New Diseases or Re-emerging ThreatsCurrent Knowledge state- Avian Reoviruses and

Clubbed Down Syndrome

SWCA 8th April 2014Philip P Hammond BVetMed PGCert Avian Health (hons) MAHM MRCVS

Crowshall Veterinary Services

Topics Covered:

1) Reovirus tenosynovitis2) Clubbed Down Syndrome

• Presentation• Investigations• Epidemiology• Treatment and Prevention• Future Research

Clinical History• Integrated company• Initially one house on one farm affected May

2013• Ross 308 broilers• Age 14 days of age at onset of symptoms

Presentation:

• Birds reported lame “walking on their hocks using wings to balance”- acute onset at 13-14 days of age.

• Approximately 5% affected (1200 birds)

• Poor uniformity• Poor growth rates

Courtesy of AAAP

First Step:Post mortem examination:

• Birds demonstrated mild bilateral tenosynovitis of gastrocnemius tendon- increased fluid in hocks

• Concurrent mild pericarditis/epicarditis

• No other gross pathology Courtesy of AAAP

Differential Diagnoses:Primarily considered likely infectious agent given

inflammation and effusion of tendon

• Mycoplasma synoviae• Staphylococcus tenosynovitis arthritis• Enterococcus tenosynovitis/arthritis• Reovirus tenosynovitis/arthritis

Course of investigation:

Step 1- Staphylococcus tenosynovitis/ arthritis• Swabs taken from hocks, tendons and

pericardial tissues• Results – no growth after 48 hours• Birds swabbed not being treated with

antibiotics and investigation undertaken at early stage of infection

• NOT STAPHYLOCOCCUS OR ENTEROCOCCUS TENOSYNOVITIS/ARTHRITIS

Step 2Mycoplasma synoviaeSerology:Rapid serum agglutination on sera of 20

birds showing symptoms in affected flock- taken at time of site visit

Results- negativeHowever- serology relies on antibody

production- acute vs convalescent phase of infection- could not rule out on the basis of this test alone

Mycoplasma synoviae PCR

• PCR • (Birds NOT on antibiotics)

• CULTURE- Chanocks- NEGATIVE

• NOT MS INFECTION

ALSO…….Mycoplasma synoviae infection is both vertically and horizontally transmittedAll PS in integrated company MS negative as monitored serologically throughout

lay- some flocks also Poultry Health Scheme status

Histology:Tendons, joint capsule and tendon sheath- mixed inflammatory infiltrate- both heterophilic and lymphoplasmacyticNOT POSSIBLE TO DETERMINE WHETHER BACTERIAL OR VIRAL FROM HISTOLOGY ALONE

Then……..Over course of following 2 months- multiple cases on multiple farms all within same integration

Issues also being reported all over UK and throughout Europe8-12% mortality due to cullingNo response to antibiotic treatment either antimycoplasmal or amoxycillinWelfare concerns due to lameness Poor conversion 1.80+ vs 1.62Poor uniformitySome response to aspirin treatment-

• better mobility, lower culling rates

Data analysis:• Common link for the above case- 80% of cases affected progeny from a

specific flock- breeder flock between 28-40 weeks- 35000 birds in 6 houses• Not all progeny from specific flock were affected• Other flocks placed at the same time from the same hatch day were

occasionally affected• Chicks were hatched in two different hatcheries- problem occurred in chicks

from both• Broiler farm location did not appear to be related to incidence

Step 3- Virus isolation• Aseptically extracted tendon tissue

from first case• Virus isolation conducted by AHVLA

Weybridge• 3 Passages

• Reovirus isolated FROM TENODON TISSUE

Gene Sequencing Undertaken“ACTGAGCATACTGCAAATAATAGCACAATGATGGATGGATTTTTGCGTGCTTGGATTCCTTCCTCTGGCGCGTCTGATGTGCTGAAGAAGTTTTGCAAATCCATTTCGATACAACGGAATTATGTTTGTCAGGGTGACGATGGTTTGATGGTTGTTGACGGGCTGTCGACGGGTAAGTTATCAGGTGAGATAATT”

86% similarity with the virus T17811. “Arch Virol. 2013 Jun 16. Detection and characterization of a divergent avian reovirus strain

from a broiler chicken with central nervous system disease. ”Dandár E, Bálint A, Kecskeméti S, Szentpáli-Gavallér K, Kisfali P, Melegh B,Farkas SL, Bányai K.

NOT A NEW VIRUS ???

Development of SNT to virus by AHVLA Weybridge:

•Some evidence of seroconversion in broilers- not consistent•Evidence of seroconversion in one parent flock from where majority of affected progeny derived•Low rate of seroconversion

• Cases of Reovirus tenosynovitis have been reported through the UK in a number of integrations this year

• Cases of Reovirus tenosynovitis have been reported throughout Europe throughout the last year

Unanswered Questions!• Why have so many companies and countries suddenly reported this

syndrome?• Why have some flocks which have not been derived from the known positive

PS also developed symptoms?- cross infection in hatchery?• Why did some flocks from the same parent flock not show symptoms?- age

related resistance?• Is this a new strain of Reovirus or is it a previously recognised strain?-

Reoviruses appear to be continuously involving• What methods are being used to type Reovirus and are these consistent

throughout laboratories?- there is no consistency at this time• Will double Nobilis Reo inac vaccination confer protection?

What can we do to prevent?• Biosecurity- hatching egg

hygiene• Hatchery hygiene• Vaccination- double

vaccination strategy advised in UK

• Sigma B antibodies• Autogenous vaccination

Affect of 2 x Nobilis Reo inac adminsitered at 14 and 18 weeks of age on ELISA antibody titres at 22 weeks of age in Broiler PS (Biochek)

Clubbed Down SyndromeThe symptoms and definition:

Definition:• Chicks with clubbed down will have matted down, in which the

down feathers remain held together and look like clubs. (banana down)- may also be hairy

• The defective down is most commonly seen on the ventral aspect of the chick especially around the vent.

• Reduced hatchability, due to weak chicks and increased late dead, with most demonstrating clubbed down.

• Chicks in a normal hatch (<0.5%) may show some down abnormalities, including clubbed down.

• With clubbed down syndrome the incidence of chicks with clubbed down is greater than 2%, usually with a similar loss of hatch. It is only clubbed down if the condition is seen in all hatches over a period of time (weeks to months) from a specific source flock.

Observations:• Breeders no clinical signs, production levels are normal and egg quality both internal and external looks the same

• Chicks have to be culled in hatcher baskets, usually 3-30%, but often many weak chicks resulting in further losses at around 4-6 days of age on broiler farm• Sometimes parent flocks improve rapidly whilst others take many weeks to show any improvement, others may never fully recover

• Spread between breeder houses on a farm can be very slow leading to a protracted disease progression

Possible Causes of Clubbed Down:

Riboflavin deficiency – histology has ruled out in recent cases

Zinc deficiency – blood analysis on chicks indicates low levels in affected chicks• Feed analysis of breeder rations shows no deficiency so a more complex

situation

Viruses• Entero like viruses • Circovirus, • Adenovirus• Astroviruses

AFBI Stormont Work and recent corroboration

Previously Virus Isolation• An “entero-like virus” (11672) has previously been isolated from chicks with

clubbed down• In SPF eggs, killed embryos and cause stunting. But no CD seen with embryo

inoculation.• Not all Clubbed Down flocks positive for this virus• This virus has now been identified as an Avian Astrovirus

• Recent cases where we have been able to demonstrate seroconversion to Chicken Astrovirus using acute and convalescent sera from the parent stock

Update on Clubbed Down Research:

1) Causal agent has not been identified

• Previously Fowl adenovirus 8 was thought to be involved but now ruled out

2) Can Chicken Astrovirus be ruled out as the cause?

• Research has shown that if Chicken Astovirus is the causal agent, it does not cause clubbed down by replicating in the embryo

• Therefore, may be infecting the breeder hen and affecting the formation of normal eggs- it may be acting physiologically to reduce transfer of nutrients in to the egg hence why progeny show symptoms of typical nutrient deficiency

Further investigation are required to understand more about this syndrome:

By infecting a known negative flock with Chicken Astrovirus it may be possible to ascertain if:

• Clubbed down can be reproduced• Where the virus replicates in the bird• How the virus affects hatchability (direct or

indirect)• If vertical transmission is occurring at all?

Diagnosis

Molecular diagnostics to quantify the levels of Astovirus present• Kidney, gut, ovaries, oviduct

Serology- monitoring of breeder flocks- will commercial assays be available one day?• indirect immunofluorescence assay• ELISA

One major diagnostic challenge is that by the time the issue is observed in the progeny the virus may have already gone 4 weeks later. How to overcome- routine storage of tissues and sera from PS??? Practicalities?

Control

Ultimate aim to vaccinate breeders to prevent infection.Astroviruses may be common place on broiler farms with limited clinical effects but the effects on breeders in lay may be the major issue as seen with Chick Anamia virus and Avian Encephalomyelitis. We may need to have a test to see if flocks have seroconverted in rear and then vaccinate if they have failed to do so

With thanks to the following in respect of Investigations:

Kathy Blake -Crowshall Veterinary Services LLPStephen Lister -Crowshall Veterinary Services LLPClaire Knott -Crowshall Veterinary Services LLPIan Lowery -Crowshall Veterinary Services LLPVanessa Ceeraz, AHVLA WeybridgeScott Reid, AHLVA WeybridgeRichard Irvine, AHLVA LuddingtonBill Cox, AHVLA WeybridgeTibor Cserep, MSD Animal Health UKVictoria Smyth AFBI Northern Ireland

We do not have all the answers but by working together we can help to understand and focus the limited research resources we have to gain the

most knowledge. Microbiological agents are always evolving and at a much faster rate than either us or the chicken!

Thank you for listeningphammond@crowshall.co.uk

www.crowshall.co.uk