of a 20-60 % (w/w)
continuous sucrose gradient and centrifuged at 31,000 rpm (SW41-Ti rotor on
Beckman ultracentrifuge) for 2 hours at 4 ºC. Virus bands (located at 40-50 % of
sucrose range) were collected and diluted 1:10 in TNE buffer (appendix) and further
centrifuged at 31,000 rpm for 1 hour at 4 ºC. The resulting pellets were resuspended
in the TNE buffer. The purity of WSSV was examined under the transmission electron
microscope CM 10 (PHILIPS 450K magnification) as described previously (Huang et
al., 2001).
4.2.4 Real-time RT-PCR
4.2.4.1 RNA extraction
100 µg WSSV-infected shrimp gill or stomach tissues were homogenized in 1
ml TRIzol reagent and kept at room temperature for 3 min. Following that, 0.2 ml of
chloroform is added to the mixture and mixed gently before leaving at room
temperature for 10 min. The samples were then centrifuged at 14,000 rpm for 15 min
at 4 °C. The upper supernatant was carefully collected and mixed gently with 0.5 ml
isopropanol. The samples were centrifuged at 14,000 rpm for 10 min at 4 °C after
incubation for 10 min at room temperature . The RNA pellets were washed with 1 ml
of 80 % ethanol by vortexing and harvested by centrifuging at 13000 rpm for 5 min at
4 °C. The RNA pellets were air dried before dissolving in an appropriate volume of
56
Diethylpyrocarbonate (DEPC)-treated water. After measuring the concentration at
OD260, the samples were stored at -80 °C for future use.
4.2.4.2 Reverse transcription
For RT-PCR, total RNA isolates were transcribed into cDNA using the
SuperScript III 1st Strand Synthesis System (Invitrogen) according to the
manufacturer’s instructions. A sample mix consisting of 5 µg total RNA, 1 µl random
hexamers (50 ng/µl), 1 µl dNTP mix (10 mM), and DEPC-treated H2O making up to
10 µl was prepared. The mixture was then incubated at 65 °C for 5 min and chilled on
ice for 1 min. A reaction master mix containing 2 µl of 10X RT buffer, 4 µl of 25
mM MgCl2, 2 µl of 0.1 M DTT and 1 µl of RNAaseOUT was prepared, added to the
sample mix and mixed well, and then place at room temperature for 2 min. After that
add 1 µl (50 units) of SuperScript III RT to each tube, mix and incubate at 25 °C for
10 min. Following that, the tubes were incubated at 42 °C for 50 min and heat
inactivated at 70 °C for 15 min and chilled on ice. 1 µl RNase H was added to the
cDNA mixture to remove any remaining RNA present and incubated at 37 °C for 20
min. The cDNA was stored at -20 °C for further use.
4.2.4.3 Real-time PCR
The cDNA obtained was diluted 10 times for realtime RT-PCR reactions.
Each cDNA sample, equivalent to 50 ng of total RNA, was then used in the real-time
RT-PCR reaction. The primers specific for the various genes examined are shown in
57
Table 4. Real-time RT-PCR conditions were optimized by adjusting the annealing
temperature. PCR was performed using a Light Cycler (Roche Diagnostics) in a total
reaction mixture of 10 µl containing 1x QuantiTect SYBR Green Master Mix
(QIAGEN), 0.5 µM of each primer and 25 ng of cDNA. After initial denaturation at
95 °C for 15 minutes, 40 cycles were performed at 94 °C for 15 seconds, 55 °C for 25
seconds, and 72 °C for 15 seconds. Melting curve analysis was carried out at 65 ºC for
15 seconds to verify the specificity of the amplification reaction. Duplicate reactions
for each specimen were performed. Relative quantification was calculated using the
∆∆CT and 2–∆∆CT method, where ∆CT refers the difference between the CT values of
the target gene and the housekeeping gene, β-actin. The CT value is considered as the
fractional cycle number at which the emitted fluorescence of the sample passes a fixed
threshold above the baseline. A Tukey’s multiple comparison post-test following
one-way-analysis of variance (ANOVA) at a 95 % confidence level was performed
using PRISM version 4.00 for Windows (GraphPad Software).
4.2.5 Localization by Western blot
Purified WSSV virions from crayfish Cherax quadricarinatus was further
separated into envelope and nucleocapsid fractions (Zhang et al., 2004). Briefly, the
intact WSSV particles were treated with 0.5-1.0 % Triton X-100 at room temperature
for 30 min. After centrifugation at 119000g for 2 hours using an SW41-Ti rotor
(Beckman), the pellets were resuspended in 0.1X TNE buffer and centrifuged at
119000g for 2 hours again. The dissolving and centrifugation step was repeated for a
58
few times in order to remove Triton X-100 completely. The purity was examined
using TEM (CM10) before use.
Gills and stomachs from moribund crayfish were homogenized separately in
a lysis buffer (1 % NP-40; 150 mM NaCl, 50 mM Tris pH 8.0, 1 mM DTT, 1 mM
PMSF). 10 µg of each sample was loaded on to a 10-20 % gradient SDS-PAGE ready
gel (Bio-rad) followed by Western blot analysis. For western blotting, three antibodies
used include anti-β-actin, anti-VP28 and anti-VP9. Two identical SDS-PAGE gels
were prepared and one of them was stained and used as a control. The other gel was
placed in the electro-blotting buffer (25 mM Tris-HCl, 190 mM glycine, 20 %
methanol) to transfer proteins to a nitrocellulose membrane (GE Osmonics Labstore)
at 30 volt at 4 °C overnight. The nitrocellulose membrane was then blocked with 2.5
% fat-free milk or 0.5 % BSA in 1X TTBS buffer (3 % BSA, 20 mM Tris-HCl, 0.9 %
NaCl, 0.1 % Tween 20, pH 7.2) for 1 h at 25 °C. Following that, the membrane was
washed three times in 1X TTBS buffer. Primary antibody at 1:15,000 dilution was
added to the membrane and incubated for 1 h at 25 °C. The membrane was then
washed three times with 1X TTBS buffer before adding 1:5000 diluted goat
anti-rabbit IgG. The membrane was stained with ECL stain (Amersham Biosciences)
after washing for three times with 1X TTBS buffer. The film (Pierce) was then
developed in the dark room for 5 to 15 minutes depending on the background signal.
4.2.6 Localization by immuno-electron microscopy
The purified WSSV virion suspension and nucleocapsids were mounted onto
59
carbon-coated nickel grids (150 mesh). After incubation at room temperature for 1
hour, the grids were washed with PBS and incubated with three antibodies including
anti-VP28, anti-VP664 and anti-VP9 for 1 hour followed by washing with PBS.
15-nm-gold-labeled anti-rabbit IgG (Sigma) was added to the grids and incubated for
1 hour. After negatively stained with 2 % phosphortungstic acid, the specimens were
examined with TEM (CM10).
To reconfirm the authenticity of VP9, total tissue lysates were separated by
performing a 10-20 % gradient gel (Biorad) in parallel with the gel for Western blot.
A protein band at approximately 9 kDa was found and analyzed with in-gel trypsin
digestion MALDI TOF-TOF MS analysis as described previously (Song et al., 2004).
4.2.7 Pull down assay
4.2.7.1 Bait protein preparation
VP9 serves as the ‘bait’ to immobilize the interacting proteins in this pull
down assay thus a sufficient amount of purified bait protein is needed. VP9 was
expressed as His-tagged protein in E.coli BL-21 for 4½ hrs at 37 °C. The cell
suspension was spun down at 6000 rpm for 30 min followed by sonication. After
spinning down at 18000 rpm for 30-45 min at 4 °C, the supernatant containing the
highly soluble target protein was micro-filtered (0.45µm) (Millipore) to remove the
trace debris. The pre-equilibrated Ni-NTA Agarose Beads (50µl per 25µg total protein)
were then added in to the supernatant and washed with abundant buffer and finally
eluted with buffer containing 250 mM imidazole as similar to native VP9 purification
60
(Chapter 3). Based on the elution profile, the most highly concentrated fractions
(F1-F5) was combined and concentrated for further purification by gel filtration
chromatography
4.2.7.2 Prey protein preparation
Potential binding partners that originate from the host and the virus itself
were applied. Samples from haemolymph were extracted from the heart of live shrimp
and the gill tissue from either of an infected or healthy shrimp was dissected by
removing the head plate and manually homogenized. One volume of anticoagulation
buffer (30 mM tri-sodium citrate, 26 mM citric acid, 20 mM EDTA and 15 mM NaCl,
pH 5.5) was added to the haemolymph from a healthy shrimp to prevent clotting of
the sample.
Five shrimp samples for each group (Table 5) were harvested at the end of
the third or fourth day after infection and processed immediately.
4.2.7.3 Pull down by Ni-NTA agarose beads
The Protein-Protein Interaction kit (ProFoundTM Pull-Down, Pierce) was first
employed to screen for binding partners of VP9. Following the manufacturer’s
instructions, the PBS buffer was prepared and then applied to the mini-spin column at
4 °C overnight. After incubation with potential prey proteins, Ni-NTA agarose beads
with His-VP9 were washed with buffer, followed by SDS-PAGE analysis. The
protocol was further optimized by the use of Polyprep columns (BioRad) for more
61
gentle separation of the protein bound beads from the solution. In order to amplify the
possible signal and therefore enhance the background from SDS-PAGE, an increased
amount of 100 µl Ni-NTA Agarose Beads (Qiagen) saturated with approximately
0.5-1 mg of the bait protein (His-VP9) was used. A large volume of prey protein
sample solution (800 µl) was also applied. With that, a higher amount of the elution
buffer volume was used.
4.3 Results and discussions
4.3.1 Real-time RT-PCR
The vp9 transcript was detected from 2 hours post infection (h.p.i.) while
dnapol and vp28 (WSSV late gene) were only detected from 10 h.p.i. These results
indicated that vp9 is an early gene, which might code for a nonstructural protein. The
level of vp9 transcipt was found to be nearly identical to dnapol or vp28 at 10 to 72
h.p.i. (Table 6). Statistical analysis (Figure 4.1) using ANOVA showed no significant
difference (p>0.05) between the transcript levels of vp9 and dnapol or vp28 (except in
24 h.p.i.) respectively. However at 24 h.p.i, there was a significant increase of vp28 as
compared to vp9 (p>0.05). This might be due to the large amount of viral particles
being assembled at this point of post infection time. The transcriptional profile from
real-time RT-PCR agreed well with the results by western blot, mass spectrometric
(MS) and immuno-electron microscopy. These experimental evidences strongly
support that VP9 is a full-length nonstructural WSSV protein with high abundance
62
both at mRNA and protein levels.
4.3.2 Localization
Western blot analysis was used to establish VP9 as a non-structural protein.
This study revealed that the anti-VP9 antibody recognized a protein band of 9 kDa not
from WSSV virion or uninfected tissues (Figure 4.2 A, B, C) but only from the
WSSV-infected stomach (Figure 4.2 D) and gills (Figure 4.2 E). Furthermore,
anti-VP9 antibody failed to recognize VP9 from both envelop and nucleocapsid
fractions from WSSV virions (Figure 4.2 F, G). This band was analyzed by mass
spectrometry and its identity was confirmed as VP9 by N-terminal sequencing (Figure
4.3). The observation that VP9 was detected only from the WSSV-infected tissues but
not from purified virions was consistent with our immuno-gold labeling experiment
results, which showed no gold labeling signal by transmission electron microscopy
(Figure 4.2 H, I, J). As all protein samples were equally loaded and the size of VP9 (9
kDa) is nearly one third of VP28 (28 kDa), therefore it was suggested that the
expression level of VP9 protein to VP28 (one of the most abundant viral structural
proteins) was nearly 1 to 1. These results confirmed that VP9 is a full-length
nonstructural WSSV protein with high abundance at protein level.
4.3.3 Pull down assay
Figure 4-4 shows the protein purification profile of His-VP9 as a bait protein.
After pull down assay, protein mix was characterized with SDS-PGAE followed by
63
silver staining. Four bands (indicated by arrows) were identified as specific prey and
were excised and processed for TOF-TOF analysis (Figure 4-5).
All samples yielded clear TOF-TOF spectra, though only two (band 1 and 3)
out of four show significant hits for a database search with in silico digest up to date.
The database results indicated that the protein band 1 was a hemolymph clottable
protein precursor with a bit score of 111 (Figure 4.6). The protein band 3 was
confidently identified as hemocycanin from P. monodon with a bit score of 129
(Figure 4.7). As WSSV interferes with the blood coagulation mechanism in the
infected host, a protein-protein interaction between VP9 and these proteins might
reveal an interesting aspect for future research. All TOF-TOF samples showed
reasonable spectra, but a database search failed to identify any proteins matching to
two samples. Considering the unavailability of the complete shrimp EST-database, it
was speculated that such two proteins were possibly from shrimp instead of WSSV.
Further data analysis will be attempted once the complete shrimp genome database
becomes available.
For future pull down experiment, however several aspects should be
considered: (i) the results should be reproducible (e.g. specificity) for each new batch
of shrimp samples; (ii) a complete cell lysis by sonication should make it more
accessible to all intracellular proteins; (iii) the use of proteinase inhibitors is necessary
throughout the experiment to prevent degradation of potential binding partners; (iv)
high concentration of applied samples will provide a possibility to spot even low
amounts of binding proteins at SDS-PAGE analysis; (v) protein quantitation of all
64
samples plays a big role in assuring comparability of different samples taken from
different animal tissues.
FIGURE 4.1 Transcriptional analysis of WSSV proteins by Real-time RT-PCR. In this study relative quantification was calculated using ∆CT, where ∆CT refers the difference between the CT values of the target genes and the housekeeping gene β-actin. ∆CT value for vp9 (wsv230) is colored in blue, dnapol (wsv514) in black and vp28 (wsv421) in red.
65
FIGURE 4.2 Localization analysis of VP9 by western blotting and IEM. (A) WSSV virions; (B) Non-infected stomach; (C) Non-infected gill; (D) WSSV-infected stomach; (E) WSSV-infected gills; (F) Envelope fraction; (G) Nucleocapsid fraction; and by immuno-electron microscopy (IEM) using (H) anti-VP28 (envelop protein) as positive control, (I) anti-VP664 (nucleocapsid) as positive control and (J) anti-VP9 respectively.
66
FIGURE 4.3 Confirmation of molecular weight of VP9 by mass spectrometry. Mass spectrometry identified VP9 as a real protein. The band appeared at 9 kDa was excised from the gel and subjected to LC-MS/MS analysis. The identified peptide sequences were indicated by bold letters (a), which suggested that this protein was the translated product of gene vp9. (b) shows nano-ESI-MS spectrum of protein VP9.
67
TABLE 4 Primers sequences for real-time RT-PCR
Gene Sense Anti-sense
wsv514 5’TTGAGAGCGATAAGACGGCAA3’ 5’AAGCCATAGCCACGTCCTTTC3’
wsv230 5’CCAGACTGACGCCGATTTCTT3’ 5’CGATGCCTCCATTGAGGACAAA3’
wsv421 5’CTTTCACTCTTTCGGTCGTGTC3’ 5’CTCAGCAGTCACAGGAATGCG3’
β-actin 5’AACTCCCATGACATGGAGAACATC3’ 5’TCTTCTCACGGTTGGCCTTG3’
68
TABLE 5 Legend for prey protein samples
code denotation explanation HB healthy blood (hemolymph of control group) IB infected blood (hemolymph of infected group) HT healthy tissue (homogenized gill tissue of control group) IT infected tissue (homogenized gill tissue of infected group) + positive control
(without prey protein)
unspecific binding of E.coli proteins to beads - negative control
(without bait protein)
unspecific binding of WSSV or shrimp proteins to beads
69
TABLE 6 Real-time RT-PCR analyses of vp9, vp28 and dnapol from 0 to72 h.p.i
Gene of interest h.p.i Gene CT values
β-actin CT values
∆CT
0 NC 23.255±0.015 NC 2 34.950±0.050 25.290±0.310 9.660±0.2604 37.900±0.300 21.980±0.070 15.920±0.3706 36.075±0.815 23.920±0.030 12.155±0.845
10 36.110±0.030 25.200±0.370 10.910±0.40012 34.545±0.635 20.660±0.060 13.885±0.57524 28.860±0.370 22.795±0.015 6.065±0.355
vp9
72 12.975±0.635 19.065±0.925 -6.090±0.290
0 NC 23.255±0.015 NC 2 NC 25.290±0.310 NC 4 NC 21.980±0.070 NC 6 NC 23.920±0.030 NC
10 37.310±3.690 25.200±0.370 12.110±3.32012 33.740±1.810 20.660±0.060 13.080±1.75024 24.140±0.370 22.795±0.015 1.345±0.385
vp28
72 11.340±0.640 19.065±0.925 -7.725±0.285
0 NC 23.255±0.015 NC 2 NC 25.290±0.310 NC 4 NC 21.980±0.070 NC 6 NC 23.920±0.030 NC
10 34.335±0.245 25.200±0.370 9.135±0.12512 31.865±0.975 20.660±0.060 11.205±1.03524 26.845±0.085 22.795±0.015 4.050±0.070
dnapol
72 12.690±0.810 19.065±0.925 -6.375±0.115
70
FIGURE 4.4 His-VP9 Bait protein purification profiles. (a) 12 % SDS-PAGE shows elution fraction 1 to 10 after Ni-NTA affinity chromatography (AC); (b) Elution profile of F1 to F5 from AC (a) by Superdex 30; (c) 12 % SDS-PAGE shows D2 to D8 elution fractions from the major peak from (b).
71
FIGURE 4.5 12 % SDS-Page analysis (maxi-gel) of prey capture (silver stain). (M) Marker; (–) negative control using healthy haemolymph; (+) positive control; (HB) healthy blood; (IB) infected blood; (IT) infected tissue; volume of elution fractions equivalent to 400µl.
72
FIGURE 4.6 MS results for protein (band 1). (a) indicates that the M.W of protein identified was ~180 kDa; (b) shows the results of TOF-TOFdata base search.
73
FIGURE 4.7 MS results for protein (band 3). (a) indicates that the M.W of protein identified was ~52 kDa; (b) shows the results of TOF-TOFdata base search.
74
Chapter 5 Structural Studies of VP9
75
5.1 Introduction
Though the functional studies (Chapter 4) demonstrated that VP9 maybe an
important protein based on the transcriptional analysis and localization studies, the
exact cellular function of VP9 still remains unclear. Structure-based functional
analysis serves as an important approach for elucidating the function of proteins.
Currently, the state-of-the-art technologies for protein structure determination include
X-ray crystallography and Nuclear Magnetic Resonance. Considering that both
technologies have their own advantages and disadvantages, and they can be
complementary to each other, both techniques have been employed independently to
determine the structure of VP9.
In this chapter, the structure determination of VP9 by both X-ray and NMR
will be discussed in detail.
5.2 Materials and methods
5.2.1 Materials
Isotopic materials for NMR studies were all purchased from Cambridge
Isotope Laboratories Inc.. The chemicals and reagents for X-ray studies were
purchased from Sigma, Merck or Hampton research (see Chapter 2 for details).
76
5.2.2 X-ray studies
5.2.2.1 SeMet VP9 preparation
SeMet VP9 was produced using the same bacterial strain grown in M9
medium, in which 100 mg/L of lysine, 100 mg/L of phenylalanine, 100 mg/L of
threonine, 50 mg/L isoleucine, 50 mg/L leucine, 50 mg/L valine and 60 mg/L of
L-selenomethionine was added when OD600 reached about 0.6 to 0.9 (Doublie et al.,
1992). The SeMet VP9 was purified using the same protocol as the native VP9.
5.2.2.2 Crystallization
Purified native VP9 was concentrated to approximately 20 mg/ml in a buffer
consisting of 20 mM Tris pH 8.0, 100 mM NaCl. The protein was crystallized by the
hanging drop vapor diffusion method at 25 ºC. Initial crystallization screening was
performed using the sparse matrix approach using kits from Hampton Research
(Screen I and II). During screening, 1 µl protein solution was mixed with 1 µl
reservoir solution. The initial condition was further optimized to obtain the best
diffracting crystals with a reservoir solution consisting of 2 M sodium acetate, 100
mM MES pH 6.3, 25 mM cadmium sulphate and 3 % glycerol. Crystals grew to
approximate sizes of ~0.2 X 0.2 X 0.1 mm3 within 7 days.
5.2.2.3 Data collection
Prior to mounting, both native and Se-Met crystals were briefly soaked for
77
around 10 seconds in a cryo-protectant solution consisting of a mixture of 50:50
mineral oil to paraffin oil using a nylon loop and flash cooled at 100 K in a nitrogen
gas cold stream (Oxford Cryosystems, Oxford, UK). Synchrotron data was collected
at X12C, beam-line, NSLS, Brookhaven National Laboratory, New York, USA.
5.2.3 NMR studies
5.2.3.1 Sample preparation
15N and 15N/13C-labeled VP9 were prepared in M9 medium with the addition
of (15NH4)2SO4 for 15N labeling and (15NH4)2SO4 and [13C] glucose for 15N/13C double
labeling, respectively. The samples for NMR spectroscopy were concentrated and
dialyzed against 20 mM sodium phosphate buffer with pH 6.8. Typically, the sample
concentration varied from 0.3 to 1.0 mM. Finally, 450 µl of protein solution was
mixed with 50 µl of D2O (final concentration is 10 %) and transferred to an NMR
tube (Cambridge Isotope Laboratories, Inc.). All samples were examined by 15 %
SDS-PAGE after purification.
5.2.3.2 NMR experiments and data process
All NMR spectra were acquired at 298 K on a Bruker 500 or 800 MHz
spectrometer. 1H-15N-HSQC spectra (Mori et al., 1995) were recorded with 128
increments in the indirect 15N dimension with scans varying from 4 to 1024
depending on the concentration of individual samples. Measurement times ranged
from 2 to 24 hrs. The NMR experiments included 15N-edited HSQC, HNCACB, and
78
CBCA (CO) NH for backbone assignments, 3D-TOCSY, 3D-NOESY and
HCCH-TOCSY for side-chain assignments. All NMR data were processed with
NMRPipe (Delaglio et al., 1995) and analyzed with NMRView (Johnson, 2004).
Structure calculation was performed with the program CYANA (Herrmann et al.,
2002). Distance constraints were obtained from 1H/1H NOEs derived from 15N-
NOESY and 13C-NOESY spectra. Hydrogen bond restraints were derived from
HSQC-based hydrogen-deuterium exchange experiment. The phi and psi angle
constraints were generated from TALOS program (Cornilescu et al., 1999). Ten
conformers with the lowest final values of the CYANA target function were chosen to
represent the most probable structures.
5.2.3.3 NMR relaxation studies
The understanding of protein function is incomplete without the study of
protein dynamics. NMR spectroscopy is valuable for probing nanosecond and
picosecond dynamics via relaxation studies. The use of 15N relaxation to study
backbone dynamics has become virtually standard (Fischer et al., 1998).
The 15N relaxation times T1, T1ρ and 1H-15N NOEs were measured by
inverse-detected 2D NMR methods (Farrow et al., 1995; Mandel et al., 1996).
Relaxation time T1 was determined by collecting 8 points with delays of 50ms, 100ms,
300ms, 500ms, 600ms, 700ms, 800ms and 1s. Relaxation time T1ρ was calculated by
collecting 8 points with delays of 10ms, 40ms, 70ms, 90ms, 110ms, 130ms, 150ms
and 160ms. To measure the heteronuclear NOEs, two spectra were acquired with and
79
without proton saturation. All the data were recorded by using 200 and 1024 complex
points in t1 (1444.8 Hz) and t2 (8012.8Hz) dimensions, respectively. Spin-spin
relaxation time T2 was calculated from T1 and T1ρ according to the formula below:
1/ T1ρ = 1/ T1 sin2θ + 1/ T2 cos2θ
where θ = atan (∆ω/ω1), and ∆ω and ω1 are the resonance offset and spin-lock field
strength, respectively. Relaxation data were processed and analyzed by the reduced
spectral density mapping approach.
5.2.3.4 NMR metal titration
In order to study the interaction between VP9 and various divalent metals,
2D 1H-15N HSQC spectra of the 15N-labeled VP9 were measured at a concentration of
0.1 mM in the absence and presence of divalent metals such as Zn2+, Cd2+, Ca2+ and
Mg2+. The final ratio of the VP9 to metal was 1:4. The perturbed residues were
assigned by superimposing the two 15N-HSQC spectra in the absence and the presence
of different metals.
5.3 Results and discussions
5.3.1 X-ray studies
5.3.1.1 SeMet VP9 preparation
The purity of SeMet VP9 was shown in Figure 5.1. The results indicated that
SeMet VP9 was pure enough for crystallization.
80
5.3.1.2 Crystallization
Both native and Se-Met substituted VP9 crystals grew under essentially the
same conditions and both belonged to the same crystal form with similar cell
parameters. The diffracting crystals are shown in Figure 5.2.
5.3.1.3 Data collection
X-ray fluorescence spectra recorded for the crystals of Se-Met VP9 near the
Se absorption edge were analyzed with the program CHOOCH (Evans et al., 2001) to
determine correct energies for the measurement of anomalous and dispersive
differences. Complete MAD datasets were collected at two wavelengths (peak and
edge) using a Quantum 4 CCD detector (Table 7). Diffraction data were processed
using the program HKL2000 (Otwinowski et al., 1997). The resolution of the data
extends up to 3.3 Å. The initial attempts for phase calculation were not successful.
Since native crystals diffracted better than the Se-Met substituted crystals, a complete
sulphur SAD data set on the native crystals of VP9 was collected (Table 7). The data
collected were at the wavelength 1.7 Å with an oscillation of 1.0 degree using a CCD
detector at a resolution of 2.35 Å. Diffraction data were processed using the program
HKL2000 (Otwinowski et al., 1997). The crystals belong to the space group P212121
with a=73.33, b=76.97, c=78.37 Å. A value of VM of 2.9 Å3Da-1 was calculated
according to Matthews (Matthews, 1968) assuming the presence of four molecules in
81
the asymmetric unit. Based on this calculation the solvent content was estimated to be
around 57.5 %. Subsequently, a high-resolution dataset was collected up to 2.2 Å
(Table 7).
5.3.1.4 Structure solution and refinement
For phase determination, the resolution range of 2.6 to 20.0Å was chosen.
During phasing trials, a strong anomalous contribution from Cd2+ was identified with
appropriate f` and f”. Assignment as Cd2+ was consistent with the high concentration
of CdSO4 that was essential for crystallization. This interpretation explains why SAD
phasing around the S absorption edge was unsuccessful due to the weak S signal.
Initial phase calculations were carried out with SOLVE (Terwilliger, 2002).
Subsequent heavy-atom refinement and density modification was carried out using
SHARP (Fortelle et al., 1997). The resulting phase gave an overall figure of merit of
0.69. The starting electron density map was further improved by phase extension up
to 2.35Å using the program wARP, which was able to trace the main chain atoms up
to ~38 % of the model. The remaining parts of the model were built manually using
the program O (Jones et al., 1991). Further cycles of model building alternating with
refinement using the program CNS (Brunger et al., 1998) resulted in the final model,
with an R-factor of 0.225 (Rfree= 0.275) to 2.35Å resolution with no σ-cutoff used
during refinement. NCS restraints were used only during the initial stage of
refinement. The final model comprises 316 residues (4 molecules), 8 Cd2+ ions and
125 water molecules in the asymmetric unit. The first well-ordered residue was Ala2.
82
The last two residues and the first three residues of the linker region could not be
traced in the electron density map and were not modeled. Validation of the model was
checked using the program PROCHECK (Laskowski et al., 1993).
5.3.1.5 Crystal structure of VP9
The crystal structure of VP9 from WSSV was determined by the single
wavelength anomalous dispersion (SAD) method from synchrotron data and refined
to a final R-factor of 0.225 (Rfree=0.275) at 2.35Å resolution (Figure 5.3). The VP9
model was refined with good stereochemical parameters (Table 7). The asymmetric
unit consists of four molecules comprising 79 residues each from Ala2 to Thr80 and a
total of 125 water molecules. The monomer of the VP9 molecule adopts a mixed α/β
fold with overall dimensions of 32 Å x 25 Å x 20 Å. A total of six β-strands and two
α-helices are found per molecule. The anti-parallel β-strands β3↑β4↓β2↑β6↓ assemble
into a single β-sheet (β-sheet I), which forms one face of the molecule. β-sheet II is
rather small consisting of only two β-strands β1↑β5↓. The two α-helices α1 and α2
and β-sheet II are packed on the same side of the β-sheet I.
In the crystal, dimers of the asymmetric unit are related by a 2-fold
non-crystallographic symmetry (NCS) approximately parallel to b-axis. Of the eight
Cd2+ ions of an asymmetric unit, five of them formed an almost perfect tetrahedral
coordination sphere, whereas the remaining three had five coordinating atoms. In
every case at least one water molecule was involved in the coordination. In the
coordination sphere, the distance between the Cd2+ and the coordinating oxygen or
83
sulfur atoms ranged from 1.9 to 2.3 Å. Cd2+ ions coordination were found at the
monomer interface of the dimer between the side-chains of Asp9, Cys46 of one
monomer and Glu31 of second monomer of the dimer. These inter monomer
coordination bonds maintained the rigid architecture of the VP9 dimer. Three Cd2+
ions were found to be in the dimerization region of the VP9 dimer. In addition,
hydrogen bonding and extensive hydrophobic interactions participated in the
stabilization of the dimer. There are 5 inter monomer hydrogen bonding contacts
(<3.2 Å). Interactions of the monomers within the dimer mainly comprised of ß-sheet
I, α2-helix and its connecting loop from each monomer.
84
FIGURE 5.1 Final purification profile of VP9. Purity of VP9 was characterized by 15 % SDS-PAGE followed by Coomassie Blue staining. Lane M, protein markers; (a) Lane 1, purified native VP9. (b) Lane 2, purified SeMet VP9. (c) The gel filtration profile of VP9 together with maker proteins. This shows that VP9 was eluted as a dimer.
85
FIGURE 5.2 Crystals images of VP9. (a) Native. (b) SeMet under nomal light microscope equipped with a polarization filter system.
86
TABLE 7 Data collection and refinement statistics
Data Set Refinement Phasing Cell parameters (Å) a= 74.13, b=78.21, c=78.98 a=73.23, b=76.97, c=78.24 Space group P212121 P212121
Data collection Resolution range (Å) 2.2-50.0 Å 2.3-50.0Å Wavelength (Å) 1.1 1.7 Observed hkl 249473 214496 Unique hkl 43491 38474 Completeness (%) 99.1(2.30-2.2, 95.4 %) 97.4(2.35-2.3, 78.4 %) Overall (I/σI) 15.6 17.5 Rsym
a (%) 6.3 5.7 Refinement Resolution range (Å) (I>σ(I) Rwork
b (no. of reflections) Rfree
c (no. of reflections) RMSD bond lengths (Å) RMSD bond angles(deg)
2.35 – 45.0 0.225(34301) 0.275(1821) 0.012 1.7
Average B-factors (Å2) Main chain atoms
Side chains atoms
45.349 50.347
Ramachandran Plot Most favored regions (%) Additional allowed regions (%) Generously allowed regions (%) Disallowed regions (%)
93.2 6.5 0.4 0.0
a Rsym = |Ii - <I>|/ |Ii| where Ii is the intensity of the ith measurement, and <I> is the mean intensity for that reflection. b Rwork = | Fobs - Fcalc|/ |Fobs| where Fcalc and Fobs are the calculated and observed structure factor amplitudes, repectively. c Rfree = as for Rwork, but for 6 % of the total reflections chosen at random and omitted from refinement.
87
FIGURE 5.3 Ribbon diagram of crystal structure of VP9. Two dimers of one asymmetric unit with four cadmium ions (blue spheres) are shown. VP9 is shown as ribbons with α-helix in red, β-sheet in cyan and random coil and loop in grey.
88
5.3.2 NMR studies
5.3.2.1 Sample preparation
The purity of VP9 samples for NMR studies were characterized by
SDS-PAGE (Figure 5.4).
5.3.2.2 NMR structure
The solution structure of VP9 was also determined by heteronuclear,
multi-dimensional NMR spectroscopy. Ten conformers with the lowest target
function values were chosen to represent the most probable structures from 100
randomized starting models (Figure 5.5). Assignment of backbone and side-chain
resonances was accomplished by a combination of double- and triple-resonance
experiments. Briefly, backbone assignments were complete except for two proline
residues. More than 92 % of side-chains were assigned. The final NMR structure of
the full length VP9 was calculated and refined with the CYANA program. This
calculation was based on manual and auto-assigned 1572 distance restraints (548
intra-residue, 349 sequential, 212 medium-range and 463 long-range) and 74
backbone dihedral-angle restraints (Table 8). The Ramachandran map indicated that
the majority of the residues (84.9 %) had angular averages in energetically most
favorable regions, 15.1 % in additional allowed regions and none in the generously
allowed or disallowed regions.
89
5.3.2.3 NMR relaxation studies
Relaxation rate fitting was performed with Matlab6.5 Release 13 (The
Mathworks, Natick, NJ). The data were shown in Figure 5.6. The results indicated
that the M.W. of VP9 appears to be around 12 kDa in solution.
90
FIGURE 5.4 SDS-PAGE of NMR samples. Lane M, protein maker; Lane 1, control; Lane 2, H2O sample without Histag; Lane 3, D2O sample without His-tag; Lane 4, 15N/ 13C sample without His-tag; Lane 5, 15N sample without His-tag.
91
FIGURE 5.5 Ribbon diagram of NMR structures of VP9. Ten lowest-energy structures of VP9 superimposed as ribbons with α-helix in red, β-sheet in cyan and random coil and loop in grey.
92
TABLE 8 NMR structural statistics
Restraints used in the structure calculation Number of distance constraints Total 1572 Intra-residue ( |i-j| = 0 ) 548 Sequential ( |i-j| = 1 ) 349 Medium range (1 < |i-j| < 5 ) 212 Long range (|i-j| >5) 463 Number of torsion angle constraints 74 Φ 37 Ψ 37 Number of hydrogen bond restraints 24 Residual violations in the DYANA calculation Residual DYANA target function value (Å2) 0.45 Residual NOE distance constraint violations a Number > 0.1 Å 1 Residual dihedral angle constraint violations a Number > 5.0 degrees 0 Geometric statistics Average backbone atoms RMSD to mean (Å) b 0.37+0.07 Average heavy atom RMSD to mean (Å) b 0.87+0.13 Ramachandran analysis c Residues in most favored regions (%) 84.9 Residues in additional allowed regions (%) 15.1 Residues in generously regions (%) 0.0 Residues in disallowed regions (%) 0.0 Ten structures with the lowest CYANA target function are selected out of 100 structures calculated
using CYANA from randomized staring structures. a Constraints violated in beyond five structures.
b RMSD for residues from 2 to 80. c Residues from 1 to 82.
93
FIGURE 5.6 NMR relaxation results. 15N R1, 15N R2, and heteronuclear NOEs for VP9 (black square). The average T2 of VP9 is around 110-120 ms.
94
5.3.3 VP9 interacts with metals
5.3.3.1 Metal binding sites
In the electron density map of the native protein, there were eight strong
peaks corresponding to metal ions (Figure 5.7). Based on the coordination we have
interpreted these peaks as Cd2+ ions. It is worth mentioning here that the Cd2+ ions
were essential for crystallization; these metal ions must have been acquired during the
crystallization process. The presence of tightly bound divalent metal ions has been
previously reported for the structural homologs of VP9 (Banci et al., 2002;
Rosenzweig et al., 1999).
It is noteworthy to observe that during crystallization, VP9 was unable to
crystallize in the absence of Cd2+ and even a reduction of the Cd2+ concentration led
to the destabilization of crystals, strongly indicating the crucial role of Cd2+ ions to
form intermolecular contacts for crystal formation (Figure 5.8). Various divalent metal
ions are integral parts of several viral proteins and are necessary for their survival and
pathogenesis (Chaturvedi et al., 2005). These bound metal ions are also required for
nucleocapsid protein-transactivation response (TAR)-RNA interactions. Zinc, is the
most common divalent metal ion that influences a variety of viral infections
(Chaturvedi et al., 2005). Proteins from viruses such as HIV-1, Hepatitis C, Hepatitis
B, Herpes Simplex, Pox, Rubella, Influenza, Corona, Human Papilloma, Ebola,
Picorn and Rotavirus essentially bind with Zn2+ and carry out the host infection
respectively (Chaturvedi et al., 2005). In VP9, the observed divalent metal ion
coordinates with Asp, Glu and Cys. Since there is no histidine and only one cysteine
95
is present in the sequence of VP9, the observed coordinating side-chains could be
considered as an unconventional binding site for Zn2+. Recently, Wuxian et al (Shi et
al., 2005) reported a similar unconventional Zn2+ binding site with His, Asp and Glu.
VP9 has identical coordinating side-chains except that histidine is replaced by
cysteine. In the crystal, substitution of Cd2+ ions for the natural Zn2+ binding sites has
been observed. Similar substitutions from the crystallization buffers have been
previously reported (Shi et al., 2005). In VP9, all the natural Zn2+ binding sites might
be taken up by the Cd2+ ions present in the crystallization solution. To further verify
this fact, the NMR titration experiments with various divalent metal ions were carried
out.
96
FIGURE 5.7 Simulated-annealing Fo-Fc omit map in the dimerization region of VP9. All the three cadimum ions (green) and all atoms within 3.5 Å of cadmium ions were omitted prior to refinement and map calculation. The map was contoured at a level of 2.5 σ. This figure was prepared using the program Bobscript.
97
FIGURE 5.8 Stick representation for the cadmium coordination sphere. Yellow dash line indicates the coordination bond. Cd2+ in green and water molecule in red respectively. Asp9, Cys46 and Glu31 from one monomer are shown in cyan and the other in magenta.
98
5.3.3.2 NMR metal titration
The results indicated that only Zn2+ and Cd2+ were able to bind with VP9.
Therefore we have monitored the binding interaction between 15N-labeled VP9 and
zinc/cadmium. Figure 5.9a shows the binding profiles of VP9 with Zn2+. A detailed
analysis of the HSQC titration resulted in the identification of 42 perturbed peaks that
either disappeared or underwent chemical shifts. Peaks disappeared because of NMR
resonance broadening, indicating that binding led to a significant increase in the
conformational exchange on the microsecond-millisecond time scale. The pattern for
cadmium was similar to that of zinc (Figure 5.9b). However there is no detectable
interaction between VP9 with either magnesium or calcium (data no shown). Our data
suggested that VP9 binds to both zinc and cadmium.
99
FIGURE 5.9 Dual 1H-15N HSQC spectra of VP9 in the absence (red) and presence (blue) of Zn-sulfate (a) and Cd-sulfate (b). Superimposition of the 1H-15N HSQC spectra of the free form of VP9 in red and in the complex with zinc sulfate/cadmium sulfate in blue at a ratio of about 1:4 at pH 6.72 and 298 K. 42 perturbed peaks that either disappeared or underwent chemical shifts are referring to Asn56, Tyr43, Glu31, Glu72, Arg19, Met44, Leu12, Gln74, Val45, Gly50, Gly57, Leu11, Leu47, Lys35, Leu55, Glu21, Gly14, Thr6, Ile59, Ser36, Val13, Arg63, Asp40, Asp15, Met76, Thr52, Leu48, Cys46, Val78, Ala2, Thr80, Thr81, Ile77, Phe4, Asp7, Ala32, Phe10, Asp9, Leu64, Gln5, Glu61, Leu62. Of 42 perturbed peaks, Asp9, Phe10, Glu31, Val45, Cys46, Leu47, and Leu48 were perturbed the most due to close locations to the metal binding sites.
100
5.3.4 Comparison of crystal structure vs. NMR structure
The three dimensional structures of VP9 were independently determined both
by X-ray crystallography and NMR spectroscopy. The root mean square deviation
(rmsd) between X-ray and NMR models was ~1.194Å for 74 Cα atoms (Phe4 to
Thr76), which indicated a good agreement between the two structures (Figure 5.10). It
is notable that the NMR structure was determined in conditions free of metal ions
whereas the X-ray structure was determined with Cd2+ ions. The observed metal ions
were located on the monomer interface of the dimer as well as on the surface of the
molecule. This suggested that the metal ions were not essential for the folding of VP9.
The structure of VP9 revealed a ferredoxin fold, a well known nucleotide recognition
fold. The following structural description is based on the crystal structure.
5.3.5 Sequence and structural homology
BLAST search reveals that VP9 has sequence homologies to only a few other
WSSV proteins of unknown function. It exhibits a maximum identity of 43 % with
wsv234 and a minimum of 31 % with wsv231 from WSSV. Search for structurally
similar proteins within the PDB database was performed with the program DALI
(Holm et al., 1995). Significant structural similarities were found with several
nucleotide binding and metal transport/binding proteins. The highest structural
similarity was observed between VP9 and Bovine papillomavirus-1 E2 DNA-binding
protein (Pdb code 2BOP) yielding an rmsd of 3.0 Å for 63 Cα atoms with 17 %
sequence identity. This was followed by a metal Transporting ATPase (PDB code:
101
1MWY, rmsd of 2.4 Å for 59 Cα atoms, with 14.6 % identity) and Atx1
Metallochaperone (PDB code 1CC8; rmsd of 2.6 Å for 62 Cα atoms; 13.4 % identity).
These structurally homologous proteins were superimposed in O program (Jones et al.,
1991) and their conformational similarities and differences were examined. Except α2
of VP9 and other small local structural differences, all the secondary structural
elements were comparable and superimposable. α2 of VP9 was in a completely
different disposition. The observed structural differences could be partly responsible
for its functional specificity in WSSV.
102
FIGURE 5.10 Crystal structure vs. NMR mean structure. Superimposition of NMR mean structure (red) on crystal monomer structure (blue) of VP9. This figure was prepared using MOLMOL (Koradi et al., 1996).
103
5.3.6 Functional implications
Based on our results, the dimeric X-ray structure would be biologically
relevant although the crystal packing forces may shift the monomer-dimer equilibrium,
thus favoring the formation of the observed dimeric structure. We propose that in fact
the fast exchange between monomer and dimer in solution may represent a critical
mechanism to facilitate the conformational switch of VP9 required for the proposed
DNA binding.
The dominant transcriptional regulator of the papillomavirus-1 E2 protein,
which shares the closest structure homology to VP9, binds to its DNA target through a
dimeric arrangement of E2. E2/DNA complex has been crystallized (Pdb code 2BOP).
The bound DNA is severely but smoothly bent over the E2 structure through the
interactions between the major grooves and a pair of symmetrically disposed α-helices
of the E2 dimer. The superposition of the VP9 and papillomaviruse-1 E2 bound with
the DNA fragment reveals a possible DNA binding mode of VP9. The specific DNA
sequence for recognition by VP9 has not yet been established. A possible DNA
recognition region is located at the α1 (Thr17-Thr26) and the ß-turn (Ser36-Asp40).
The helix α1 is highly conserved among all structural homologs of VP9. In the
superimposed model the side-chains from Arg19 and Lys25 from α1 is facing the
DNA. Figure 5.11 shows the DNA binding model for VP9. It shows only the
monomer of VP9 superimposed with the monomer of E2 DNA-binding domain. In E2
crystal structure the DNA fragment binds with the dimer. However in the case of VP9,
the superimposed DNA fragment has to undergo a conformational change to engage
104
with both monomers of the dimer. Similar conformational changes upon DNA binding
were previously documented for several DNA protein complexes (Hedge et al., 1992).
Although the exact cellular function of VP9 has yet to be demonstrated, our studies
including the transcriptional, western blot, MS, and immuno-electron microscopy,
have identified VP9 as a novel, nonstructural and abundant protein in the WSSV
infected host tissues. The structure of VP9 is the first structure to be reported for
WSSV proteins. The X-ray and NMR based structural studies revealed that VP9
possesses a DNA recognition fold with specific metal-binding sites. A possible natural
metal co-factor could be Zinc ions (Sivaraman et al., 2005). Taken together, we
speculate that VP9 might be involved in the transcriptional regulation of WSSV
similar to its most structurally homologous counterpart, the E2 protein in the
papillomavirus-1. Our findings have identified a new candidate protein suitable for
further studies towards drug and vaccine development against WSSV infections.
105
FIGURE 5.11 Proposed DNA binding model. Superimposition of E2 monomer (with DNA molecules) on VP9 monomer, DNA is shown in stick representation (blue), E2 in ribbon representation (red), VP9 in ribbon representation (yellow). α1 of E2 and VP9 highlighted in magenta and cyan respectively as shown in the box.
106
Chapter 6 Summary and Future Studies
107
6.1 Summary
The main aim of this work was structural and functional characterizations of
a highly abundant nonstructural protein in WSSV, VP9, which has the potential of
playing an important role in the regulation of gene transcription or translation during
viral infection. The functional studies of this novel protein have been greatly
hampered due to the lack of a suitable cell line. In order to facilitate the
characterization of this functionally important gene, structure-based functional
analyses were applied using NMR and X-ray crystallography.
Despite the exact cellular function of VP9 has yet to be revealed, our studies
including transcriptional analysis, western blot, MS, and immuno-electron
microscopy have identified VP9 as a novel, nonstructural and highly abundant protein
in the WSSV infected host tissues. X-ray crystallography and NMR based structural
studies revealed that VP9 possesses a DNA recognition fold with specific
metal-binding sites to Cd2+ or Zn2+ ions. A possible natural metal co-factor could be
zinc ions (Sivaraman et al., 2005). Taken together, we speculate that VP9 might be
involved in the transcriptional regulation of WSSV similar to its most structurally
homologous counterpart, the E2 protein in the papillomavirus-1. Our findings have
identified a new candidate protein suitable for further studies towards drug and
vaccine development against WSSV infections.
108
6.2 Future studies
6.2.1 Establishment of cell line
A complete understanding of shrimp viruses is dependent upon the
development of laboratory techniques for the maintenance and culturing of these
viruses and host cells (Hsu et al. 1995). In the case of WSSV, attempts were made by
various researchers in establishing a primary cell culture and continuous cell lines
from different organ sources of shrimp (Luedman and Lightner 1992; Purushothaman
et al. 1998 and Roper et al. 2001). There were no successful attempts on the
development of a primary cell culture derived from hepatopancreas (Toullec et al.,
1996). As a result, functional studies of WSSV novel genes have been greatly
hampered (Liu et al., 2006). Consequently, the establishment of a primary or stable
cell culture becomes urgent and critical. Once such a cell culture system is available,
scientists will be able to design and conduct more biochemical experiments, and
ultimately dissect the molecular mechanism of WSSV infections in the near future.
6.2.2 RNAi
RNAi has been employed to specifically inhibit gene expression and
replication of infectious viruses. The replication of a growing number of human
pathogenic viruses has been shown to be inhibited by RNAi, including poliovirus,
HIV-1, HCV, influenza virus and hepatitis B virus (Randall et al., 2003). Also, RNAi
has been revealed to function as an adaptive antiviral immune mechanism (Lu et al.,
109
2005; Wilkins et al., 2005). Recently the in vivo roles of double-stranded RNA
(dsRNA) and RNAi in shrimp antiviral immunity have also been demonstrated
(Robalino et al., 2004, 2005; Westenberg et al., 2005). In the mean time,
sequence-independent or sequence-specific dsRNA, which may activate RNAi-like
mechanisms as antiviral response, was shown to be induced in the marine shrimp,
Litopenaeus vannamei (Robalino et al., 2004, 2005). It was reported that siRNA could
suppress the gene expression and replication of WSSV in a sequence-independent
manner (Westenberg et al., 2005). Recently, RNAi has been applied very effectively
in Caenorhabditis elegans functional genomics (Lamitina 2006) and others species
(Zhou et al., 2006). Taken together, we believe that the application of RNAi
technology will greatly facilitate our understanding to the mechanism of WSSV
infections.
6.2.3 Structural genomics
The main technologies used in structural genomics are X-ray crystallography,
nuclear magnetic resonance (NMR) spectroscopy and cryo-electron microscopy
(cryo-EM).
CD coupled with NMR-based heteronuclear single-quantum coherence
(HSQC) experiments can be employed to explore the foldings of all candidate
proteins in WSSV. The CD spectrum is the simplest and fastest way to differentiate
well structured proteins from unstructured ones. In addition, more accurate and
detailed information regarding the folding of a protein can be deduced from
110
NMR-based HSQC experiments. Basically, based on their HSQC spectra, proteins can
be categorized into two groups: 1) well-structured proteins with well-dispersed HSQC
spectra and narrow resonance peaks; 2) partially-structured proteins with poorly
dispersed HSQC spectra and broad resonance peaks. After screening, proteins with
poor CD and HSQC spectra will be identified as unstructured and therefore will be
excluded; only well structured proteins will be selected for structure determinations.
For structure determination of well-folded proteins, strategies will be chosen
based on the molecular weight of the protein. Basically, X-ray crystallography will be
applied for proteins with size larger than 15 kDa, e.g. envelope and capsid proteins.
Meanwhile, NMR will be utilized for small proteins with size less than 15 kDa. In
addition, for those functionally important proteins, NMR will be also employed to
guide the designing of inhibitors or small molecules. The obtained inhibitors and
small molecules hold a promise to serve as potential templates for further drug design
(Song and Ni, 1998).
Cryo-electron microscopy (cryoEM) can be utilized to study the mechanism
of the viral particle assembly. For the cryoEM studies, WSSV virions can be prepared
by rapid plunging into liquid ethane at a temperature of -180 °C and imaged at low
temperature in the EM at a magnification of 20-50,000 times using minimal dose
techniques (Dubochet et al., 1988). It is feasible to use such methods to determine the
overall structure and symmetry of the virion and nucleocapsids. Comparison of the
virion and nucleocapsid structures will provide insights into the infection, assembly
and maturation process of the viral particle. Using the available antibodies
111
immuno-EM can be used to determine the location of individual particles in the virus
particles. With the available X-ray structures of component proteins, these can be
combined with the overall EM structure to provide a more complete structural
description.
Structural genomics aims to determine the structures of all structured proteins.
Besides elucidating the functions of the presumptive proteins based on the determined
structure, such study should provide the essential structural insight for the designing
of inhibitors or small molecules. Ultimately, drugs can be developed to keep the
WSSV infection under control and therefore boost the shrimp aquaculture industry.
6.2.4 Structure-based drug design
The analysis of protein structure is often performed with one goal in mind: to
design a ligand capable of binding to it and moderating its activity (Stewart, 2002).
Our X-ray and NMR-based structural studies revealed that VP9 possesses a
DNA recognition fold with specific metal binding sites (coordinating residues include
Asp9, Glu31, and Cys46). The specific DNA sequence for recognition by VP9 has not
yet been established. However, based on homology modeling, a possible DNA
binding region located at α1 (Thr17-Thr26) and the β-turn (Ser36-Asp40) has been
proposed (Liu et al., 2006).
Thus, the metal binding sites, α1 and β-turn form three presumably active
sites for de novo VP9-structure-based drug design. Algorithms are available to design
ligands in silico and approach the task in different ways (Bohm, 1992; Gillet et al.,
112
1993). Efforts to dock potential chemical groups and subsequently accept those
groups that appear to bind well to the active site may be attempted; otherwise, we can
dock a starting group or a substructure, and then add groups to this starting point,
effectively “evolving” a ligand in the active site. Once identified, crystallization of
lead structures in the protein target will be performed in order to enable further
designing (Daniel, 2005). A careful examination of such a co-complex will highlight
areas where suboptimal interactions are present or where selectivity may be affected.
113
Coordinates
The NMR structures and X-ray structure VP9 were deposited in the Protein
Data Bank, with the PDB ID 2GJI and 2GJ2, respectively.
114
References
Banci, L., Bertini, I., Ciofi-Baffoni, S., Finney, L.A., Outten, C.E., O`Halloran, T.V. (2002). a new zinc-protein coordination site in intracellular metal trafficking, solution structure of the apo and Zn (II) forms of ZntA (46-118) J.Mol.Biol, 323, 883-897. Bax, A. (2003).Weak alignment offers new NMR opportunities to study protein structure and dynamics, Protein Sci, 1, 1-16. Bergfors, T., ed. 1999). Protein Crystallization, Techniques, Strategies, and Tips, International University Line, La Jolla, CA. Blissard, G.W. (1996). Baculovirus—insect cell interactions. Cytotechnology, 20, 73-93. Blissard, G.W., Rohrmann, G.F. (1990). Baculovirus diversity and molecular biology. Annu. Rev. Entomol, 35, 127-155. Bloch F., Hansen W. W., and Packard M. (1946). Nuclear induction. Phys. Rev, 70, 460-474. Blow DM. (2002). Rearrangement of Cruickshank's formulae for the diffraction-component precision index. Acta Crystallogr D Biol Crystallogr, 58, 792-7. Brunger, A. T., Adams, P. D., Clore, G. M., DeLano, W. L., Gros, P., Grosse-Kunstleve, R. W., Jiang, J. S., Kuszewski, J., Nilges, M., Pannu, N. S., Read, R. J., Rice, L. M., Simonson, T., and Warren, G. L. (1998). Crystallography & NMR system, a new software suite for macromolecular structure determination, Acta Crystallogr. Sect. D, 54, 905-921. Bustin SA, Mueller R. (2005). Real-time reverse transcription PCR (qRT-PCR) and its potential use in clinical diagnosis. Clin Sci (Lond), 109, 365-79. Chang, P., C. F. Lo, Y. Wang, and G. H. Kou. (1996). Identification of white spot syndrome associated baculovirus (WSBV) target organs in the shrimp Penaeus monodon by in situ hybridization. Dis. Aquat. Org, 27, 131-139. Chaturvedi UC, Shrivastava R. (2005). Interaction of viral proteins with metal ions, role in maintaining the structure and functions of viruses. FEMS Immunol Med Microbiol, 43, 105-14.
115
Chayen, N.E., Turning. (2004). Protein crystallization from an art into a science. Curr. Opinions Struct Biol, 14, 577-583. Chen, L. L., C. F. Lo, Y. L. Chiu, C. F. Chang, and G. H. Kou. (2000). Natural and experimental infection of white spot syndrome virus (WSSV) in benthic larvae of mud crab Scylla serrata. Dis. Aquat. Org, 40, 157-161. Chen LL, Wang HC, Huang CJ, Peng SE, Chen YG, Lin SJ, Chen WY, Dai CF, Yu HT, Wang CH, Lo CF, Kou GH. (2002).Transcriptional analysis of the DNA polymerase gene of shrimp white spot syndrome virus. Virology, 301, 136-147. Clore, G. M. and Gronenborn, A. M. (1991). Prog. NMR Spectrosc, 23, 43-92. Cornilescu, G., Delaglio, F., and Bax, A. (1999). Protein backbone angle restraints from searching a database for chemical shift and sequence homology. J. Biomol. NMR, 13, 289–302.
Daniel Figeys (2005). Industry Proteomics: Applications for Biotechnology and
Pharmaceuticals. Publisher: Wiley-Liss.
Delaglio, F., Grzesiek, S., Vuister, G. W., Zhu, G., Pfeifer, J., and Bax, A. (1995). NMRPipe, a multidimensional spectral processing system based on UNIX pipes. J. Biomol. NMR, 6, 277–293. de La Fortelle, E. & Bricogne, G.. (1997). Maximum-likelihood heavy-atom parameter refinement for multiple isomorphous replacement and multiwavelength anomalous diffraction methods. Methods Enzymol, 276, 472–494. Donald Lightner. (1999). Report to OIE of "notifiable" disease in shrimp. Dubochet, J., M. Adrian, J. J. Chang, J. C. Homo, J. Lepault, A. W. McDowall, and P. Schultz . (1988). Cryo-electron microscopy of vitrified specimens. Q. Rev. Biophys, 21, 129-228. Durand, S., D. V. Lightner, R. M. Redman, and J. R. Bonami. (1997). Ultrastructure and morphogenesis of white spot syndrome baculovirus (WSSV). Dis. Aquat. Organ, 29, 205-211. Emiliani, C. (1993). Extinction and viruses. BioSystems, 31, 155-159. Farrow NA, Zhang O, Forman-Kay JD, Kay LE. (1995). Comparison of the backbone dynamics of a folded and an unfolded SH3 domain existing in equilibrium in
116
aqueous buffer. Biochemistry, 34, 868-78. Fesik S. W., and Zuiderweg, E. R. P., Quart. (1990). Rev. Biophys, 23, 97-131. Freeman, R. and Anderson, W. A. (1962). J. Chem. Phys, 37, 2053-2073. Fischer MW, Zeng L, Majumdar A, Zuiderweg ER. (1998). Characterizing semilocal motions in proteins by NMR relaxation studies. Proc Natl Acad Sci U S A, 95, 8016-9. Flegel, T. W. (1997). Special topic review, major viral diseases of black tiger prawn (Penaeus monodon) in Thailand. World J. Microbiol. Biotechnol, 13, 443-42. Friesen, P.D. (1997). Regulation of Baculovirus early gene expression. In, Miller, L.K. (Ed.). The Baculoviruses, Plenum Press, New York, pp. 141-170. Friesen, P.D., Miller, L.K. (1986). The regulation of baculovirus gene expression. Curr. Top. Microbiol. Immunol, 131, 31-49. Greber, U. F., Suomalainen, M., Stidwill, R. P., Boucke, K., Ebersold, M. W., and Helenius, A. (1997). The role of the nuclear pore complex in adenovirus DNA entry. EMBO J, 16, 5998–6007. Greber, U. F., Webster, P., Weber, J., and Helenius, A. (1996). The role of the adenovirus protease in virus entry into cells. EMBO J, 15, 1766–1777. Hameed, A. S. S., M. Anilkumar, M. L. Stephen Raj, and K. Jayaraman. (1998). Studies on the pathogenicity of systemic ectodermal and mesodermal baculovirus and its detection in shrimp by immunological methods. Aquaculture, 160, 31-45. Hegde RS, Grossman SR, Laimins LA, Sigler PB. (1992). Crystal structure at 1.7 A of the bovine papillomavirus-1 E2 DNA-binding domain bound to its DNA target. Nature, 359, 505-12. Herrmann, T., Guntert, P & Wuthrich, K. (2002). Protein NMR structure determination with automated NOE assignment using the new software CANDID and the torsion angle dynamics algorithm DYANA. J. Mol. Biol, 319, 209-227. Holm, L. and Sander, C. (1995). Trends Biochem. Sci, 20, 478–480. Honess, R.W., Roizman, B. (1974). Regulation of herpesvirus macromolecular synthesis, I. Cascade regulation of the synthesis of three groups of viral proteins. J. Virol, 14, 8-19. Huang, C., X. Zhang, Q. Lin, X. Xu, and C. L. Hew. (2002a). Characterization of a
117
novel envelope protein (VP281) of shrimp white spot syndrome virus by mass spectrometry. J. Gen. Virol, 83, 2385-2392. Huang, C., X. Zhang, Q. Lin, X. Xu, Z. Hu, and C. L. Hew. (2002b). Proteomic analysis of shrimp white spot syndrome viral proteins and characterization of a novel envelope protein VP466. Mol. Cell. Proteomics, 1, 223-31. Huang, C., Zhang, L., Zhang, J., Xiao, L., Wu, Q., Chen, D., and Li, J. K. (2001). Purification and characterization of white spot syndrome virus (WSSV) produced in an alternate host, crayfish, Cambarus clarkii. Virus Res, 76, 115–125. Hsu, Y., Y. Yang, Y.Chen, M. Tung, J. Wu, M. Engeking and J. Leong. (1995). Development of an invitro subcuture system for the oka organ (Lymphoid tissue) of Penaeus monodon. Aquaculture, 136, 43-55. James L. Cole and Jeffrey C. (1999). Hansen Analytical Ultracentrifugation as a Contemporary Biomolecular Research Tool. J Biomol Tech, 10, 163-176. Jean-Luc DARLIX, Branka HORVAT, Viktor VOLCHKOV and all the participants. (2005). "Virus & Immunity" Course, Lyon, France. http,//vandi.ens-lyon.fr/virus_and_immunity. Johnson B.A. (2004). Using NMRView to visualize and analyze the NMR spectra of macromolecules. Methods Mol Biol, 278, 313-52. Jones, T. A., Zou, J. -Y., Cowan, S. W., and Kjeldgaard, M. (1991). Improved methods for building models in electron density maps and the location of errors in these models. Acta Crystallogr. Sect. A, 47,110-119. Kann, M., Sodeik, B., Vlachou, A., Gerlich, W. H., and Helenius, A. (1999). Phosphorylation-dependent binding of hepatitis B virus core particles to the nuclear pore complex. J. Cell Biol. 145, 45–55. Kasamatsu, H., and Nakanishi, A. (1998). How do animal DNA viruses get to the nucleus? Annu. Rev. Microbiol. 52, 627–686. Kenneth H. Lundstrom. (2006). Structural genomics on membrane proteins. CRC Press, Taylor & Francis Group. 6000 Broken Sound Parkway NW, Suite 300. Boca Raton, FL 33487-2742. Khadijah S, Neo SY, Hossain MS, Miller LD, Mathavan S, Kwang J. (2003). Identification of white spot syndrome virus latency-related genes in specific-pathogen-free shrimps by use of a microarray. J Virol. 77, 10162-7. Koradi, R., Billeter, M., and Wüthrich, K. (1996). MOLMOL, a program for display
118
and analysis of macromolecular structures. J Mol Graphics 14, 51-55. Kyte, J. and Doolittle, R. F. (1982). A simple method for displaying the hydropathic character of a protein. J. Mol. Bio, 157, 105-132. Laemmli, U.K. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature, 227, 680-685. Lamitina T. (2006). Functional genomic approaches in C. elegans. Methods Mol Biol, 351, 127-38. Laskowski, R. A., MacArthur, M. W., Moss, D. S., and Thornton, J. M. (1993). PROCHECK, a program to check the stereochemical quality of protein structures. J. Appl. Crystallogr, 26, 283-291. Leu, J. H., J. M. Tsai, H. C. Wang, A. H. Wang, C. H. Wang, G. H. Kou, and C. F. Lo. (2005). The unique stacked rings in the nucleocapsid of the white spot syndrome virus virion are formed by the major structural protein VP664, the largest viral structural protein ever found. J. Virol. 79, 140-149. Li, Q., Y. Chen, and F. Yang. (2004). Identification of a collagen-like protein gene from white spot syndrome virus. Arch. Virol. 149,215-223. Li, Y., Lu, Z., Sun, L., Ropp, S., Kutish, G. F., Rock, D. L., and Van Etten, J. L. (1997). Analysis of 74 kb of DNA located at the right end of the 330-kb chlorella virus PBCV-1 genome. Virology, 237, 360-377. Lightner, D. V. (1996). A handbook of pathology and diagnostic procedures for diseases of penaeid shrimp. World Aquaculture Society, Baton Rouge, LA. Liu, W. J., H. T. Yu, S. E. Peng, Y. S. Chang, H. W. Pien, C. J. Lin, C. J. Huang, M. F. Tsai, C. H. Wang, J. Y. Lin, C. F. Lo, and G. H. Kou. (2001). Cloning, characterization, and phylogenetic analysis of a shrimp white spot syndrome virus gene that encodes a protein kinase. Virology, 289, 362-377. Liu WJ, Chang YS, Wang CH, Kou GH, Lo CF. (2005). Microarray and RT-PCR screening for white spot syndrome virus immediate-early genes in cycloheximide-treated shrimp. Virology, 10, 327-41. Liu WJ, Chang YS, Wang AH, Kou GH, Lo CF. (2006). WSSV has Successfully Annexed a Shrimp STAT To Enhance the Expression of the Immediate Early Gene (ie1). J Virol, Nov 1; [Epub ahead of print] Liu, Y, Wu JL, Song JX, Sivaraman1 J, Hew CL. (2006). Identification of a novel
119
nonstructural protein VP9 from white spot syndrome virus, its structure reveals a ferredoxin fold with specific metal binding sites. J Virol, 80, 10419-27. Lo, C. F. (2005). One step ahead of the emerging crustacean viruses. http,//www.iq2000kit.com/news_019a.htm. Lo, C.F., C.T. Cheng, ad G. H. kou. (1998). PCR monitoring of cultured shrimp for white spot syndrome virus (WSSV) infection in grow out ponds.. In T.W. flegel (ed.). Advances in shrimp biotechnology. National Center for Genetic Engineering and Biotechnology, Bangkok, Thailand, P281-286. Lu, R., Maduro, M., Li, F., Li, H.W., Broitman-Maduro, G., Li, W.X., Ding, S.W. (2005). Animal virus replication and RNAi-mediated antiviral silencing in Caenorhabditis elegans. Nature, 436, 1040–1043. Luedman, R.A and D.V. Lightner. (1992). Development of an in vitro primary cell culture system from the penaeid shrimp, Penaeus stylirostris and Penaeus vannamei. Aquaculture, 101, 205-211. Magbanua, F. O., K. T. Natividad, V. P. Migo, C. G. Alfafara, F. O. de la Pena, R. O. Miranda, J. D. Albaladejo, E. C. Nadala, Jr., P. C. Loh, and L. Nahilum-Tapay. (2000). White spot syndrome virus (WSSV) in cultured Penaeus monodom in the Philippines. Dis. Aquat. Org, 42, 77-82. Mandel AM, Akke M, Palmer AG III. (1996). Dynamics of ribonuclease H, temperature dependence of motions on multiple time scales. Biochemistry, 35, 16009-23. Marks, H., R. W. Goldbach, J. M. Vlak, and M. C. W. van Hulten. 2004. Genetic variation among isolates of white spot syndrome virus. Arch. Virol, 149, 673-697. Marsh, M., and Helenius, A. (1989). Virus entry into animal cells. Adv. Virus Res, 36, 107–151. Mayo, M. A. (2002). A summary of taxonomic changes recently approved by ICTV. Arch. Virol, 147, 1655-63. McPherson A. (1993). Effects of a microgravity environment on the crystallization of biological macromolecules. Microgravity Sci Technol, 6, 101-9. Moradian-Oldak, J., Leung, W., and Fincham, A.G.. (1998). Temperature and pH-dependent supramolecular self-assembly of amelogenin molecules, a dynamic light-scattering analysis. J. Struct Biol, 122, 320-327.
120
Nadala, E. C. B., L. M. Tapay, and P. C. Loh. (1998). Characterization of a non-occluded baculovirus-like agent pathogenic to penaeid shrimp. Dis. Aquat. Org, 33, 221-229. Nakanishi, A., Clever J., Yamada. M., Li, P. P., and Kasamatsu, H. (1996). Association with capsid proteins promotes nuclear targeting of simian virus 40 DNA. Proc. Natl. Acad. Sci. USA, 93, 96–100. Naylor, R. L., R. J. Goldburg, H. Mooney, M. Beveridge, J. Clay, C. Folke, N. Kautsky, J. Lubchenco, J. Primavera, and M. Williams. (1998). ECOLOGY, Nature's 10 Subsidies to Shrimp and Salmon Farming. Science, 282, 883-4. Oppenheimer, N. J., Meth. (1989). Enzymol, 176, 78-89. Oschkinat, H., Grieinger, C., Kraulis, P. J., Sorensen, O. W., Ernst, R. R., Gronenborn, A. M., and Clore, G. M. (1998). Nature, 332, 374-376. Otwinowski, Z., and W. Minor. (1997). Processing of X-ray diffraction data collected in oscillation mode. Methods Enzymol, 276, 307–326. Primrose, W. U. (1993). “NMR of Macromolecules, a Practical Approach” (G. C. K. Roberts, ed.), IRL Press, Oxford, pp. 7-34, Purcell, E. M., Torrey, H. C. and Pound, R. V. (1946). Phys. Rev, 69, 37-38. Purushothaman, V., K. Sankaranarayananad, R.M. Ravikumar and P. Ramasamy. (1998). Development of in vitro primary cell culture system from penaeid shrimp, Penaeus indicus, Penaeus monodon and sand crab Emerita asiatica. Indian Journal of Animal Sciences, 68, 1097-1099. Randall, G., Grakoui, A., Rice, C.M. (2003). Clearance of replicating hepatitis C virus replicon RNAs in cell culture by small interfering RNAs. Proc. Natl. Acad. Sci. USA, 100, 235–240. Rajni Hatti-Kaul, Bo Mattiasson. (2003). Isolation and purification of proteins. New York, Marcel Dekker. Robalino, J., Bartlett, T., Shepard, E., Prior, S., Jaramillo, G., Scura, E., Chapman, R.W., Gross, P.S., Browdy, C.L., Warr, G.W. (2005). Double-stranded RNA induces sequence-specific antiviral silencing in addition to nonspecific immunity in a marine shrimp, convergence of RNA interference and innate immunity in the invertebrate antiviral response. J. Virol, 79, 13561–13571. Robalino, J., Browdy, C.L., Prior, S., Metz, A., Parnell, P., Gross, P., Warr, G.. (2004).
121
Induction of antiviral immunity by double-stranded RNA in a marine invertebrate. J. Virol, 78, 10442–10448. Roper, K.G., L. Owens and L. West. (2001). The media used in primary cell cultures of prawn tissues , A review and a comparative study. Asian Fish Science, 14, 61-75. Rosenzweig, A.C., Huffman, D.L., Hou, M.Y., Wernimont, A.K., Pufahl, R.A., O`Halloran, T.V. (1999). Crystal structure of the Atx1 metallochaperone protein at 1.02 A resolution. Structure Fold. Des, 7, 605-617. Schachman, H.K. (1992). Is there a future for the ultracentrifuge? In Analytical ultracentrifugation in biochemistry and polymer science (eds. S.E. Harding et al.). The Royal Society of Chemistry, Cambridge, UK , pp. 3–15. Shi W, Zhan C, Ignatov A, Manjasetty BA, Marinkovic N, Sullivan M, Huang R, Chance MR. (2005). Metalloproteomics, high-throughput structural and functional annotation of proteins in structural genomics. Structure, 13, 1473-86. Sivaraman J, Myers RS, Boju L, Sulea T, Cygler M, Jo Davisson V, Schrag JD. (2005). Crystal structure of Methanobacterium thermoautotrophicum phosphoribosyl-AMP cyclohydrolase HisI. Biochemistry, 44, 10071-80. Sritunyalucksana K, Wannapapho W, Lo CF, Flegel TW. (2006). PmRab7 is a VP28-binding protein involved in white spot syndrome virus infection in shrimp. J Virol, 80, 10734-42. Sodeik, B., Ebersold, M. W., and Helenius, A. (1997). Microtubulemediated transport of incoming herpes simplex virus 1 capsids to the nucleus. J. Cell Biol, 136, 1007–1021. Song, J., and F. Ni. (1998). NMR for the design of functional mimetics of protein-protein interactions, one key is in the building of bridges. Biochem Cell Biol, 76, 177-88. Song WJ, Qin QW, Qiu J, Huang CH, Wang F, Hew CL. (2004). Functional genomics analysis of Singapore grouper iridovirus, complete sequence determination and proteomic analysis. J Virol, 78, 12576-90. Stewart, L., Clark, R., and Behnke, C. (2002). High-throughput crystallization and structure determination in drug discovery. Drug Discov. Today, 7, 187-196. Suomalainen, M., Nakano, M. Y., Keller, S., Boucke, K., Stidwill, R. P., and Greber, U. F. (1999). Microtubule-mediated plus- and minus enddirected motilities are competing processes for nuclear targeting of adenoviruses. J. Cell
122
Biol, 144, 657–672. Terwilliger, T.C. (2002). Automated structure solution, density modification and model building. Acta Crystallogr. D Biol. Crystallogr, 58, 1937–1940. Thakur, P. C., F. Corsin, J. F. Turnbull, K. M. Shankar, N. V. Hao, P.A. Padiyar, M. Madhusudhan, K. L. Morgan, and C. V. Mohan. (2002). Estimation of prevalence of white spot syndrome virus (WSSV) by polymerase chain reaction in Penaeus monodom postlarvae at time of stocking in shrimp farms of Karnataka, India, a population-based study. Dis. Aquat. Org, 49, 235-243. Tidona, C. A., and Darai, G.. (1997). Molecular anatomy of lymphocystis disease virus. Arch. Virol. Suppl, 13, 49–56. Toullec, J.Y., Y. Crozat, J. Patrois and P. Porcheron. (1996). Development of primary cell culture from the penaeid shrimps Penaeus vannamei and P. indicus. Journal of Crustacean Biology, 16, 643 – 649. Tsai, M.F., Kou, G.H., Liu, H.C., Liu, K.F., ea al. (1999). Long-term presence of white spot syndrome virus (WSSV) in a cultivated shrimp population without disease outbreaks. Dis. Aquat. Org, 38, 107-114. Tsai, M. F., C. F. Lo, M. C. van Hulten, H. F. Tzeng, C. M. Chou, C. J. Huang, C. H. Wang, J. Y. Lin, J. M. Vlak, and G. H. Kou. (2000a). Transcriptional analysis of the ribonucleotide reductase genes of shrimp white spot syndrome virus. Virology, 277, 92-99. Tsai, M. F., H. T. Yu, H. F. Tzeng, J. H. Leu, C. M. Chou, C. J. Huang, C. H. Wang, J. Y. Lin, G. H. Kou, and C. F. Lo. (2000b). Identification and characterization of a shrimp white spot syndrome virus (WSSV) gene that encodes a novel chimeric polypeptide of cellular-type thymidine kinase and thymidylate kinase. Virology, 277, 100-110. Tsai, J. M., H. C. Wang, J. H. Leu, H. H. Hsiao, A. H. Wang, G. H. Kou, and C. F. Lo. (2004). Genomic and proteomic analysis of thirty-nine structural proteins of shrimp white spot syndrome virus. J Virol, 78, 11360-70. van Hulten, M. C., J. Witteveldt, S. Peters, N. Kloosterboer, R. Tarchini, M. Fiers, H. Sandbrink, R. K. Lankhorst, and J. M. Vlak. (2001). The white spot syndrome virus DNA genome sequence. Virology, 286, 7-22. van Hulten, M. C. W., M. F. Tsai, C. A. Schipper, C. F. Lo, G. H. Kou, and J. M. Vlak. (2000a). Analysis of a genomic segment of white spot syndrome virus of shrimp containing ribonucleotide reductase genes and repeat regions. J. Gen. Virol,
123
81, 307-316. van Hulten MCW, Westernberg M, Goodall SD, Vlak JM. (2000b). Identification of two major virion protein genes of white spot syndrome virus of shrimp. Virology, 266, 227-236. van Hulten, M. C., M. Reijns, A. M. Vermeesch, F. Zandbergen, and J. M. Vlak. (2002). Identification of VP19 and VP15 of white spot syndrome virus (WSSV) and glycosylation status of the WSSV major structural proteins. J. Gen. Virol, 83, 257-265. Vihinen-Ranta, M., Yuan, W., and Parrish, C. R. (2000). Cytoplasmic trafficking of the canine parvovirus capsid and its role in infection and nuclear transport. J Virol， 74, 4853–4859. Vlak, J.M., Bonami, J.R., Flegel, T.W., Kou, G.H., Lightner, D.V., Lo, C.F., Loh P.C. and Walker P.W. (2004). Nimaviridae. In, VIIIth Report of the International Committee on Taxonomy of Viruses (C.M. Fauquet, M.A. Mayo, J. Maniloff, U. Desselberger and L.A. Ball, Eds.), Elsevier, p. 187-192. Wang, C. H., C. F. Lo, J. H. Leu, C. M. Chou, P. Y. Yeh, H. Y. Chou, M. C. Tung, C. F. Chang, M. S. Su, and G. H. Kou. (1995). Purification and genomic analysis of baculovirus associated with white spot syndrome (WSBV) of Penaeus monodon. Dis. Aquat. Organ, 23, 239-242. Wang YG, Hassan MD, Shariff M, Zamri SM, Chen X. (1999). Histopathology and cytopathology of white spot syndrome virus (WSSV) in cultured Penaeus monodon from peninsular Malaysia with emphasis on pathogenesis and the mechanism of white spot formation. Dis Aquat Organ, 39, 1-11. Wang CH, Wu CY, Lo CF. (1999). A new picorna-like virus, PnPV, isolated from ficus transparent wing moth, Perina nuda (Fabricius). J Invertebr Pathol. 74, 62-8. Westenberg, M., Heinhuis, B., Zuidema, D., Vlak, J.M. (2005). siRNA injection induces sequence-independent protection in Penaeus monodon against white spot syndrome virus. Virus Res, 114, 133–139. Whittaker, G. R., and Helenius, A. (1998). Nuclear import and export of viruses and virus genomes. Virology, 246, 1–23. Wilkins, C., Dishongh, R., Moore, S.C., Whitt, M.A., Chow, M., Machaca, K. (2005). RNAinterference is an antiviral defence mechanism in Caenorhabditis elegans. Nature, 436, 1044–1047.
124
Wittek., R. (1982). Organization and expression of the poxvirus genome. Experientia, 38, 285–297. Wongteerasupaya, C., J. E. Vickers, S. Sriurairatana, G. L. Nash, A. Akarajamorn, V. Boonsaeng, S. Panyim, A. Tassanakajon, B. Withyachumnarnkul, and T. W. Flegel. (1995). A non-occluded, systemic baculovirus that occurs in cells of ectodermal and mesodermal origin and causes high mortality in the black tiger prawn Penaeus monodon. Dis. Aquat. Organ, 21, 69-77. Wu J., Arimoto M, Nishizawa T and Muroga K. (2002). Preparation of an inoculum of white spot syndrome virus for challenge tests in Penaeu japonicus. Fish Pathol, 37, 65–69. Wychowski, C., Benichou, D., and Girard, M. (1986). A domain of SV40 capsid polypeptide VP1 that specifies migration into the cell nucleus. EMBO J, 5, 2569–2576. Wychowski, C., Benichou, D., and Girard, M. (1987). The intranuclear localization of simian virus 40 polypeptides Vp2 and Vp3 depends on a specific amino acid sequence. J Virol, 61, 3862–3869. Yang, F., J. He, X. Lin, Q. Li, D. Pan, X. Zhang, and X. Xu. (2001). Complete genome sequence of the shrimp white spot bacilliform virus. J Virol, 75, 11811-20. Zhang, X., C. Huang, X. Xu, and C. L. Hew. (2002a). Transcription and identification of an envelope protein gene (p22) from shrimp white spot syndrome virus. J. Gen. Virol, 83, 471-477. Zhang, X., C. Huang, X. Xu, and C. L. Hew. (2002b). Identification and localization of a prawn white spot syndrome virus gene that encodes an envelope protein. J. Gen. Virol, 83, 1069-1074. Zhang, X., X. Xu, and C. L. Hew. (2001). The structure and function of a gene encoding a basic peptide from prawn white spot syndrome virus. Virus Res, 79, 137-144. Zhang X, Huang C, Tang X, Zhuang Y, Hew CL. (2004). Identification of structural proteins from shrimp white spot syndrome virus (WSSV) by 2DE-MS. Proteins, 55, 229-35. Zhou D, He QS, Wang C, Zhang J, Wong-Staal F. (2006). RNA interference and potential applications. Curr Top Med Chem, 6, 901-11.
125
Appendices
Name Company
Restriction endonucleases, T4-DNA ligase New England Biolabs
pfuturbo DNA polymerase, pfu buffer and Dpn I. Statagene
Tag-DNA polymerase New England Biolabs
Hen egg white lysozyme Sigma
RNase A Sigma
DNase I Sigma
Thrombin Sigma
Complete protease inhibitors cocktail Roche Applied Science
Phenylmethylsulfonyl fluorid (PMSF) Roche Applied Science
List of various kits and reagents used
QIAquick PCR purification kit QIAGEN
QIAprep Spin Miniprep kit QIAGEN
QIAquick Gel Extraction kit QIAGEN
Coomassie Protein Assay kit PIERCE
Crystallization kits Hampton Research
SuperScript III 1st Strand Synthesis System Invitrogen
126
Publications
1. Liu Y, Sivaraman J, Hew CL. (2006). Expression, purification and crystallization of
a novel nonstructural protein VP9 from white spot syndrome virus. Acta
Crystallograph Sect F Struct Biol Cryst Commun. 62, 802-4.
2. Liu Y, Wu JL, Song JX, Sivaraman1 J, Hew CL. (2006). Identification of a novel
nonstructural protein VP9 from white spot syndrome virus, its structure reveals a
ferredoxin fold with specific metal binding sites.
J Virol. 80, 10419-27.
3. Liu, Y.*, Li, ZJ*, Lin QS, Jan, K., Seetharaman J., Janusz M. B., Sivaraman, J.,
Hew CL. (2007). Structure and evolutionary origin of herring type II antifreeze
protein. PLoS ONE (accepted)
127
