THE JOURNAL OF B~OLCGICAL CHEMISTRY 0 1993 by The American Society for Biochemistry and Molecular Biology, Inc.

Vol. 268, No. 32, Issue of November 15, pp. 24481-24490, 1993 Printed in U.S.A.

Escherichia coli Topoisomerase IV PURIFICATION, CHARACTERIZATION, SUBUNIT STRUCTURE, AND SUBUNIT INTERACTIONS*

(Received for publication, May 19, 1993, and in revised form, July 26, 1993)

Hong Peng and Kenneth J. Marians From the Program in Molecular Biology, Memorial Sloan-Kettering Cancer Center and the Graduate Program in Molecular Biology, Cornel1 University Graduate School of Medical Sciences, New York, New York 10021

DNA sequence analysis of Escherichia coli pa& and parE, encoding the subunits of topoisomerase IV (Top0 nr) (Kato, J.-I., Suzuki, €I., and Ikeda, H. (1992) J. BioZ. Chem. 267, 25676-26684), showed that ParC was 22 amino acids longer on the N terminus and ParE was 29 amino acids longer on the C terminus than reported pre- viously. E. coli strains bearing bacteriophage T7 RNA polymerase-based expression plasmids carrying both in- tact and truncatedparC andparE were used to overpro- duce the ParC and ParE proteins. Full-length ParC and ParE were required to reconstitute Top0 IV activity, whereas the truncated ParC and ParE were inactive. Top0 IV activity was supported only by ATP or dATP. The [ATPll,, for DNA relaxation was 0.45 m ~ , almost 25-fold higher than the [ATP],,, for decatenation of kinetoplast DNA. Top0 IV activity was inhibited by the quinolone and coumarin antibiotics, although the concentrations required for 50% inhibition of activity were 3-30-fold higher than those required to inhibit DNA gyrase. The norfloxacin-induced DNA cleavage patterns of Top0 IV and DNA gyrase were distinct but overlapping. The na- tive forms of ParC and ParE were a dimer and a mono- mer, respectively; whereas the active form of Top0 IV was a heterotetramer, ParCzParE2. The inactivity of the truncated forms of ParC and ParE could be attributed to their failure to form the heterotetramer.

Escherichia coli has four topoisomerases. Topoisomerases I and I11 are type I enzymes, whereas topoisomerases I1 (DNA gyrase) and IV are type I1 enzymes. Topo’ I is implicated, along with gyrase, in the maintenance of intracellular superhelical tension. The DNA of cells carrying leaky point mutations in topA (encoding Top0 I) have a higher than normal superhelical density (1). Deletion of topA causes E. coli cells to accumulate compensatory mutations in either gyrA, gyrB (1, 21, or toc (r): The DNA in these cells has a reduced superhelical density. At least in one case, it has been shown that the supercoiling ac- tivity of the mutant gyrase has been reduced (2). Thus, the relaxation activity of Top0 I and the supercoiling activity of gyrase act in dynamic equilibrium to adjust the superhelicity of cellular DNA. Although not established by genetic analysis, it

* This work was supported by National Institutes of Health Grant GM34558. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “aduertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s1 reported in this paper has been submitted to the GenBankTMIEMBL Data Bank with accession nunbeds) L22025 and L22026.

The abbreviations used are: Topo, topoisomerase; kb, kilobase paids); PCR, polymerase chain reaction; IPTG, isopropyl-1-thio-6-D- galactopyranoside; DTT, dithiothreitol; PAGE, polyacrylamide gel elec- trophoresis; AMP-PNP, adenosine 5’-(p,y-immino)triphosphate; ATPyS, adenosine 5’-O-(thiotriphosphate).

seems likely that toc mutations result in an overproduction of parC and parE (4), which encode Top0 IV (5). Thus, at least under some conditions, the relaxation activity of Top0 IV can substitute for that of Top0 I.

Unlike gyrase, Top0 I, and Top0 IV, Top0 I11 has not been implicated in the maintenance of superhelical density in the cell. Its biochemical properties suggest that under intracellular conditions, decatenation is the preferred reaction over relax- ation by a factor of 10 (6). The biological role of this enzyme remains a puzzle. Cells carrying topB (encoding Top0 111) null mutations are viable (7),2 although they exhibit an increased frequency of spontaneous deletion formation (8). No other phe- notype has been reported. Interestingly, Top0 111 has been shown to cleave RNA at sequences identical to where it cleaves DNA (9). Whether this reflects a role for Top0 I11 in RNA me- tabolism remains a topic for speculation.

Gyrase appears to be required for DNA replication. The phe- notypes of different mutant alleles of gyrA and gyrB have sug- gested that gyrase is required for initiation of DNA replication (10, 11) and elongation of nascent DNA (12, 131, as well as for segregation of daughter chromosomes (14). However, with the discovery of Top0 IV (4,5), the role of gyrase in segregation now appears more ill-defined.

Like cells mutated ingyrA (parA) andgyrB (parD) (15-17), those mutated in parC and parE show defects in partition at the nonpermissive temperatures (4, 18-20). Thus, it would seem that both bacterial type I1 topoisomerases are required at the terminal stages of DNAreplication. Paradoxically, Adams et al. (21) demonstrated that replication catenanes of pBR322 plasmid DNA accumulated at the nonpermissive temperature only in pare andparE strains, not in gyrA or gyrB strains. This leaves unresolved the relative contributions of the two enzymes to segregation and partition.

In order to define the role of Top0 IV in these processes, we have undertaken a characterization of the enzyme. We show here that ParC is 22 amino acids longer on the N terminus and ParE is 29 amino acids longer on the C terminus than as re- ported by Kat0 et al. (4). Hydrodynamic studies indicate that the active form of the enzyme is ParCaParE, and that the truncated species described by Kat0 et al. (4) fail to form the heterotetramer. In addition, we have characterized the relax- ation activity of the intact enzyme and shown that Top0 IV sensitivity to quinolones and courmarins is somewhat less than that of gyrase. Finally, we show that Top0 IV and gyrase cleav- age sites on the DNA form distinct but overlapping sets.

MATERIALS AND METHODS DNA Sequencing-A 6.2-kb EcoRI-Hind111 DNA fragment containing

parC and a 5.5-kb EcoRI-EglII DNA fragment containing parE were derived from the Kohara A phage 506 (which spans the parCEF region (22)) and subcloned into pBS+/- DNA(Stratagene1. These plasmids were

R. J. DiGate and K. J. Marians, unpublished information,

24481

24482 Top0 N

A- parC par€ G A T C G A T C -

U - -.e

FIG. 1. Nucleotide sequence deter- mination at the 5'-end of pa& and the 3'-end of parE. A, DNA sequencing was as described under "Materials and Methods." The arrows indicate the addi- tional nucleotide residues found in the se- quences of parC and parE as compared with the sequences reported by Kat0 et al. (4). The gels read the sequences of the noncoding strand forparC and the coding strand for parE. B , the N-terminal se- quence of ParC and the C-terminal se- quence of ParE. The nucleotide insertions are shown in lowercase bold-faced letters. The open reading frames have been trans- lated, and the amino acids are given in the single-letter code. The previously re- ported (4) translational start site forparC is shown as a bold-faced M . The previ- ously reported C-terminal sequence of ParE was . . . DEDDHVLTR-STOP. Also highlighted for parC are the predicted -35 and -10 promoter sequences (under- lined) and the predicted Shine-Dalgarno sequence (bold-faced and underlined ).

B. P a C -3 5 -1 0 "GGCGCTATTCACGmTCTCCTGTGACTCGACGCGGCAGATAATGTAGTA

TCTCCGGCAATATTGCCCCTITGAAGGCTGGCGAATAAGTTGAGGAATCA

G A A l T A A T G A G C G A T A T G G C A G A G C G C C T T G C G c T A C A T G A A l T

ACGGAAAACGCCTACTTAAACTACTCCATGTACGTGATCATGGAC- M S D M A E R L A L H E F

T E N A Y L N Y S M Y V I M D

par€ A A G ' T T G A C T A T C G A T G A T G A A G A C G A T C A g C G T A C T G A C G C G A T G A T G

Q L T I D D E D D Q R T D A M M GATATGCTGCTGGCGAAGAAACGCTCGGAAGATCGCCGCAACTGGTTG

D M L L A K K R S E D R R N W L

Q E K G D M A E I E V S T O P CAA GAG AAA GGC GAC ATG GCG GAG ATT GAG G'TT TAA AGGAAAGAACAT -

used as templates in double-stranded DNA sequencing reactions as

oligonucleotides 5'-ATACACAATGCGGCGCTGAACAGG-3' and 5'-AT- described by the manufacturer (United States Biochemical Corp.). The

GCAATTGCGCGAAACCACGCTT-3' were used as sequencing primers for parC and parE, respectively.

Construction of ParC and ParE Overexpression Plasmids-The following oligonucleotides were synthesized: N terminus of ParC,

terminus of ParC, 5'-CGAACTGGATTCTCGTTACTCTTCGCTATCA- CCGCTGCTGGC-3'; N terminus of ParE, 5'"I"TACTAACTTAACATAT- GACGCAAACTTAT-3'; C terminus of ParE, 5'-CCAAGGCCAGGATC- CCC'MTAAACCTCAATCTCCGCCATGTC-3'; N terminus of ParC,, 5'- TACTTAAACTACCATATGTACGTGATCATG-3'; and C terminus of ParE,, 5'-GCTTCACTCACTCGAGGATCCGACTCATCGCGTCAGTAC-

5"CCAAGGCCACATATGAGCGATATGGCAGAGCGCCTTGCG-3'; C

GTGATCGTCTTC-3'. These oligonucleotides were used as primers in polymerase chain reactions (PCR) using Kohara phage A506 DNAas the template. The oligonucleotides were designed to introduce a NdeI site a t the translation initiation codon and a BamHI site just downstream of the translation termination codon. The products of the PCRs were di- gested with NdeI and BamHI and ligated with NdeI- and BamHI- digested pET3c DNA (23). The resulting plasmids were named pET3c- parC, pET3c-parCt, pET3c-parE, and pET3c-parEV Overproduction of ParC and ParE proteins was induced by the addition of IPTG to cultures of E. coli BL2l(hDE3)pLysS (23) harboring the plasmids.

Purification of ParC-BL2l(hDE3)pLysS-pET3c-parC was grown at 37 "C in 5 liters of L-broth to ODfiw = 0.5. IPTG was added to 0.4 mM and growth continued for 3 h. Cells were harvested, resuspended in 60 ml of buffer A (50 mM Tris-HCI, pH 7.5 a t 4 "C, 5 mM D'I"I', 1 mM EDTA, and

Top0 N 24483

kDa M 1

200 - - - 116 - 97 - 66 -

45 - ".

2 3 4

D 0

FIG. 2. SDS-PAGE analysis of Pa& and ParE. ParC (lane 1,20 pg of fraction 1; lane 3, 10 pg of fraction 5) and ParE (lane 2, 20 pg of fraction 1; lane 4 , 10 pg of fraction 5) were electrophoresed through a 1 0 0 polyacrylamide gel containing SDS according to Laemmli (26). The gel was stained with Coomassie Brilliant Blue and photographed.

1 0 9 sucrose), frozen in liquid Nz, and stored a t -80 "C. The cell sus- pension was thawed and adjusted to 50 mM Tris-HCI, pH 8.4 a t 4 "C, 20 mM EDTA, 150 mM NaCI, 0.120 Brij, and 0.029 lysozyme. The suspen- sion was incubated for 20 min a t 0 "C and then centrifuged a t 100.000 x g for 1 h. The supernatant (fraction 1, 65 ml, 318 mg) was dialyzed against 3 liters OfbufferAovemight. Insoluble material was removed by centrifugation (leaving 305 mg), and fraction 1 was loaded onto a 30-ml DEAE-cellulose column that had been equilibrated previously with buffer A. The column was washed with 100 ml of buffer A and then developed with a linear gradient (300 ml) of 0-200 mM NaCl in buffer A. ParC (fraction 2a, 50 ml, 120 mg) eluted a t 100 mM NaCI. Fraction 2a was diluted with buffer A to 50 mM NaCl and loaded onto a second DEAE-cellulose column (12 ml). The column was washed with 36 ml of bufferA+ 50 mM NaCI, and ParC (fraction 2b, 10 ml, 72 mg) was eluted with 150 mM NaCl in buffer A. Fraction 2b was applied to a 7.2-ml heparin-agarose column equilibrated with buffer A + 150 mM NaCI. The column was washed with 25 ml of the same buffer and developed with a linear gradient (72 ml) of 150-600 mM NaCl in buffer A. ParC (fraction 3 , 8 ml, 11 mg) eluted a t 400 mM NaCI. Fraction 3 was diluted to 100 mM NaCl with buffer A and applied to a 5-ml column of single-stranded DNA cellulose equilibrated with buffer A + 100 mM NaCI. The column was washed with 15 ml of the same buffer and developed with a linear gradient (50 ml) of 100-300 mM NaCl in buffer A. ParC (fraction 4,2.8 ml, 9 mg) eluted a t 200 mM NaCI. Fraction 4 was then dialyzed against 500 ml of 20 mM KP,, pH 6 .0 , l mM EDTA, 5 mM DTT, and 10% sucrose for 4 h. Precipitated ParC (fraction 5,3.9 mg) was collected by centrifu- gation, dissolved in 1.5 ml of 50 mM Tris-HCI, pH 7.5 a t 4 "C, 1 mM EDTA, 5 mM DTT, 200 mM NaCI, and 30% glycerol, frozen in liquid N2, and stored a t -80 "C. ParC, was purified in a similar fashion.

Purification ofParE-Overexpression (3 liters of cells) of ParE and the initial steps of purification were the same as for ParC through the second DEAE column. Fraction 1 contained 498 mg of protein (33 ml). The first DEAE column was 50 ml. ParE eluted a t 110 mM NaCI. Frac- tion 2a contained 222 mg of protein (38 ml). The second DEAE column was 20 ml, fraction 2a was diluted to 65 mM NaCl before applying, and ParE (fraction 2b, 15 ml, 104 mg) was eluted with 100 mM NaCI. Frac- tion 2b was diluted with buffer A to 50 mM NaCl and loaded on to a 10 ml heparin-agarose column equilibrated with buffer A + 50 mM NaCI. The column was washed with 30 ml of buffer A and eluted with a linear gradient (100 ml) of 50-500 mM NaCl in buffer A. ParE (fraction 3, 17 ml, 76 mg) eluted a t 200 mM NaCI. Fraction 3 was adjusted to 1 M NaCl and applied to an 18-ml hydroxylapatite column equilibrated in buffer A+ 1 M NaCI. The column was washed with 54 ml of the same buffer and developed with a linear gradient (180 ml) of 0-500 mM (NH4),S04 in buffer A + 1 M NaC1. Fraction 4 (22 ml, 37 mg) eluted a t 200 mM (NH4),S04. Fraction 4 was dialyzed against buffer B (50 mM Tris-HC1, pH 7.5 a t 4 "C, 1 mM EDTA, 5 mM DTT, and 20% glycerol) overnight and then applied to an 11-ml Sigma Brown 10-agarose column equilibrated in buffer B. The column was washed with 35 ml of buffer B and then developed with a linear gradient (100 ml) of 0-1 M NaCl in buffer B. ParE (fraction 5) eluted a t 190 mM NaCI. Fraction 5 (15 ml, 12.4 mg)

Top0 IV-catalyzed relaxation of superhelical DNA. Standard reaction FIG. 3. Relaxation and decatenation activities of Top0 TV. A,

mixtures containing either no enzyme (lane I ) , 1.8 pmol of ParC (lane 2~,4.3pmolofParE~lane3~,or0.035,0.07,0.14,0.28,0.56,or1.1pmol of Top0 IV (lanes 4-9, respectively), were incubated, processed, and analyzed as described under "Materials and Methods." I , I ' , I I , and III indicate the positions of form I, form 1'. form 11, and form 111 DNA, respectively. Under these gel electrophoresis conditions, the mobility of form I' and form I1 are very similar. B, Top0 IV-catalyzed decatenation of kinetoplast DNA. Standard reaction mixtures containing either no enzyme (lane 1 ), or 17.5, 35, 70, or 140 fmol of Top0 IV (lanes 2 5 , respectively) were incubated, processed, and analyzed as described un- der "Materials and Methods."

was dialyzed overnight against 2 liters of 50 mM Tris-HCI, pH 7.5 a t 4 "C, 1 mM EDTA, 5 mM D'M', 100 mM NaCI, and 30%- glycerol, frozen in liquid Nz, and stored a t -80 "C. ParE, was purified in a similar fashion.

Superhelical DNA Relaxation Assay-Standard reaction mixtures (20 pl) containing 40 mM Tris-HCI, pH 7.5 a t 30 "C, 6 mM MgC12, 10 mM D'M', 1 mM spermidine HCI, 20 mM KCI, 1 mM ATP (unless indicated otherwise), 50 pg/ml bovine serum albumin, pBS+/- DNA(200 fmol), 10 mM NaCl introduced from the Top0 IV diluent, and the indicated amounts of Top0 IV were incubated a t 37 "C for 30 min. The reaction was terminated by the addition of EDTA to 50 mM. After an additional 1-min incubation a t 37 "C, SDS and proteinase K were added to 1%- and 50 pg/ml, respectively, and then the incubation was continued for 15 min a t 37 "C. One-fifth volume of a loading dye was then added, and the reactions were analyzed by electrophoresis through a 1.4% agarose gel at either 3.5 V/cm for 12 h or 6.5 V/cm for 5 h using 50 mM Tris-HCI, pH 7.9 at 23 "C, 40 mM NaOAc, and 1 mM EDTA as the electrophoresis buffer. When used, norfloxacin and nalidixic acid were dissolved in 10 mM NaOH and diluted with 1 mM NaOH. Coumermycin AI was dis- solved in dimethyl sulfoxide and diluted with 10% dimethyl sulfoxide so as to introduce only 0.5% dimethyl sulfoxide to the reaction mixture. The sodium salt of novobiocin was dissolved in HzO. Top0 IV was re- constituted by mixing ParC and ParE a t roughly equivalent molar amounts in their storage buffers and incubating a t 0 "C for 30 min.

Decatenation of Kinetoplast DNA-Standard reaction mixtures (20 pl) containing 40 mM Tris-HCI, pH 7.5 a t 30 "C, 6 mM MgCI2, 10 mM Dl", 100 mM potassium glutamate, 40 p~ ATP (unless indicated other- wise), 50 pg/ml bovine serum albumin, kDNA (ToPoGene, 300 ng), 10 mM NaCl introduced from the Top0 IV diluent, and the indicated amounts of Top0 IV were incubated a t 37 "C for 30 min. The reactions were terminated, processed, and analyzed as described for the super- helical DNA relaxation assay, except that electrophoresis was through 1.2% agarose gels.

DNA Cleavage-pTH101 form I DNA(24) was linearized by digestion with XhoI and treated with calf intestinal phosphatase to remove the terminal 5'-phosphates. The DNA was then end-labeled using T4 poly- nucleotide kinase and [y-"PJATP. The labeled DNA was digested with EcoRI, which cleaves the DNA asymmetrically, producing one fragment of 2.8 kb that is not labeled and two fragments of 1 and 0.2 kb that are

24484 Top0 N

80

U a, m & 60

v

c.

c m 0 a, n a, 40 2 I

c)

-0 v)

; 20

FIG. 4. ATP requirement for Top0 IV-catalyzed relaxation and decatenation. A, ATP requirement during Top0 IV-catalyzed relaxation of superhelical DNA. Standard reaction mixtures containing either no enzyme (lane 1 ) or 0.7 pmol of Top0 IV (all other lanes) and either no ATP (lane 2 ) or 0.05, 0.1, 0.25, 0.35, 0.5, 1.0, 1.5 , or 2 mM ATP (lanes 3-11, respectively) were incubated, processed, and analyzed as described under "Materials and Methods." The negative of the photograph of the gel was scanned with a Millipore BioImage Densitometer and the extent of relaxation determined ( C ) . B, ATP requirement during Top0 IV-catalyzed decatenation of kinetoplast DNA. Standard reaction mixtures containing either no enzyme (lane 1 ) or 140 fmol of Top0 IV (all other lanes) and either no ATP (lane 2) or 1.25, 2.5, 5, 10, 20, 40, or 80 PM ATP (lanes 3-9, respectively) were incubated, processed, and analyzed as described under "Materials and Methods." The negative of the photograph was scanned and the extent of decatenation determined (D).

labeled uniquely a t one end. The 1-kb fragment was recovered after electrophoresis through a 5% polyacrylamide gel (20:l acrylamide to bisacrylamide). DNA cleavage reactions (20 pl) containing 40 mM Tris- HCI, pH 7.8 a t 37 "C, 3 mM MgC12, 10 mM D m , 1 mM ATP, 25 pg/ml bovine serum albumin, DNA fragment (2 fmol), and either Top0 IV (40 fmol) or DNA gyrase (40 fmol) were incubated at 37 "C for 5 min. Norfloxacin was then added to 0.5 mM followed by an additional incu- bation a t 37 "C for 3 min. SDS was then added to 1% and the incubation continued for 2 min. EDTA and proteinase K were then added to 25 mM and 100 pg/ml, respectively, and the incubation continued for 15 min. Following extraction with a phenoVchloroform (1:l) mixture, the DNA fragments were recovered by ethanol precipitation, dissolved in a de- naturing loading dye, and electrophoresed through a 6% polyacrylamide (19:l acrylamide to bisacrylamide) sequencing gel. The cleavages were compared with a dideoxy sequence ladder generated by double-stranded DNA sequencing using the oligonucleotide 5'-TCGAGGCCGCGAT- TAAA?TCCAAC-' as a primer. The 5'-end of this oligomer is identical to the labeled 5'-end of the 1-kb fragment used for the cleavage reactions.

Determination of Stokes Radius-The indicated proteins (100 pg)

were equilibrated with buffer C (25 mM Tris-HC1, pH 7.5 a t 4 "C, 100 mM NaCI, 0.5 mM EDTA, and 2.5 mM D m ) + 10% glycerol for 1 h a t 0 "C before loading onto a 25-ml Pharmacia LKB Biotechnology Inc. fast protein liquid chromatography Superose 6 column equilibrated with buffer C + 10% glycerol. The column was developed with the same buffer a t a flow rate of 0.4 mumin. Fractions (200 pl) were collected and Top0 N assayed as described above. Kav was calculated, and Stokes radii were determined from a least squares plot of the K,, of the stan- dard proteins versus their Stokes radii.

Determination of Sedimentation Constants-The indicated proteins (100 pg) were equilibrated in buffer C + 10% glycerol for 1 h a t 0 "C before loading onto linear gradients (5 ml) of 2040% glycerol in buffer C. Gradients were centrifuged at 45,000 rpm in a Beckman SW 50.1 rotor for 18 h a t 4 "C. Fractions (160 p1) were collected from the bottom of the tubes. The polypeptides present were analyzed by SDS-PAGE, and Top0 IV activity was assayed as described above. Sedimentation coefficients were determined from a least squares plot of the elution position of the standard proteins versus their sedimentation coeffi- cients.

Top0 N

RESULTS

Purification of Topoisomerase N-In order to develop a plen- tiful source for Top0 IV purification, E. coli strains overexpress- ing ParC and ParE via the transient T7 RNA polymerase ex- pression system of Studier (23) were constructed. Primers were synthesized based on the DNA sequences reported forparC and parE by Kat0 et al. (4) and used for PCR (with the Vent poly- merase) to amplify parC and parE and to add NdeI sites over- lapping the translation start codons and BamHI sites just downstream of the termination codons. The PCR products were digested with NdeI and BamHI and ligated with similarly di- gested pET3c DNA (23). IPTG induction of cultures of BLBl(DE3)pLysS carrying the resulting plasmids, pET3c- pa&, and pET3c-parE,, resulted in the overproduction of poly- peptides with apparent molecular masses of 88 kDa (ParC,) and 75 kDa (ParE,), respectively (data not shown). ParC, and ParE, were purified (see Fig. 11) as described under "Materials and Methods"; however, no topoisomerase activity could be de- tected under any conditions when these two proteins were com- bined (see Fig. 10).

A reason for the failure of combinations of ParC, and ParE, to yield topoisomerase activity was suggested by the studies of Luttinger et al. (20) and Springer and Schmid (25) that showed differences in the nucleotide sequences between the Salmo- nella and E. coli parC and parE, respectively. These single nucleotide insertions cause the Salmonella parC and parE open reading frames to be longer on the 5'- and 3'-ends, respec- tively, then reported for their E. coli counterparts.

Accordingly, oligonucleotides were synthesized composed of internal DNA sequences ofparC and parE (see "Materials and Methods") and used to determine the nucleotide sequence up- stream of the 5'-end of parC and downstream of the 3'-end of parE. Chromosomal DNA derived from A phage 506 from the Kohara collection (22). which carries the parCEF region, was used as a template. This analysis (Fig. 1A) demonstrated that the parC nucleotide sequence should read, starting a t position 54 of Kat0 et al. (4), GCT and not GT, and that the parE nucleotide sequence should read, starting at position 1855 of Kat0 et al. (4), AGC and not AC. These nucleotide insertions increase the parC open reading frame by 22 amino acids on the N terminus and theparE open reading frame by 29 amino acids on the C terminus compared with that reported by Kat0 et al. (4) (Fig. 1B ). In addition, the nucleotide insertion in parC alters the predicted position of the -35 and -10 promoter sequences and the Shine-Dalgarno sequence (Fig. 1B).

New pET3c clones were constructed using PCR with primers derived from the corrected sequences. These clones, pET3c- parC and pET3c-parE, complemented the temperature-sensi- tive growth defect of the Salmonella typhimurium strains SE7784 (parC281) and SE5206 (parE206), respectively. When synthesis of the T7 RNA polymerase was induced by the addi- tion of IPTG to cultures of E. coli (ADE3)pLysS carrying the overexpression plasmids, polypeptides with apparent molecu- lar masses of 88 and 78 kDa were overexpressed in the strains carrying the parC and parE plasmids, respectively (Fig. 2). This agrees very closely with the calculated molecular masses of 83.7 and 70.2 kDa for ParC and ParE, respectively.

ParC and ParE were purified from 5 and 3 liters, respec- tively, of induced culture. Because of the extreme overproduc- tion, SDS-PAGE was used as an assay for purification. ParC was purified from the crude lysate by fractionation on DEAE- cellulose (twice), heparin-agarose, and single-stranded DNA cellulose columns, followed by an isoelectric precipitation. ParE was purified from the crude lysate in an identical fashion as ParC through the heparin agarose step, followed by chroma- tography on hydroxylapatite and a dye column. The final frac-

A ' l 2 3 4 5 6 7 8 9 1 0 1 1 1 2

2 3 4 5 6 7 8 9 1 0 1 1 12

FIG. 5. Nucleot ide requirements for Top0 IV-catalyzed relax- ation and decatenation. A, relaxation. Standard rractlon mixtures containing either no cnzyme ( lane I ) or 0.56 pmol of Topo rV (all other lanes) and either no nucleotide (lane 2) or (all at 1 m\I) ATP, GTP, CTP, UTP. dATP, dGTP, dCTP, TTP, ATPyS, or AMP-PNP (lanes 3-12, respec- tively) were incubated, processed, and analyzed as described under "Materials and Methods." B, decatenation. Standard reaction mixtures containing either no enzyme (lane I ) or 140 fmol of Top0 IV (all other lanes) and either no nucleotide (lane 2 ) or (all a t 1 mM) ATP, GTP, CTP, UTP, dATP, dGTP, dCTP, TTP,ATPyS, or AMP-PNP (lanes 3-11, respec- tively) were incubated, processed, and analyzed as described under "Materials and Methods."

tions were greater than 95% homogeneous for single bands on SDS-PAGE (Fig. 2). The two successive fractionations on DEAE-cellulose were required to ensure complete removal of Top0 I and Top0 111, neither of which binds to this resin, from the ParC and ParE preparations.

The truncated forms of ParC and ParE and ParC, and ParE,, respectively, were purified in an identical fashion (data not shown). As described below, these proved useful in analyzing the subunit interactions of Top0 IV.

Characterization of Topoisomerase NActivity-As described by Kat0 et al. (5), Top0 IV superhelical DNA relaxation activity required both ParC and ParE (Fig. 3A). The Mg2+ optimum for this reaction was 6-10 mM (data not shown). Top0 IV relaxation activity was stimulated slightly by low concentrations of mono- valent salt, although it was inhibited a t 60-80 mM KC1 or 140-160 mM potassium glutamate (data not shown). The spe- cific activity of our preparation of Top0 IV was 25,000 unitslmg, where 1 unit was defined as the amount of enzyme required to relax 50% of the form I DNA present in the reaction in 30 min a t 37 "C.

Top0 IV was capable of decatenating kinetoplast DNA (Fig. 3B). The specific activity of Top0 IV in this reaction was 45,000 unitsJmg, where 1 unit was defined as the amount of enzyme required to completely decatenate 50% of the kinetoplast DNA present in the reaction in 30 min a t 37 "C.

The [ATPlIl2 for relaxation was 0.45 mM, whereas the [ATP]112 for decatenation was only 17 VM (Fig. 4). It is not clear whether this reflects the existence of two distinct ATP binding sites on the enzyme, one for relaxation and one for decatena- tion, or differential activation of a single ATP binding site by DNA bound to the enzyme in two distinct modes, one inducing relaxation and one inducing decatenation. Top0 IV required ATP hydrolysis for activity (Fig. 5).

Of all the dNTPs and NTPs a t a concentration of 1 mM, only ATP or dATP could support relaxation and decatenation (Fig. 5). The other NTPs and dNTPs could not support relaxation,

24486 Top0 N

A ' 1 2 3 4 S 6 7 8 9 10 11 12 13

FIG. 6. Inhibit ion of Top0 IV-catalyzed relaxation by quino- lones and coumarins. A, inhibition by norfloxacin and coumermycin. Standard reaction mixtures containing either no enzyme (lane 1) or 280 fmol of Top0 IV (all other lanes) and either no antibiotic (lanes 2 and 8) or 7.8, 15.6,31.3, 62.5, or 125 p~ norfloxacin (lanes 3-7, respectively) or 22.5,45,90,180, or 360 nM coumermycin (lanes 9-13, respectively) were incubated, processed, and analyzed as described under "Materials and Methods." B, inhibition by novobiocin. Standard reaction mixtures con- taining either no enzyme (lane 1 ) or 280 fmol ofTopo IV (all other lanes) and either no antibiotic (lane 2 ) or 0.31, 0.63, 1.25, 2.5, 5, or 10 p~ novobiocin were incubated, processed, and analyzed as described under "Materials and Methods." C, inhibition by nalidixic acid. Standard re- action mixtures containing either no enzyme (lane 1) or 280 fmol ofTopo IV (all other lanes) and either no antibiotic (lane 2) or 0.1, 0.21, 0.43, 0.85, 1.7, or 3.4 mM nalidixic acid were incubated, processed, and ana- lyzed as described under "Materials and Methods."The negatives of the photograph shown here were scanned and analyzed as described in the legend to Fig. 4 to determine the [I l ln (Table I).

T ~ L E I Comparison of inhibition of Top0 N and gyrase by quinolones and

coumarins The D l l n values for Top0 IV were derived from the data shown in Fig.

6.

Antibiotic 111112

Top0 IV Gyrase

Norfloxacin 56 p~ 1.8 p ~ " Nalidixic acid 270 p~ 110 PMh Coumermycin 34 nM 4 nMC Novobiocin 2.7 p~ 6 1 6 0 nMd

a Shen and Pernet (30). Sugino et al. (28). Sugino et al. (31). Gellert et al. (29) and Higgins et al. (32).

even when present a t a concentration of 10 mM (data not shown).

Top0 IV activity is inhibited by the quinolones and coumarins (5), previously thought to target only gyrase (27,29). Inhibition by norfloxacin, nalidixic acid, coumermycin, and novobiocin of Top0 IV was compared with the previously determined values for gyrase (Fig. 6 and Table I). Gyrase was consistently more sensitive to the antibiotics than Top0 IV. The range of difference in the concentration of antibiotic required for 50% inhibition of activity ([Ill/2) varied considerably. For example, gyrase-cata- lyzed relaxation was 30-fold more sensitive to norfloxacin, but only 2.5-fold more sensitive to nalidixic acid than Top0 IV- catalyzed relaxation (Table I). 125 PM norfloxacin stimulated Top0 IV-catalyzed DNA cleavage by %fold (determined by den- sitometric analysis of the linear DNA present in lanes 2 and 7, Fig. 6). There was a considerable difference in the [I]llz of

A. 1 2 3 G A C T 4 5

rn m

B TG?CGGGCAA;ICAGGTGCGA,Cl/?TCTATCIGA? g y r

I I I V

I GTATGGGAAGCCCGAT~$GCCAGAG~~G~CT I I I I I gyr I V

I I I

TACAGA+G+ATGG;I;CAGACTAAACTGGCTGAC gyr I V

I V

Q Y f

FIG. 7. Comparison of Top0 IV- and gyrase-catalyzed cleavage of DNA. A, DNA cleavage. A detailed description of the experiment can be found under "Materials and Methods." Lanes 1-5 contained DNA fragment and either no enzyme (lane 1 ), Top0 IV (lanes 2 and 3), or gyrase (lanes 4 and 5 ) and either no norfloxacin (lanes 1,2, and 5 ) or 0.5 mM norfloxacin (lanes 3 and 4 ) . The sequence ladder (G, A, C, T) was generated as described under "Materials and Methods." The arrows mark the limits of the DNA sequence shown in B. B, alignment of DNA cleavages along the nucleotide sequence. Bars above and below the sequence indicate cleavages sites and the length of the bar approxi- mates the relative cleavage intensity. Bars above the sequence repre- sent Top0 IV-catalyzed cleavages, and bars below the sequence repre- sent gyrase-catalyzed sequences. The limits of the sequence shown correspond to nucleotides 243-392 of the kanamycin gene-resistant block (Pharmacia).

novobiocin between Top0 IV and the values published for gy- rase (29,321. However, in our hands, the [IIln for novobiocin for gyrase was 1 p ~ . This value is more in range with the others reported in Table I. The of norfloxacin and coumermycin during Top0 N-catalyzed decatenation of kDNA was 40 p~ and 36 nM, respectively (data not shown).

Topoisomerase action is characterized by binding of the to- poisomerase to the DNA followed by the establishment of a

Top0 N 24487

TABLE I1 Physical characteristics of the Par proteins

Protein Stokes radius S value u= M,, M,,,

calculatedb determined fifo‘

A 10-13 s ParC 57.5 7.5 0.742 83,712 189,150 1.51 ParC, 57.5 7.5 0.742 81,237 189,150 1.51 ParE 40.7 3.7 0.739 70,239 65,300 1.52 ParE, 37.2 3.7 0.739 66,768 59,700 1.43

a Partial specific volume, determined as described by Cohn and Edsall(35).

Top0 Iv 65.3 11.3 0.741 307,902d 321,800 1.46

Calculated molecular weight based on the amino acid sequence translated from the respective open reading frame. Frictional ratio calculated from the equation flf, = a + (3 vM/47~N)l’~, where a = Stokes radius, M = molecular weight, u = partial specific

volume, and N = Avogadro’s number. Calculated for ParCzParEa

cleavage-religation equilibrium (33). Denaturation of the topoi- somerase when it is bound to the DNA causes cleavage of the DNA. The extent of cleavage reflects the equilibrium constant for the cleavage-religation reaction. When such a cleavage ex- periment is performed on uniquely end-labeled DNA, the pat- tern of bands observed on denaturing gels reflects the binding site preference of the topoisomerase. Because Top0 IV and gy- rase share significant sequence homology, it was of interest to determine if they shared DNA binding sequences as well.

Both Top0 IV and gyrase were incubated with a 1-kb-long DNA fragment labeled only a t one 5’-end. DNA cleavage was induced by the addition of 1% SDS in the presence or absence of 0.5 mM norfloxacin. The cleaved DNA was recovered by etha- nol precipitation and electrophoresed through a sequencing gel. Also included on the gel was a dideoxy sequencing ladder gen- erated from an oligonucleotide whose 5’-end coincided with the position of the 5’-end label on the DNA fragment. DNA cleavage by both enzymes was stimulated by norfloxacin (Fig. 7A). Many of the cleavage sites of gyrase and Top0 IV clearly overlapped, although site preference was distinct for the two enzymes. A summary of the cleavage sites for both enzymes in a 150- nucleotide-long stretch is shown in Fig. 7B.

Physical Properties of ParC, ParE, and Top0 N-The behav- ior of ParC, ParE, and Top0 IV during gel filtration and sedi- mentation through glycerol gradients was examined (Figs. 8,9, 11, and Table 11). ParC, ParE, and Top0 IV gave single peaks during sedimentation through glycerol gradients (Fig. 8 A ) and gel filtration through a Superose 6 column (Fig. 11). Because Top0 IV was reconstituted with a slight molar excess of ParE over ParC, two peaks are evident in these profiles, the leading peak corresponding to Top0 IV and the trailing peak to excess ParE. Superhelical DNArelaxation activity co-sedimented with the leading peak during glycerol gradient sedimentation (Fig. 8B) and co-eluted with the leading peak during gel filtration (Figs. 9A and 11). These data were used to determine the sedi- mentation coefficients (Fig. 8D) and Stokes radii (Fig. 9C) of ParC, ParE, and Top0 IV.

The equations of Siege1 and Monty (34) were then used to calculate the native molecular weights and frictional coeffi- cients of ParC, ParE, and Top0 IV (Table 11). The molecular weight of ParC was consistent with the existence of the protein as a homodimer in solution. However, the molecular weight of ParE indicated that the protein was a monomer in solution. A similar analysis has not been reported for gyrase; however, protein cross-linking studies suggest that GyrA is a dimer, whereas GyrB is a monomer (36). The molecular weight of Top0 IV was consistent with the existence of the protein as a hetero- tetramer, ParC2ParE2, in solution. Additional evidence in sup- port of this conclusion was that the molar ratio of ParC to ParE was 1.1:l across the peak of active Top0 IV during sedimenta- tion and 1.2:l across the peak of active Top0 IV during gel

filtration. This was determined by densitometric analysis of the negatives of photographs of Coomassie Blue-stained SDS-poly- acrylamide gels of the polypeptides present in the active frac- tions after sedimentation (Fig. 8C) and gel filtration (Fig. 9B).

The N Terminus of ParC and the C Terminus of ParE Are Required to Form the Heterotetramer-The truncated forms of ParC and ParE, ParC, and ParE,, respectively, did not combine to give Top0 N activity (data not shown), nor would they give active Top0 IV when combined with their respective full-length partner (e.g. ParC, with ParE), even when the truncated form was in 10-fold excess over the full-length partner (Fig. 10). Since active Top0 IV was a heterotetramer, the possibility that ParC, and ParE, failed to associate to form the heterotetramer was investigated. This proved to be the case.

The Superose 6 gel filtration profiles of ParC,, ParE,, and a mixture of ParC, and ParE, are shown in Fig. 1L4 compared with those of the full-length proteins. It is evident that the truncated proteins failed to associate to form the hetero- tetramer. Additional support for this comes from an examina- tion of the polypeptide composition in fractions taken during gel filtration of the mixture of ParC, and ParE, (Fig. 11B). This shows no evidence of co-elution of ParC, and ParE,, unlike the case when ParC and ParE are mixed together (Fig. 9B). Nei- ther could any association be detected between ParC, and Pa- rE, and their respective full-length partners by gel filtration (Fig. 11, C and D).

Although ParC, and ParE, could not associate to form the heterotetramer, their native form in solution was the same as for their intact counterparts, i.e. ParC, was a homodimer and ParE, was a monomer (Table 11).

DISCUSSION

In the course of preparing strains overexpressing ParC and ParE, the subunits of Top0 IV (4,5), we found that ParC was 22 amino acids longer on the N terminus and ParE was 29 amino acids longer on the C terminus than reported originally (4). The additional amino acids proved critical in each instance. Trun- cated forms of these proteins (based on the original sequence) failed to combine to give Top0 IV activity. In addition, the single nucleotide insertion inparC changes significantly the predicted position of the promoter (Fig. 2). As reported by Kat0 et al. (51, both ParC and ParE were

required to reconstitute Top0 IV activity. (It should be noted that the clones used by Kat0 et al. (5) to express ParC and ParE carried considerable flanking sequence on both sides of the genes.) We have shown here that Top0 IV activity requires either ATP or dATP, no other NTP or dNTP can substitute, and that activity requires nucleotide hydrolysis. The for relaxation of superhelical DNA was %-fold greater than that for decatenation of kinetoplast DNA. The meaning of this is not

24488 Top0 N

". t

0.20 E

0.05

10 12 14 16 18 20 22 24 26 28 30 Fraction

- 2 6 10 12 14 16 18 20 22 24 26 28

C. k~~ 2 6 10 12 14 16 18 20 22 24 26 28

200 - 116- 97 -

66- ""

"

45 -

r n \+

I I I I I \ I 10 20 30

Fraction FIG. 8. Determination of the sedimentation coefficients for

P a s , ParE, and Top0 IV. A, ParC, ParE, and Top0 IV were sedi- mented through 2040% glycerol gradients as described under "Mate- rials and Methods." Fractions were collected from the bottom. Marker proteins were sedimented in a separate gradient. Shown are the super- imposed protein concentration profiles for ParC, ParE, and Top0 IV. B, 1 pl of a 1:4 dilution of the indicated fractions from the gradient con- taining Top0 IV were assayed for superhelical DNA relaxation activity as described under "Materials and Methods." C, the polypeptides pre- sent in the indicated fractions from the gradient containing Top0 IV were analyzed by SDS-PAGE through a 10% gel (30 pl each fraction). The gel was stained with Coomassie Brilliant Blue and photographed. D, a least squares plot based on the positions of urease (18.6 S , fractions 8 and 5), aldolase (7.3 S, fraction 20). and bovine serum albumin (4.2 S , fraction 24) was used to determine the sedimentation coefficients for Top0 IV, ParC, and ParE. The behavior during sedimentation of ParC, and ParE, was identical to that of ParC and ParE, respectively (data not shown).

clear, but it does suggest that the enzyme is differentially en- gaged by both the DNA and ATP substrates during these reac- tions. In contrast, the K , values for ATP during gyrase-cata-

200 - 116 - 97 - 66 -

"". "_ - ". 45 -

100

80

O S

h

v)

m 3 60

(d (r

$ 40

.-

Y 0 F3

20

0 0.2 0.3 0.4 0.5 0.6 0.7 0.8

Kav FIG. 9. Determination of the Stokes radii of Top0 IV, P a s , and

ParE. A, 1 pl of the indicated fractions from a Superose 6 gel filtration column of Top0 IV (see Fig. 1 L 4 for the protein concentration profile) were assayed for superhelical DNA relaxation activity. B, the polypep- tides present in the indicated fractions from Superose 6 gel filtration of Top0 IV were determined by SDS-PAGE through a 10% gel (40 p1 each fraction). The gel was stained with Coomassie Brilliant Blue and pho- tographed. C, a least squares plot based on the elutjon positions of thyroglobulic ( I f a v = 0.28, 85 A), ferritin (Kay = 0.4, 61 A), aldolase (ICav

chrome c (KaV = 0.71, 10 A) was used to determine the Stokes radii of = 0.5, 48.1 A), bovine serum albumin (K,,, = 0.53, 35.5 A), and cyto-

Top0 IV, ParC, and ParE. The behavior of ParC, was identical to that of ParC. ParE, gel-filtered slightly different from ParE (see Fig. 11).

lyzed supercoiling (31, 37, 38) and decatenation (39) are very similar.

The difference in [ATP]1,2 for Top0 IV-catalyzed relaxation and decatenation and its contrast with the similarity of these values for gyrase may reflect a difference in the organization of and communication between the subunits of the two enzymes. However, parC and parE show considerable homology with gyrA and gyrB (4, 201, respectively. Little is known about the regions of GyrA and GyrB that are required for interaction. I t is known that a C-terminal fragment of GyrB (40) can interact with GyrA to form Top0 11' (41,42). This is consistent with our finding that the C-terminal 29 amino acids of ParE are re- quired for heterotetramer formation.

ParE is monomeric and ParC is dimeric in solution. Thus, Top0 IV may assemble in a stepwise fashion, i.e. ParC2 + ParE - ParC2ParE and ParC2ParE + ParE + ParC2ParE2. Protein- protein cross-linking data in the presence of DNA supports a

Top0 N

1 2 3 4 5 6 7 8 9 1 0 1 1

FIG. 10. P a s , and Pa rE , are inactive. Standard superhelical DNA

2, 4, 6, 8, and 10) or 1.0 pp (lanes 3 , 5 , 7, 9, and 11) of the following reaction mixtures containing either no enzyme (lone 1 ) or 0.1 pg (lanes

protein mixtures: a 1:l molar ratio of ParC, to ParE (lanes 2 and 3) . a 1 O : l molar ratio of ParC, to ParE (lanes 4 and 5 ) , a 1:l molar ratio of ParC to ParE, (lanes 6 and 7). a 1:lO molar ratio of ParC to ParE, (lanes 8 and 9) , or a 1:l molar ratio of ParC to ParE (lanes 10 and 11) were incubated, processed, and analyzed as described under "Materials and Methods."

similar assembly pathway for gyrase (36). Assembly of Top0 IV, however, requires neither DNA or ATP. In addition, ATP does not change the native form of ParE in solution (data not shown). A differential subunit organization between gyrase and Top0 IV seems likely to reflect a difference in their primary task in the cell. Gyrase may be engaged primarily in modulating superhelical density and Top0 IV in the segregation of daughter chromosomes. In support of this, we have shown (48) that al- though Top0 IV can replace gyrase only poorly during oriC DNA replication in vitro with purified proteins, in the same replica- tion system, Top0 IV catalyzes segregation of the daughter molecules 7-10-fold more efficiently than gyrase.

Top0 IV is sensitive to the quinolones and coumarins (5). In general, Top0 IV is less sensitive to these antibiotics than gy- rase. This is certainly true for coumermycin (8.5-fold differ- ence), but less so for nalidixic acid (2.5-fold difference). The difference in the sensitivity of the two enzymes may be suffi- cient to explain why coumermycin-resistant mutants arise only in gyrB (43) and not in parE but seems a less likely explanation as to why nalidixic acid resistant mutants arise only in gyrA and gyrB (44-46) and not in pa&.

It should also be noted that the significance in vivo of com- parisons of the determined in vitro for Top0 IV and gyrase for any particular antibiotic is somewhat problematic. Even in uitro, the activities being compared differ in reaction conditions (e.g. in the concentration of ATP, of which coumermycin and novobiocin are competitive inhibitors (31)) and in the molar ratios of enzyme to substrate required to observe activity.

Sensitivity to nalidixic acid presumably results from the in- ability of replication forks to pass the frozen topoisomerase complex on the DNA. This can also lead to duplex DNA break- age. In nalidixic acid-resistant strains, the Top0 IV should still be sensitive to the antibiotic. Yet these strains grow well in the presence of the drug. This suggests either that the frozen Top0 IV.DNA complex can be bypassed by the replication fork or repaired by a mechanism that does not occur for the gyrase- DNA complex or that Top0 IV access to the chromosome is restricted in some manner.

FIG. 11. ParC, and ParE, do not associate to form the hetero- tetramer. A, protein profiles from Superose 6 gel filtration of the indi- cated proteins or mixtures of proteins. Gel filtration was as described under "Materials and Methods." B, the polypeptides present in the indicated fractions from gel filtration of a mixture of ParC, and ParE, were determined by SDS-PAGE through a 10% gel (40 pl each fraction). The gel was stained with Coomassie Brilliant Blue and photographed. C, analysis, as above, of the polypeptides present in the indicated frac- tions from gel filtration of a mixture of ParC, and ParE. D, analysis, as above, of the polypeptides present in the indicated fractions from gel filtration of a mixture of ParC and ParE,.

B.

kDa

200 - 116 - 97 - 66 -

45 -

C. kDa

200 - 116 - 97 - 66 -

45 -

D. kDa

200 - 116- 97 - 66 -

45 -

2- 8 10 12 14 16 18 20

Eluate(rn1)

- "- " - "-

24490 Top0 N One simple mechanism of restricting access of Top0 IV to the

chromosome might be a competition for binding sites with DNA gyrase. We have shown here that Top0 IV and gyrase cleavage sites overlap considerably, although cleavage site preference varies for the two enzymes. If the affinity of gyrase for the DNA is greater than that of Top0 IV, the latter enzyme may be effectively excluded from a majority of its potential binding sites. This remains to be tested.

Alternatively, Top0 IV action may be restricted to the D pe- riod of the cell cycle (471, when replication has been completed. This would, of course, imply that if expression ofparC andparE is constant throughout the cell cycle, Top0 IV either does not normally, as discussed above, have free access to the chromo- some or Top0 IV activity is modulated post-translationally in a cell cycle-linked manner. On the other hand, Top0 IV expres- sion may itself be cell cycle-dependent.

Acknowledgments-We thank Dr. Molly Schmid for helpful discus- sion, Drs. H. Hiasa and s. Shuman for their critical reading of the manuscript, and Dr. Amy Springer and Molly Schmid for communicat- ing results prior to publication. We also thank David Valentin for the artwork.

REFERENCES 1. Pruss, G . J., Manes, S. H., and Drlica, K. (1982) Cell 31, 3 5 4 2 2. DiNardo, S., Volkel, K. A., Sternglanz, R.. Reynolds, A. E., and Wright, A.

3. Raji, A., Zabel, D. J.. Laufer, C. S., and Depew, R. E. (1985) J . Bacterid. 162,

4. Kato, J., Nishimura, Y., Imamura, R., Niki, H., Hiraga, S., and Suzuki, H.

5. Kato, J., Suzuki, H., and Ikeda, H. (1992) J . Biol. Chem. 267.2567625684 6. DiGate, R. J.. and Marians, K. J. (1988) J. Biol. Chem. 263, 1336613373 7. Saporito, S. M., Smith-White, B. J. , and Cunningham, R. P. (1988) J. Bacteriol

(1982) Cell 31 43-51

1173-1179

(1990) Cell 63,393404

170, 45424547 8. Schofield, M. A,, Agbunag, R., Michaels, M. L., and Miller, J. H. (1992) J.

Bacteriol., 174, 5168-5170

10. Fainveather, N. F., On; E., and Holland, I. B. (1980) J. Bacterid. 142, 153-161

12. Filutowicz, M.. and Jonczk, P. (1982) Mol. & Gen. Genet. 191, 282-287 11. Filutowicz, M. (1980) Mol. & Gen. Genet. 177,301-309

13. Kreuzer, K. N., and Cozzarelli, N. R. (1979) J. Bacteriol. 140, 424435 14. Steck, T. R., and Drlica, K. (1984) Cell 36, 1081-1088 15. Kato, J.-I., Nishimura, Y., and Suzuki, H. (1989) Mol. & Gen. Genet. 217,

9. DiGate, R. J., and Marians, K. J. (1992) J. Biol. Chem. 267,20532-20535

178-181

16. Hussain, K., Begg, K. J., Salmond, G. P. C., and Donachie, W. D. (1987) Mol.

17. Hussain. K. Elliot, E. J., and Salmond, G. P. C. (1987) Mol. Microbiol. 1,

18. Kato, J.-I., Nishimura, Y., Yamada, M., Suzuki, H., and Hirota, Y (1988) J.

20. Luttinger, A. L., Springer, A. L., and Schmid, M. B. (1991) New Biol. 3,687497 19. Schmid, M. B. (1990) J. Bacteriol. 172, 5416-5424

21. Adams, D. E., Shekhtman, E. M., Zechiedrich, E. L., Schmid, M. B., and

22. Kohara, Y., Akiyama, K., and Isono, K. (1987) Cell 50, 495-508 23. Studier, W. F., Rosenberg, A. H., and Dunn, J . J . (1990) Methods Enzymol. 185,

24. Hill, T. M., Pelletier, A. J., Tecklenburg, M., and Kuempel, P. L. (1988) Cell 55,

26. Laemmli, U. K. (1970) Nature 227,680-685 25. Springer, A., and Schmid, M. B. (1993) Nucleic Acids Res. 21, 1805-1809

27. Gellert, M., Mizuuchi, K., ODea, M. H., Itoh, T., and Tomizawa, J.-I. (1977)

28. Sugino, A., Peebles, C. L., Kreuzer, K. N., and Cozzarelli, N. R. (1977) Proc.

29. Gellert, M., ODea, M. H., Itoh, T., and Tomizawa, J.4. (1976)Proc. Natl. Acad.

30. Shen, L. I., and Pernet, A. G. (1985) Proc. Natl. Acad. Sci. U. S. A. 74, 4767-

Microbiol. 1, 73-81

259-273

Bacteriol. 170, 3967-3977

Cozzarelli, N. R. (1992) Cell 71, 277-288

60-8s

459466

Proc. Natl. Acad. Sci. U. S. A. 74, 47724776

Natl. Acad. Sei. U. S . A. 74, 4767-4771

Sci. V. S. A. 73, 4474-4478

4771 31. Sugino, A,, Higgins, N. P., Brown, P. O., Peebles, C. L., and Cozzarelli, N. R.

(1978) Proc. Natl. Acad. Sci. U. S. A. 75. 48384842 ~ ,~

32. Higgins, N. P., Peebles, C. L., Sugino, A., and Cozzarelli, N. R. (1978) Proc.

33. Been, M. D., and Champoux, J. (1981) Proc. Natl. Acad. Sci. U. S.A. 78,

34. Siegel, L. M., and Monty, K. J. (1966) Biochim. Biophys. Acta 112, 346-362 35. Cohn, E. J., and Edsall, J. T. (1943) Proteins, Amino Acids and Peptides,

37. Staudenbauer, W., and Om, E. (1981) Nucleic Acids Res. 9,3589-3603 36. Klevan, L., and Wang, J. C. (1980) Biochemistry 19,5229-5234

38. Maxwell, A,, and Gellert, M. (1984) J. Biol. Chem. 259, 14472-14480 39. Marians, K. J . (1987) J. Biol. Chem. 262, 10362-10368 40. Adachi, T., Mizuuchi, K., Menzel, R., and Gellert, M. (1984) Nucleic Acids Res.

41. Brown, P. O., Peebles, C. L., and Cozzarelli, N. R. (1979) Proc. N d . Acad. Sci.

42. Gellert, M., Fisher, L. M., and ODea, M. H. (1979) Proc. Natl. Acad. Sci.

43. Ryan, M. J. (1976) Biochemistry 15, 3769-3777 44. Goss, W. A., Deitz, W. H., and Cook, T. M. (1965) J. Bacterid. 89, 1068-1074 45. Staudenbauer, W. L. (1976) Eul: J . Biochem. 62,491-497 46. Maxwell, A. (1992) J. Antimicrob. Chemothel: 30, 409-414 47. Helmstetter, C. E. (1987) in Escherichia coli and Salmonella typhimurium

(Neidhardt, F. C., Ingraham, J. L., Low, K. B., Magasanik, B., Scheckter, M., and Umbarger, H. E., eds) pp. 1595-1605, American Society of Microbiology, Washington, D. C.

~~

Natl. Acad. Sci. U. S. A. 75, 1773-1777

2883-2887

Academic Press, New York

12,63894395

U. S . A. 76, 6110-6114

U. S. A. 76,62894293

48. Peng, H., and Marians, K. J. (1993) Proc. Natl. Acad. Sci. U. S. A., in press