Supplemental Information
Fig. S1
Fig. S1. Sequence Alignment of TAR1 and Twenty-three TAR1-related Proteins.
The alignment was used to produce the NJ phylogenetic tree shown in Fig 2A. All
proteins contain a single AP2 domain at their N termini, as shown in box, except three
AP2 transcription factors (AaORA, AaERF1 and AaERF2) of Artemisia annua.
Conserved amino acid residues are highlighted with asterisks. The accession numbers
used are as follows: At1g15360_WIN1 and At5g25390_SHINE3 from Arabidopsis;
Ga_EPS65581 Genlisea aurea; Pd_XP008792041 from Phoenix dactylifera;
Cc_XP006427266 from Citrus clementina; Hv_NP001148685 from Hordeum
vulgare; Zm_NP001148685 from Zea mays; Cs_XP006465341 from Citrus sinensis;
Jc_KDP32410 from Jatropha curcas; Sb_04g006970 from Sorghum bicolor;
Pm_XP008243869 from Prunus mume; BnaA08g23880D from Brassica napus;
Si_XP004951533 from Setaria italica; Cm_XP008466408 Cucumis melo;
Rc_XP002524500 Ricinus communis; Vv_XP002268413 from Vitis vinifera;
Os02g0202000 from Oryza sativa Japonica Group; Tu_EMS56658 from Triticum
urartu ; Gm_XP006594272 from Glycine max; Pt_XP002324652 from Populus
trichocarpa ;Mt_XP003609337 from Medicago truncatula; AaORA(JQ797708),
AaERF1 (JN162091) and AaERF2 (JN162092) from A. annua.
Fig. S2
Fig. S2. Nucleotide Sequence of the Cloned TAR1 Promoter with Putative cis-
acting Regulatory Elements Shown.
The putative transcription start site is red and bold. The TATA box is in bold and
underlined, and the CAAT box sequence is boxed. The important putative cis acting
regulatory elements are under different background color. Numbers indicate the
position relative to the transcription start site.
Fig. S3
Fig. S3. Analysis of Transgenic A. annua Plants by PCR.
(A-B) PCR analysis of TAR1-RNAi transgenic A. annua DNA using JDPDK 1R
reverse primer and JDPDK F forward primer in pC1300-pHANNBIAL.
(C-D) PCR analysis of pTAR1-GUS transgenic A. annua DNA using TAR1pro forward
primer and GUS-R reverse primer.
(E-F) PCR analysis of pTAR1:TAR1-GFP transgenic A. annua DNA using TAR1-F
forward primer and GFP-R reverse primer. Numbers (1-n): different lines, M: DNA
size marker DL2000, N: wild type (untransformed), P: positive control.
Fig. S4
Fig. S4. Identification of Transgenic A. annua Plants.(A) The reduced transcript level of the TAR1 gene in TAR1-RNAi lines by
semiquantitative RT-PCR. Actin was used as a control for normalization. Each line is
identified with three technical repeats.
(B) qRT-PCR analysis of TAR1 expression in different TAR1-RNAi lines. Actin was
used as a control for normalization. Each data point is the average of three technical
repeats and the results were consistent in three biological replicates. Error bars
indicate SD.
(C) qRT-PCR analysis of TAR1 expression in different TAR1-overexpressing lines.
Actin was used as a control for normalization. Each data point is the average of three
technical repeats and the results were consistent in three biological replicates. Error
bars indicate SD.
Fig. S5
Fig.S5. Chromatogram Result of TAR1-RNAi Transgenic Plant by Electrospray
LC-MS/MS.
The extracted peak identification: (A) artemisinin, (B) artemisinic acid and (C)
dihydroartemisinic acid. This chromatogram is the result of RNAi-13 transgenic line.
Fig. S6
Fig.S6. The Typical Total Ions Current Chromatograms (TICs) of Derivatized
Cuticular Waxes Extracted from Leaves of TAR1-RNAi Plants.
The main components of total cuticular waxes (C20-alkane and C20, C16, C18-fatty
acid) and internal standard (C23-alkane) in the box is detail showed upon the whole
chromatogram. (A) Wild type; (B) RNAi-13 transgenic line; (C) RNAi-14 transgenic
line; (D) RNAi-18 transgenic line.
Fig. S7
Fig.S7. SDS-PAGE Analysis of Purified TAR1 from The Recombinant
Bacterium.
SDS-PAGE was performed on a 10% gel. lane 1, 10 μl solution of proteins in
precipitation from recombinant bacterium; lane 2, 10 μl supernatant proteins solution
from recombinant bacterium before purified; lane 3, 10 μl eluted solution of GST-
tagged pGEX-4t-TAR1 protein from a Bio-Scale Mini Profinity GST Cartridges
chromatography column; Marker, protein ladder (Takara).
Fig.S8
Fig.S8. Nucleotide Sequence of CYP71AV1, ADS and DBR2 promoters and the Activation of ADS and CYP71AV1 Promoters by TAR1.(A-C) Nucleotide Sequence of CYP71AV1 promoter (A), ADS promoter (B) and
DBR2 promoter (C) cloned from genome DNA of A. annua.
(D) Transactivation of DBR2pro:GUS gene expression by TAR1 in A. annua leaves.
qRT–RCR analysis of the GUS gene expression in transiently transformed or
35s:TAR1 stably transgenic A. annua with Agrobacterium harboring DBR2pro:GUS
and 35s:TAR1 or DBR2pro:GUS alone.
The CBF2- and RAA-motif were highlighted by blue or yellow background
respectively. For mutant construction, change “G” to “T” in CBF2 motif and “C” to
“T” in RAA motif.
Table S1 List of All Primers Used in This Study.
Primers used for PCR analysis
Primers Function Primer Sequences (5’-3’)Base Pairs
TAR1-F Gene clone ctttaccatcacttccctct 20TAR1-R Gene clone ccttggatgagatacactgtc 21TAR1-RNAiF construction aaaTCTAGAaaaCCATGGcctcttaacaagccagagtc 38
TAR1-RNAiR constructionaaaGGATCCaaaGGTACCccttggatgagatacactgtc
39
subTAR1-F constructs aaCCATGGGAatgggtcaaaagaagtttag 30subTAR1-R constructs aaACTAGTattcgtattaagcaattctt 29PGTAR1-F constructs aaaGGATCCatgggtcaaaagaagtttag 29PE TAR1-R constructs aaaCTCGAGattcgtattaagcaattctt 29gw-Rn Promoter clone tcgaatgttcctagccacaccctcctct 28TAR1gw-Rw Promoter clone ggttgttgctgttgtagatgttggtggtg 29TAR1gw-Rn-2 Promoter clone ttagttgctcgccacaagttggaccac 27TAR1gw-Rw-2 Promoter clone tgacccttctaaactcgtccgtgacaac 28TAR1gw-Rn-3 Promoter clone gctacaacactcccgctaaaccactgcc 28AP2 Promoter clone actatagggcacgcgtggt 19
AP1 Promoter clone gtaatacgactcactatagggc 22
TAR1pro-FPromoter clone &
constructsaaaGGATCCgggctggtcctaagttgtaa 30
TAR1pro-RPromoter clone &
constructs aaaCCATGGtgtagatgctgttagagtga 31
pCYP71AV1-FPromoter clone &
constructsgcTCTAGAactacaacgcctctactacaat 30
pCYP71AV1-R
Promoter clone & constructs
aaaCCATGGtgcttttagtatactctttatg 31
pADS-FPromoter clone &
constructsgcTCTAGAgtattagggcaccaaacatcaa 30
pADS-RPromoter clone &
constructsaaaCCATGGgattttacaaactttgaata 31
pDBR-FPromoter clone &
constructsgcTCTAGAgaaggtgacttgacgactgctt 30
pDBR-RPromoter clone &
constructsaaaCCATGGtattgaatttgatgttgatc 29
GUS-R PCR atccagactgaatgcccaca 20GFP-R PCR ttacttgtacagctcgtccatgccga 26micF PCR acgcggttctggtatgaaag 20micR PCR gttattgctcagcggtggc 19
JDPDK-1R PCR cttcttcgtcttacacatcac 21JDPDKF PCR acagtggtcccaaagatgga 20JDPDKR PCR ggcggtaaggatctgagcta 20JDPDK-1F PCR ttggattgattacagttggga 21
Primer sequences used for QRT-PCR analysis
Primers Primer Sequences (5’-3’) Base Pairs
TAR1-RT-F gggttcttgggtttccgaga 20
TAR1-RT-R gctgttgtagatgttggtgg 20Actin-F ccaggctgttcagtctctgtat 22Actin-R cgctcggtaaggatcttcatca 22GUS-RT-F gatctgaggaaccgacgact 20GUS-RT-R agacttcgcgctgataccag 20ADS-F aatgggcaaatgagggacac 20ADS-R tttcaaggctcgatgaactatg 22CYP71AV1-F caccctccactacccttg 18CYP71AV1-R gacacatccttctcccagc 20CPR-F agcctctttgccacctcct 19CPR-R gaacagactcccttgtgaacg 21DBR2-F cttgggttacaagctgtg gctcaag 26DBR2-R atataatcaaaactagaggagtgacc 27ALDH1-F cagtttctgacccaaatccaggttga 26ALDH1-R tcggagtagttggtcacat 19HMGR-F ttgtgtgcgaggcagtaat 19HMGR-R cctgaccagtggctataaaga 21DXS-F atgggttggcgggattcac 19DXS-R ccgtcaagattggcagtaggtaaa 24DXR-F attgctggcggtccctttgttctt 24DXR-R cttttctccccatgctcagttagg 24FPS-F tcattgtctattcaccgccg 20FPS-R caccgcttggactgctttgct 21TTG1-F ccagcttgatgacaccaacgg 21TTG1-R cccactcccagccccactac 20AaORA-RT-F atttccaactaaacacggttgagcct 26AaORA-RT-R ggatcttgaagtgttgcatataatgaaagt 30TFAR-F ctccacactacttgggagag 20TFAR-R aacgtatgtgttcggccaac 20OSC2-RT-F cggtcgagcgtcaagaagta 20OSC2-RT-R cgcataagcaaatcaccgca 20CYP7V2-RT-F aagctgacatcgctgacgta 20CYP7V2-RT-R tgcacatgttgagcttgcat 20
Probe sequences used for EMSA
Probe Probe Sequences (5’-3’) Base Pairs
CBF2-F aggtcgaccgataggtcgaccgataggtcgaccgat 36CBF2-R atcggtcgacctatcggtcgacctatcggtcgacct 36RAV-F ctcaacattgtctcaacattgtctcaacattgt 33RAV-R acaatgttgagacaatgttgagacaatgttgag 33Y-GCC-F AATTCtaagagccgcctaagagccgcctaagagccgccGAGCT 43Y-GCC-R CggcggctcttaggcggctcttaggcggctcttaG 35
Sequences used for Yeast one-hybrid
Names Sequences (5’-3’) Base PairsY-CBF2-F AATTCaggtcgaccgataggtcgaccgataggtcgaccgatGAGCT 46Y-CBF2-R CatcggtcgacctatcggtcgacctatcggtcgacctG 38Y-RAV-F AATTCctcaacattgtctcaacattgtctcaacattgtGAGCT 43Y-RAV-R CacaatgttgagacaatgttgagacaatgttgagG 35PAD-TAR1-F aaaGGATCCGAatgggtcaaaagaagtttag 31PAD-TAR1-R aaaCTCGAGctaattcgtattaagcaatt 29
Y-mCBF2-F AATTCagttctaccgatagttctaccgatagttctaccgatGAGCT 46Y-mCBF2-R CatcggtagaactatcggtagaactatcggtagaactG 38Y-mRAV-F AATTCcttaatattgtcttaatattgtcttaatattgtGAGCT 43Y-mRAV-R CacaatattaagacaatattaagacaatattaagG 35Y-mGCC-F AATTCtaagatcctcctaagatcctcctaagatcctccGAGCT 43Y-mGCC-R CggaggatcttaggaggatcttaggaggatcttaG 35
Abbreviation:
G3P+pyruvate: glyceraldehyde 3-phosphate +pyruvate; methylerythritol phosphate;
ADS: amorpha-4,11-diene synthase; ALDH1: aldehyde dehydrogenase 1; AAOH:
artemisinic alcohol; AAA: artemisinic aldehyde; AA: artemisinic acid; CPR:
cytochrome P450 reductase; CYP71AV1: amorphadiene-12-hydroxylase; DBR2:
artemisinic aldehyde D11(13) reductase; DHAAA: dihydroartemisinic aldehyde;
DHAA: dihydroartemisinic acid; FPS: farnesyldiphosphate synthase; FPP: farnesyl
pyrophosphate; HMGR: 3-hydroxy-3-methyl-glutaryl coenzyme A reductase; IPP:
isopentenyl pyrophosphate MVA: mevalonic acid; DXP: 1-deoxy-D-xylulose 5-
phosphate; DXR: 1-deoxy-D-xylulose-5-phosphate reductoisomerase; DXS: 1-deoxy-
Dxylulose-5-phosphate synthase; MEP: 2-C-methyl-D-erythritol 4-phosphate.