Date post: | 10-Jun-2018 |
Category: |
Documents |
Upload: | duongthien |
View: | 214 times |
Download: | 0 times |
• Why is your hair the color that it is???
Introduction
Copyright © 2002 Pearson Education, Inc., publishing as Benjamin Cummings
• George Beadle and Edward Tatum made Neurospora crassa famous. You know it as ____??
• Here’s what they did…
Copyright © 2002 Pearson Education, Inc., publishing as Benjamin Cummings
Copyright © 2002 Pearson Education, Inc., publishing as Benjamin Cummings
Fig. 17.1
• They came up with this saying: one gene - one enzyme.
• Why is this one better: one gene - one protein?
• Oops – how about this one: one gene - one polypeptide hypothesis?
• (But we are even going to change that).
Copyright © 2002 Pearson Education, Inc., publishing as Benjamin Cummings
• RNA is chemically similar to DNA, except
• 1.
• 2.
• 3.
Can I borrow your chocolate cake recipe?
Copyright © 2002 Pearson Education, Inc., publishing as Benjamin Cummings
2. The basic structural differences include:
i. DNA has deoxyribose (RNA has ribose).
ii. RNA contains uracil in lieu of thymine in
DNA.
iii. DNA is usually double stranded, RNA is
usually single stranded.
iv. The two DNA strands in double-stranded
DNA are antiparallel in directionality.
• DNA -> RNA -> protein.
• This idea was called the “central
dogma”.
• What is a “dogma”?
• As with many dogmas, we will
see later that this one will have
an exception or two.
Copyright © 2002 Pearson Education, Inc., publishing as Benjamin Cummings
•Let’s crunch some numbers and see what kind of code we have here.
3. In the genetic code, nucleotide triplets
specify amino acids
Copyright © 2002 Pearson Education, Inc., publishing as Benjamin Cummings
• Look at this simple diagram first.
Copyright © 2002 Pearson Education, Inc., publishing as Benjamin Cummings
Fig. 17.3
•So how many A’s, U’s,
C’s and G’s would it take
to code for a polypeptide
chain of 70 amino acids??
Copyright © 2002 Pearson Education, Inc., publishing as Benjamin Cummings
• Time for another race with a
Nobel Prize for the winner.
In the early 1960’s we have
revolution in America and in
biology.
• And the winner is…Marshall
Nirenberg . Copyright © 2002 Pearson Education, Inc., publishing as Benjamin Cummings
• By the mid-1960s the entire code was deciphered.
• Let’s look.
• See the start and stop?
• Is this code redundant?
• Ambiguous?
• Degenerate? ambiguous?
Copyright © 2002 Pearson Education, Inc., publishing as Benjamin Cummings
Fig. 17.4
Speaking of degenerate, here’s Brett,
Eman and Thomas at a pre-school
slumber party.
• One of the more
famous
pictures in biology.
4. The genetic code must have evolved very
early in the history of life
Copyright © 2002 Pearson Education, Inc., publishing as Benjamin Cummings
Fig. 17.5
• What does the picture imply about fireflies
and tobacco plants?
• We are more closely related to wart hogs
and fungi than we would like to think.
Copyright © 2002 Pearson Education, Inc., publishing as Benjamin Cummings
• This is similar to replication, so watch out.
1. Transcription is the DNA-directed
synthesis of RNA: a closer look
Copyright © 2002 Pearson Education, Inc., publishing as Benjamin Cummings
• Transcription
can be
separated
into three
stages:
initiation,
elongation,
and
termination.
Copyright © 2002 Pearson Education, Inc., publishing as Benjamin Cummings
Fig. 17.6a
1. The enzyme RNA-polymerase
reads the DNA molecule in the 3'
to 5' direction and synthesizes
complementary mRNA molecules
that determine the order of
amino acids in the polypeptide.
• What’s a TATA box, or a CAAT box, and a promotor?
Copyright © 2002 Pearson Education, Inc., publishing as Benjamin Cummings
Fig. 17.7
• Check out this one.
Copyright © 2002 Pearson Education, Inc., publishing as Benjamin Cummings
Fig. 17.6b
• Here’s another look.
Copyright © 2002 Pearson Education, Inc., publishing as Benjamin Cummings
• Let’s do one of those theme things again:
• Take a minute and make a list in your notes:
• How many similarities between replication and
transcription can you name?
• How many differences?
Copyright © 2002 Pearson Education, Inc., publishing as Benjamin Cummings
And now for some vocab that is commonly
misused…
• Nucleic acid, nucleotide, base,
letter, amino acid, protein, and
gene are NOT synonyms.
• Differentiate, please.
• In the process of translation, a transfer RNA (tRNA) transfers amino acids from the cytoplasm’s pool to a ribosome.
• Where do the aa’s come from?
• Let’s watch this animation.
1. Translation is the RNA-directed making of a
polypeptide: protein synthesis
Copyright © 2002 Pearson Education, Inc., publishing as Benjamin Cummings
Fig. 17.12
• Look at tRNA. Codon? Anti-codon?
Copyright © 2002 Pearson Education, Inc., publishing as Benjamin Cummings Fig. 17.13
• Surprise! tRNA picking up it’s amino acid involves the help of an enzyme.
Copyright © 2002 Pearson Education, Inc., publishing as Benjamin Cummings
Fig. 17.14
• Here’s what a ribosome looks like.
• What’s it made of???
• EPA???
Copyright © 2002 Pearson Education, Inc., publishing as Benjamin Cummings
Fig. 17.15a
• While very similar in structure and function,
prokaryotic and eukaryotic ribosomes have enough
differences that certain antibiotic drugs (like
tetracycline) can paralyze prokaryotic ribosomes
without inhibiting eukaryotic ribosomes.
Copyright © 2002 Pearson Education, Inc., publishing as Benjamin Cummings
• This is AP bio, right??
• E is for exit…
Copyright © 2002 Pearson Education, Inc., publishing as Benjamin Cummings
Fig. 17.15b &c
• It looks like it is the RNA in a ribosome that
holds the substrates in the right position.
• So all biological catalysts
are not proteins, some are
RNA. We will come back to
this later, it is big stuff.
Copyright © 2002 Pearson Education, Inc., publishing as Benjamin Cummings
Fig. 17.16
• Translation can be divided into three stages:
initiation
elongation
termination
• Notice these are the same names as in transcription. Same
concept – start making a polymer, make it longer, finish.
• Both initiation and chain elongation require energy (what
do we call such reactions?) provided by the hydrolysis of
GTP (not ATP this time).
Copyright © 2002 Pearson Education, Inc., publishing as Benjamin Cummings
3. Translation of the mRNA occurs in
the cytoplasm on the ribosome.
4. In prokaryotic organisms,
transcription is coupled to translation
of the message. Translation involves
energy and many steps, including
initiation, elongation and
termination.
• Initiation brings together mRNA, a tRNA with the first amino acid, and the two ribosomal subunits.
• Note the order of events.
Copyright © 2002 Pearson Education, Inc., publishing as Benjamin Cummings Fig. 17.17
• Elongation is very repetitive.
• Can you describe it step by step?
• Note that amino acids are not being “made” or
“produced” by this process, so don’t explain it
that way.
• Your cells can make some amino acids (not all),
but during translation they are already in the
cell and are simply being joined to each other.
• Where did they come from???
Copyright © 2002 Pearson Education, Inc., publishing as Benjamin Cummings
• The mRNA is “read” in the 5’ to 3’ direction.
• Is this the same as the Little Train That Could?
Copyright © 2002 Pearson Education, Inc., publishing as Benjamin Cummings
• Here’s a diagram
Copyright © 2002 Pearson Education, Inc., publishing as Benjamin Cummings
Fig. 17.18
• Termination occurs when one of the three stop
codons reaches the A site.
• Note that another tRNA is not involved.
Copyright © 2002 Pearson Education, Inc., publishing as Benjamin Cummings
Fig. 17.19
• What’s a polyribosomes?
• Watch again
Copyright © 2002 Pearson Education, Inc., publishing as Benjamin Cummings
Fig. 17.20
Here’s an even more detailed animation/tutorial
for your viewing pleasure
• http://www.wiley.com/legacy/college/boyer/0470
003790/animations/animations.htm
• Link to Protein Synthesis
• Here’s one with neat graphics
• And now, a little ditty
i. The mRNA interacts with the rRNA of the
ribosome to initiate translation at the (start)
codon.
ii. The sequence of nucleotides on the mRNA
is read in triplets called codons.
iii. Each codon encodes a specific amino
acid, which can be deduced by using
a genetic code chart. Many amino acids have
more than one codon.
iv. tRNA brings the correct amino acid to
the correct place on the mRNA.
v. The amino acid is transferred to the
growing peptide chain.
vi. The process continues along the mRNA
until a “stop” codon is reached.
vii. The process terminates by release of
the newly synthesized peptide/protein.
Diagram each step of the translation of
the following mRNA transcript.
• ACCGUCAUGCCCACCGUGUGACACGCG
• Diagram EACH step (each time a new codon
moves into the ribosome).
• Include correctly paired codons and anti-
codons and amino acids.
• Label all significant parts (eg - A site) and
processes (eg - initiation).
• Although bacteria and eukaryotes carry out
transcription and translation in very similar ways,
they do have differences in cellular machinery and
in details of the processes.
• Watch here
4. Comparing protein synthesis in
prokaryotes and eukaryotes: a review
Copyright © 2002 Pearson Education, Inc., publishing as Benjamin Cummings
• Here’s something
bacteria cells can
do that yours and
mine can’t.
• Why can it do
this?
Copyright © 2002 Pearson Education, Inc., publishing as Benjamin Cummings
Fig. 17.22
• All this happens in the nucleus.
• At the 5’ end of the pre-mRNA molecule, a modified
form of guanine is added, the 5’ cap.
• This helps protect mRNA from hydrolytic enzymes.
• It also functions as an “attach here” signal for ribosomes.
2. Eukaryotic cells modify RNA after
transcription
Copyright © 2002 Pearson Education, Inc., publishing as Benjamin Cummings
• At the 3’ end, an enzyme adds 50 to 250 adenine
nucleotides, the poly(A) tail.
• In addition to inhibiting hydrolysis and facilitating
ribosome attachment, the poly(A) tail also seems to
facilitate the export of mRNA from the nucleus.
Copyright © 2002 Pearson Education, Inc., publishing as Benjamin Cummings
Fig. 17.8
• Now here’s a big difference between you and bacteria.
• Noncoding segments, introns, lie between coding
regions.
• Intron stands for “intervening”.
• The final mRNA transcript includes coding regions,
exons, that are translated into amino acid sequences,
plus the leader and trailer sequences.
• Exon stands for “expressed”.
• “Ex”, then, in this case, doesn’t mean it comes OUT.
The exons are the ones that stay in, the introns are the
ones that come out. Confusing, yes?
Copyright © 2002 Pearson Education, Inc., publishing as Benjamin Cummings
Copyright © 2002 Pearson Education, Inc., publishing as Benjamin Cummings
Fig. 17.9
• RNA splicing removes introns and joins exons to
create an mRNA molecule with a continuous
coding sequence. This is the RNA the ribosomes
“read”.
•A little molecular beast called a “spliceosome”
accomplishes this editing. Let’s watch:
•Look: at this then Watch here or here
• As with a ribosome, RNA, not proteins are
the catalyst in a spliceosome.
Copyright © 2002 Pearson Education, Inc., publishing as Benjamin Cummings
• RNA splicing appears to have several functions.
• First, at least some introns contain sequences that control gene activity in some way.
• Splicing itself may regulate the passage of mRNA from the nucleus to the cytoplasm.
• One clear benefit of split genes is to enable one gene to encode for more than one polypeptide.
• Alternative RNA splicing gives rise to two or more different polypeptides, depending on which segments are treated as exons.
• Early results of the Human Genome Project indicate that this phenomenon may be common in humans, making that definition of a gene even tougher to nail down. The average transcript codes for 5.7 proteins.
Copyright © 2002 Pearson Education, Inc., publishing as Benjamin Cummings
2. In eukaryotic cells the mRNA
transcript undergoes a series of
enzyme regulated modifications.
• Addition of a poly-A tail
• Addition of a GTP cap
• Excision of introns
• What is a mutation?
• A point mutation? Gene mutation?
• Somatic mutation? Germ mutation?
5. Point mutations can affect protein
structure and function
Copyright © 2002 Pearson Education, Inc., publishing as Benjamin Cummings
• Here’s the classic example of a point mutation, specifically
a base-pair substitution. Watch here.
Copyright © 2002 Pearson Education, Inc., publishing as Benjamin Cummings
Fig. 17.23
• What would a silent mutation be?
• Missense mutations are those that still code for an amino acid but change the indicated amino acid. Sickle cell is a missense mutation.
• Nonsense mutations change an amino acid codon into a stop codon, nearly always leading to a nonfunctional protein.
• Which would be most likely to be lethal?
Copyright © 2002 Pearson Education, Inc., publishing as Benjamin Cummings
Fig. 17.24
Copyright © Pearson Education, Inc., publishing as Benjamin Cummings
• Insertions and deletions can cause frameshift
mutations.
• What would this mean, and what would it cause?
Copyright © 2002 Pearson Education, Inc., publishing as Benjamin Cummings
Copyright © 2002 Pearson Education, Inc., publishing as Benjamin Cummings
Fig. 17.24
• Mutations can occur in a number of ways.
• Errors can occur during DNA
replication, DNA repair, or DNA
recombination.
Copyright © 2002 Pearson Education, Inc., publishing as Benjamin Cummings
• Mutagens are chemical or physical agents that
interact with DNA to cause mutations.
• Can you name some specific ones?
• How do these relate to carcinogens?
Copyright © 2002 Pearson Education, Inc., publishing as Benjamin Cummings
Too much sun, as you know, can cause
the mutations that result in skin cancer.
Is all sunshine bad?
Not sure if staying out in the sun too
long is bad for you?
Check out what a thymine dimer or two
can do.
• The Mendelian concept of a gene views it as a
discrete unit of inheritance that affects phenotype.
• Morgan and his colleagues assigned genes to specific
loci on chromosomes.
• We can now view a gene as a specific nucleotide
sequence along a region of a DNA molecule.
• We can define a gene functionally as a DNA
sequence that codes for a specific polypeptide chain.
• Or is that not enough?
6. What is a gene? revisiting the question
Copyright © 2002 Pearson Education, Inc., publishing as Benjamin Cummings
• Even the one gene-one polypeptide definition must
be refined and applied selectively.
• Most eukaryotic genes contain large introns that have
no corresponding segments in polypeptides.
• Promotors and other regulatory regions of DNA are not
transcribed either, but they must be present for
transcription to occur.
• Our definition must also include the various types of
RNA that are not translated into polypeptides.
• Our best definition now is that a gene is a region
of DNA whose final product is either a polypeptide
or an RNA molecule. But wait! We’ll change that
too. Copyright © 2002 Pearson Education, Inc., publishing as Benjamin Cummings
A little song, you say??
• Check this out
• Or how about this one?
• Let’s review with some video. Shout out when
you recognize something.