Thesis- Final Sep 21-1

Genetic stability of recombinant baculoviruses containing foreign genes

Jasvir Kaur

Presented as final requirement for the degree of Master of

Biotechnology

Oxford Brookes University School of Life Sciences

September 2015

ii

Table of Contents

LIST OF FIGURES IV

LIST OF TABLES VI

ACKNOWLEDGMENTS VII

DECLARATION VIII

ABSTRACT IX

TABLE OF ABBREVIATIONS XI

OVERVIEW OF BACULOVIRUS 1

CHAPTER 1-‐ INSIGHT OF BACULOVIRUS 3 1.1 HISTORY 3 1.2 CLASSIFICATION 4 1.3 BACULOVIRUS PROTEIN STRUCTURE 5 1.4 GENOME OF ACMNPV 6 1.5 BACULOVIRUS REPLICATION 7 1.6 VIRUS REPLICATION IN VIVO 10 1.7 ENTRY INTO THE NUCLEI 11 1.8 EXITING THE CELL NUCLEI 11 1.9 GENE EXPRESSION REGULATION 12 1.9.1 IMMEDIATE EARLY GENES 12 1.9.2 DELAYED EARLY GENES 13 1.9.3 LATE AND VERY LATE GENE 13 1.10 INSECT CELL LINES 13 1.11 TRANSFER VECTOR 14 1.13 SELECTION OF POLYHEDRON-‐NEGATIVE RECOMBINANT BACULOVIRUSES 16 1.13.1 BEVS-‐ BACULOVIRUS EXPRESSION VECTOR SYSTEM 16 1.13.2 RECOMBINANT BACULOVIRUS PRODUCTION 18 1.13.3 THE BACPAK6 SYSTEM 18 1.13.4 BAC-‐TO BAC® 19 1.13.5 FLASHBACTM 20 1.14 MULTIPLICITY OF INFECTION 21 1.15 SERIAL PASSAGING 23 AIM OF THIS PROJECT 25

CHAPTER 2 -‐MATERIALS AND METHODS 26 2.1 MATERIALS 26 2.1.1 PLASMIDS 26 2.2 PREPARATION OF BACTERIAL CELLS AND EXTRACTION OF PLASMID DNA 26 2.3 INSECT CELLS AND VIRUSES 27 2.4 COTRANSFECTION OF INSECT CELLS WITH FLASHBAC AND PLASMID TRANSFER VECTOR DNA 27

iii

2.5 VIRUS STOCK 28 2.6 TESTING PRESENCE OF FOREIGN GENE IN VIRUS STOCK 28 2.7 TEMPLATE FORMATION WITH THE USE OF KIT TO TEST THE PRESENCE OF THE GENE IN THE VIRUS 29 2.8 SERIAL PASSAGING 29 2.9 HARVESTING OF VIRUS DNA 30 2.10 VIRUS STOCK TITRATION 30 2.10.1 PLAQUE ASSAY 30 2.11 PURIFICATION OF VIRUS DNA 31 2.12 PCR ANALYSIS 31 2.13 AGAROSE GEL ELECTROPHORESIS 32

CHAPTER 3 – RESULTS 33 3.1 VIRUSES 33

CHAPTER 4-‐ DISCUSSION 45

CONCLUSION AND FUTURE DEVELOPMENTS 51

REFERENCES 53

iv

List of Figures Figure Figure Caption Page Figure 1.1. The above phylogenetic tree indicates the division of four groups

in baculovirus family. It indicates amino acids of 29 baculoviruses genes derived from 29 sequenced baculovirus genomes -‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐ 5

Figure 1.2. Group I has both GP64 and F while Group II only has F protein -‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐ 6

Figure1.3. AcMNPV's genetic map. -‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐ 7 Figure 1.5. Baculovirus structure -‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐ 10 Figure 1.3. A. DNA containing Escherichia coli (E. coli) lacZ inserted at polh

locus. B. Digestion of viral DNA removes lacZ and partially deletes orf1629-‐coding region C. Cotransfection and insertion of foreign gene into the virus DNA and restoration of orf1629 and recircularization of DNA thus permitting replication within insect cells. D. Plaque assay is used to isolate recombinant virus -‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐ 19

Figure 1.4. The flashBAC baculovirus expression system used for

production of recombinant baculoviruses. A.) Shows the deleted genes. B.) Containment of gene, insert, lef2, and orf1629 gene in transfer vector. C.) Recombinant virus with repaired orf1629 gene. -‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐ 21

Figure 3.1. A. PCR analysis of the recombinant genes. B. A plasmid map of

pAcRP23.lacZ C. A plasmid map of pOET6NaV1.4. -‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐ 35 Figure 3.2. PCR analysis of cell DNA and plasmid DNA. Lane 1, molecular

weight markers (New England Biolabs). Lane 2, 6, 8, are plasmid DNA. Lane 2, 4, 5, 7, are cell DNA. Lane9, 10 are control groups -‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐ 36

Figure 3.3. The virus stock titration done by plaque assay. A. AcNaV1.4 virus dilution 10-‐4. B. AcUK, virus dilution10-‐1. C. AcHANA , virus dilution10-‐2. D. AcRP23.lacZ virus dilution10-‐5 -‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐ 37

Figure 3.4. Genomic DNA isolated from AcMNPV passaged five times at low (0.1 pfu/cell, lane 2-‐6) and (high 5pfu/cell, land 7-‐11). The MOI was amplified using PCR with oligonucleotide primers RDP 213 and 214. Lane 1, molecular weight markers (New England Biolabs). -‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐ 38

v

Figure 3.5. Genomic DNA isolated from AcRP23.lacZ passaged five times at low (0.1 pfu/cell, lane 2-‐6) and (high 5pfu/cell, land 7-‐11). The MOI was amplified using PCR with oligonucleotide primers RDP 213 and 214. Lane 1, molecular weight markers (New England Biolabs). -‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐ 38

Figure 3.6. Genomic DNA isolated from AcUK passaged five times at low (0.1 pfu/cell, lane 2-‐6) and (high 5pfu/cell, land 7-‐11). The MOI was amplified using PCR with oligonucleotide primers RDP 213 and 214. Lane 1, molecular weight markers (New England Biolabs). A. Ethidium bromide nucleic acid gel stain used. B. SYBR Gold nucleic acid gel stain used. -‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐ 39

Figure 3.7. Genomic DNA isolated from AcRP23.lacZ passaged five times at low (0.1 pfu/cell, lane 2-‐6) and (high 5pfu/cell, land 7-‐11). The MOI was amplified using PCR with oligonucleotide primers RDP 213 and 214. Lane 1, molecular weight markers (New England Biolabs). A. Ethidium bromide nucleic acid gel stain used. B. SYBR Gold nucleic acid gel stain used. -‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐ 40

Figure 3.8. Genomic DNA isolated from AcNaV1.4 passaged five times at low (0.1 pfu/cell, lane 2-‐6) and (high 5pfu/cell, land 7-‐11). The MOI was amplified using PCR with oligonucleotide primers RDP 213 and 743. Lane 1, molecular weight markers (New England Biolabs). A. Ethidium bromide nucleic acid gel stain used. B. SYBR Gold nucleic acid gel stain used. -‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐ 42

Figure 3. 9. Genomic DNA isolated from AcHANA passaged five times at low

(0.1 pfu/cell, lane 2-‐6) and (high 5pfu/cell, land 7-‐11). The MOI was amplified using PCR with oligonucleotide primers RDP 213 and 214. Lane 1, molecular weight markers (New England Biolabs). -‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐ 43

Figure 3.10. PCR analysis of virus DNA provided by Robert Possee -‐-‐-‐-‐-‐-‐-‐-‐ 43

vi

List of Tables Table Table Caption Page Table 2.1 Plasmid Transfer Vectors -‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐ 27

Table 2.2: Viruses used in this experiment -‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐ 28

Table 3.1. DNA concentration of virus cells using Nanovue

Spectrophotometer -‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐ 36

Table 3.2. Titration using plaque assay of each virus. -‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐-‐ 37

vii

Acknowledgments

I would like to acknowledge and thank the following individuals who helped

me perform the work presented in this thesis.

Prof. Possee who was always available to help me and guided me throughout

the research. I thank him for giving me the opportunity to work in his lab. He

has invested significant amounts of time and been a great mentor to me.

My parent for their support and their encouragement in everything I did.

This master’s research thesis was not possible without my parent’s support

and love.

viii

Declaration I, Jasvir Kaur declare that this thesis and the work present in it are my own

and have been generated by me as the result of my own original research.

Wherever contributions of others are involved, it is made clear with due

reference to literature.

The work was performed under the guidance of Prof. Robert Possee, at

Oxford Brookes University.

ix

Abstract Baculoviruses are mostly found in order Lepidoptera and are found among

600 different insect species. Baculoviruses were originally used in

production of insecticides, but now they are widely used for the production

of many recombinant proteins. The baculovirus expression system was

developed decades ago and has improved in expression of foreign genes in

insect cell lines. Cotransfection is commonly used to generate recombinant

viruses. The Sf9 cells were co-‐transfected with the use of flashBAC DNA and

plasmid transfer vectors (pACRP23.lacZ, pAcUK, pOET6.NaV1.4, and

pAcHANA). The populations of the viruses were monitored up to five

passages at both low (0.1) and high (5) moi. The viruses were passaged in

cell culture at 5ml, from which the virus particles were purified from and

DNA analysis was performed. The data collected in this study reveals that

two control viruses AcMNPV, AcRP23.lacZ and AcHANA generated in this

study were all genetically stable during passage. However, AcUK, which

contains the mammalian gene urokinase, AcRP23.lacZ (generated in this

study), containing bacterial beta-‐glacatosidase gene and AcNav1.4, which

contains mammalian Nav1.4 gene were found to be genetically unstable.

Thus, nonspecific bands were found in the viruses AcUK and AcRP23.lacZ.

The results with the newly generated AcRP23.lacZ were surprising since the

control virus with the same gene appeared to be stable after passage at both

low and high moi’s. This may be due to defective interfering particles (DIPs)

or few polyhedra (FP)25K mutation. DIP occurs over time during viral

infection and FP25K mutation takes place, if small amount of cells have

x

polyhedron and ODV, which can cause nonspecific bands to occur. The

verification of plasmid cell DNA in the cotransfected cells all had high

molecular weight bands. The PCR analysis of the plasmid DNA showed no

such results among AcUK, AcRP23.lacZ, and AcNaV1.4.

xi

Table of Abbreviations AcMNPV: Autographa californica nucleopolyhedrovirus

BAC: bacterial artificial chromosome

BEVs: baculovirus expression vectors

bp: base pairs

BV: budded virions

DNA: deoxyribonucleic acid

DI: defective interfering

dpi: days post infection

FCS: foetal calf serum

Fp25k: Autographa californica multiple nucleopolyhedrovirus with the

fp25k gene removed

FP: few polyhedra

Gp64: globular protein 64

GV: granulovirus

H: hours

hpi: hours post infection

LB: luria broth

MOI: multiplicity of infection

NPV: nucleopolyhedrovirus

N-‐terminal: amino-‐termina

OBs: occlusion bodies

ODV: occlusion-‐derived virions

ORF: open reading frame

P10: baculovirus 10 kDa protein

PBS: phosphate buffered saline

PCR: polymerase chain reaction

PE: polyhedral envelope

PFU: plaque forming units

pi: post-‐infection

Polh: polyhedrin

rpm: rotations per minute

xii

Sf: Spodoptera frugiperda

T. ni: Trichoplusi ni

TBS: tris buffered saline

1

Overview of Baculoviruses

Baculoviruses are commonly found in nature. They are large DNA viruses

isolated from arthropods found on land and in aquatic environments. They

mainly tend to infect butterflies, moths, sawflies, wasps, flies and beetles.

However, most baculoviruses have been isolated from species in the order

Lepidoptera. They are believed to have coevolved with their insect hosts

over millions of years. Baculoviruses have the ability to survive easily in soil

or in clefts of plants for long periods (decades) since they have the capability

of surviving outside their host within highly resistant protein occlusion

bodies. The recent literature claims that baculovirus diseases are found in

more than 600 different insect species. New information is also emerging

about the genetic diversity of baculoviruses. The gene organization of NPVs

is conserved, but the existence or truancy of auxiliary genes can result in

variation among the viruses.

Baculoviruses were originally studied for their use as biological

insecticides. Each baculovirus isolate only infects particular species and will

not harm non-‐ invertebrate hosts. Hence they are regarded as very safe

viruses. This was a major advantage in their second main use. Currently

they are also widely employed as gene expression vectors to make

recombinant proteins and as vectors for mammalian cell transduction,

where genes are introduced under control of promoters active in the target

cells.

One of the most widely studied members of the family Baculoviridae

is Autographa californica multiple nucleopolyhedrovirus (AcMNPV), as it

infects around 30 species belonging to the lepidoptera. Most studies of virus

structure have been based on this isolate. Baculovirus nucleocapsids are

rod-‐shaped and contain double stranded circular genome DNA. Some of the

features of baculoviruses include two types of virions: occlusion-‐derived

virions (ODV) with occlusion bodies –responsible for horizontal

transmission between insects and budded virions (BV)-‐ known to spread

virus from cell to cell within a host insect. The baculoviruses are capable of

2

expressing foreign genes in baculovirus expression vector system (BEVS), as

they are nuclear-‐replicating DNA viruses that encode DNA directed RNA

polymerase, which is used to transcribe late and very late genes (Clem &

Passarelli, 2013). The BEVS has been used to express genes from plants,

fungi, bacteria, and viruses in insect cells. One of the benefits of

baculoviruses is that they have large genomes, which allows easy insertion

of the foreign genes. The basis of the system is the removal of the occlusion

body protein gene (polyhedron) and its replacement with a foreign coding

region.

An important aspect of the BEVs is the method used to insert genes

into the recombinant virus. flashBACTM produced by Oxford Expression

technologies has reduced the time to produce recombinant viruses to a one

step process (Possee et al., 2008). However, it is also important that we have

a better understanding of the stability of these viruses as they are passaged

in insect cells to generate infectious stocks used for subsequent recombinant

protein production.

3

Chapter 1-‐ Insight of Baculoviruses

1.1 History

Baculoviruses do not cause any infection in humans, mammals and

researchers have known of their existence for several hundred years. The

earliest information on baculoviruses can be traced in ancient Chinese

literature, which describes the culture of silkworms. Marco Vida of Cremona,

an Italian bishop of 16th century, provided the first explanation of

baculovirus disease. He described the disease of silk worms in a poem called,

“De Bombyce”. In the poem he described the symptoms of the infection.

Baculoviruses were not observed directly until 19th century. Polyhedral

crystals were observed by microscopy and associated with disease in

insects. During research carried out in the 20th century, it was found that the

virus particles are embedded in the polyhedral crystals. In addition it was

found that baculoviruses played a major role in regulating insect

populations. The granuloviruses (GVs) were also identified. In comparison

to nucleopolyhedrovirus (NPV), the GVs are found to be small and granular.

They contain only one virion per occlusion body. During the same period,

baculoviruses were observed and were affecting the insect pest. Introducing

baculoviruses in North America effectively controlled sawfly. From the early

1950’s to 1975, the development of baculovirus as control agents of insect

pests was on the rise.

From 1970 to 1985, various pathological and genetic understandings

of baculoviruses were developed. Discovering the fact that there are two

different forms of baculoviruses, a budded virus (BV) and occluded virus

(OV) form was important in realizing the behavior of the virus. The behavior

helped in cell cultures and in insect host pathology. OV are more infectious

in the mid-‐gut of an insect, while BV spreads the infections in cell cultures or

in other tissues.

The most studied member of the Baculoviridae family is Autographa

californica nucleopolyhedrovirus (AcMNPV). It became popular for study

because it was easy to grow in cell cultures. In 1979, National Institutes of

4

Health allowed cloning of baculovirus in Escherichia coli. The cloning was

used to analyze particular genes and their functions. The usefulness of

baculovirology led to major success in human gene therapy, molecular

biology and genetics with cell culturing. It also led to mass production of

pesticides for the benefit in the field of agriculture.

1.2 Classification The Baculoviridae viruses are rod-‐shaped with circular double

stranded DNA genome of 88-‐180 kbp, consisting of up to 180 genes, in a rod-‐

shaped virus particle with the size of 200-‐400nm in length and 36nm wide

(Cheng et al., 2013). These viruses are categorized as arthropod-‐specific

viruses. (Shi et al., 2015). There are two virion pheotypes found in

baculoviruses occlusion-‐derived virion (ODV) and budded virions (BV).

Budded virion (BV)-‐ spreads the infecton from tissue to tissue and occlusion

derived virion (ODV), which is consumed via oral route and spreads

infection between individual insects. In the two virions, the nucleocapsid

protein and genetic material are identical to each other. Both of the virions

are formed in the virogenic stroma (VS) (Shi et al., 2015). ODV are occluded

in a crystalline protein matrix to form granules or polyhedra. The viruses

that form ganules are known as granuloviruses and the viruses that form

polyhedra are known as nucleopolyhedroviruses (NPVs). Granuloviruses

produce small occlusion bodies (OBs) ranging between the size of (0.13-‐

0.50μm), containing one to two encapsulated virions in a protein known as

granulin(Jehle et al., 2006).

Nucleopolyhedroviruses produce occlusion bodies ranging from

(0.15 to 3μm) and they contain many ODVs (Jehle et al., 2006). NPVs have

been commonly found among insect orders Lepidoptera, Diptera and

Hymenoptera, while GVs have been only found among Lepidoptera. For a

long time, baculoviruses have been classified into two groups granuloviruses

(GVs) and nucleopolyhedroviruses (NPVs) (Kelly et al., 2008). The

Baculoviridae family is sectioned into four generas. The Alphabaculoviruses

are lepidoperan-‐specific nuclopolyhedroviruses with either single or

multipe nuclocapsids, which produces both BV and ODV (Jehle et al., 2006).

5

The Betabaculoviruses are composed of lepidoteran specific genus

Granulovirus and also produces both BV and ODV. Deltabaculoviruses and

Gammabculoviruses are made up of NPVs that only infect dipteran and

hymenopteran (Jehle et al., 2006). The phylogentic tree shown below in

Figure 1.1 shows the division of Baculoviridae family.

Figure 1.5. The above phylogenetic tree indicates the division of four groups in baculovirus family. It indicates amino acids of 29 baculoviruses genes derived from 29 sequenced baculovirus genomes (Jehle et al., 2006).

1.3 Baculovirus protein structure

The baculoviruses have the potential to encode more than 150 proteins due

to their large genomes (Ahrens et al., 1997). The viral particles consist of

nucleocapsids of which the DNA is associated with the p6.9 protein, which is

a 54 amino acid protein. In additon, vp39 has also been recognized, which is

about 39 kDa and forms most of the capsid structure. The occlusion bodies,

budded virus (BV) and occlusion derived virus (ODV) envelopes and

proteins are building blocks of nucleocapsids (Rohrmann, 2013). One of the

best characterised baculovirus protein is group I NPV gp64, this protein is

6

important for BV infectivity but genome sequence analysis indicateded that

many baculoviruses lack homologs of the gp64 gene(Rohrmann, 2013). It

was later discovered that those that lack gp64 possess a different protein,

called F (fusion) protein (e.g. LD130 from Lymantria dispar MNPV)

Granuloviruses and group II NPVs do not have GP64, therefore the F protein

is used as an alternative (Rohrmann, 2013). It is assumed that group I

viruses use GP64 to enter BV into cells, while the baculoviruses that lack

gp64 homolog use F protein as their envelope protein (Figure 1.2)

(Rohrmann, 2013).

Figure 1.6. Group I has both GP64 and F while Group II only has F protein (Rohrmann, 2013).

1.4 Genome of AcMNPV

The AcMNPV was first described in the early 1970s and a decade later

genetic research was done. The genetic research was influenced by virus

replication in cells from Spodoptera frugiperda and Trichoplusia ni

(Rohrmann, 2013). These discoveries lead to the development of a bacmid

system, which produced recombinant virus with transposition plasmids in

the AcMNPV genome in artificial bacterial chromosome. The artificial

bacterial chromosome replicated the entire AcMNPV genome in bacteria

(Rohrmann, 2013). This technology allowed specific deletion gene knockout

7

in bacteria, which could later be investigated with the use of transfection in

insect cells (Rohrmann, 2013). AcMNPV is a vector that is used frequently

for recombinant protein production in baculovirus expression system

(Harrison, 2009). AcMNPV infections have been reported in 43 lepidopteron

species belonging to 11 different families caused by AcMNPV. The first fully

sequenced AcMNPV was the C6 clone (Ayreus et al.,1994). The genome of

AcMNPV contains a 133.9 kbp, circular double stranded DNA genome in rod-‐

shaped virion (Lee, et al., 2015). AcMNPV is also made up of about 154

ORFs, which have little redundant sequence between them (Dickison et al.,

2012). AcMNPV lead to the development of the original baculovirus-‐insect

cell expression system.

Figure1.3. AcMNPV's genetic map. Adapted from (Maciag, Olszowka, &Klein,2014)

1.5 Baculovirus replication

The replication cycle consists of two type of virions, one known as occluded

and the other as budded. The occluded is responsible for infection and

stability in insects midgut cells. Whereas the budded virions are only

responsible in spreading the infection from cell to cell. The replication starts

when the occlusion body is absorbed by the insect. The viral particles are

8

then released inside insects midgut due to high pH (Figure 1.4). The viral

particles (ODV) after being released, infect three different cell types, such as

regenerative(R ), columnar epithelium (CE), and goblet cells (G). (McCarthy

& Theilmann, 2008).

Figure 1.4. Baculovirus infection in insect larvae (O’Reilly et al., 1994)

The replication system for OB and NPVs differ, first it produces budded virus

and then it goes onto developing occluded form. At around 12 hour post-‐

infection (h p.i), nucleocapsids buds through plasma membrane, further

enveloping the BV (Figure 1.4). After 20 h p. i., ODVs tend to form

nucleocapsids and then they are transported between nuclear membrane

and VS. Hence, it forms occlusion bodies or polyhedra (Shi et al., 2015). The

genetic expression is also divided into three phases: early, late and very late.

In the late phase of the infection, production of budded virus starts and the

production of polyhedron begin in the very late phase (Kelly et al., 2008).

The NPV virus are found in the matrix of polyhedra and they can remain

stable in the environment (Lynn, 2003). When the larvae eats the occlusion

bodies, the ODVs are then released in the midgut alkaline environment. This

phenomenon leads to infection in the epithelium(Cheng et al., 2013, Lynn,

2003). The ODV then attaches to the microvilli of the midgut leading to an

infection. The infection spreads with budded virus (BV) from midgut to

other tissues (Figure 1.5)(Lynn, 2003). Occluded virus is responsible for

causing the primary infection and only infects insect-‐to-‐insect transmission

of the virus. The BVs bud out from infected cells acquiring their envelopes

9

from the plasma membranes, thereafter it continues to cause infection to

other tissues (Cheng et al., 2013). The ODVs are found occluded in protein-‐

polyhedra, which consists of 29 kDa polyhedrin protein (Cheng et al., 2013).

The ODV obtain their envelope from the protein FP25K from inside nuclear

membrane (INM) (Cheng et al., 2013). The FP25K is found in the cytoplasm

and nuclei of AcMNPV-‐ infected cells (Harrison & Summers, 1995a).

Polyhedrin and granulin are very similar to each other and are major

components of occlusion bodies. Polyhedrins are one of the abundant

proteins found in the infected baculovirus cells. They tend to form

crystalline cubic lattice that is enclosed by virions (Rohrmann, 2013). The

polyhedron envelope (PE) or calyx is what surrounds polyhedra

(Rohrmann, 2013). The function of PE is to increase the stability and seal the

surface. When polyhedra are given alkaline treatment, the crystalline lattice

dissolves but polyhedron envelope does not and that is where all the virions

are trapped (Rohrmann, 2013). Those viruses that do not sysnthesize

occluded form are known as “nonoccluded” baculoviruses. The PE protein is

linked to p10 fibrillar and it is required for assembly of the polyhedron

envelope (Rohrmann, 2013). If p10 is deleted it causes reduction in lysising

of cells and increase in virus. The deletion of p10 gene makes a positive

impact on recombinant protein production (Hitchman et al., 2011). The

homologs of p10 are found in all group I and II NPVs and also among some

GVs. Although the exact funtion of p10 (10kDA) is still unknown in previous

studies it was concluded that knock-‐out of p10 function by lacZ had no

impact on polyhedral envelope (Hitchman et al., 2011). Although it is not

proven it is thought that P10 may help polyhedra bundle separate into

individual particles to spread in the environment and thus aid horizontal

transmission. However, OB bundles spread easily if p10 orf is deleted

(Hitchman et al., 2011).

10

Figure 1.5. Baculovirus structure (Maciag, Olszowka, & Klein, 2014)

1.6 Virus replication in vivo

Infection in vivo occurs when the alkali-‐soluble occlusion body is ingested by

a host and dissolves in the high pH of the insect’s midgut, thus releasing

virions. In the first stage of the infection BV are produced. This further

spreads the infection from cell to cell in the insect. The nucleocapsids are

then transported from nucleus to the cytoplasm. From cytoplasm, the

nucleocapsids obtain an envelope when they bud through the plasma

membrane. The membrane has been modified by the glycoprotein known as

gp64. At the later stage of the infection, the virions stay within the nuclei of

the cell where they become occluded. Theses occluded virions are then

released from decaying insect and contaminate foliage. Thereafter other

insects consume the foliage. The total infection time takes around 5-‐7 days.

During the infection stage, the host goes through various phases. In the first

phase the skin tends to swell and a change is observed in the luster of the

skin. In the second stage, the muscular tissues dissolve and thereafter the

larva becomes a pouch of fluid. In the final stage, the larva bursts and

releases polyhedral particles.

The two viral structures are different in their composition, although

their nucleocapsids are similar. The differences among these viruses exist

due to their different functionality. For example the BV tends to infect insect

tissues, while the envelope of ODV is responsible for midgut infection. It also

plays an important role while interacting with polyhedron structure. The

11

ODV occluded form is considered to be stable in harsh environment of the

insect gut. Thus, it spreads the infection from one insect to another over the

period of one year.

1.7 Entry into the nuclei

After the virus enters the cell, the NPV nucleocapsids are taken to the

nuclear membrane, where actin polymerization takes place (Rohrmann,

2013). Many studies suggest that nucleocapsids are carried via nuclear pore.

Even the observation of empty nucleocapsids found in the nuclei of cells

support this evidence (Rohrmann, 2013). Finding nuclocapsids in nuclei,

leads to the suggestion that they do not need cell dividing or neccessity of

nuclear membrane breakdown to migrate into nuclei (Rohrmann, 2013; Van

Loo et al., 2001). Studies have found that some baculoviruses inject their

DNA through nuclear pores with the use of fluorescent tag attached to vp39

capsid protein and also to WT vp39 protein (Rohrmann, 2013; Ohkawa et al.,

2010). The fluorescence was observed inside nuclei and also found that

nucleocapsids restrict to the nuclear pore. Thus, this concludes that

nucleocapsids are transported through nuclear pore complex (Rohrmann,

2013). The nuclear pore have been characterised to have channels of 38-‐78

nm. The virion are measured to be around 30-‐60 nm in diameter. Hence,

these measurements allow them to move through the pores (Rohrmann,

2013).

1.8 Exiting the cell nuclei

The virions have the ability to enter and exit with the use of nuclear pores,

with nucleocapsids injected into Xenopus oocytes. In a previous study, it was

found that treatment by colchicine tends to obstruct the formation of the

microtubule. Further, it leads to the reduction in production in BV. This

process indicates that the structure might play a role in virion movement

out of the cell (Rohrmann, 2013). Kinesin is one of the major protein that

transports material to the cell periphery. The BV has been found to interact

12

with kinesin, which transports them from microtubules to the cell

membrane (Au, 2012; Danguah et al., 2012; Rohrmann, 2013).

Nucleocapsids obtain their envelope, which consist of one viral protein

GP16. It happens when the nucleocapsids replicate in the nucleus they are

then released from midgut cells by budding via the nuclear

membrane.(Pearson et al., 2001). The envelope then gets lost on its way to

the cytoplasm and parts of the envelope protein assembly to the plasma

membrane. This contains both GP64 (Ac128) and the F protein (Ac23) for

the group I NPVs (Blissard & Rohrmann, 1989). The GP64 protein modifies

the host membrane, this mechanism then allows the occurrence of virus

budding and secondary infection to take place, which infects midgut cells

(Pearson et al., 2001; Blissard & Rohrmann, 1989; Rohrmann, 2013). If the

AcMNPV is used to infect, it tends to go toward basal and lateral regions of

the cells allowing the infection to target tissues rather than the gut lumen

(Keddie et al., 1989; Rohrmann, 2013).

1.9 Gene expression regulation

Baculoviruses gene expression is split into three different stages, each one

depends on the prior stage: early, late and very late. The viral RNA

polymerase II transcribes the early genes while RNA polymerase transcribes

late and very late genes (Clem & Passarelli, 2013).

1.9.1 Immediate early genes

The immediate early genes are the ones that can be transcirbed even when

the protein synthesis inhibitors are present, for example cycloheximide

(King & Possee, 1992). This stage has been further studied and has been

known that copies of these genes are transcriptionally active when inserted

into plasmids. It should be considered that genes should be active even after

transfection into uninfected insect cells.

13

1.9.2 Delayed early genes

In the second phase of gene expression, the use of cycloheximide and other

inhibitors is important in defining this stage (King & Possee, 1992). When

cells are treated with such inhibitors and returned to normal condition, a

pattern of protein expression is observed (King & Possee, 1992). Some

proteins express instantly when the inhibitors were removed while the

others are expressed after a delay. Thus, it defines the division between

immediate and delayed genes (King & Possee, 1992).

1.9.3 Late and very late gene

The third phase, in which the virus genes are expressed in infected cells with

replication of virus DNA (King & Possee, 1992). If the virus DNA replication

is inhibited by aphidicolin then the late genes are not transcribed. The virus

genes expressed in this stage are those that are encoding structural

elements of the virus particles (basic protein, capsid protein, and the virus

membrane glycoprotein (gp67)) (King & Possee, 1992). The transcription of

these genes begins with RNA polymerase, which is α-‐ amanitin resistant. It is

prompted in the late infection of the cells. The very late genes are

transcribed when the virus is producing occlusion bodies in the nucleus of

an infected cell from 15 h p.i. onwards. This stage includes polyhedron

protein, which helps in forming the matrix of the occlusion body and p10

protein. Further, it plays the role in the production of polyhedra. The p10

forms crystalline matrix in the nucleus of the infected cells is also associated

with formation of polyhedra.

1.10 Insect Cell lines The cell lines that are used in baculovirus-‐based expression studies are

usually Sf21, Sf9, and Trichoplusia ni (Tn). The two cell lines (Sf21 and Sf9)

were obtained from ovarian cells of Spodoptera frugiperda –(fall army

worm) (Haines et al., 2006). The Trichoplusia ni (Tn) were obtained from

14

adult tissues of cabbage loopers (Hink, 1970). T.ni is a very important pest

in agriculture and highly similar to AcMNPV. The Sf-‐9 cells were cloned from

Sf-‐21 cells to provide the maximum-‐production of Beta-‐galactosidase during

the process of baculovirus expression. The cells Sf21 or Sf9 are used for co-‐

transection, amplification of virus and in plaque assays (Haines et al., 2006).

The insect cells are easier to maintain when compared to mammalian cell.

They can be grown in either a shake or stirred flask, or if monolayer needs to

be maintained T-‐flasks or culture dishes can be used easily (Haines et al.,

2006). These cell culture lines do not require a CO2 incubator, as they can be

easily grown at 25OC to 30OC temperature (Haines et al., 2006).

1.11 Transfer Vector

There are many transfer plasmids available which contain different

sequences for various purposes (Hitchman et al., 2011). One of the main

purposes of transfer vector is to allow the insertion of a foreign gene of a

specific promoter gene. The transfer vectors are composed of polyhedrin or

p10 very late promoters. This then produces high concentration virus within

the infected cells (Possee & King, 2007). After the insertion into the virus

genome, the two genes have well characterized promoters and results in

high-‐level transcription or recombinant sequence (Possee & King, 2007).

One of the benefits of using transfer vector is that it is easy to operate in

vitro. It is also simple to find the primary genetic structure of recombinant

components (Possee & King, 2007). A transfer vector is combined with virus

DNA and then used to co-‐transfect insect cells to develop an infection. The

infected cells with a virus, face the occurrence of recombination in between

homologous sequences in the plasmid transfer vector and virus genome

(Possee & King, 2007). The native virus gene is usually discarded in the

event of double cross-‐over and substituted with a foreign coding region

(Possee & King, 2007).

15

1.12 Glycosylation

The N-‐linked glycosylation takes place in endoplasmic reticulum of both

insect and mamalian cells. In insect and mammalian cells, N-‐linked

glycosylation can be repressed if cells are treated with tunicamycin (King &

Possee, 1992). Eukaryotic proteins are modified by adding covalent to

carbohydrate side chains. There are three glycosylation pathways in

eukaryotes: N-‐glycosylation, O-‐glycosylation, and O-‐linked N-‐

actylglucosamine (O-‐GlcNAc). Insect cells consists of all these three

pathways but do not match up with eukaryotes (Jarvis, 1997). Insect cells

contain low levels of fucose, galactose and sialic acid transferases. Thus,

insect cells lack the ability undertake oligosaccharide (King & Possee, 1992).

The recombinant proteins tend to be sensitive to endo H, endo F and N-‐

glycanase, which is responsible in removal of immature oligosaccharides

(King & Possee, 1992). Abnormal glycosylation can result in disease and

such developmental deficiency, neuro disorders or it can lead to serious

tumors. Therefore, it is important to have functional glycoprotein for

analyses and medical treatment for many symptoms (Morokuma, et al.,

2015). As we know N-‐linked glycan increases the protein stability and also

regulate cell-‐cell and protein-‐protein interactions (Morokuma, et al., 2015).

Thus, it is necessary to have complex linkage of glycoprotein for proper

function and medical treatment of many diseases. Up until today,

mammalian expression system is used to produce glycoproteins even when

it carries many disadvantages. Those disadvantages could be such as high

cost and low productivity (Morokuma, et al., 2015). The proteins retrieved

from insect cells are paucimannosidic-‐type N-‐glycan therefore, it removes

the terminal GlcNAc of hybrid structures (Morokuma, et al., 2015).

16

1.13 Selection of polyhedron-‐negative recombinant baculoviruses

1.13.1 BEVS-‐ Baculovirus Expression Vector System

The BEVS consists of three important parts, a transfer plasmid with gene of

interest that needs to be transferred into the virus genome, a baculovirus

vector (AcMNPV) and insect cell line (Sf9 or Sf21) (Hitchman et al., 2011). It

usually begins with cloning of a preferred gene into a transfer plasmid

between sequences that flank the polyhedrin (polh) locus in the genome of

the virus (Hitchman et al., 2011). The baculovirus expression vector system

(BEVS)-‐ is a very important system. It has high expression level and has the

capability of insertion of large DNA fragments, glycosylation modification,

acylation, phosphorylation and amidation (Shu-‐ffen et al., 2012). A BEV is a

double-‐stranded circular DNA genome, that has been genetically modified to

contain a foreign gene of interest. They are also capable of transferring

foreign genes into the eukaryotic host cells. Since baculovirus has many

interesting features, the BEVS is used not only for protein production of

interest but also for gene therapy and surface display (Shu-‐ffen et al., 2012).

Over the past three decades, baculovirus has been efficiently used in

pharmaceutical and vaccine production (Shu-‐ffen et al., 2012). The BEV

system has been intensively used in basic research for the production of

many different recombinant proteins. The BEV system has the capability to

produce a large quantity of foreign proteins. The BEV system can make

perfect foreign proteins as it has the ability to process eukaryotic protein

products. The BEV system does have fewer limitations such as protein to

protein variation in production. Also, the glycoproteins are produced in low

levels, this can further lead to unsuitable clinical uses due to the difference

in the N-‐linked glycan structure among insects and mammals. (Morokuma,

et al., 2015). This can also lead to a low production of recombinant proteins

such as membrane-‐bound and secreted glycoproteins (Jarvis, 1997).

Another limitation that BEV has is when the insect cell protein processing

pathway are not identical to eukaryotes. Thus, it leads to differentiation in

17

protein production compared to native proteins due to modifications in

covalent bonds (Jarvis, 1997).

One of the properties that lead to the production of baculoviruses

expression vectors is their ability to produce a larger quantity of polyhedrin

during infection. The production of the BEV can be done by replacing a polh

gene in the nucleotide sequence of wild-‐type viral genome with a particular

foreign gene of interest. This then allows the wild type to be distinguished

due to its phenotype of inability to produce polyhedra. It also leads to

isolation and expression of human β-‐interferon or even Escherichia coli β-‐

galactosidase in insect cell cultures (Jarvis, 1997). This method was the

original way of producing recombinant baculoviruses, but it was quite

difficult for non-‐virologists. But the new methods have improved such

difficulties with systems such as Bac-‐toBac, BacPAK6, and flashBAC. The

Bac-‐to-‐Bac technology depends on production of recombinant baculovirus

via site-‐specific transposition in E.coli. The recombinant virus DNA is then

purified and used to transfect insect cells to recover infectious virus

particles. The BacPAK6 method consists of AcMNPV with lacZ insert in place

of the polyhedrin gene, which can be linearized prior to cotranfection of

insect cells with the transfer vector. Recombinant viruses can then be

recovered at high frequency (>95%). The flashBAC system is similar to

BacPAK6, but it doesn’t require linearization to use and it is also fast and

easy. These systems allow production of larger quantities of expression

(Possee & King, 2007). One of the most important purposes of baculovirus

systems is its uses to produce proteins in insect cells.

One of the earliest BEVS had been based on polyhedra-‐negative

viruses, their polyhedrin coding region was replaced with a foreign gene

inorder to produce recombinant baculovirus (Hitchman et al., 2012). The

expression of the foreign was influenced by the polyhedrin promoter

(Hitchman et al., 2012). Transfer vectors are used to insert foreign gene as

the baculovirus genome is too big to insert the foreign gene directly. The

recombinant virus genome results when a foreign gene is inserted into the

virus genome (Pennock et al, 1984). This produces both original parental

18

viruses and recombinat, thus plaque-‐purification is necessary to separate

the two but this process can be time-‐consuming (Kitts et al., 1990).

1.13.2 Recombinant Baculovirus Production

There are several different techniques that had been used to produce

recombinant baculoviruses consisting the gene(s) of interest. Some of these

techniques aim to produce a pure recombined virus with little to none

recombinant virus as possible. These techniques use transfer vector with the

gene of interest with control of many promoters in baculovirus genome. The

transfer plasmid consist of gene of interest downstream of promoter

sequence and is flanked with complementary sequence to baculovirus

genome, which helps recombination of the promoter gene DNA into

unessential region of the baculovirus (polyhedrin) gene. One of the methods

includes the use of bacteria by inserting the gene of interest into bacmid

consisting the baculovirus genome, and using marker gene to produce

recombinant baculovirus (Lee et al., 1993). Another method uses in-‐vitro

site specific transposition to insert a foreign gene and eliminates non-‐

recombined baculovirus by adding negative selection marker (Zhao et al,

2003).

1.13.3 The BacPAK6 system

As the original method of purification of the recombinant virus was time

consuming, it was then further improved with linearized baculovirus

genomes at insert site, which allowed the recovery of more recombinants as

linearized vectors lacked functional Orf1629 (Kitts & Possee, 1993). The

orf1629 is an important gene that is involved in nuclear actin during

baculovirus infection (M. van Oers, 2011). In the BacPAK6 system, orf1629 is

restored after viral genome and transfer plasmid are recombined, thus

giving 90% recombinantion frequency (M. van Oers, 2011). The BacPAK6

system deletes polyhedrin gene with the lacZ gene, which has restriction

enzymes Bsu361 on either side of lacZ. (Kitts & Possee, 1993). Digestions

19

with Bsu361 removes ORF1629 and lacZ gene, causing linear virus DNA

that is not capable of replication with insect cells (Kitts & Possee, 1993). The

co-‐transfection with Bsu361, re-‐circularises the virus DNA by replacing

orf1629. The restoration of orf1629 allows replication in insect cells and

constructing high frequency production of recombinant viruses (Kitts &

Possee, 1993; Haines, Possee, & King, 2006). Eventhough addition of Bsu361

sites in BacPAK6 increases recovery of recombinants the Bsu361 digestion is

not 100 efficient and will always have mixture of parental and recombinant

virus (Possee, & King, 2006).

Figure 1.7. A. DNA containing Escherichia coli (E. coli) lacZ inserted at polh locus. B. Digestion of viral DNA removes lacZ and partially deletes orf1629-‐coding region C. Cotransfection and insertion of foreign gene into the virus DNA and restoration of orf1629 and recircularization of DNA thus permitting replication within insect cells. D. Plaque assay is used to isolate recombinant virus (Possee, & King, 2006).

1.13.4 Bac-‐to Bac®

The Bac-‐to-‐Bac Baclovirus Expression System represents an efficient way to

make recombinant baculoviruses. The advantage is that recombinant

baculovirus can be obtained fairly quickly in 7-‐19 days (Anderson, et al.,

20

1996). This system does not require separation and purification of

recombinant viruses by using plaque –assay (Anderson, et al., 1996). The

vector of this system contains kanamycin resistance gene and lacZa

(Anderson, et al., 1996). The Bac-‐to-‐Bac Baculovirus expression System has

site specified transposition properties of the Tn7 transposon. This aspect

makes it easier to generate recombinant bacmid DNA. The transposition

connection does not interfere with the functions of the gene (Anderson, et

al., 1996). This plasmid is designed to form blue colonies as bacmid is

propagated in E. coli on differentiation medium with kanamcycin, X-‐gal and

IPTG. The recombinant bacmid-‐containing colonies can be isolated by

plating them on a selective media (Anderson, et al., 1996). The bacmid

recombinant DNA is isolated by alkaline lysis procedure from the E.coli cells.

Thereafter, the obtained DNA is then used to transfect insect cells and this

does not require any further selection before virus amplification (Anderson,

et al., 1996).

1.13.5 flashBACTM

The flashBac is a new technique developed by Oxford Brookes University,

which is sold by Oxford Expression Technologies (Hitchman et al., 2011).

Essentially, flashBAC comprises a copy of the AcMNPV genome with a partial

deletion of ORF1629, which is amplified in bacterial cells. This DNA cannot

replicate and produce infectious virus in insect cells unless it is

cotransfected with a plasmid transfer vector containing the complete

ORF1629 gene. The flashBAC technology is one of the best platforms to be

used. It does not require selection pressure to separate recombinant virus

from the non-‐recombinant parental virus (Hitchman et al., 2011). This

system is dependent on homologous recombinant of insect cells and transfer

plasmids. The flashBAC provides many advantages to the existing

baculovirus expression vector system (Hitchman et al., 2011). This

technology allows the user to skip the necessity which required carrying out

plaque-‐purification (Hitchman et al., 2011). The gene deletion restrains

virus replication in the insect cells, but BAC permits the viral DNA for the

21

propagation of bacterial genome (Hitchman et al., 2011). In addition, the

bacterial circular DNA is isolated by lysis and purification by making use of

flashBACTM Kit and the DNA is ready for use in co-‐transfection (Hitchman et

al., 2011). Genes under the control of any promoter can be expressed

provided that the ORF1629 deletion is rescued(Fig. 3). The recombinant

parent virus is not required as the parental viruses propagate in the insect

cell lines.

The flashBAC DNA system is as simple as BacPAK6 system, when

making recombinant viruses in insect cells and removal of the step of plaque

purification is one of the concerns. The flashBAC also enhances the protein

secretion and membrane proteins (Hitchman et al., 2011). The removal of

chitinase from flashBAC has improved the secretory pathway and produces

great yield of recombinant proteins (up to 60 folds) which is secreted

(Hitchman et al., 2011).

Figure 1.8. The flashBAC baculovirus expression system used for production of recombinant baculoviruses. A.) Shows the deleted genes. B.) Containment of gene, insert, lef2, and orf1629 gene in transfer vector. C.) Recombinant virus with repaired orf1629 gene (Rohrmann, 2013).

1.14 Multiplicity of Infection

The virus multiplicity of infection (MOI) describes the infectious virus

particle ratio to the quantity of cells in the culture (Kool et al., 1991). It can

be used to estimate the amount of cells infected by the viruses (Kool et al.,

22

1991). A high MOI is needed to achieve synchronous infection of the cells,

which usually range between 5-‐10 pfu/cell, but when the MOI is low only a

part of the cell population is infected (Kool et al., 1991). The use of high

MOIs is used for quick determination of the protein production in a small

scale (Kool et al., 1991). On the other hand, it becomes difficult on a larger

scale as producing high multiplicities of infection tends to be a problem. It

becomes a problem as a larger quantity of virus is needed and it becomes

unrealistic. In the past studies, it has been noted that defective particles

form during the passage of baculovirus, as a result to loss of partial genome

(Kool et al., 1991). This then grows in cell culture and causes decrease in

protein production. Rather this can be avoided with the production of

baculoviruses infected with low multiplicities (Zwart et al., 2008).

Those cells that are infected with low multiplicities of infection tend

to only affect small proportion of cells. Later, they spread the virus to other

cells in the culture (Radford et al., 1997). In addition the non-‐infected cells

continue to divide, thus low MOI system cannot be predicted easily (Wong et

al., 1996). Another tactics that can play a role towards predictability of low

MOI infection is the sensitivity to conditions such as cell density and virus

titers. It can produce improper quantification for baculovirus titration

(Radford et al., 1997).

In low MOI if time is not reduced while attempting to increase

protein production then the proteolytic degradation of the proteins take

place which can be problemetic in low MOI infection (Radford et al., 1997;

Wong et al., 1996). The low MOI infection also carry the risk of having high

cell density. This leads to nutrient depletion and causes decrease in

production (Radford et al., 1997). If cell density and time of infection is

taken care of then the use of low MOI becomes possible. It also requires

appropriate baculovirus titers as inaccurate MOI can cause cells to die

immediately (Radford et al., 1997; Wong et al., 1996). Other factors that lead

to low production can be due to inaccurate cell density, or inaccurate cell

number to be infected. This aspect can either lead to high cell density and

low protein production as well (Licari & Bailey, 1991). In previous studies,

23

it has been noted that if cells are infected in early exponential phase, there is

no significant correlation to MOI. But if cells are infected in the last

exponential phase, then there must have been significant correlation to MOI,

resulting in high yield (Wong et al., 1996). If the cell density, time of

infection, and MOI are taken in careful consideration, then the low MOI can

also produce proteins equal to those with high MOI (Radford et al., 1997;

Wong et al., 1996).

The lower MOIs tend to infect only the portion of the cell while the

remainder grow uninfected. The cells may have a high yield instead of the

cell density, when the uninfected cells and their progeny get infected in

secondary infection. Further, the secondary infection will lead to release of

progeny virus. Thus, to obtain high production, cells should be infected at

low cell density lower than cell yield.

1.15 Serial Passaging

Baculovirus go through genetic variation during passaging in a

bioreactor to produce few polyhedra and defective interfering particle (DIP)

(Giri et al., 2012). Due to the cumulation of the mutants it results in a

decrease in production of polyhedra thus reduces the virulence leading to

being inefficient at being biopesticide (Giri et al., 2012). In previous studies

passaging effect has been found to be a problem in development of large-‐

scale batch of recombinant proteins/vaccines with the use of baculovirus

expression vector system (BEVS), as mutants tend to pile up after a few

passages to produce necessary baculovirus stock (Giri et al., 2012).

Mutation can occur in passaged viruses for many reasons, such as: deletion

of the gene fragment, point mutations, frame shift mutations, insertions of

transposonmediated host cell and viral genome sequencing (Giri et al.,

2012). The virus variants can also cause virus titers to drop drastically, in

addition, virus variants with a large number of deletions have been found

among many virus families (Zwart et al., 2013). The DIP mutants are

deletion mutant viruses that take place during passaging and usually

compete for growth with normal wild-‐type virus. A decrease in recombinant

24

protein production is usually due to DIP mutants as they lack foreign gene of

interest or genes that are involved in very late gene expression (Giri et al.,

2012). In particular, AcMNPV DIPs arise very quick in cell culture, usually

two passages, and they tend to become diverse in the late passages (Zwart et

al., 2013). It is suggested from observations of previous studies, a possible

reason for genome deletion can be due to recombination between any two of

the eight homologous repeat regions in the AcMNPV genome (Giri et al.,

2012). Defective interfering (DI) viruses replicate at much faster pace due to

small genome size than viruses that have the full-‐length genome (Zwart et

al., 2013). They can also develop a better way to compete with helper

viruses, for example, accumulation of origins of DNA with a single genome.

However, DI viruses are unable to replicate as they do not carry the essential

genes to do so, therefore DI viruses must co-‐infect a cell with helper virus for

it to replicate (Zwart et al., 2013). Upon passaging cell culture, few-‐

polyhedra (FP) mutants are found to have decrease infectivity with reduced

yield of occluded virus (polyhedra). FP mutations usually occur due to

transposon insertion in fp25k gene, which leads to decrease FP25K protein

synthesis (Giri et al., 2010). Due to repeat passaging baculoviruses can have

mutant accumation in cell cultures. Also, polyhedra yield and virus number

also decreased due to few-‐polyhedra (FP) and defective interfering particle

(DIP) (Giri et al., 2010). For large-‐scale production it is necessary to come

over mutations, thus will enable them to be cost effective. FP mutants occur

due to low amount of cells containing polyhedron. Most of the FP can disrupt

the FP25K protein sysnthesis by placing host cell DNA into a various region

of the baculovirus genome (Giri et al., 2010). In previous studies it has been

found, that deletion or insertion of fp25k gene can lead to increase of BV

production, increase in BV structural proteins (GP64, BV E-‐26 and VP9),

decrease in occluded virus proteins, decrease in liquefacation of the larval

host, decrease in E66 protein, and production of deviant virions morphology

(Giri et al., 2010). Thus, fp25k gene mutation can take place during passaging

of the viruses and can decrease the production of polyhedra and ODV in

continuous cells

25

Aim of this project

The aim of this research thesis is to distinguish the populations of parental

and recombinant baculoviruses generated after using the flashBAC system

and their subsequent passage at high and low MOIs. The research will follow

cotransfection of Sf9 insect cells by making use of flashBAC DNA and a

number of different plasmid transfer vectors. The population of the virus

will be monitored for five passages at both low and high multiplication of

infection (moi). The low moi will be at 0.1 plaque-‐forming unit/per cell to

infect cultures with virus. On the other hand the high (moi) will be set at 5

pfu/cell.

The viruses will then be passaged in cell culture containing sufficient

amount of volume. From these volumes the virus particles will be

concentrated. Thereafter the DNA extraction will then be used for extended

analysis. In addition, the polymerase chain reaction (PCR) which had a

foreign gene inserted in it, will be used to identify the structure of the virus

genomes. Using agarose gel the PCR products will be analyzed. These five

passages will help determine whether the change in ratio occurred among

the virus. The results from this study will provide us with knowledge to

determine, if the baculovirus expression vectors have genetic instability.

Further it will help in understanding if it impacts the yield of the protein.

This factor is important for commercial use, as virus recombinant is used on

long-‐term basis. This is also considered as the source of protein for vaccine

production or diagnostics.

26

Chapter 2 -‐Materials and Methods

2.1 Materials The procedures described below are those that have been used to for all the

work in this thesis.

2.1.1 Plasmids R.D. Possee provided the following plasmids that were used in this thesis.

Table 2.1 Plasmid Transfer Vectors

Plasmids Ng/ul PCR primers

pAcRP23.lacZ 125.5 ng/ul RDP 213 1/214 2

pAcUK 108 ng/ul RDP 213/214

pOET6. NaV1.4 84.0 ng/ul RDP7433/214

pAcHANA 1430 ng/ul RDP 213/214 1. TGAGACGCACAAACTAATATCACAAAC 2. ATACGTACAACAATTFTCTGTAAAAC 3. TAATACGACTCACTATAGG

2.2 Preparation of bacterial cells and extraction of plasmid DNA

Two universal tubes were setup containing 4 ml Luria Broth with ampicillin

(100ug/ml), and bacteria from a single colony from a fresh plate of E.coli

containing pAcRP23-‐lacZ (Possee & Howard, 1987). The culture was

incubated overnight at 27OC with shaking (200rpm). The plasmid DNA was

then purified with the use of QIAprep Spin Miniprep Kit, QIAGEN Plasmid

Midi Kit. The procedure used as described in the supplier’s protocol.

27

Table 2.2: Viruses used in this experiment

Virus Source

AcHANA Prepared in this study

AcUK Prepared in this study

AcRP23.lacZ Prepared in this study

AcNaV1.4 Prepared in this study

Control AcMNPV R.D. Possee

Control AcRP23. lacZ R.D. Possee

2.3 Insect cells and Viruses

Spodoptera frugiperda (Sf9) and Spodoptera frugiperda 21 (Sf21) insect cells

were provided by R.D. Possee. The Sf9 cells were maintained in ESF 921

Serum-‐free insect express in Erlenmeyer flask at a temperature of 28OC on

shaker rotation at 130rpm. The Sf21 cells were propagated in TC100

medium with the addition of 10% foetal calf serum (FCS). The cell cultures

were seeded at a density of 1x106 cells/ml and were infected with viruses:

AcRP23.lacZ, AcUK, AcHANA, AcNaV1.4, ACMNPV C6 to make working virus

stocks.

2.4 Cotransfection of insect cells with flashBAC and plasmid transfer vector DNA

The 35 mm petri dishes were seeded with Sf9 insect cells in a monolayer

(1X106cells/dish) with 1 ml volume of the medium. The petri dishes were

then left at 28oC for 1 hour. Then 100μl of medium was dispensed into the

screw cap plastic bijou with added flashBAC DNA 100 ng (5 μl) per co-‐

transfection [20ng/μl], and plasmid DNA (500ng) was also added. In

addition to the DNA/medium mix, 1.2μl TransIT transfection reagent was

also added and mixed gently by shaking. The bijous were then left to

incubate at room temperature for 15-‐30 minutes. The mixture was then

28

added to the 35 mm petri dish drop wise and was left to incubate over night

at 28oC. 1 ml of fresh medium was added the next day to each dish and they

were incubated for 4 days at 28oC. The medium was removed and stored at

4oC and 1ml fresh medium was then added to each dish. 5μl of X-‐gal was

added to the medium that contained the transfer vector lacZ gene and was

incubated at 28oC and observed after one hour. The cells developed blue

colour due to beta-‐galactosidase produced by the virus-‐infected cells.

2.5 Virus Stock

The virus stocks were made in Sf9 cells by seeding the cells at the density of

5.0X106 cells/ 15ml in tissue culture flasks and they were left overnight in

the incubator at 28OC. The flasks were then infected with the virus at a

multiplicity of infection (MOI) of 0.1 pfu/cell. The cells were harvested

approximately 4 days post infection (dpi). The cells were centrifuged at

2,000 rpm for 20 minutes at 4OC (Ty-‐JS 4.2 rotor, J6-‐MI Beckman centrifuge).

The supernatant was collected into a sterile Universal tube and stored at

4OC.

2.6 Testing presence of foreign gene in virus Stock

This method was used prior to setting up serial passaging to test the

presence of the gene in the virus. This was done by seeding Sf21 cells at the

density of 1.0x106 cells in 35mm petri dish. The plates were then left to

incubate for 2 hour at 28OC, which allowed the cells to adhere to the petri

dishes. The cells were then inoculated with 200μl of the virus from the virus

stock. After the infection the dishes were incubated at room temperature for

1 hour. After the incubation, the virus was removed and 1 ml of Sf21 cells

was added. The petri dishes were then left to incubate at 28oC for 4 days.

After 4 days of incubation, the virus cells were harvested. The cells were

scraped from each petri dish by using pipette tip. The scraped cells were

moved into 1.5 ml microcentrifuge tubes from each petri dish and were

29

centrifuged for 2 minutes at 14,800 RPM. The supernatant was carefully

removed and the pellet formed was saved in 1 ml PBS. The DNA purification

was done using DNAeasy Blood & Tissue Kit as the methods described

below.

2.7 Template formation with the use of Kit to test the presence of the gene in the virus

The virus cell DNA was extracted with the DNeasy Blood & Tissue Kit

(QIAGEN, Mississauga, ON, Canada). The genetic material from 200μl of virus

stock was purified as indicated in the manufacturer’s protocols. The pelleted

virus was re-‐suspended in 200μl PBS and 20μl proteinase K solution was

added. Since the requirement of the RNA-‐free genomic DNA was required,

4μl of RNase A (100mg/ml) was added and mixed by vortexing after it was

incubated for 2 minutes at room temperature. 200μl Buffer Al was added

and mixed thoroughly by vortexing and incubated at 56OC for 10 min. 200 μl

absolute ethanol was added to the sample and was vortexed thoroughly. The

solution was then moved into the 2 ml DNeasy Mini spin column and

centrifuged at 8000 rpm for 1 minute. The flow-‐through was then

discarded. This step was then repeated with the addition of 500μl of buffer

AW1 and 500μl AW2, followed by the centrifugation of the column at 14,000

rpm for 3 minutes to dry the DNeasy membrane. The DNeasy mini spin was

then placed in sterile 1.5 ml micro centrifuge tube, which was used to collect

the DNA by adding 100 μl of AE buffer and centrifuging at 8000 rpm for 1

minute. The DNA concentration was then determined by placing 3 μl of the

DNA on Nanovue Spectrophotometer. The PCR analysis was done as

described below in section 2.13. After agarose gel electrophoresis was

performed as described below in section 2.14 to observe the bands for

success of co-‐transfection.

30

2.8 Serial Passaging

Serial passaging at low and high MOI T-‐25 flasks were seeded with Sf9 cells

in 5ml medium. The 6 viruses were passaged at both low and high

multiplicity of Infection (0.1 and 5). The cells were setup at 1x106 density in

T-‐25 flask medium and left to incubate over night. The cells were then

infected 24hours later. Duplicate flasks were infected with virus using a high

MOI (150μl of the stock) or low MOI (3μl of a 1:20 dilution of the sock).

2.9 Harvesting of virus DNA

The T-‐25 flasks containing the cells were slammed against the flat surface to

loosen the infected cells. The cells were harvested from the T-‐25 flask and

then transferred into the universal tube to centrifuge at 2,000 rpm for 20

minutes at 4OC. The supernatant was carefully removed and placed into a

sterile bijou. The pellet was re-‐suspended in 1ml PBS and placed in a 2ml

tube and stored at -‐20OC.

2.10 Virus Stock Titration The virus stock was titrated by using the plaque assay technique (King & Possee, 1992).

2.10.1 Plaque assay

Sf21 cells were seeded at the density of 0.4x106 cells in a plate consisting of

12 wells. The plate was then left to incubate for 1 hour at 28OC, which

allowed the cells to adhere to each well. Serial dilutions were set up for each

virus stock to be titrated in TC100/10%FBS media from 10-‐1 to 10-‐7. The

medium was then removed from one plate at a time and replaced with 100μl

of the appropriate virus dilution for 1 hour at room temperature on a

rocking platform. After the incubation, the virus was then removed and 1 ml

of overlay was placed (2% low-‐temperature agarose). The overlay was left

31

to set at room temperature, and additional 1 ml of TC100/10%FCS media

was then added to each dish, which was then left to incubate for 5 days at

28OC. After 4 days of incubation, the liquid overlay was removed and each

dish was stained with neutral red dye diluted in PBS. The stain was removed

after 24 hours and the plates dried on tissue paper. Plaques were counted

over the light box. The equation used for calculating the virus titer pfu/mL is

as follows:

Virus titer = ! !(!!)!

The P represents the number of plaques counted and average of two wells. D

is the dilution of virus in the well from which the plaques are counted. V is

the volume of virus added to that well.

2.11 Purification of virus DNA

1.5ml harvested supernatant from each T-‐25 flask was pelleted by

centrifugation at 14,800rpm for 30 minutes. The supernatant was removed

and 1 ml TE buffer was added and again centrifuged at 14,800rpm for 15

minutes. The supernatant was removed and 50μl of TE buffer was added to

cover the pallet and was left to incubate for 1 hour at 4OC. The samples were

then lysed after 1-‐hour incubation by placing 5μl of sample and 16μl of lysis

buffer (microlysis-‐plus) into PCR tubes. The Agilent technology sure cycle

8800 was used to do the lysing. The lysing conditions were: 96OC-‐2 minutes,

65OC 4 minutes, 96OC 1 minute, 65OC-‐ 1 minute, 96OC-‐30seconds.

2.12 PCR analysis

Further analysis of co-‐transfection was carried out using PCR amplification

of the gene that was inserted into the genome. The Agilent technology sure

cycle 8800 and PCR Reagent System kit were used. The primers from

Eurofins MWG Operon, RDP 213c and RDP 214c were used to detect the

polyhedron gene in the recombinant flashBAC genome. The sequence for

RDP 213c follows 5’ TGA GAC GCA CAA ACT AAT ATC ACA AAC3’, and RDP

32

214c follows, 5’ ATA CGT ACA ACA ATT FTC TGT AAA AC3’. The reaction

mixture was prepared with 2.5μl NH4 buffer, 1.25μl 50mM MgCl2, 0.125μl

100mM dNTPs, 19.4μl dI water, 5μl template, 0.25 μl Taq, 0.25μl primer 1

(213)-‐ (100pM/μl), 0.25μl primer 2 (214) – (100pM/μl). The primers that

were used were specific for target sequences. The amplification conditions

were: 95OC for denaturing, annealing, followed by 25 cycles, Extension set at

72OC for 4 minutes.

2.13 Agarose gel electrophoresis

The high-‐temperature agarose gel was made at 1%. and was submerged in

gel tanks containing 1x TAE (Tris-‐acetate 40mM, EDTA 1 mM) buffer,

containing ethidium bromide. The electrophoresis was run at 75volts for

about 1-‐2 hours as needed. After, gel electrophoresis the DNA was observed

using UV transilluminator (Syngene Bio imaging Ltd).

33

Chapter 3 – Results

3.1 Viruses The six viruses that were used in this study were: AcRP23.lacZ, AcUK,

AcOET6.NaV1.4, AcHANA, AcMNPV, LacZ.AcRP23. The virus AcHANA

consists of two glycoproteins of influenza A virus: hemagglutinin (HA) and

neuraminidase (NA). Influenza HA is a surface glycoprotein that mediates

virus attachment and uptake into host cells; NA is a virus surface

glycoprotein that enables detachment of the mature virus particle from cells

after it has budded from the cell plasma membrane (Thaa et al., 2010). The

virus AcUK contains the gene urokinase, which encodes serine protease that

helps degrades extracellular matrix and migration of tumor cells (Database,

2015). The AcRP23.lacZ virus contain beta-‐galactosidase. It is usually used

as a reporter to monitor the strength of promoter gene. It serves as the

control during the transient transfection experiment (Smale, 2010). The

virus AcOET6.NaV1.4 has the gene Nav1.4, which is a voltage-‐gated sodium

channel, which is responsible for action in muscles and neurons (Database,

2015). The flashBAC DNA was mixed with each transfer vector as described

in methods (2.4) after incubation of 5 days the cell media was harvested.

The infectious virus was titrated using a plaque assay as described in

methods (2.10) (Figure 3.3)(Table 3.2).

The PCR analysis was performed on recombinant genes prior to

passaging of the virus using the DNA concentration (Table 3.1) to test the

presence of the gene (Figure 3.1). The viruses have been passaged for 5

times in Sf9 cells. The results are presented in Figures 3.4 to 3.9. The cell

DNA extracted from supernatants of each passage was amplified using PCR.

The analysis focused on both high and low multiplicity (0.1 and 5) pfu. The

PCR products were then analyzed with the use of 1% agarose gel

electrophoresis. The primers were all the same for all viruses (RDP 213 and

214), except for AcOET6NaV1.4, which used RDP 743 as its forward primer

and RDP 214 as its backward primer as indicated in methods section 2.1.1.

34

The results collected in this study will help determine whether the

baculovirus expression vectors used in this study have genetic instability. It

will also help us determine the protein yield, as it is a necessary factor for

commercial use.

A

35

Figure 3.1. A. PCR analysis of the recombinant genes. B. A plasmid map of pAcRP23.lacZ C. A plasmid map of pOET6NaV1.4.

B

C

36

The PCR analysis of the recombinant genes (Figure 3.1), shows various sizes

for each gene. The pAcHANA (Weyer and Possee, 1991) has a band at

5000bp and pOET6.NaV1.4 (RD Possee, pers. Comm.) has a band at 6000bp.

The band for pAcUK is prominent at 2000bp, while the bands for

AcRP23.lacZ, pACRP23 (lan2 6 and lane 7) is visible at 5000bp. The plasmid

map of pAcRP23.lacZ (Figure 3.1A), indicates the location of binding site, lac

operator and binding site of primers RDP 213 and 214. The plasmid map of

pOET6NaV1.4 (Figure 3.1B), indicates the location of T7 promoter, binding

sites of primers RDP 743, 213, 214. Table 3.1. DNA concentration of virus cells using Nanovue Spectrophotometer.

Virus DNA concentration AcHANA 43.0 ng/μl AcUK 23.0 ng/μl AcRP23. lacZ 15.0 ng/μl Control AcRP23.lacZ 10.2 ng/μl Control AcMNPV 21.0 ng/μl

Figure 3.2. PCR analysis of cell DNA and plasmid DNA. Lane 1, molecular weight markers (New England Biolabs). Lane 2, 6, 8, are plasmid DNA. Lane 2, 4, 5, 7, are cell DNA. Lane9, 10 are control groups.

The cell DNA concentration (Table 3.1) after harvesting the cells from petri

dishes as mentioned in materials and methods section (2.6-‐2.7). This was

37

done prior to setting up serial passaging. The PCR was performed (Figure

3.2) after obtaining DNA concentration of virus-‐infected cell DNA (Table

3.1), to observe the success of cotransfection prior to setting up serial

passaging with high and low MOI’s. The control band of pAcHANA plasmid

control (lane 3) can be seen around 4000bp, which is also seen in co-‐

transfected cells AcHANA (lane 2). pAcUK (lane 6), shows the plasmid

control band around 2500bp, which is also seen in virus cells (lane 4), in

addition a faint band is also see above 400 bp for AcUK (lane 4). However,

no indications of bands were found in duplicate of AcUK (lane 5). The

plasmid control pAcRP23.lacZ has a band around 5000 bp (lane 8), which is

also observed in cell DNA (lane 7). The control AcRP23.lacZ shows a band

around 5000 bp (lane 8). The control AcMNPV shows a band around 1000

bp (lane 10).

Figure 3.3. The virus stock titration done by plaque assay. A. AcNaV1.4 virus dilution 10-‐4. B. AcUK, virus dilution10-‐1. C. AcHANA , virus dilution10-‐2. D. AcRP23.lacZ virus dilution10-‐5.

Table 3.2. Titration using plaque assay of each virus.

Virus Pfu/ml P0 Pfu/ml P1 AcNaV1.4 2.6x106 2.95x108 AcUK 2.4x103 2.95108 AcHANA 3.5x103 7.5x107 AcRP23. lacZ 8.5x106 2.95x108 Control AcMNPV 2x107 2.2x108 Control AcRP23.lacZ 2.5x108 2.95x108

38

Plaque assay was then performed (Figure 3.3) to titrate the viruses (Table

3.2) prior to setting up serial passaging accurately. Table 3.2 indicates the Po

and P1 titration of the virus cells.

Figure 3.4. Genomic DNA isolated from AcMNPV passaged five times at low (0.1 pfu/cell, lane 2-‐6) and (high 5pfu/cell, land 7-‐11). The MOI was amplified using PCR with oligonucleotide primers RDP 213 and 214. Lane 1, molecular weight markers (New England Biolabs).

In Figure 3.4 results of control plasmid AcMNPV can be observed (lane 12)

at around 1000 bp. The same size can also be observed in both low and high

MOI (lane 2-‐11).

Figure 3.5. Genomic DNA isolated from AcRP23.lacZ passaged five times at low (0.1 pfu/cell, lane 2-‐6) and (high 5pfu/cell, land 7-‐11). The MOI was amplified using PCR with oligonucleotide primers RDP 213 and 214. Lane 1, molecular weight markers (New England Biolabs).

39

In Figure 3.5, results of control AcRP23. lacZ can be observed. The control

band lane 11 shows the band at 5000 bp, which can also be observed in high

MOI (lane 6-‐10). In low MOI, the band in lane 2 is observed to be around the

same size (5000 bp) but those bands in lane 3-‐5 are very faint at 5000bp.

Figure 3.6. Genomic DNA isolated from AcUK passaged five times at low (0.1 pfu/cell, lane 2-‐6) and (high 5pfu/cell, land 7-‐11). The MOI was amplified using PCR with oligonucleotide primers RDP 213 and 214. Lane 1, molecular weight markers (New England Biolabs). A. Ethidium bromide nucleic acid gel stain used. B. SYBR Gold nucleic acid gel stain used.

A

B

40

In Figure 3.6, results of AcUK can be observed. The control plasmid (lane 12)

was observed at 2000bp. Low molecular bands can be observed just above

400bp and 1000bp (lane 2-‐11). Due to the light visible stains, SYBR Gold

nucleic acid gel stain was also used, as it is more sensitive than ethidium

bromide nucleic acid gel stain. The faint bands can be easily observed with

SYBR Gold nucleic acid gel Figure 3.6b. There is still evidence the bands are

present at the right size (Figure 3.6b lane4-‐8). It is not clear whether the

non-‐specific bands contain urokinase but many bands can be observed at

the wrong size (Figure 3.6 a & b).

Figure 3.7. Genomic DNA isolated from AcRP23.lacZ passaged five times at low (0.1 pfu/cell, lane 2-‐6) and (high 5pfu/cell, land 7-‐11). The MOI was amplified using PCR with oligonucleotide primers RDP 213 and 214. Lane 1, molecular weight markers (New England Biolabs). A. Ethidium bromide nucleic acid gel stain used. B. SYBR Gold nucleic acid gel stain used.

B

A

41

In Figure 3.7, agarose gel results of AcRP23.lacZ can be observed. The

plasmid control (lane 12) shows the band in at 4000bp. This is only seen in

high MOI (lane 7, 8), but the bands are also faintly seen (lane 9,10).

However, the band is faintly seen in low MOI (lane2 &3) at 4000 bp, but no

bands are observed matching up to the control in lane 4, 5,6. There are some

bands observed at 1500/1517 bp (lane 2-‐6 and lane 8-‐11). More bands are

visible above 400bp (lane 2-‐6 and lane 8-‐11). SYBR Gold was also used, as

there were many faint bands. In Figure 3.7b, there is still evidence that

bands match up to control plasmid 4000bp in high MOI (lane 7-‐8), but were

still faintly present in lane 9 and 10. In low MOI only lane 2 match up to

plasmid control 4000 bp. There are many variable size bands seen in both

high and low MOI that do not match up to the control plasmid.

42

Figure 3.8. Genomic DNA isolated from AcPOET6NaV1.4 passaged five times at low (0.1 pfu/cell, lane 2-‐6) and (high 5pfu/cell, land 7-‐11). The MOI was amplified using PCR with oligonucleotide primers RDP 213 and 743. Lane 1, molecular weight markers (New England Biolabs). A. Ethidium bromide nucleic acid gel stain used. B. SYBR Gold nucleic acid gel stain used.

In Figure 3.8, agarose gel results of AcPOET6NaV1.4 can be observed. The

plasmid control (lane 12) shows the band at 6000bp but no bands are

observed matching up to the control. This gene may not have entered the

virus. The same results were observed in Figure 3.8b.

B

A

43

Figure 3. 9. Genomic DNA isolated from AcHANA passaged five times at low (0.1 pfu/cell, lane 2-‐6) and (high 5pfu/cell, land 7-‐11). The MOI was amplified using PCR with oligonucleotide primers RDP 213 and 214. Lane 1, molecular weight markers (New England Biolabs).

In Figure 3.9, agarose gel results of AcHANA can be observed. The plasmid

control (lane 12) shows the band at 4000bp, which also see in all passages in

both low and high MOI except for lane 10 in high MOI.

Figure 3.10. PCR analysis of virus DNA provided by Robert Possee.

In Figure 3.10, PCR analysis was performed on virus DNA provided by

Robert Possee. The gene RSF (lane 2), shows band at 2000bp. The gene

44

fBuHAM1 (lane 3) shows band present at 2500bp, 2000 bp and faint band

around 800bp. AcMNPV (lane 4) has a band at 1000bp, fbUKe9 (lane5)

shows band at 1500/1517 bp and 3ABC (lane 6) has visible bands at

1500/1517bp and 1000bp. 3AB (lane 7) has a band present at 2000bp,

BacPAK6 (lane 8) has band around 3000bp and BacPAK6 (lane 9) also has a

visible band at 3000bp. While it was not possible to compare the virus DNA

with the corresponding plasmid DNA used to make the recombinants, the

results show that those containing genes RSF, KE9, 3AB and lacZ(BacPAK6)

only generated a single DNA product after analysis using PCR. Viruses

containing HAM1 and 3ABC generated multiple DNA products.

45

Chapter 4-‐ Discussion

In this experiment the genetic stability of the four baculoviruses were tested.

These baculovirus expression vectors contained DNA sequences encoding a

range of proteins from viral, bacterial and mammalian sources. Sequences

encoding the haemagglutinin (HA) and neuraminidase (NA) glycoproteins

from influenza A virus were cloned into the AcHANA baculovirus; the

Autographa californica multicapsid nucleopolyhedrovirus was used as a

control; the mammalian gene urokinase was cloned into the AcUK

baculovirus; beta-‐galactosidase was cloned into AcRP23.lacZ and the

mammalian gene Nav1.4, a voltage-‐gated sodium channel was cloned into

the AcNaV1.4 baculovirus. Prior to doing the co-‐transfection, PCR analysis of

the recombinant genes was performed to determine if the genes were

present in the transfer plasmids (Figure 3.1).

DNAeasy Blood & Tissue Kit mentioned in materials and methods

section 3.7 was only used in the beginning of this experiment but not

throughout the entire experiment. Even though the DNAeasy Blood & Tissue

Kit was very convenient but it was expensive and very time consuming for

multiple samples due its multiple steps. Therefore, DNA purification was

done by pelleting the virus cells and performing lysis as described in

material methods section 3.12. This method was used throughout the

experiment is it was fast and affordable compared to DNAeasy Blood &

Tissue Kit.

The plaque assay method was used to determine the titration of P0

and P1; it was not carried out after every passage, as it was too time

consuming. It could have been used to determine the accurate infection titre

of the viruses in order to set the passaging accurately but instead a set value

of 1x108Pfu/ml was used, as it was a reasonable assumption that each of the

titer for the passage should be similar to the previous passage. Even though,

titration should have been done after every passage to get the accurate

figure but it was not performed as there was limited time to do this research.

Real time PCR analysis of virus could also have been used to determine the

titres of infectious virus. This method can be done in a few hours.

46

SYBR Gold nucleic acid gel stain was used for pAcUK, AcRP23.lacZ,

AcNaV1.4 for visibility of faint bands that were observed with the use of

ethidium bromide nucleic acid. SYBR Gold stain is more sensitive than

ethidium bromide due to quantum yield of nucleic acid complexes (Tuma et

al., 1999).

The viruses control AcMNPV (Figure 3.4), control AcRP23.lacZ

(Figure 3.5), and AcHANA (Figure 3.9), all have genetic stability as the bands

amplified equally to the plasmid control. However, this was not the case for

AcUK, which contained the mammalian gene urokinase (Figure 3.6),

AcRP23.lacZ, which contained the bacterial beta-‐galactosidase gene (Figure

3.7), and AcNaV1.4 which contained the mammalian Nav1.4 gene (Figure

3.8). Although both baculoviruses, which, contained mammalian cloned

sequences were found to be genetically unstable, one of the baculoviruses

which, contained a bacterial gene (AcRP23.lacZ) was unstable whereas the

other (control AcRP23.lacZ) demonstrated genetic stability in these

experiments. Therefore, there is no clear relationship between the origin of

the cloned sequence within the baculovirus and the species of origin of the

cloned DNA. One reason for stability in control AcRP23.lacZ could be due to

its plaque purification, while the AcRP23.lacZ (Figure 3.7) was not plaque

purified. This may have caused the low molecular weight concatemers.

Similar results were found in the study done by Wu et al., 1999. They

believed that it could be due to formation of multimers of replicated plasmid

DNA (Wu et al., 1999). The development of multimeric insert can take place

when plasmid-‐plasmid recombination occurs in result to unequal crossing-‐

over in-‐between genomes (Wu et al., 1999). In addition to the serial

passaging, PCR analysis was also performed on virus DNA provided by

Robert Possee (Figure 3.10). Which contained BackPAk6 that was similar to

AcRP23.lacZ, and 3AB, which was similar to AcMNPV. These virus cells were

made using the standard method. The results (Figure 3.10) indicate that the

control viruses in Figure 3.4 and Figure 3.5 have accurate results.

The unstable baculoviruses varied in their degree of instability. For

example passaged AcUK virus showed only a weak PCR band, sized around

2000 bp, in common with the control at passage 1 with the high MOI of 5,

47

with not obvious PCR product at around 2000 bp being observed in

subsequent passages (Figure 3.6). This result shows that there was genetic

instability of the AcUK virus after the first passage. Non-‐specific binding and

primers can be the cause of low molecular bands. It is also possible that gene

responsible in urokinase for production of viruses made a deletion, which

may have lead to the amplification of different size fragments (Kool et al.,

1991). In contrast, AcRP23.lacZ had prominent band at around 4000bp for

passage 1 and 2 with high MOI of 5, but this was much weaker at passages 3

and 4 and absent from passage 5 which suggests the gradual loss of full

length insert over time, with loss occurring after the second passage (Figure

3.7). In contrast, results with AcRP23.lacZ with the low MOI of 1 show

specific band at around 4000bp at passage 1 and a much weaker band at

passage 2, which indicate that loss of the full sized insert was starting after

the first passage (Figure 3.7). Whether the loss of the full-‐length insert of

AcRP23.lacZ was beginning after the first or the second passage is somewhat

academic, but both sets of results show the genetic instability of this cloned

sequence.

In AcUK (Figure 3.6) and AcRP23.lacZ (Figure 3.7), the presence of

non-‐specific bands was observed at various sizes at around (400bp, 1000bp

and 1500/1517bp). The bands that are found at low molecular weight can

be further characterized by various tests. The results were similar in Figure

3.10, the low molecular weight markers can be observed in fBuHAM1 and

3ABC. Wu et al. suggested in their study that large amount of plasmid DNA

may have integrated into the virus DNA for the appearance of non-‐specific

bands (1999). In another study done by Wu and Carstens, they found that

replication of nonspecific plasmids appeared even when the virus infection

was present (1996). The possibility of the visible bands at various sizes

could be due to defective interfering particles (DIPs), which form during

viral infections over time in the process of serial passaging of the virus,

which can also cause plaque-‐morphology mutants (Pijlman et al., 2004; Kool

et al., 1991). Wu and Carstens, also suggested that inserted DNA may have

characterized specifically that it can allow nonspecific initiation to take place

on any DNA, when the viral DNA proteins replication synthesized and taken

48

to the nuclear sites (1996). The occurrence of nonspecific bands may be due

to random nonhomologous recombination (Wu et al, 1999). The

nonsequence bands can also occur if plasmid sequences and cellular

sequences insert at numerous location in viral genome (Wu et al, 1999).

Caution should be exercised in interpreting the intensity of DNA bands

generated from PCR analysis. Unlike real time or quantitative (q) PCR, gel

analysis of virus genome DNA is not amenable to accurate determination of

original template concentration. Smaller PCR products are likely to be

generated more readily than larger ones and may give a false impression of

relative amounts in the sample. More detailed analysis of the virus

populations would nucleic acid hybridization or preferably qPCR.

It is still in question whether the recovered gene in AcUK (Figure

3.6) and AcRP23.lacZ (Figure 3.7) are either from the host or from the virus.

The unknown sequences may possibly be derived from the host insect cells,

as it has been observed in the genome of defective viruses (Kool et al., 1991).

More tests can be done to characterize the bands present in both AcUK and

AcRP23.lacZ such as: gene expression, enzyme assay, and plaque

purification. Another specific approach to characterize the non-‐specific

bands of AcRP23.lacZ can be performed by plaque purification of the virus

or by purifying each individual visible band on the electrophoresis gel. As

AcRP23.lacZ has a bacterial promoter in addition to the polyhedron

promoter, the E.coli can be stained with X-‐gal, which will then form blue and

white colonies The white colonies would indicate the presence of the

bacterial DNA, which can be individually picked up to do the passaging. It

may give similar results to control AcRP23.lacZ. This will help indicate

whether the bands present in Figure 3.7 were from AcRP23.lacZ or the virus

DNA.

As AcNaV1.4 (Figure 3.8) showed no bands, sized around 5000bp, in

common with the control for any of the 5 passages the genetic instability of

the baculovirus over time could not be assessed (Figure 3.8). Previous

studies to generate recombinant viruses containing this gene were very

difficult (R.D. Possee, pers comm). The absence of the bands in AcNAV1.4

could be due to the occurrence of integration at multiple sites surrounding

49

the viral genome or integration occurred in different sizes (Wu et al., 1999).

On the other hand, absence of the bands may also result if the gene was not

properly cloned into the virus properly. Whether the absence of the bands is

due to complete loss of the baculovirus or a substantial reduction in the copy

number of the vector is unknown. One aspect that maybe taken to approach

this problem is by redoing the experiment with the gene NaV1.4 using linear

DNA instead of circular DNA. As in circular DNA crossover occurs, which can

cause the entire plasmid to enter the virus. Another way of solving this

problem is by increasing the number of cycles in the PCR would determine

whether any vector remained after the first passage. This is a more sensitive

approach than that adopted by Chakiath and Esposito (2007) in their studies

of E. coli strains using gel electrophoresis of purified plasmids following

transfection with a lentiviral expression vector which is discussed below.

Establishing the genetic stability of vectors carrying exogenous DNA

sequences is an important consideration for their long-‐term use. This has

been recognized for a variety of different vector systems. For example,

highly purified plasmid DNA used for gene therapy and a DNA vaccination

application is vulnerable to degradation of supercoiled isoforms following

cell culture of E. coli transfectants and subsequent purification of the DNA.

Plasmid DNA was found to be stable in E. coli pellets, even at 4oC, but storage

at -‐20oC of alkaline lysates was required to avoid degradation of DNA over

time (Freitas et al., 2007).

Lentiviral expression vectors which are derived from retroviruses

generally contain regions of long terminal repeats which leads to genetic

instability following cloning in E. coli hosts due to deletion of the regions

between these repeats. The mechanism considered to be responsible for

deletion of these sequences is homologous recombination. These deletion

events commonly remove critical lentiviral sequences, which makes

recovery of full length clones difficult as only the marker of antibiotic

resistance and the origin of replication are retained within the plasmid

following deletion. The use of a strain of E. coli, MDS42, which had a

genetically engineered reduced genome, resulted in stabilization of lentiviral

expression clones, which contained these repeat sequences. In these

50

experiments agarose gel electrophoresis was used to determine the relative

number of the 7.4 kb full length plasmids and 3.6 kb genetically deleted

plasmids in each of the E. coli strains transfected with the lentiviral

expression vector. In several clones of one strain of E. coli, STBL3, no

plasmid DNA could be recovered which may indicate loss of the plasmid or a

substantial reduction in the copy number of the plasmid (Chakiath and

Esposito, 2007).

The stability of a second type of viral vector, replication defective

adenoviral vectors was studied by Smith et al. (2009) who investigated the

effect of genome length on virion stability. Adenoviral vectors are commonly

used to deliver foreign genes into mammalian cells for gene therapy. Smaller

adenoviral vectors of around 30 kb were much more sensitive to heat

inactivation than their larger parental helper viruses, which were greater

than 36 kb on length. Thus the proteins encoded by the longer parental

viruses had an important role in the maintenance of capsid strength and

integrity (Smith et al., 2009). These results show that genetic stability or

instability is not the only consideration for an effective viral vector.

The baculovirus-‐insect cell expression system has become a valuable

tool for production of recombinant proteins. This system has been wide

spread due to its ability to isolate recombinant virus technique with either a

large number or a small number of insect cells. Large numbers of

laboratories are using cloning methods and protein purification instruments

as this system is becoming popular over time. For more than 30 years

baculoviruses have been found to be adaptable for the expression of

proteins in insect cells, but more recently have also been used for protein

expression in mammalian cells (Kost et al., 2005; Aucoin et al., 2010;

Kroemer et al., 2015). Baculovirus expression vectors have been used

successfully for manufacturing of biological products including viral

antigens and vaccines for use in humans and for veterinary purposes. For

example, a baculovirus expression system is used to produce the

homologous vaccine against human papilloma virus for the prevention of

cervical cancer (Aucoin et al., 2010).

51

The Sf9 insect cell line, which is derived from Spodoptera frugiperda

was used in these experiments and has been widely used for the study of

cloning, amplification and titration of variety of recombinant baculoviruses.

An alternative source of insect cells for such studies is the High Five cell line,

which is obtained from Trichoplusia ni, and has a higher protein yield and a

higher virus like particle yield than Sf9 cells (Aucoin et al., 2010). It would be

interesting to know whether the genetic instability of the three (pAcUK,

AcRP23.lacZ and AcNaV1.4) recombinant baculoviruses in Sf9 cells found in

this study can also be found in the High Five cell line.

Conclusion and future developments

Examining the genetic stability of six recombinant baculoviruses containing

bacterial, viral or mammalian exogenous sequences by PCR amplification

following 5 passages in Sf9 insect cells showed that three baculoviruses

(control AcMNPV, control AcRP23.lacZ, AcHANA) were genetically stable

whereas three other baculoviruses (pAcUK, AcRP23.lacZ, AcNaV1.4) were

genetically unstable.

One limitation of the present study is the lack of replication of

results. Replicating the results would increase the confidence that the three

recombinant viruses, which have been shown to be genetically stable, could

be suitable for commercial use. The remaining three recombinant viruses

(pAcUK, AcRP23.lacZ, AcNaV1.4), require further study to determine the

possible reason for their genetic instability. This could include sequencing of

the native cloned viral sequences and those following a change in the size of

the PCR products after passaging to determine the nature of the genetic

instability. This could identify if there were any specific DNA sequences

within the cloned inserts for example repeat sequences, which may have

been responsible for the observed genetic instability. More interestingly, it

would be interesting to see the result difference if linear viruses were used

than the circular viruses. Further tests such as northern blotting, western

blotting, fluorescent in situ hybridization (FISH), reverse transcription

polymerase chain reaction (RT-‐PCR) and DNA microarray can be useful in

52

determination of the non-‐specific bands in the unstable viruses. Such tests

will help us conclude their stability for commercial use. The low molecular

bands can also be sequenced and compared with other genes using the

BLAST system. The sequencing system will help us determine the

similarities and the change that took place during the passaging.

53

References Ahrens, C. H., Russell, R., Funk, C. J., Evans, J. T., Harwood, S. H., & Rohrmann,

G. F. (1997). The sequence of the Orgyia pseudotsugata multinuclocapsid nuclear polyhedrosis virus genome. Virology , 229, 381.

Anderson, D., Harris, R., Polayes, D., Ciccarone, V., Donahue, R., Gerard, G., et

al. (1996). Rapid generation of recombinant baculoviruses and expression of foreign genes using the Bac-‐to-‐Bac baculovirus expression system. Focus , 17, 53-‐58.

Au, S. P. (2012). Nuclear transport of baculovirus: revealing the nuclear pore

complex passage. Journal of Structural Biology , 177 (1), 90-‐98. Aucoin, M. G., Mena, J. A., & Kamen, A. A. (2010). Bioprocessing of

baculovirus vectors: a review . Current Gene Therapy , 10 (3), 174-‐186.

Blissard, G. W., & Rohrmann, G. F. (1989). Location,sequence, transcriptional

mapping, and temporal expression of the gp64 envelope glycoprotein gene of the Orgyia pseudotsugata multicapsid nuclear polyhedrosis virus. Journal of Virology , 170, 537-‐555.

Burgess, R. B., & Deutscher, M. P. (2009). Guide to Protein Purification (Vol.

463). London: Academic Press. Chakiath, C. S., & Esposito, D. (2007). Improved recombinational stability of

lentiviral expression vectors using reduced-‐genome Escherichia coli. Bio Techniques , 43 (4), 466-‐469.

Cheng, X., Hillman, C. C., Zhang, C., & Cheng, X. (2013). Reduction of

polyhedrin mRNA and protein expression levels in Sf9 and Hi5 cell lines, but not in Sf21 cells, infected with Autographa californica multiple nucleopolyherovirus fp25k mutants. Journal of General Virology , 95 (5), 166-‐176.

Clem, R. J., & Passarelli, A. L. (2013). Baculoviruses: Sophisticated Pathogens

of Insects. PLoS Pathogens Journal , 9 (11). Clem, R. J., & Passarelli, L. A. (2013). Baculoviruses: Sophisticated pathogens

of Insects. PLOS Pathogens , 9 (11), 1-‐4. Condreay, J. P., Witherspoon, S. M., Clay, W. C., & Kost, T. A. (1999). Transient

and stable gene expression in mammalian cells transduced with a recombinant baculovirus vector. Proceedings of the National Academy of Science of the United States of America , 96 (1), 127-‐132.

54

Danguah, J. O., Botchway, S., Jeshtadi , A., & Kingh, L. A. (2012). Direct interaction of baculovirus capsid proteins VP39 and EXON0 with kinesin-‐1 in insect cells determined by fluorescence resonance energy transfer-‐fluorescence lifetime imaging microscopy. Journal of Virology , 86 (2), 844-‐853.

Database, G. (2015). PLAU Gene (Protein Coding) Plasminogen Activator,

Urokinase. Retrieved 05/09/2015, from Gene Cards Human Gene Database: http://www.genecards.org/cgi-‐bin/carddisp.pl?gene=PLAU

Dickison, V. L., Willis, L. G., Sokal, N. R., & Theilmann, D. A. (2012). Deletion of

AcMNPV ac146 eliminates the production of budded virus. Virology , 431 (1-‐2), 29-‐39.

Freitas, S. S., Azzoni, A. R., Santos , J. A., Monterio, G. A., & Prazeres, D. M.

(2007). On the stability of plasmid DNA vectors during cell culture and purification. Molecular Biotechnology , 36 (2), 151-‐158.

Giri, L., Feiss, M. G., Bonning, B. C., & Murhammer, D. W. (2012). Production

of baculovrius defective interfering particles during serial passage is delayed by removing transposon target sites in fp25k. Journal of General Virology , 93, 389-‐399.

Giri, L., Li, H., Sandgren, D., Feiss, M. G., Roller, R., Bonning, B. C., et al. (2010).

Removal of transposon target sites from the Autographa californica multiple nucleopol. Journal of General Virology , 91 (12), 3053-‐3064.

Haines, F. J., Possee, R. D., & King, L. A. (2006). Baculovirus Expression

Vectors. In V. R. M., Encyclopedia of Virology (3rd ed., pp. 451-‐454). London: Elsevier.

Harrion, R. L., & Summers, M. D. (1995a). Biosynthesis and localization of the

Autographa californica nuclear polyhedrosis virus 25K gene product. Virology , 208, 279-‐288.

Harrison, R. (2009). Structural divergence among genomes of closely related

baculoviruses and its implications for baculovirus evolution. Journal of Invertebrate Pathology , 101 (3), 181-‐186.

Heimpel, A. M., Thomas, E. O., Adams, J. R., & Smith, L. J. (1973). The presence

of nuclear polyhedrosis viruses of Trichoplusia ni on cabbage from the market shelf. Environment Entomol , 2 (173).

Hink, W. F. (1970). Established insect cell line from the cabbage

looper,Established insect cell line from the cabbage looper, Trichoplusia ni. Nautre , 466-‐467.

55

Hitchman, R. B., Locanto, E., Possee, R. D., & King, L. A. (2011). Optimizing the baculovirus expression vector system. Methods , 55, 52-‐57.

Jarvis, D. L. (1997). Baculovirus Expression Vector. In L. K. Miller, The

Baculoviruses (pp. 389-‐391). Athens, Georgia: Plenum Press. Jehle, J. A., Blissard, G. W., Bonning, B. C., Cory, J. S., Hernious, E. A.,

Rohrmann, G. F., et al. (2006). On the classification and nomenclature of baculoviruses: A proposal for revision. Archives of Virology , 151, 1257-‐1266.

Keddie, B. A., Aponte, G. W., & Volkman, L. E. (1989). The pathway of

infection of Autographa californica nuclear polyhedrosis virus in an insect host. Journal of Science , 243, 1728-‐1730.

Kelly, B. J., Chapple, S. D., Allen, C., Pritchard, C., King, L. A., & Possee, R. D.

(2008). Extended budded virus formation and induction of apoptosis by an AcMnpv Fp-‐25/p35 double mutant in Trichoplusia ni cells. Virus Research , 133, 157-‐166.

King, L. A., Hitchman, R., & Possee, R. D. (2007). Recombinant baculovirus

isolation. Methods in Molecular Biology , 388, 77-‐94. King, L., & Possee, R. D. (1992). The Baculovirus Expression System A

laboratory guide. London: Chapman & Hall. Kitts, P. A., & Possee, R. D. (1993). A method for producing recombinant

baculovirus expression vectors at high frequency. BioTechniques , 14, 810-‐817.

Kitts, P. A., Ayres, M. D., & Possee, R. D. (1990). Linearisation of baculovirus

DNA enhances the recovery of recombinant virus expression vectors. Nucleic Acids Research: Oxford Journals , 18, 5667-‐5672.

Kool, M., Voncken, J. W., Van Lier, F. L., & Tramper, J. V. (1991). Detection and

analysis of autographa californica nuclear polyhedrosis virus mutants with defective interfering properities. . Virology , 183 (2), 739-‐746.

Kost, T. A., Condreay, J. P., & Jarvis, D. L. (2005). Baculovirus as versatile

vectors for protein expression in insect and mammalian cells. Nature Biotechnology , 23 (5), 567-‐575.

Kroemer , J. A., Bonning, B. C., & Harrison, R. L. (2015). Expression, delivery

and function of insecticidal proteins expressed by recombinat baculoviruses. Viruses , 7 (1), 422-‐455.

56

Lee, H. S., Lee, H. Y., Kim, Y., Jung, H., Choi, K. J., Yang, J. M., et al. (2015). Small interfering (Si) RNA mediated baculovirus replication reduction without affecting target gene expression. Virus Research , 199, 68-‐76.

Licari, P., & Bailey, J. E. (1991). Factors influencing recombinat protein yields

in an insect cell baculovirus expression system: Multiplicity of infection and intracellular protein degradation. Biotechnology and Bioengineering , 37, 238-‐246.

Luckow, V. A., Lee, S. C., Barry, G. F., & Olins, P. O. (1993). Efficient generation

of infectious recombinant baculoviruses by site-‐specific transposon mediated insertion of foreign genes into a baculovirus genome propagated in Escherichia coli. Journal of Virology , 67 (8), 4566-‐4579.

Lynn, D. (2003). Comparative susceptibilities of insect cell lines to infection

by the occlusion-‐body derived phenotype of bacloviruses. Journal of Invrtebrate Pathology , 83, 215-‐222.

M. van Oers, M. (2011). Opportunities and challenges for the baculovirus

expression system. Journal of Invertebrate Pathology , 107, S3-‐S15. Maciag, K., Olszowka, M., & Klein, A. (2014). Biotechnology progress-‐The

polish students' scientific interest. Cracow: Academic Society of Biotechnology Students.

McCarthy , C. B., & Theilmann, D. A. (2008). AcMNPV ac143 (odv-‐e18) is

essential for meidating budded virus production and is the 30th baculovirus core gene. Virology , 375, 277-‐291.

Morokuma, D., Xu, J., Mon, H., Hirata, K., Hino, M., Kuboe, S., et al. (2015).

Human alpha 1-‐acid glycoprotein as a model protein for glcoanalysis in baculovirus expession vector system. Journal of Asia-‐Pacific Entomology , 18 (2), 303-‐309.

Ohkawa, T., Volkman, L. E., & Welch, M. D. (2010). Actin-‐based motility

drives baculovirus transit to the nucleus and cell surface. Journal of Cell Biology , 190 (2), 187-‐195.

O'Reilly, D. R., Miller, L. K., & Luckow, V. A. (1994). Baculovirus Expression

Vectors. A laboratory manual . New York: Oxford University Press. Pearson, M. N., Russell, R., & Rohrmann, G. F. (2001). Characterization of a

baculovirusencoded protein that is associated with infected-‐cell membranes and budded virions. Journal of Virology , 291, 22-‐31.

Pennock, G. D., Shoemaker, C., & Miller, L. K. (1984). Strong and regulated

expression of E. coli B-‐galactosidase in insect cells using a bculovirus vector. . Journal of Molecular Cell Biology , 4, 399-‐406.

57

Pijlman, G. P., Vrij, J. d., vanden End, F. J., VIak, J. M., & Martens , D. E. (2004). Evaluation of baculovirus expression vectors with enchanced stability in continous cascaded insect-‐cell bioreactors. Journal of Biotechnology and Bioengineering , 87 (6), 743-‐753.

Possee, R. D., & Howard, S. C. (1987). Analysis of the polyhedrin gene

promoter of the Autographa californica nuclear polyhedrosis virus. Nucleaic Acids Research , 15, 10233-‐10248.

Possee, R. D., & King, L. A. (2007). Baculovirus Transfer Vectors. In D. W.

Murhammer, Baculovirus and Insect Cell Expression Protocols Methods in Molecular Biology (Vol. 388, pp. 55-‐75). Totowa : Humana Press.

Possee, R. D., & Rohrmann, G. F. (1997). Baculovirus Genome Organization

and Evolution. In L. K. Miller, The Baculoviruses (pp. 109-‐110). Athens, Georgia: Plenum Press.

Possee, R. D., Hitchman, R. B., Richards, K. S., Mann, S. G., Siaterli, E., Nixon, C.

P., et al. (2008). Generation of baculovirus vectors for the high-‐throughput production of proteins in insect cells. Biotechnology and Bioengineering , 101 (6), 1115-‐1122.

Radford, K. M., Cavegn, C., Bertrand, M., Bernard, A. R., Reid, S., & Greenfield,

P. F. (1997). The indirect effects of multiplicity of infection on baculovirus expressed proteins in insect cells: Secreted and non-‐secreted products. Cytotechnology , 24 (1), 73-‐81.

Rohrmann, G. (2013). Baculovirus Molecular Biology (Third ed.). Bethesda:

National Center for Biotechnology Information. Shi, Y., Tang, P., Li, Y., zhou, Q., Yang, K., & Zhang, Q. (2015). Three-‐

dimensional visulization of the Autographa californica multiple nucleopolyherovirus occlusion-‐derived virion envelopment process gives new clues as to its mechanism . Virology , 476, 298-‐303.

Shu-‐ffen, L., Hua-‐lin, W., Zhi-‐hong, H., & Fei , D. (2012). Genetic Modification

of Baculovirus Expression Vectors. Virologica Sinica , 27 (2), 71-‐82. Smale, S. T. (2010). Beta-‐galactosidase assay. Cold Spring Harbor Protocols ,

5. Smith, A. C., Poulin, K. L., & Parks, R. J. (2009). DNA genome size affects the

stability of the adenovirus virion. Journal of Virology , 83 (4), 2025-‐2028.

Thaa, B., Hofmann, K. P., & Veit, M. (2010). Viruses as vesicular carriers of

the viral genome: A functional module perspective. Biochimica et Biophysica Acta (BBA)-‐ Molecular Cell Research , 1803 (4), 507-‐519.

58

Toprak, U., Harris, S., Theilmann, D., Gillott, C., Hegedus, D. D., & Erlandson, M. A. (2012). Role of enhancin in Mamestra configurata nucleopolyhedrovirus virulence: selective degradation of host peritrophic matrix proeins. The Journal of general virology , 4, 744-‐753.

Tuma , R. S., Beaudet, M. P., Jin, X., Jones, L. J., Cheung, C. Y., Yue, S., et al.

(1999). Characterization of SYBR Gold nucleic acid gel stain: a dye optimized for use with 300n, ultraviolet transilluminators. Analytical biochemistry , 268 (2), 278-‐288.

Van Loo, N., Fortunati, E., Ehlert, E., Rabelink, M., Grosveld, F., & Scholte, B. J.

(2001). Baculovirus Infection of Nondividing Mammalian Cells: Mechanisms of Entry and Nuclear Transport of Capsids. Journal of Virology , 75 (2), 961-‐970.

Wang, P., & Granados, R. R. (1997). An intestinal mucin is the target

substrate for a baculovirus enhancin. Proceedings of the National Academy of Science of the United States of America , 94 (13), 6977-‐6982.

Weyer, U., & Possee, R. D. (1991). A baculovirus dual expression vector

derived from the Autographa Californica nuclear polyhedrosis virus polyhedrin and p10 promoters: co-‐expression of two influenza virus genes in insect cells. Journal of General Virology , 72, 2967-‐2974.

Wong, K. T., Peter, C. H., Greenfield, P. F., Reid, S., & Nielsen, L. K. (1996). Low

Multiplicity infection of insect cells with a recombinant baculovirus: The cell yield concept. Biotechnology and Bioengineering , 49 (6), 659-‐666.

Wu, Y., & Carstens, E. B. (1996). Initiation of baculovirus DNA replication:

early promoter regions can function as infection-‐dependent replicating sequences in a plasmid-‐based replication assay. Journal of Virology , 70, 6967-‐6972.

Wu, Y., Liu, G., & Carstens, E. B. (1999). Replication, Integration, and

Packaging of Plasmid DNA following Cotransfection with Baculoviurs Viral DNA. Journal of Virology , 73 (7), 5473-‐5480.

Zhang, J. H., Ohkawa, T., Washburn, J. O., & Volkman, L. E. (2005). Effects of

Ac150 on virulence and pathogenesis of Autographa californica multiple nucleopolyhedrovirus in noctuid hosts. Journal of Genetic Virology , 86 (6), 1619-‐1627.

Zhao, Y., Chapman, D. A., & Jones, I. M. (2003). Improving rcombination.

Nucleic Acids Research , 31 (2), E6.

59

Zwart, M. P., Pijlman, G. P., Sardanyes, J., Duarte, J., Januario, C., & Elena, S. F. (2013). Complex dynamics of defctive interfering baculoviruses during serial passage in insect cells. Journal of Biological Physics , 39, 327-‐342.

Zwart, M. P., Van Oers, M. M., Cory, J. S., Van Lent, J. W., Van der Werf, W., &

Vlak, J. M. (2008). Development of a quantitative real-‐time PCR for determination of genetype frequencies for studies in baculovirus population biology . Journal of Virological Methods , 148 (1-‐2), 146-‐154.

Date post:	12-Apr-2017
Category:	Documents
Upload:	jasvir-jass-kaur
View:	142 times
Download:	2 times

Thesis- Final Sep 21-1

Documents