The inhibitory signaling receptor protocadherin-18 regulates … · 2017. 9. 2. · memory T cells...

1

The inhibitory signaling receptor protocadherin-18 regulates tumor-infiltrating CD8+ T cell

function

Alan B. Frey

Department of Cell Biology and Perlmutter Cancer Center New York University Langone School of Medicine 550 First Avenue, New York, NY 10016 USA Correspondence: [email protected] Tel: (212) 263-8129; FAX: (212) 263-8139 Conflict of Interest Statement: The author declares no potential conflicts of interest. Acknowledgements: Research in the author’s lab was supported by NIH R01CA108573 and Pfizer Inc (through the CTI program), both to ABF, and to NYULSM for core facilities support (P30CA016087 for Cytometry and Cell Sorting, Histopathology, and Genome Technology).

Running title: Protocadherin-18 regulates TIL function

Keywords: inhibitory signaling receptor, tumor infiltrating lymphocyte, immune suppression, immune checkpoint inhibition, lytic function, CD8+ T cells, protocadherin-18

10 figures total

on July 21, 2021. © 2017 American Association for Cancer Research. cancerimmunolres.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on September 5, 2017; DOI: 10.1158/2326-6066.CIR-17-0187

http://cancerimmunolres.aacrjournals.org/

2

Abstract

Cancers are infiltrated with antitumor CD8+ T cells that arise during tumor growth, but

are defective in effector phase functions because of the suppressive microenvironment.

The reactivation of TILs can result in tumor destruction, showing that lytic dysfunction in

CD8+ tumor-infiltrating lymphocytes (TILs) permits tumor growth. Like all memory T cells,

TILs express inhibitory signaling receptors (aka checkpoint inhibitor molecules) that

downregulate TCR-mediated signal transduction upon TIL interaction with cells

expressing cognate ligands, thereby restricting cell activation and preventing the effector

phase. Previously we identified a novel murine CD8+ TIL inhibitory signaling receptor,

protocadherin-18, and showed that it interacts with p56lck kinase to abrogate proximal

TCR signaling. Here we show that TILs from mice deleted in protocadherin-18 had

enhanced antitumor activity and that co-blockade of PD-1 and protocadherin-18 in wild-

type mice significantly enhanced TIL effector phase function. These results define an

important role for protocadherin-18 in antitumor T-cell activity.




3

Introduction

Effective CD8+ antitumor T-cell responses require several stages of development and

activity: differentiation of antigen-specific cells, homing and entrance into tumor tissue,

recognition of MHC-restricted cognate peptide on tumor cells, and cytolytic function. Each

of these functional stages can be deficient or defective in cancer but the presence of

antigen-specific TILs in many types of tumors argues that antitumor T cells develop and

home (1). However, the tumor microenvironment is robustly immunosuppressive with

potential inhibitory contributions from many cells in the tumor: B cells, cancer-associated

fibroblasts, mast cells, myeloid-derived cells, pericytes, FoxP3+ regulatory T cells, or

vascular endothelia (2). Reversing inhibition in endogenous TILs (and in adoptively-

transferred antitumor T cells) is now recognized as a major therapeutic objective (3).

T cell activation results after T cell receptor (TCR) interaction with cognate antigen.

This generates a positive signal that is integrated with negative signals resulting from the

trans interaction of T-cell surface inhibitory signaling receptors (ISRs) with their cognate

ligands. ISRs, also known as co-inhibitory receptors or cell-surface immune-checkpoint

molecules, are widely expressed and regulate T-cell activation, differentiation,

homeostasis, and effector phase functions. In conditions of chronic antigen exposure and

inflammation, hyporesponsive T cells develop, which characterize latent infection or tumor

growth (4). Two ISRs, CTLA-4 (CD152) and PD-1 (CD274), have emerged as major

inhibitors of antitumor T-cell function. Monoclonal antibody (mAb)-based inhibition of

CTLA-4 or PD-1 activation (targeting either PD-1 or its ligand PD-L1) elicits potent

antitumor activity in various models and clinical trials, especially in treatment of human

tumors having strong inherent antigenicity (5). Although clinical results have been

dramatic (6), successes are limited to subsets of patients having certain tumor types,

suggesting that additional ISRs may be involved in the functional regulation of TILs in

human cancer (7). Supporting this notion, various other T cell ISR (8) such as BTLA,

LAG-3, TIGIT, TIM-3 or VISTA, have different cellular patterns of expression and are

being targeted in experimental mAb-based blockade mono- and combination therapy

trials (9).

Analysis of multiple ISRs that are simultaneously expressed on hyporesponsive T

cells shows that any individual ISR expressed can regulate cell function in vitro, implying




4

that, collectively, the repertoire of expressed ISR may function in an additive or

synergistic manner, especially in vivo (10). TILs can be nonlytic in vivo (1, 11, 12) and

express a variety of different ISRs (8) that restrict TIL functionality, leading to tumor

escape from immune killing. Because ISR expression in TILs is intrinsic to T-cell

differentiation and activation status (13-15), the availability of ISR ligands on cells within

the tumor determines if a given ISR is engaged and thus contributes to TIL effector phase

dysfunction (16). Multiple cell types within the tumor microenvironment can potentially

express ISR ligands—including vascular endothelia, tumor cells, myeloid components of

the stroma (DC, macrophages, and myeloid cells), and TILs themselves—making

regulation of TIL function by ISRs complex.

A role for protocadherin-18 (pcdh18) in T-cell function was identified through study of

the nonlytic phenotype of CD8+ TILs in a murine model of colon cancer, in which it was

discovered to interact with p56lck, thereby blocking proximal TCR signaling and cytolysis

(13, 17). Proximal TCR-mediated signaling (calcium flux) in purified TILs is intact if

assessed by activation in vitro with anti-CD3 (18) and TIL lytic function is restored upon

purification and brief culture in vitro (17), properties suggestive of ISR activity. As

opposed to other ISRs, pcdh18 is expressed in activated CD8+ memory T cells

(CD8+CD44+CD62L+CD127hi), is not expressed in B cells, NK cells, naive CD8+ T cells, or

primary CD8+ effector cells, and the kinetics of its transcriptional regulation upon TCR

ligation are that of an immediate-early response gene (13). The only known ligand for

pcdh18 is itself and it mediates homophilic binding (19). Here we show in a murine cancer

model that pcdh18 is a key regulator of antitumor CD8+ T-cell effector-phase function.

Methods

Animals

Wild-type C57BL/6 male mice were from Taconic (Hudson, NY). The pcdh18 gene-

deleted mouse (Pcdh18tm1(KOMP)Vlcg) was obtained from the Komp Repository Knockout

Mouse Project (# 14494, via Regeneron Pharmaceuticals, Tarrytown, NY).

Reagents




5

Doxycycline, puromycin, protein G-agarose, and polymyxin B-agarose were from Sigma

Aldrich (St. Louis, MO). Magnetic immunobeads for isolation of human (130-096-495) or

murine (130-049-401) T cells were from Miltenyi Biotec (San Diego, CA). Primary

antibodies for flow cytometry were from eBiosciences (San Diego, CA) and secondary

reagents (Alexa 647-, HRP-anti-rabbit Ig) from Jackson ImmunoResearch (West Grove,

PA, 111-625-144 and 111-035-144). Anti-TCR H57-597 was purified from hybridoma

conditioned medium using protein G-agarose. Rabbit Ab reactive to the cytoplasmic

domain of pcdh18 was produced using a Gst-fusion protein as immunogen as described

(13). Rabbit and mouse Abs reactive to the extracellular domain of pcdh18 (amino acids

37, Glu- 690, Ser) were produced using a His-tag protein expressed in CHO cells as

immunogen. The rabbit Ab was purified on Protein G-agarose and the murine serum used

as serum in passive transfer (see below). SIINFEKL-tetramer was from MBL International

(Woburn, MA). Anti-CD8 (clone 53.6.7) used for in vivo depletion was purified from

hybridoma conditioned medium using Protein G-agarose and was absorbed on Polymyxin

B-agarose before dialysis versus PBS. Anti-PD-1 Ab 29F.1A12 (the gift of G. Freeman,

Dana Farber, Cambridge, MA) or control Rat IgG2a (BioXCell, Lebanon, NH) were

similarly treated for potential LPS contamination.

MCA38 cells (obtained from N. Restifo, NIH, circa 1990) and RMA-S cells (from M.

Bevan, Univ. of Washington) were routinely tested for mycoplasma contamination

(MP0025-1KT, Sigma Aldrich, St. Louis, Mo).The cell lines have not been authenticated

by our lab and were cultured for < 10 passages before new stocks were thawed . Listeria

monocytogenes-ova, the gift of Eric Pamer (MSKCI, NY), was prepared and used as

described (13). Human Leukopaks were obtained from the New York Blood Center

(Queens, NY).

Pcdh18 shRNA virus

The pTRIPZ vector (Dharmacon/GE Lifesciences, Lafayette, CO) was used to express

candidate pcdh18 shRNAs. Candidate pcdh18 targets were:

ATGTCCTGGCTAAGAATCTGAA = 'a', CACCAAGCCTCTCCTCAGTGAG = 'b',

CGCCACTCCTGCTGTTGAGGTC = 'c', and scrambled control

GACTAGTCTTACGATACATGCA. Recombinant vectors were sequenced to confirm




6

insert sequences. Virus was produced in HEK293 cells, concentrated by centrifugation,

and used for infection in the presence of Polybrene. Vectors containing TurboGFP (and

separately lacking GFP) were produced and were titered on HEK293 cells. Knockdown in

MCA38 cells used an MOI of 1.

Flow cytometry and cell sorting

MCA38 cells were fixed and permeabilized (eBiosciences, 88-8824) before labeling with

rabbit anti-pcdh18, or control rabbit Ig, which was detected using PE-conjugated goat-

anti-rabbit IgG. Human CD8+ memory T cells were isolated after Ficoll purification of

PBMC followed by FACS isolation using antibodies to CD8, CD44, CD27, and CD45RO

(eBiosciences). TILs were isolated by magnetic immunobeading (Miltenyi Corp, San

Diego, CA).

Tumor formation

Wild-type MCA38 cells or MCA38 cells transduced with either virus encoding shRNA

'pcdh18b' or control virus, both lacking GFP, were injected ip or sc into 6-8 week male

mice and observed for 15 weeks or until sacrifice was required. Mice received

doxycycline in drinking water (50 g/mL) as indicated. Subcutaneous tumors were

measured with calipers and volume was calculated as: (W2 x L)/2). P values for group

comparisons of tumor growth were calculated using the two-tailed nonparametric Mann-

Whitney (GraphPad Prism 5.0).

Antibody treatment of mice

Five or 10 days after seeding of tumor as indicated, mice received ip injections of 0.2 mg

of purified anti–PD-1 Ab 29F.1A12 or control Rat IgG2a (in PBS), or 0.05 mL mouse anti-

pcdh18 sera (or control sera) twice per week. MCA38 tumors were initiated sc and on day

10 mice received control Ig, anti-PD-1, anti-pcdh18 or both. Data are representative of

two independent experiments (n = 5 per group). For the experiment shown in Fig. 4,

comparison of average tumor size at 4 weeks of growth for treatment starting at day 5 is

P < 0.001 (wild-type average size was 0.78 cm3 and pcdh18–/– is 0.21 cm3). Murine anti-

pcdh18 serum was prepared by immunization of pcdh18–/– mice with recombinant pcdh18




7

extracellular domain (amino acids 39-690). Immunized mice were bled and pooled sera

was used for passive transfer.

MCA38 cell growth in vitro

MCA38 cells (2.5 x 104) infected with 'pcdh18b' or control lentivirus were plated in

triplicate in 48-well plates in the presence of doxycycline (0.001 mg/mL) and were

enumerated after trypan blue staining.

Tumor infiltrating lymphocyte preparation

TILs were prepared from either 5 (for use as effector cells in in vitro killing assays) or 10-

15 pooled tumors (for RNAseq analyses) per experiment by magnetic immunobeading as

described (13, 17). For Nanostring and RNAseq analyses, after enrichment by magnetic

immunobeading, TILs were stained with anti-CD8 and anti-TCR and purified by FACS

before purification of RNA. For assay of IFN production, 10 tumors were pooled to purify

TILs. Quadruplicate wells (2 x 105 cells/) were stimulated in vitro (for 36 h using plate-

bound anti-TCR) before assay of supernatants by ELISA (eBioscience, # 88-8314-88,

minimum sensitivity= 0.7 pg/mL).

Cytotoxicity assay.

Target cell killing was assessed (using freshly-isolated TILs or TILs that were cultured in

complete RPMI-1640 medium overnight) by MTT assay (Sigma-Aldrich) in quadruplicate

wells for each E:T ratio. Targets were either MCA38 tumor or RMA-S cells (pulsed with

SIINFEKL or control Kb binding peptide for 2 h at 26°). For determination of lytic

efficiency, maximal target cell lysis was calculated after treating target cells with 1% Triton

X-100 and used the formula: % cytotoxicity = (experimental- spontaneous

release)/(maximal release- spontaneous release) X 100.

TIL immune cell profiling

Wild-type mice were reconstituted with bone marrow from congenic pcdh18–/– mice

(Thy1.2) and MCA38 tumors developed. CD8+ TILs were combined from 5 individual

mice, then FACS-purified (by Thy1 expression) before RNA isolation and analysis by




8

Nanostring Pancancer Immune Cell profiling (Nanostring Technologies, Seattle, WA)

performed by the NYU School of Medicine Genome Technology Center.

MCA38 TIL were purified (combining 10 pooled tumors grown in WT mice) by

magnetic immunobeading and FACS, RNA was prepared, converted to cDNA and used

and analyzed by gene array (13) or RNAseq. RNAseq was performed on two

independent biological replicates of TIL (n = 6 and 10 pooled tumors each) isolated by

magnetic immunobeading followed by FACS.

Immunocytochemistry of human LN

Anonymized normal LN samples were de-parafinized and reacted with rabbit anti–pcdh-

18 (1:3,000) that was detected with HRP-conjugated donkey-anti-rabbit and amplified with

biotin/tyramide (Sigma-Aldrich, St. Louis, MO) and Alexa 594 Streptavidin essentially as

described (20). Samples were also labeled with mouse anti-CD8 (1:300) that was

detected with donkey-anti-mouse Alexa 488. Two individual LN were analyzed and 5

microscopic fields were counted for each sample which were scored by a blinded

observer.

Checkpoint inhibitor blockade of human T cells in vitro

PBMC were prepared by Ficoll gradient from a single donor (1.21 x 109 total cells) and

used to isolate CD8+ T cells by magnetic immunobeading. Total CD8+ cells were isolated

by negative selection ('untouched'), then CD45RA+ cells by positive selection (naïve).

CD45RO+ cells (memory) were then used to isolate Cm by positive selection (CD27+) and

Em (CD27–, 'untouched'). Cells were plated in triplicate in round-bottom wells using 96

well plates (22 x 103 cells/well) with or without blocking or control Ab (10 g/mL) as

indicated.

Results

Blockade of pcdh18 ligand expression in tumor targets restores TIL lytic function.

Pcdh18 is expressed in dysfunctional MCA38 TILs, within which it interacts with

p56lck. It is postulated to play a functional role in the lack of cytolytic activity of MCA38-

infiltrating T cells recovered from MCA38 tumor-bearing mice (13). The transiently




9

blocked proximal TCR-mediated signaling in these TILs is coincident with the tumor-

induced defect in cytotoxicity (21). Because pcdh18 binds to itself in a trans fashion (20),

and the inhibition of TIL lytic function by contact with cognate tumor cells implies a

reversible activation switch reminiscent of ISR interactions with their cognate ligands (17),

we examined the activation of TIL pcdh18 when cognate tumor cells had expression of

pcdh18 knocked down (22). We tested three shRNAs for their abilities to downregulate

pcdh18 expression in the cognate tumor cells that were used as targets for in vitro

cytolysis assays (Fig. 1). Expression of target sequence 'b' in MCA38 reduced pcdh18

mRNA 94% compared to controls (Fig. 1A), and pcdh18 protein was undetectable in

those tumor cells (Fig. 1B). As has been observed in almost every tumor model (16, 23),

freshly-isolated ('nonlytic') TILs lacked lytic function against MCA38 that express pcdh18

(Fig. 1C, solid blue tracing), but after purification and brief culture of the TILs, cytolysis

was restored (solid red tracing). In contrast, cognate MCA38 with pcdh18 knocked down

due to expression of shRNA were efficiently killed, even by freshly-isolated TILs (broken

blue tracing). (The robust lytic function of 'fresh' TILs was more pronounced than for TILs

after brief in vitro culture ('recovery'), possibly because many TILs are effete immediately

after the in vitro 'recovery' period, as suggested by higher annexin-V binding compared to

freshly-isolated TILs (24). The expression of pcdh18 on tumor cells was thus necessary to

engage pcdh18 on TILs and initiate its inhibitory function.

In the L. monocytogenes-OVA infection model, antigen-specific CD8+ T cells

accumulate in nonlymphoid tissue long after the infection is cleared, and these cells

resemble TILs in terms of cell surface expression of memory markers (25). However,

tissue-resident anti–L. monocytogenesOVA T cells are cytolytic immediately upon isolation

[as assessed by lytic activity towards OVA-expressing or SIINFEKL-pulsed RMA-S cells,

(25, 26))], whereas TILs are not (18). Thus, we asked if the tumor microenvironment

might induce defective effector-phase function in anti–L. monocytogenes T cells that

infiltrate tumor tissue. Mice were infected with L. monocytogenes-OVA at different times

relative to MCA38 tumor seeding (10 days prior, coincident, or 10 days after) and the lytic

function of CD8+ T cells isolated from tumor tissue after 20 days of growth was

determined (Fig. 1D). The time of infection relative to tumor seeding did not affect the

anti–L. monocytogenes-OVA response. CD8+ T cells had no lytic activity towards cognate




10

MCA38 tumor cells (red tracings). The same population of T cells, however, had efficient

lytic activity towards RMA-S cells pulsed with SIINFEKL (solid black tracings), but not

target RMA-S cells pulsed with control peptide.This experiments shows that residence in

tumor tissue is not sufficient to induce either pcdh18 expression or lytic dysfunction . We

found that mice infected with L. monocytogenes-OVA developed antigen-specific T cells

that both expressed pcdh18 protein and were maintained more than 1 year after infection

(Supplementary Fig. S1).

Delay of tumor formation after pcdh18 knockdown in tumor.

Knockdown of pcdh18 in tumor cells did not affect either the in vitro growth of MCA38

cells (Fig. 2A) nor the incidence or growth rate of tumors in CD8–/– mice (Fig 2B).

However, tumor growth in wild-type mice was significantly delayed (Fig. 2C, P < 0.001),

indicating that antitumor growth control mediated by T cells was enhanced in the

absence of pcdh18 in the tumor. To evaluate the effects on tumor growth of T cells that

lack pcdh18, MCA38 tumors with normal expression of pcdh18 were grown in pcdh18–/–

mice (Fig. 2D). Similar to delay in tumor growth of tumor cells lacking pcdh18 in wild-type

mice (Fig 2C), MCA38 tumor growth in pcdh18–/– mice was significantly delayed

compared to wild-type mice, implying that TILs in pcdh18–/– mice have enhanced effector-

phase function.

pcdh18–/– TILs upregulate gene expression for a variety of immune functions.

Why tumor development in pcdh18–/– mice was only delayed and not obviated was

investigated by analysis of gene expression in TILs from pcdh18–/– mice. Bone marrow

from wild-type and pcdh18–/– mice was used to generate bone-marrow chimeras in Thy1

congenic mice. Wild-type and pcdh18–/– MCA38 TILs isolated from the same tumors were

analyzed by Nanostring Immune Cell profiling containing 562 targets (Fig. 3). The data is

displayed as the ratio of expression of a given gene in pcdh18–/– TILs compared to wild-

type TILs and showed pcdh18–/– TILs had significant upregulation of many immune

function genes including those involved in T-cell activation and signaling (e.g., CD2, CD3,

CD8, CD122, CD278, p56lck, Zap70, TCR), the effector phase (GrzA and B, Prf), and

chemokines and cytokine receptors (Cxcr6, Ccr7 and CD122, CD212, CD218, IL27R).




11

In addition, pcdh18–/– TILs robustly expressed genes associated with negative functional

regulation (PD-1, NKG2a, CTLA-4, CD94, TIGIT, Sh2d1, CD5), most of which were

previously identified by gene array as expressed in nonlytic wild-type TILs

(Supplementary Fig. S2).

Blockade of PD-1 in pcdh18–/– mice enhanced antitumor TIL function.

Because expression of PD-1 is both highly expressed in wild-type TILs (13) and

significantly upregulated in pcdh18–/– TILs, analysis of the major PD-1 ligand (PD-L1) in

MCA38 tumor cells was assessed by flow cytometry (Fig. 4A, top). Cultured MCA38 cells

uniformly expressed little PD-L1, but exposure to IFN induced expression. In vivo more

host stromal cells expressed PD-L1 compared to tumor cells at early in tumor growth, but

at later times when the percentage of tumor cells within the tumor tissue increased, tumor

cell expression became dominant (Fig. 4A, bottom). PD-L1 expression following

inflammation in MCA38 tumor has been observed (27).

The finding that primary MCA38 tumors upregulate PD-L1 expression as a function of

time of growth prompted analysis of tumor growth in mice treated with PD-1 blockade (Fig

4B). Ab-mediated PD-1 blockade in wild-type mice significantly delayed growth of early

stage tumors (P < 0.001 on day 5, Fig 4B, top, solid lines), an effect that was diminished if

treatment was initiated after 10 days of tumor growth (dashed lines). Anti-PD-1 blockade

in pcdh18–/– mice inhibited tumor growth, even if treatment was delayed, and this effect

was more pronounced than in wild-type mice (Fig 4B, bottom). The average time to reach

half-maximal tumor size (~0.6 cm3) in wild-type mice treated with anti–PD-1 was 3 to 4

weeks but in pcdh18–/– mice is 5 to 6 weeks. A similar effect was noted in mice deleted for

the LAG-3 ISR (28).

An essential role for CD8+ T cells in mediating the delay of tumor growth following

anti–PD-1 blockade was assessed by depleting T cells in both wild-type and pcdh18–/–

mice (Fig 4c). Tumor volume was measured at 25 days of growth and showed both an

essential role for CD8+ T cells and an additive benefit of PD-1 blockade in pcdh18–/– mice

compared to PD-1 blockade in wild-type mice (average tumor volume ~0.1 cm3 versus ~

0.28 cm3, respectively).




12

The phenotype of TILs isolated from MCA38 tumors grown in wild-type and pcdh18–/–

mice was assessed by determination of IFN production upon isolation (at 26 days of

growth) and activation in vitro (Fig 4D). Following PD-1 blockade, TILs from wild-type

mice produced IFN immediately after isolation and pcdh18–/– TILs produced slightly more

IFN. The highest IFN secretion was seen in TILs from pcdh18–/– mice that were also

treated with anti–PD-1, an observation that is in keeping with those mice having the

smallest tumors (Fig 4C).

Antibody blockade of pcdh18 enhances anti–PD-1 tumor therapy in wild-type mice

Ab-mediated PD-1 blockade in wild-type mice delayed tumor growth (Fig 4B, top), an

effect that was enhanced in pcdh18–/– mice (Fig 4B, bottom), which we interpret to mean

that activity of both PD-1 and pcdh18 restrains CD8+ TILs function. To test the effect of

simultaneous blockade of PD-1 and pcdh18 on tumor growth, murine anti-pcdh18 serum

reactive with recombinant extracellular domain of pcdh18 was developed and was tested

for effect on tumor growth by passive transfer of sera (Supplementary Figs. S4 and S5).

Control mice developed tumors with characteristic kinetics (detectable at 6-7 days),

treatment with anti-pcdh18 slightly but consistently delayed growth, and anti–PD-1 was

more effective at tumor inhibition than anti-pcdh18. Control mice developed tumors with

characteristic kinetics (detectable at 6-7 days), treatment with anti-pcdh18 slightly but

consistently delayed growth, and anti–PD-1 was more effective at tumor inhibition than

anti-pcdh18. Consistent with the observations that anti–PD-1 treatment is more effective

in pcdh18–/– mice compared to wild-type mice (Fig. 4B), combined antibody therapy was

dramatically more effective than either monotherapy.

Pcdh18 expressed in human memory T cells mediated AICD and IFN secretion.

The expression of pcdh18 in human T cells was examined by immunocytochemistry

analysis of human LN (Fig. 5A). Regions containing CD8+ or CD4+ T cells showed less

abundant, but coincident, pcdh18 staining in a subset of T cells, ~ 5% of each single

positive cell type compared to single staining of CD8 or CD4 cells. We further analyzed

pcdh18 expression in freshly-isolated CD8+ memory T cells FACS-purified from normal

donor PBMC (Fig. 5B) wherein effector-memory CD8+ cells (CD44+CD45RO+CD27–)




13

were shown to contain pcdh18 protein. Expression of pcdh18 in the Em1 (CD44+CD27–

CD45RO–) subpopulation of CD8+ memory cells was especially strong, given that the

immunoblot signal was obtained from only 1.4 x 105 cells, whereas it is a minor fraction of

total CD8+ T cells in the peripheral blood. These analyses corroborated our previous

findings in mice that show CD8+ effector memory T cells, but not naive cells, express

pcdh18 (13) and extend those findings, in that pcdh18 was also found in memory CD4+ T

cells. Similar to mouse (13), human CD8+ human central memory T cells (CD27+, 'Cm')

expressed pcdh18 protein after in vitro activation coincident with conversion to CD27–

effector memory cells (Supplementary Fig. S6).

The role of pcdh18 in effector-phase functions of human memory T cells was

examined (Fig. 5C). Similar to the phenotype of TILs (24) and primary murine lytic effector

cells transfected to express pcdh18 (13), in vitro activation of purified pcdh18+ effector-

memory CD8+ T cells resulted in AICD, but inclusion of anti-pcdh18 enhanced viability

and cell recovery and had a slightly additive effect in conjunction with blocking anti–PD-1.

Checkpoint inhibitor blockade also enhanced effector phase function of activated primary

human CD8+CD27– memory T cells in that IFN secretion was dramatically increased

(Fig. 5D).

Discussion

Activation of T cells results from integration of a positive signal, generated by TCR

recognition of cognate antigen, with a negative signal, generated by interaction of ISR

with cognate ligands that are expressed on the antigen-expressing cell with which the T

cell interacts (15). The relative balance of signals from these two opposing systems

results from the number of receptors interacting with their cognate ligands and influences

the T-cell activation threshold, thus determining the functional outcome. The lytic

dysfunction of the effector-phase that typifies CD8+ TILs (1) is mediated by intrinsic

expression of the ISRs characteristic of effector memory cells (13). Engagement by the

ISR ligands expressed in the tumor environment results in abrogation of proximal TCR

signaling. Analysis of the basis for defective TIL lytic function in the murine

adenocarcinoma MCA38 model showed that the lytic defect is manifested by a failure to

mobilize TIL lytic granules upon conjugation with cognate tumor cells (18, 29); is transient




14

in nature, being rapidly reversed upon purification (13, 18, 21); and is induced by TILs

contact with cognate tumor cells (21, 30). Biochemical assessment of TIL signal

transduction in the MCA38 model revealed that although proximal TCR-mediated

signaling is intact when assessed with a surrogate antigen (by anti-CD3 TCR ligation)

(18), when cognate tumor cells are used to stimulate TILs in vitro, Zap70 is not activated,

implicating defective p56lck activity (21). In nonlytic nonsignaling TILs, pcdh18 interacts

with p56lck and expression of pcdh18 in signaling-competent primary lytic effector CD8+ T

cells (that do not endogenously express pcdh18) induces the TIL phenotype: proximal

TCR signaling is blocked at Zap70 activation coincident with abrogation of lytic function

(13). These characteristics strongly supported pcdh18 being an inhibitory signaling

receptor in TILs, one whose expression is restricted to memory T cells (13), and

motivated the experiments reported in this work.

ISRs initiate inhibitory signaling after binding to cognate ligand in trans (31), so we

determined the effect of silencing pcdh18 ligand expression in cognate tumor cells upon

TIL lytic response, and found that the poor lytic ability of freshly-isolated TILs could be

overcome with the use of tumor targets lacking pcdh18, showing that pcdh18 acted like

an ISR. The growth of MCA38 tumors lacking pcdh18 was significantly delayed, as was

the growth of wild-type MCA38 in pcdh18–/– mice, corroborated the in vitro data. These

experiments show that pcdh18 interaction with ligand initiated TIL functional deficiency.

Comparison of pcdh18–/– to wild-type TILs showed changes in the expression of

genes involved in the antitumor T-cell immune response, including genes encoding

inhibitory signaling receptors (e.g. PD-1). Nonetheless, effector-phase functions were also

increased in pcdh18–/– TILs as shown by enhanced tumor clearance, which was

correlated with increased expression of GrzB and IFN.

MCA38 TILs in wild-type mice are CD62lo (24), defining them as effector-memory T

cells, and clearly contain pcdh18 protein [which was the basis for its identification (13,

17)], thus it was interesting to note that RNA encoding pcdh18 was not robustly

expressed in freshly-isolated pcdh18–/– TILs. CD8+ memory T cells express pcdh18 RNA

(13) and upon activation, as CD62Lhi central-memory cells convert to CD62Llo effector-

memory cells, similar to the kinetics of activation of immediate-early response genes,

pcdh18 mRNA is rapidly upregulated following activation, but is quickly terminated and




15

degraded (13). This is likely the reason why prior RNA analysis of memory T cells failed

to detect pcdh18 expression (32). Rapid loss of pcdh18 RNA after activation shows that

dependency on RNA expression data for evaluation of involvement of a given candidate

ISR in T cell function need be corroborated with protein expression analyses.

Pcdh18 is highly expressed in embryonic brain, where it functions as a patterning

receptor (33), localizes to the to the neuronal synapse (34), and interacts with the brain

src homolog p59fyn (35). It is also expressed in various adult tissues (36), but until our

initial report (13) was not known to be expressed in the immune system. In the

hematopoietic system expression was restricted to the T cell lineage, including CD4+ T

cells, but only following differentiation to the memory state. Since pcdh18 was expressed

only in memory cells (and dendritic cells), pcdh18 appears to play an adjunct role in

regulation of the effector phase, in contrast to other IRS (e.g., PD-1) which are also

expressed in naive cells. Thus, we consider the function of pcdh18 to modify or sculpt the

effector phase, depending upon the expression of its ligand (itself) in tumor cells. Since

multiple ISRs are co-expressed in antitumor T cells (37), it seems reasonable to propose

that inhibition of pcdh18 in conjunction with other target ISRs like PD-1 may find utility in

experimental therapy of cancer. In this regard, we note that inspection of the cBioPortal

database shows amplification of pcdh18 ligand in a few cancer types (breast, prostate,

desmoplastic small-round-cell tumors), wherein it seems reasonable to predict anti-

pcdh18 intervention may be impactful (38).

ISRs, typified by PD-1, often function to raise the threshold of immune cell activation

by recruiting inhibitory phosphatases Shp-1 or Shp-2 (encoded by Ptpn6 and Ptpn11,

respectively) from the cytoplasm into proximity with components of the antigen receptor

wherein molecules important in signal transduction are inactivated by dephosphorylation

(39). Thus, because pcdh18 binds directly to p56lck (13), it differs mechanistically from

most ISRs and may represent a novel class of ISR that functions by direct interaction with

key enzymes in the proximal TCR signaling pathway, a class which may include other

src-binding proteins LIME, Sit, and TSAd. In this regard it is of interest that mRNA for all

three of these src-binding proteins are expressed at high levels in nonlytic TILs (13).




16

Acknowledgements

I am endebted to the many persons who materially contributed to this project: Adam

Blasidell, Rachel Brody, Jeremy Burns, Luis Chiriboga, Devon Columbus, Adrian

Erlebacher, Adriana Heguy, Tim Hemesath, Mythili Koneru, Ngozi Monu, Sasa Radoja,

Mohini Ragasagi, David Schaer, Sergio Trombetta, Alejandro Ulloa, Claire Vanpouille-

Box, Edwin Vazquez-Cintron.

Figures and figure legends

Figure 1. Inhibition of pcdh18 expression in MCA38 tumor cells enabled TIL killing

in vitro. A. 48 h after infection with lentiviruses expressing shRNA, MCA38 cells were

analyzed by qRT-PCR. Data shown is the average of 3 separate transductions. B. MCA38

infected with shRNA 'pcdh18b' lentivirus were analyzed by flow cytometry for pcdh18

expression C. Nonlytic (freshly-isolated) or lytic (overnight culture) MCA38 TILs were used

as effector cells and MCA38 tumor cells expressed either control or pcdh18 shRNA as

indicated. D. Freshly-isolated TILs from mice infected with Listeria monocytogenes-OVA for

the indicated times were assessed for lytic function using either cognate MCA38 tumor

(red tracings), SIINFEKL-pulsed RMA-S cells as targets (solid tracings), or RMA-S cells

pulsed with control peptide (dashed tracings).

Figure 2. Tumor formation after pcdh18 knockdown in MCA38 was delayed. A.

MCA38 cells infected with pcdh18b shRNA or control lentivirus were plated for the

indicated times and enumerated. B, CD8–/– mice (n = 10 per group), or C, wild-type mice

(n = 10 per group), were injected subcutaneously with MCA38 cells (2 x 105) transduced

with pcdh18b shRNA (solid line) or control lentivirus (dashed line) and tumor size

measured over time. Mice received doxycycline in drinking water. In C, P < 0.01 (student

t test) for average group tumor volume at week 5. D. Wild-type or pcdh18–/– mice were

injected ip with 2 x 105 MCA38 cells (n = 40 per group, P < 0.001, Gehan-Breslow-

Wilcoxon, GraphPad Prism).

Figure 3. Expression of immune cell molecules in wild-type and pcdh8–/– TILs.

Congenic mice were reconstituted with bone marrow from pcdh18–/–mice and MCA38




17

tumors developed (n = 5). CD8+ TILs were analyzed by Nanostring Pancancer

Immune Cell Profiling. Data is shown as expression in pcdh18–/– TILs (Thy1.2)

relative to wild-type (Thy1.1) TILs.

Figure 4. Involvement of PD-1 in regulation of TIL function in pcdh18–/– mice. A.

MCA38 cells were treated with IFN for 4 (green),12 (blue), or 24 (red tracings) h and

analyzed for PD-L1 expression (top). MCA38 tumors were seeded in congenic mice and

PD-L1 expression in Thy1.2+ tumor and Thy1.1+ stromal cells analyzed by flow cytometry

(bottom). B. Effect of anti–PD-1 (given on day 5 -solid lines or day 10 -dashed lines) on

tumor growth in wild-type (top panel) or pcdh18–/– mice (bottom panel). Data are

representative of two independent experiments (n = 5 per group). Comparison of average

tumor size at 4 weeks of growth for treatment starting at Day 5 is P < 0.001 (wild-type

average size was 0.78 cm3 and pcdh18–/– is 0.21 cm3). C. SC MCA38 tumors were

developed and mice received anti-CD8 (or control Ig) on day 5, 10, and 15 or anti–PD-1

starting on day 10. Tumor volumes in mice were determined 25 days after tumor injection.

Data are representative of two independent experiments (n = 5 per group). **, P < .001

compared to mice receiving no Ab. D. TILs were isolated from tumors of mice that did NOT

receive anti-CD8 (in panel C) and IFN production determined 26 days after tumor

injection. *, P < .01; **, P < .001 compared to WT mice.

Figure 5. Pcdh18 expression in human CD8+ and CD4+ T cells. A. Normal human LN

(n = 2, 5 consecutive sections/LN) were stained with anti-pcdh18 (red) and anti-CD8 or

anti-CD4 (green). Sections were scored for the ratio of pcdh18+ cells detected in the CD8+

or CD4+ T cell populations, as “# pcdh18+CD8+ T cells/ # CD8+ T cells" and “# of

pcdh18+CD4+ cells /# of CD4+ T cells". The percent of “double positive cells” was

calculated for each sample. Arrows indicate double-positive cells (CD4 or CD8 plus

pcdh18). B. Human CD8+ T cells from two pooled donors ('Leukopack') by collection of

PBMC on Ficoll, enrichment of CD8+ T cells by magnetic immunobead negative selection,

and FACS as described in 'Methods'. Cells were lysed in SDS-PAGE sample buffer before

immunoblot analysis of equal number of cell equivalents (1.4 x 105/lane). C. Primary

human CD8+CD45RO+CD27– effector memory (Em) T cells were isolated and stimulated




18

with OKT3 (2ug/mL) with or without a rabbit IgG anti-pcdh18, anti-PD-1, or control IgG of

appropriate species. Cell number data (C) is representative of three experiments.

Supernatants of cells in C were collected for IFN ELISA (in D) and is representative of

two experiments.

Citations

1 Radoja, S. and A. B. Frey. Cancer-induced defective cytotoxic T lymphocyte effector function: another mechanism how antigenic tumors escape immune-mediated killing. Mol Med 2000:6:465-79. 2 Frey, A. B. Suppression of T cell responses in the tumor microenvironment. Vaccine 2015. 3 Hanahan, D. and L. M. Coussens. Accessories to the crime: functions of cells recruited to the tumor microenvironment. Cancer Cell 2012:21:309-22. 4 Wherry, E. J. T cell exhaustion. Nat Immunol 2011:12:492-9. 5 Chen, D. S. and I. Mellman. Oncology meets immunology: the cancer-immunity cycle. Immunity 2013:39:1-10. 6 Sharma, P. and J. P. Allison. The future of immune checkpoint therapy. Science 2015:348:56-61. 7 Pitt, J. M., M. Vetizou, R. Daillere, M. P. Roberti, T. Yamazaki, B. Routy, P. Lepage, I. G. Boneca, M. Chamaillard, G. Kroemer and L. Zitvogel. Resistance Mechanisms to Immune-Checkpoint Blockade in Cancer: Tumor-Intrinsic and -Extrinsic Factors. Immunity 2016:44:1255-69. 8 Vazquez-Cintron, E. J., N. R. Monu and A. B. Frey. Tumor-induced disruption of proximal TCR-mediated signal transduction in tumor-infiltrating CD8+ lymphocytes inactivates antitumor effector phase. J Immunol 2010:185:7133-40. 9 Topalian, S. L., J. D. Wolchok, T. A. Chan, I. Mellman, K. Palucka, J. Banchereau, S. A. Rosenberg and K. Dane Wittrup. Immunotherapy: The path to win the war on cancer? Cell 2015:161:185-6. 10 Pauken, K. E. and E. J. Wherry. Overcoming T cell exhaustion in infection and cancer. Trends Immunol 2015:36:265-76. 11 Frey, A. B. and N. Monu. Signaling defects in anti-tumor T cells. Immunol Rev 2008:222:192-205.




19

12 Schietinger, A., M. Philip, V. E. Krisnawan, E. Y. Chiu, J. J. Delrow, R. S. Basom, P. Lauer, D. G. Brockstedt, S. E. Knoblaugh, G. J. Hammerling, T. D. Schell, N. Garbi and P. D. Greenberg. Tumor-Specific T Cell Dysfunction Is a Dynamic Antigen-Driven Differentiation Program Initiated Early during Tumorigenesis. Immunity 2016:45:389-401. 13 Vazquez-Cintron, E. J., N. R. Monu, J. C. Burns, R. Blum, G. Chen, P. Lopez, J. Ma, S. Radoja and A. B. Frey. Protocadherin-18 is a novel differentiation marker and an inhibitory signaling receptor for CD8(+) effector memory T cells. PLoS ONE 2012:7:e36101. 14 Pardoll, D. M. The blockade of immune checkpoints in cancer immunotherapy. Nat Rev Cancer 2012:12:252-64. 15 Chen, L. and D. B. Flies. Molecular mechanisms of T cell co-stimulation and co-inhibition. Nat Rev Immunol 2013:13:227-42. 16 Frey, A. B. Suppression of T cell responses in the tumor microenvironment. Vaccine 2015:33:7393-400. 17 Monu, N. and A. B. Frey. Suppression of proximal T cell receptor signaling and lytic function in CD8+ tumor-infiltrating T cells. Cancer Res 2007:67:11447-54. 18 Radoja, S., M. Saio, D. Schaer, M. Koneru, S. Vukmanovic and A. B. Frey. CD8(+) tumor-infiltrating T cells are deficient in perforin-mediated cytolytic activity due to defective microtubule-organizing center mobilization and lytic granule exocytosis. J Immunol 2001:167:5042-51. 19 Thu, C. A., W. V. Chen, R. Rubinstein, M. Chevee, H. N. Wolcott, K. O. Felsovalyi, J. C. Tapia, L. Shapiro, B. Honig and T. Maniatis. Single-cell identity generated by combinatorial homophilic interactions between alpha, beta, and gamma protocadherins. Cell 2014:158:1045-59. 20 Blaisdell, A., A. Crequer, D. Columbus, T. Daikoku, K. Mittal, S. K. Dey and A. Erlebacher. Neutrophils Oppose Uterine Epithelial Carcinogenesis via Debridement of Hypoxic Tumor Cells. Cancer Cell 2015:28:785-99. 21 Koneru, M., D. Schaer, N. Monu, A. Ayala and A. B. Frey. Defective proximal TCR signaling inhibits CD8+ tumor-infiltrating lymphocyte lytic function. J Immunol 2005:174:1830-40. 22 Chen, W. V. and T. Maniatis. Clustered protocadherins. Development 2013:140:3297-302. 23 Frey, A. B. (2008). Cancer-induced signaling defects in antitumor T cells. Mechanisms of tumor immue suppression. A. a. Hurwitz and D. I. Gabrilovich. New York, Springer: 69-100.




20

24 Radoja, S., M. Saio and A. B. Frey. CD8+ tumor-infiltrating lymphocytes are primed for Fas-mediated activation-induced cell death but are not apoptotic in situ. J Immunol 2001:166:6074-83. 25 Masopust, D., V. Vezys, A. L. Marzo and L. Lefrancois. Preferential localization of effector memory cells in nonlymphoid tissue. Science 2001:291:2413-7. 26 Masopust, D., V. Vezys, E. J. Usherwood, L. S. Cauley, S. Olson, A. L. Marzo, R. L. Ward, D. L. Woodland and L. Lefrancois. Activated primary and memory CD8 T cells migrate to nonlymphoid tissues regardless of site of activation or tissue of origin. J Immunol 2004:172:4875-82. 27 Terawaki, S., S. Chikuma, S. Shibayama, T. Hayashi, T. Yoshida, T. Okazaki and T. Honjo. IFN-alpha directly promotes programmed cell death-1 transcription and limits the duration of T cell-mediated immunity. J Immunol 2011:186:2772-9. 28 Woo, S. R., M. E. Turnis, M. V. Goldberg, J. Bankoti, M. Selby, C. J. Nirschl, M. L. Bettini, D. M. Gravano, P. Vogel, C. L. Liu, S. Tangsombatvisit, J. F. Grosso, G. Netto, M. P. Smeltzer, A. Chaux, P. J. Utz, C. J. Workman, D. M. Pardoll, A. J. Korman, C. G. Drake and D. A. Vignali. Immune inhibitory molecules LAG-3 and PD-1 synergistically regulate T-cell function to promote tumoral immune escape. Cancer Res 2012:72:917-27. 29 Bronte, V., T. Kasic, G. Gri, K. Gallana, G. Borsellino, I. Marigo, L. Battistini, M. Iafrate, T. Prayer-Galetti, F. Pagano and A. Viola. Boosting antitumor responses of T lymphocytes infiltrating human prostate cancers. J Exp Med 2005:201:1257-68. 30 Koneru, M., N. Monu, D. Schaer, J. Barletta and A. B. Frey. Defective adhesion in tumor infiltrating CD8+ T cells. J Immunol 2006:176:6103-11. 31 Greenwald, R. J., G. J. Freeman and A. H. Sharpe. The B7 family revisited. Annu Rev Immunol 2005:23:515-48. 32 Wherry, E. J., S. J. Ha, S. M. Kaech, W. N. Haining, S. Sarkar, V. Kalia, S. Subramaniam, J. N. Blattman, D. L. Barber and R. Ahmed. Molecular signature of CD8+ T cell exhaustion during chronic viral infection. Immunity 2007:27:670-84. 33 Shapiro, L. and D. R. Colman. The diversity of cadherins and implications for a synaptic adhesive code in the CNS. Neuron 1999:23:427-30. 34 Dustin, M. L. and D. R. Colman. Neural and immunological synaptic relations. Science 2002:298:785-9. 35 Homayouni, R., D. S. Rice and T. Curran. Disabled-1 interacts with a novel developmentally regulated protocadherin. Biochem Biophys Res Commun 2001:289:539-47.




21

36 Kim, S. Y., S. Yasuda, H. Tanaka, K. Yamagata and H. Kim. Non-clustered protocadherin. Cell Adh Migr 2011:5:97-105. 37 Blackburn, S. D., H. Shin, W. N. Haining, T. Zou, C. J. Workman, A. Polley, M. R. Betts, G. J. Freeman, D. A. Vignali and E. J. Wherry. Coregulation of CD8+ T cell exhaustion by multiple inhibitory receptors during chronic viral infection. Nat Immunol 2009:10:29-37. 38 cBioPortal1. http://www.cbioportal.org/cross_cancer.do?cancer_study_list=&cancer_study_id=all&data_priority=0&case_ids=&patient_case_select=sample&gene_set_choice=user-defined-list&gene_list=PCDH18. 2017. 39 Paling, N. R. and M. J. Welham. Role of the protein tyrosine phosphatase SHP-1 (Src homology phosphatase-1) in the regulation of interleukin-3-induced survival, proliferation and signalling. Biochem J 2002:368:885-94.




Figure 1on July 21, 2021. © 2017 American Association for Cancer Research. cancerimmunolres.aacrjournals.org Downloaded from






Figure 3 on July 21, 2021. © 2017 American Association for Cancer Research. cancerimmunolres.aacrjournals.org Downloaded from









Published OnlineFirst September 5, 2017.Cancer Immunol Res Alan B. Frey tumor infiltrating CD8+ T cell functionThe inhibitory signaling receptor protocadherin-18 regulates

Updated version

10.1158/2326-6066.CIR-17-0187doi:

Access the most recent version of this article at:

Material

Supplementary

http://cancerimmunolres.aacrjournals.org/content/suppl/2017/09/02/2326-6066.CIR-17-0187.DC1

Access the most recent supplemental material at:

Manuscript

Authoredited. Author manuscripts have been peer reviewed and accepted for publication but have not yet been

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected] at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://cancerimmunolres.aacrjournals.org/content/early/2017/09/02/2326-6066.CIR-17-0187To request permission to re-use all or part of this article, use this link



http://cancerimmunolres.aacrjournals.org/lookup/doi/10.1158/2326-6066.CIR-17-0187

http://cancerimmunolres.aacrjournals.org/content/suppl/2017/09/02/2326-6066.CIR-17-0187.DC1

http://cancerimmunolres.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://cancerimmunolres.aacrjournals.org/content/early/2017/09/02/2326-6066.CIR-17-0187


Date post:	25-Feb-2021
Category:	Documents
Upload:	others
View:	2 times
Download:	0 times

The inhibitory signaling receptor protocadherin-18 regulates … · 2017. 9. 2. · memory T cells...

Documents