Date post: | 14-Nov-2023 |
Category: |
Documents |
Upload: | independent |
View: | 0 times |
Download: | 0 times |
1
Original article was published in Antonie van Leeuwenhoek 2011, 100 (2), 279-289.
Analysis of the DNA region mediating increased thermotolerance at 58°C in
Cronobacter sp. and other enterobacterial strains
Jana Gajdosova1, Kristina Benedikovicova1, Natalia Kamodyova1, Lubomira Tothova1, Eva
Kaclikova2, Stanislav Stuchlik1, Jan Turna1 and Hana Drahovska1*
1Dep. of Molecular Biology, Fac.Natural Sciences, Comenius University, Bratislava, Slovakia 2Dep. of Microbiology and Molecular Biology, Food Research Institute, Bratislava, Slovakia
Correspondence to: Hana Drahovská, Department of Molecular Biology, Faculty of Natural
Sciences, Comenius University, Mlynska dolina 1, 841 15 Bratislava, Slovakia;
e-mail: [email protected]
Telephone number: 421 2 6096 639
Fax number: 421 2 6096 508
Abstract
Cronobacter spp. are opportunistic pathogens associated with serious infections in neonates.
The increased stress tolerance, including thermoresistance, of some Cronobacter strains can
promote their survival in production facilities and thus raise the possibility of contamination of
dried infant milk formula, which has been identified as a potential source of infection. In this
study, we characterized a DNA region which is present in some Cronobacter strains and which
contributes to their prolonged survival at 58 °C. The 18 kbp long region containing 22 open
reading frames was sequenced in Cronobacter sakazakii ATCC 29544. The major feature of the
region contained a cluster of conserved genes, most of them having significant homologies with
bacterial proteins involved in some type of stress response, including heat, oxidation and acid
stress. The same thermoresistance DNA region was detected in strains belonging to the genera
Cronobacter, Enterobacter, Citrobacter and Escherichia and its presence positively correlated
with increased thermotolerance.
Keywords: Cronobacter, Enterobacter sakazakii, heat resistance, food
2
Introduction
Cronobacter spp. are opportunistic pathogens that can cause serious infections in neonates,
including meningitis, necrotising enterocolitis and sepsis with fatality rates as high as 80% (van
Acker et al 2001; Gurtler et al. 2005; Caubilla-Barron et al. 2007; Healy et al., 2010). Recently,
infections in adults have been reported, in particular among the elderly and
immunocompromised patients (FAO/WHO report 2008). The genus Cronobacter was
established by a polyphasic taxonomic approach as a reclassification of Enterobacter sakazakii
and other strains. Currently, five species and three subspecies are described in the genus
Cronobacter (Iversen et al. 2008).
Although these bacteria are widely distributed in the environment and in various foods
(Iversen and Forsythe 2004, Friedman 2007, Turcovsky et al. 2010), dried infant milk formula
has been implicated as the vehicle of transmission in many clinical manifestations (Nazarowec-
White and Farber, 1997; van Acker et al., 2001; Gurtler et al. 2005; Caubilla-Barron et al. 2007).
Accurate knowledge of the growth condition range of Cronobacter strains is necessary to
minimize the risk of contamination during the production and preparation of rehydrated infant
formula. Increased thermoresistance together with tolerance to high-osmotic and dry conditions
are very important properties in this point of view.
Thermoresistance of Cronobacter spp. was evaluated by several studies. Nazarowec-White
and Farber (1997) obtained D-values at 58 °C to be 4.2 min and they concluded that Cronobacter
were among the most thermotolerant microorganisms of the family Enterobacteriaceae. In
contrast to these results, Breeuwer et al. (2003) determined the D58-value for Cronobacter as
ranging from 0.3 to 0.6 min, which is much lower and comparable with that of other
Enterobacteriaceae. On the other hand, these authors showed that Cronobacter spp. are
particularly tolerant to osmotic stress and desiccation, which is most likely linked to
accumulation of trehalose in the cells. Iversen et al. (2004) obtained D-values for Cronobacter
between those previously published, with a D-value at 58 °C of 2.4 min. Similarly, Dancer et al.
(2009) determined D60 values for strains ranging from 1.05 to 2.21 min and observed a positive
correlation between thermo- and desiccation tolerance. It is difficult to compare D-values
obtained for identical strains by different researchers, as many factors (e.g. type of cultivation
media, bacterial growth phase, previous heat shock treatment) can influence thermotolerance
(Chang et. al. 2009; Arroyo et al. 2009). However, differences in D-values between strains
3
measured in the same experimental conditions are very reproducible. Edelson-Mammel and
Buchanan (2004) observed 20-fold differences in the ability of Cronobacter strains to survive
heating in rehydrated infant formula at 58 °C, with D-values ranging from 0.5 to 9.9 min and the
strains appearing to fall into two distinct heat resistance phenotypes, thermosensitive and
thermotolerant strains. Proteins unique for thermotolerant Cronobacter strains were identified by
liquid chromatography and mass spectrometry (Williams et al. 2005). One protein found only in
thermotolerant strains was sequenced and identified as homologous to a hypothetical protein
(Mfla_1165) from the thermotolerant bacterium Methylobacillus flagellatus KT. According to
the sequence of the respective gene, a PCR detection system was designed, which showed
specificity for thermotolerant strains. The same protein was observed to be induced by osmotic
stress and in desiccated cultures (Riedel and Lehner 2007).
The aim of our work was to assess the genetic variability of Cronobacter strains differing
in thermal tolerance and to study the genetic organisation of the DNA region surrounding the
thermotolerance marker homologous to Mfla_1165.
Materials and Methods
Bacterial strains used in the study. Enterobacterial strains were isolated from foods and
clinical samples at our laboratory or were obtained from the American Type Culture Collection
(ATCC), from the Belgian Co-ordinated Collections of Microorganisms (BCCM/LMG), Czech
Collection of Microorganisms (CCM) and from the Institute for Food Safety and Hygiene,
Vetsuisse University of Zurich, Switzerland (IFSH). Cronobacter strains were previously
identified at the species level and characterised by several phenotyping and molecular methods
(Turcovsky et al. 2011). A list of strains studied is presented in Table 1.
All strains were maintained in 15 % glycerol solution at -70 °C and freeze-dried for long-
period storage. Strains were cultured on Luria-Bertani or Brain Heart broth/agar (Merck) at
37 °C.
Determination of thermotolerance. The thermotolerance of strains was determined by
dispensing a series of 70 µl aliquots of the first decimal dilution of overnight cultures
4
(approximately 18 h at 37 °C) in Brain Heart broth into sterile 200 µl thin-wall microtubes which
were incubated in a thermoblock adjusted to 58 °C. The initial concentration of cells estimated
from decimal dilutions by the plate-count method was within the range from 5 x 107 to 8 x 107
CFU/ml. At given time periods, three tubes were transferred to another thermoblock adjusted to
10 °C. The numbers of viable cells were determined from appropriate decimal dilutions by the
plate-count method. The time required for the viable count to decrease by 1 log order (decimal
reduction time = D-value) at 58 °C was determined by plotting the log10 CFU/ml against the time
of incubation using linear regression and the D-value determined as the negative reciprocal of the
slope. Each D-value was determined in triplicate for each culture in two independent
experiments.
PCR detection of the orfI thermotolerance marker. Chromosomal DNA was isolated
using a DNeasy blood and tissue kit (Qiagen, Hilden, Germany) according to the manufacturer´s
instructions. PCR primers ThrF (gccaacgtggaatcggta) and ThrR (acggacgacagcaaggtg)
complementary to the C. sakazakii ATCC 29544 sequence were used for the detection of orfI in
enterobacterial strains.
Sequencing of the thermotolerance region. The sequence of the thermotolerance DNA
region in C. sakazakii ATCC 29544 was obtained from PCR products with primers designed
according to similar sequences from DNA databases and/or by the inverse PCR approach. DNA
sequencing was performed using an ABI 3130 Prism Avant automatic DNA analyzer (Applied
Biosystems) using a Big Dye Terminator 3.1 kit (Applied Biosystems). DNA sequences were
assembled in Vector NTI software (Invitrogen), coding regions were annotated by
GeneMark.hmm for prokaryotes (Lukashin and Borodovsky 1998) and a search for potential
promoters was performed using promoter prediction software
(http://www.fruitfly.org/seq_tools/promoter.html). Potential Orfs were analyzed for homology to
other proteins and for the presence of conserved domains using the NCBI/Blast server
(http://blast.ncbi.nlm.nih.gov/Blast.cgi). The presence of signal peptides was detected with
SignalP 3.0 (http://www.cbs.dtu.dk/services/SignalP/) and the cell localization was assessed by
PSORTb v3.0 (http://www.psort.org/psortb/index.html, Yu et al. 2010). The sequence obtained
has been deposited in the EMBL database (FR714908).
5
Detection of transcription by rtPCR. Total bacterial RNA was isolated from overnight
bacterial cultures grown for 18-20 h at 37 ºC in LB medium as well as from the exponential
growth phase cells, which were cultivated up to 0.3-0.5 OD600. Total RNA was isolated using an
RNeasy Protect Mini Kit (Qiagen). Five µg RNA were used for reverse transcription with a First
Strand cDNA Synthesis Kit (Fermentas). Gene expression from the thermotolerance DNA region
was detected by amplification of cDNA samples with orf-specific primers, chromosomal DNA
from C. sakazakii ATCC 29544 being used as a positive control.
Cloning of orfH-K in Escherichia coli. A part of the thermotolerance DNA region from C.
sakazakii ATCC 29544 covering orfH-K was amplified with primers p1163F-BamHI
(agcaggatccactgaaggcaagccag) and p1167R-EcoRI (catcgaattcgtcggcattgttcaagg). The PCR
product was digested with EcoRI and BamHI and, after ligation into pUC21 (Vereira and
Messing, 1991), the recombinant plasmid pKK12 was created and transformed into E. coli XL1
Blue (Stratagene). Thermoresistance of recombinant bacteria was measured according to the
same protocol as for Cronobacter strains.
Results and Discussion
Thermotolerance of Cronobacter strains. Since thermoresistance of Cronobacter is an
important parameter likely facilitating contamination of powdered infant milk formula, the
ability of strains to survive at 58 ˚C was measured in our study. In agreement with other authors
(Edelson-Mammel and Buchanan 2004; Dancer et al. 2009, Walsh et al. 2010), strains were
separated into two groups; D58 values of twelve thermosensitive strains fell within the range from
15 to 60 s. On the other hand, eleven strains were assessed as thermotolerant because their D58
values ranged from 102 to 217 s (Table 1). According to several phenotyping and genotyping
tests (Turcovsky et al. 2011), nine of the thermotolerant strains belonged to C. sakazakii, four of
them being closely related according to the AFLP analysis. The other two thermotolerant strains
were identified as Cronobacter malonaticus. Elevated thermoresistance strictly correlated with
the presence of the thermotolerance DNA marker orfI, homologous to the Mfla_1165 gene,
which was described previously (Williams et al. 2005). Several other enterobacterial strains
6
belonging to Citrobacter freundii, Citrobacter braakii, Enterobacter cloacae and E. coli
contained the orfI marker. Thermotolerance of all enterobacterial strains determined as D58 value
>100 s correlated with orfI presence (Table 1).
Thermotolerance DNA region. In further work, the genetic context of the orfI marker
was analyzed by sequencing of an 18 kbp region in strain C. sakazakii ATCC 29544 (EMBL acc.
no. FR714908). Twenty-two potential open reading frames with sizes ranging from 141 – 2850
bp were found in this region by analysis with GeneMark.hmm for prokaryotes (Lukashin and
Borodovsky 1998). The major feature of the region contained a cluster of conserved genes (orfA-
Q), most of them having significant homologies with bacterial proteins involved in some type of
stress response, including heat, oxidation and acid stress (Fig. 1; Table 2). The GC content of the
orfA-Q region was 61.8%, which is higher than average for the genome of C. sakazakii BAA-
894 (56.7%, Kucerova et al. 2010). The DNA region identified here was not present in the
genome of C. sakazakii BAA-894. By PCR analysis, the same organization of the
thermotolerance DNA region was detected in all strains containing the orfI marker (data not
shown). The region was surrounded at both ends by genes encoding for putative transposases,
these sequences were unique only for Cronobacter and one E. cloacae strains.
By comparison with the GenBank database, the thermotolerance DNA region from
C. sakazakii showed significant similarity to several chromosomal and plasmid sequences from
different Proteobacteria. An almost identical gene cluster was present in genomes of three β-
proteobacteria: Ralstonia pickettii 12D, Burkholderia multivorans ATCC 17616 and M.
flagellatus KT (Fig. 1). Substantial parts of the Cronobacter thermotolerance DNA region were
also homologous to plasmids of the α-proteobacteria Ochrobactrum anthropi ATCC 49188 and
Methylobacterium exorquems AM1 and to chromosomal DNA of the δ-proteobacterium
Desulfovibrio desulfuricans G20. Strains belonging to Burkholderia and Ralstonia species can
grow in intimate associations with plants and they are also important bacterial pathogens of
plants. Similarly, strains belonging to Methylobacterium, as well as its relative Ochrobactrum,
are often found in association with plants (Vuilleumier et al. 2009). Plant material was assumed
to be a natural habitat also for Cronobacter spp. (Iversen and Forsythe 2004; Friedman 2007)
and the ability of Cronobacter strains to associate with plants was recently experimentally
7
confirmed for environmental as well as clinical strains (Schmid et al. 2009). Thus horizontal
transfer of the thermotolerance DNA region may have happened in this environment.
In the Enterobacteriaceae family, several chromosomal and plasmid replicons from
Escherichia, Yersinia, Enterobacter and Klebsiella showed significant homology to the
thermotolerance DNA region. An almost identical sequence was present in E. coli MS 115-1 and
in Escherichia sp. 1_1_43, strains isolated from human intestine and sequenced in the Human
Microbiome Project (Turnbaugh et al. 2007). The former strain contained all the structural genes
of the thermotolerance DNA region, whereas the latter isolate showed high similarity to both
ends covering orfB-E and orfL-Q, but the genes H-K were missing (Fig. 1). The DNA region
encoding for OrfB-J was nearly identical to sequence from a large conjugative plasmid of
Klebsiella pneumoniae C-132-98 which was sequenced recently (Bojer et al. 2010). The region
restricted to orfCD was also found in E. cloacae ATCC 13047.
Expression of the thermotolerance DNA region. The level of mRNA transcription for
genes from the thermotolerance DNA region was measured in three thermotolerant strains by
rtPCR. We observed high expression throughout the whole thermotolerance gene cluster (orfA-
Q). Similar levels of transcription were observed in all strains and in both stationary and
exponentially growing bacteria (Fig. 2A). We obtained positive results from several mutually
overlapping rtPCRs throughout all of the thermotolerance genomic island, which supports our
proposal that the region is transcribed as a continuous operon. A very weak or no mRNA signal
was detected in the outer regions containing the putative transposase genes (Fig. 2B).
Genes from the thermoresistance DNA region. The thermotolerance DNA region of
C. sakazakii ATCC 29544 contained seventeen genes transcribed in the same orientation (Fig. 1),
many of them showed similarity to stress response proteins (Table 2).
The OrfB is similar to the N-terminal domain of MerR superfamily transcriptional
regulators. It has been shown that these proteins mediate responses to stress including exposure
to heavy metals, drugs, or oxygen radicals in eubacterial and some archaeal species (Brown et al.
2003). Compared to homologous proteins from Ralstonia, Methylobacillus and Escherichia,
Cronobacter OrfB is shortened by about one third at the C-terminal end.
Proteins OrfC and OrfH belong to the family of the small heat-shock proteins (sHsps).
These proteins contain a common α-crystallin domain and function as ATP-independent holding
8
chaperones, which assist in the folding process by stabilizing the unfolded or partially folded
proteins, without actively promoting their remodelling (Baneyx and Mujacic, 2004; Han et al.
2008). The sHsps are present in almost all organisms. Two genes named ibpA and ibpB, are
present in E. coli and their homologues were also found in the C. sakazakii BAA-894 genome
(Kucerova et al. 2010).
Protein OrfD is homologous to Clp ATP-dependent chaperones. These proteins are
known to increase the survival during heat shock and their function is to disaggregate misfolded
and aggregated proteins (Doyle and Wickner 2008). The OrfD possesses 99% similarity to a new
member of the Clp chaperone family, ClpK from K. pneumoniae, which was characterized
recently (Bojer et al. 2010). By mutation and complementation it was shown that ClpK does not
affect the maximum growth temperature, but specifically enhances the ability of K. pneumoniae
to survive at otherwise lethal temperatures. The clpK marker was present in about 30% of
clinical K. pneumoniae isolates and, as in Cronobacter, a positive correlation between clpK
expression and a thermotolerant phenotype was established (Bojer et al. 2010). Genes encoding
for OrfCD chaperones were found also in E. cloacae ATCC 13047 and in E. cloacae 41S from
our study. These genes might be responsible for the slightly increased thermoresistance of the
latter strain (Table 1).
The orfEFG are, with a high probability, non-functional, being fragments of homologous
genes present in Methylobacillus, Burkholderia and Ralstonia encoding for phospholipase D and
FtsH protease.
The thermotolerance marker OrfI is a member of the YfdX family of conserved proteins
with unknown function found in Proteobacteria. The yfdX gene is essential for growth in E. coli
and is up-regulated in stationary phase (Schlicht et al. 2006) as well as by overexpression of the
EvgA regulator (Nishino et al. 2003; Masuda and Church 2003). Similar to YfdX, the OrfI
localization is extra-cytoplasmic according to PSORTb (Yu et al. 2010). OrfI has a high
similarity to the adjacent OrfJ protein (48% amino acid identity and 63% amino acid similarity).
However, OrfJ does not possess a signal peptide and membrane spanning regions. OrfI was
discovered as a marker associated with increased thermotolerance in Cronobacter (Williams at
al. 2005). Both OrfI and OrfJ (as well as OrfD) change their expression and cellular localization
during osmotic and desiccation stress (Riedel and Lehner 2007). These results may indicate a
possible interaction of these proteins with the cell membrane during stress conditions.
9
The orfK encodes for a conserved transmembrane protein belonging to the HdeD family.
The hdeD gene is a part of the acid resistance island in E. coli and it is involved in the same
regulatory network as yfdX (Masuda and Church 2003). The HdeD protein participates in an acid
resistance mechanism exhibited only at high cell densities (Mates et al. 2007). In our study, the
role of the orfH-K genes in thermoresistance also was confirmed experimentally. We have
observed that an E. coli strain containing the orfHIJK genes cloned on multicopy plasmid
exhibited more than 2-fold increased D58 value comparing with the value for the control strain
(Fig. 3).
The OrfL gene is probably involved in regulation of gene expression from the
thermotolerance DNA region because this protein shows similarity with the alternative sigma 28
factors of RNA polymerases from several bacteria including Burkholderia ubonensis and
Ochrobactrum anthropi. orfM encodes for a putative thioredoxin, a small protein essential for
the maintenance of proper reduction status of proteins and the cell redox potential. By its redox
activity or by non-oxidative interaction, thioredoxin modulates the activity of many cellular
proteins (Kumar et al. 2004). The OrfN protein showed highest homology to the KefC
glutathione-regulated potassium-efflux protein. This efflux system is involved in detoxification
of toxic metabolites such as methylglyoxal (Roosild et al. 2009).
The OrfP protein is a putative peptidase of the M-48 superfamily homologous to HtpX of
E. coli. This zinc metalloprotease has been shown to participate in the proteolytic quality control
of membrane proteins and its function is closely connected with the FtsH ATP-dependent
protease (Sakoh et al. 2005). A HtpX metalloprotease from an unknown organism with 98%
similarity to Mfla_1159 from M. flagellatus KT and 73% similarity to OrfP was expressed in E.
coli and proved to be proteolytically active and localized in cell inner membrane (Siddiqui at al.
2007). OrfQ was assigned to HtrA/DegP family of proteins, which are periplasmic proteins with
chaperone and protease activity and have been implicated as key players in the control of protein
quality in the periplasmic space of Gram-negative bacteria, in particular during thermal and other
stresses (Kim et al. 2005). The domain structure of OrfQ is most similar to that of DegS from E.
coli, which functions to activate the sigmaE factor.
Conclusion. By measurement of the D58 values, we have observed that Cronobacter, as
well as other enterobacterial strains with the thermotolerance DNA region, have two to ten fold
increased thermotolerance compared to negative strains of the same species (Table 1). However,
10
we observed also two-fold differences in thermotolerance between thermotolerant strains. These
differences may be due to the presence of additional genes outside this region or due to
differences in the expression of the genes in the thermotolerance region. Involvement of the
OrfD and OrfHIJK in survival at increased temperatures was confirmed experimentally (Bojer et
al. 2010; this study). However, the contribution of particular genes from this region to the
increased thermotolerance is still not understood and their influence on the survival at elevated
temperatures and to resistance to other stress conditions (e. g. to dry and acid stress) must be
further elucidated.
Acknowledgement
This publication is the result of the project implementation: Centre of excellence for
utilization of information bio-macromolecules in disease prevention and in improving of quality
of life (ITMS 26240120027) supported by the Research & Development Operational Programme
funded by the ERDF. This work was also supported by Slovak Research and Development
Agency under the contract No. APVV-27-009705 and by Slovak Ministry of Education under the
contract No. VEGA 1/0344/10. Tomáš Kuchta and Katarína Oravcová from the Food Research
Institute Bratislava are acknowledged for the critical reading of the manuscript.
11
References
Arroyo C, Condón S, Pagán R (2009) Thermobacteriological characterization of Enterobacter
sakazakii. Int J Food Microbiol 136:110-118.
Baneyx F, Mujacic M (2004) Recombinant protein folding and misfolding in Escherichia coli.
Nat Biotechnol 22:1399-1407.
Bojer MS, Struve C, Ingmer H, Hansen DS, Krogfelt KA (2010) Heat resistance mediated by a
new plasmid encoded Clp ATPase, ClpK, as a possible novel mechanism for nosocomial
persistence of Klebsiella pneumoniae. PLoS ONE 5:e15467.
Breeuwer P, Lardeau A, Peterz M, Joosten HM (2003) Desiccation and heat tolerance of
Enterobacter sakazakii. J Appl Microbiol 95:967–973.
Brown NL, Stoyanov JV, Kidd SP, Hobman JL (2003) The MerR family of transcriptional
regulators. FEMS Microbiol Rev 27:145-163.
Caubilla-Barron J, Hurrell E, Townsend S, Cheetham P, Loc-Carrillo C, Fayet O, Prère M-F,
Forsythe SJ (2007) Genotypic and phenotypic analysis of Enterobacter sakazakii strains from an
outbreak resulting in fatalities in a neonatal intensive care unit in France. J Clin Microbiol 45:
3979-3985.
Chang C-H, Chiang M-L, Chou C-C (2009) The effect of temperature and length of heat shock
treatment on the thermal tolerance and cell leakage of Cronobacter sakazakii BCRC 13988. Int J
Food Microbiol 134:184-189.
Dancer GI, Mah J-H, Rhee M-S, Hwang I-G, Kang D-H (2009) Resistance of Enterobacter
sakazakii (Cronobacter spp.) to environmental stresses. J Appl Microbiol 107:1606-1614.
Doyle SM, Wickner S. (2009) Hsp104 and ClpB: protein disaggregating machines. Trends
Biochem Sci 34:40-48.
Edelson-Mammel SG, Buchanan RL (2004) Thermal Inactivation of Enterobacter sakazakii in
Rehydrated Infant Formula. J Food Prot 67:60-63.
FAO/WHO report (2008) Enterobacter sakazakii (Cronobacter spp.) in powdered follow-up
formulae: Meeting report. Microbiological Risk Assessment Series No. 15, Rome, Italy.
Friedemann M (2007) Enterobacter sakazakii in food and beverages (other than infant formula
and milk powder). Int J Food Microbiol 116:1-10.
Gurtler JB, Kornacki JL, Beuchat LR (2005) Enterobacter sakazakii: A coliform of increased
concern to infant health. Review. Int J Food Microbiol 104:1-34.
Han M-J, Yun H, Lee SY (2008) Microbial small heat shock proteins and their use in
biotechnology. Biotechnol Adv 26:591-609.
Healy B, Cooney S, O'Brien S, Iversen C, Whyte P, Nally J, Callanan JJ, Fanning S (2010)
Cronobacter (Enterobacter sakazakii): An opportunistic foodborne pathogen. Foodborne Pathog
Dis 7:339-350.
Iversen C, Forsythe S (2004) Isolation of Enterobacter sakazakii and other Enterobacteriaceae
from powdered infant formula milk and related products. Food Microbiol 21:771-777.
12
Iversen C, Lane M, Forsythe SJ (2004) The growth profile, thermotolerance and biofilm
formation of Enterobacter sakazakii grown in infant formula milk. Lett Appl Microbiol 38:378-
382.
Iversen C, Mullane N, McCardel B, Tall BD, Lehner A, Fanning S, Stephan R, Joosten H (2008)
Cronobacter gen. nov., a new genus to accommodate the biogroups of Enterobacter sakazakii,
and proposal of Cronobacter sakazakii gen. nov., comb. nov., Cronobacter malonaticus sp. nov.,
Cronobacter turicensis sp. nov., Cronobacter muytjensii sp. nov., Cronobacter dublinensis sp.
nov., Cronobacter genomospecies 1 and three subspecies, Cronobacter dublinensis subsp.
dublinensis subsp. nov., Cronobacter dublinensis subsp. lausannensis subsp. nov. and
Cronobacter dublinensis subsp. lactaridi subsp. nov. Int J Syst Evol Microbiol 58:1442-1447.
Kim DY, Kim KK (2005) Structure and function of HtrA family proteins, the key players in
protein quality control. J Biochem Mol Biol 38:266-274.
Kucerova E, Clifton SW, Xia X-Q, Long F et al (2010) Genome sequence of Cronobacter
sakazakii BAA-894 and comparative genomic hybridization analysis with other cronobacter
species. PLoS ONE 5:e9556.
Kumar J, Tabor S, Richardson CC (2004) Proteomic analysis of thioredoxin-targeted proteins in
Escherichia coli. Proc Natl Acad Sci USA 101:3759–3764.
Lukashin AV, Borodovsky M (1998) GeneMark.hmm: New solutions for gene finding. Nucleic
Acids Res 26:1107-1115.
Masuda N, Church GM (2003) Regulatory network of acid resistance genes in Escherichia coli.
Mol Microbiol 48:699-712.
Mates AK, Sayed AK, Foster JW (2007) Products of the Escherichia coli Acid Fitness Island
Attenuate Metabolite Stress at Extremely Low pH and Mediate a Cell Density-Dependent Acid
Resistance. J Bacteriol 189: 2759–2768.
Nazarowec-White M, Farber JM (1997) Thermal resistance of Enterobacter sakazakii in
reconstituted dried-infant formula. Lett Appl Microbiol 24:9-13.
Nishino K, Inazumi Y, Yamaguchi A (2003) Global Analysis of Genes Regulated by EvgA of
the Two-Component Regulatory System in Escherichia coli. J Bacteriol 185:2667–2672.
Riedel K, Lehner A (2007) Identification of proteins involved in osmotic stress response in
Enterobacter sakazakii by proteomics. Proteomics 7:1217-1231.
Roosild TP, Castronovo S, Miller S, Li C, Rasmussen T, Bartlett W, Gunasekera B, Choe S,
Booth IR (2009) KTN (RCK) domains regulate K+ channels and transporters by controlling the
dimer-hinge conformation. Structure 17:893-903.
Sakoh M, Ito K, Akiyama Y (2005) Proteolytic activity of HtpX, a membrane-bound and stress-
controlled protease from Escherichia coli. J Biol Chem 280:33305-33310.
Schlicht M, Berens C, Daam J, Hillen W (2006) Random insertion of a TetR-inducing peptide
tag into Escherichia coli proteins allows analysis of protein levels by induction of reporter gene
expression. Appl Environ Microbiol 72:5637-5642.
13
Schmid M, Iversen C, Gontia I, Stephan R, Hofmann A, Hartmann A, Jha B, Eberl L, Riedel, K,
Lehner A (2009) Evidence for a plant-associated natural habitat for Cronobacter spp. Res
Microbiol 160:608-614.
Siddiqui AA, Jalah R, Sharma YD (2007) Expression and purification of HtpX-like small heat
shock integral membrane protease of an unknown organism related to Methylobacillus
flagellatus. J Biochem Biophys Methods 70:539-546.
Turcovsky I, Kunikova K, Drahovska H, Kaclikova E (2011) Biochemical and molecular
characterization of Cronobacter spp. (formerly Enterobacter sakazakii) isolated from foods.
Antonie Van Leeuwenhoek 99:257-269.
Turnbaugh PJ, Ley RE, Hamady M, Fraser-Liggett CM, Knight R, Gordon JI (2007) The human
microbiome project. Nature 449:804-810.
van Acker J, de Smet F, Muyldermans G, Bougatef A, Naessens A (2001) Outbreaks of
necrotizing enterocolitis associated with Enterobacter sakazakii in powdered milk formula. J
Clin Microbiol 39:293-297.
Vieira J, Messing J (1991) New pUC-derived cloning vectors with different selectable markers
and DNA replication origins. Gene 100:189-94.
Vuilleumier S, Chistoserdova L, Lee M-C et al (2009) Methylobacterium genome sequences: A
reference blueprint to investigate microbial metabolism of C1 compounds from natural and
industrial sources. PLoS ONE 4: no. 5584.
Walsh D, Molloy C, Iversen C, Carroll J, Cagney C, Fanning S, Duffy G (2011) Survival
characteristics of environmental and clinically derived strains of Cronobacter sakazakii in infant
milk formula (IMF) and ingredients. J. Applied Microbiol. 110:697-703.
Williams TL, Monday SR, Edelson-Mammel S, Buchanan R, Musser SM (2005) A top-down
proteomics approach for differentiating thermal resistant strains of Enterobacter sakazakii.
Proteomics 5:4161-4169.
Yu NY, Wagner JR, Laird MR, Melli G, Rey S, Lo R, Dao P, Sahinalp SC, Ester M, Foster LJ,
Brinkman FS (2010) PSORTb 3.0: Improved protein subcellular localization prediction with
refined localization subcategories and predictive capabilities for all prokaryotes. Bioinformatics
26:1608-1615.
14
Table 1. Thermal tolerance of strains used in the study
Species
Strain
Origin D58 value
[s]
Thermotolerance
marker
orfI
C. sakazakii ATCC 29544 clinical 122 +
C. sakazakii LMG 2786 clinical 111 +
C. sakazakii ATCC 29004 unknown 188 +
C. sakazakii ILS 744/03 food 126 +
C. sakazakii 061107/08 food 122 +
C. sakazakii 091007/14 food 102 +
C. sakazakii 201206/19 food 150 +
C. sakazakii 201206/22 food 129 +
C. sakazakii 210307/19 food 217 +
C. sakazakii ATCC BAA 894 food 59 -
C. sakazakii 220108/52 food 26 -
C. sakazakii 280108/V1 environmental 28 -
C. sakazakii 201206/25 food 22 -
C. sakazakii 120808/27 food 30 -
C. sakazakii 210807/39 food 30 -
C. malonaticus LMG 23826 clinical 107 +
C. malonaticus 120808/24 food 151 +
C. malonaticus 161007/35 food 15 -
C. dublinensis LMG 23823 environmental 44 -
C. turicensis 290708/07 food 22 -
C. turicensis LMG 23827 clinical 20 -
C. muytjensii ATCC 51329 unknown 53 -
Cronobacter sp. 040407/32 food 31 -
C. braakii CCM 3393 faecal 141 +
C. freundii CCM 4475 food 157 +
E. cloacae CCM 1903 clinical 166 +
E. cloacae CCM 2320 faecal 125 +
E. cloacae 41R unknown 127 +
E. cloacae 41S unknown 85 -
E. cloacae 440 food 193 +
E. cloacae 441 food 166 +
E. cloacae KH22 clinical 67 -
E. cloacae KH35 clinical 243 +
E. coli CCM 2024 unkown 21 -
E. coli KL6 clinical 28 -
E. coli KL53 clinical 182 +
15
Table 2. Predicted open reading frames from the thermotolerance region in C. sakazakii ATCC 29544
Gene Localization
[bp]
Mw
[kDa]
Predicted protein function in stress response Proteins with the highest similarity E value
orfT5 415 - 717 11.5 Transposase IS3 family InsN from
Salmonella Choleraesuis SC-B67
3E-48
orfT4 774 - 1808 39 Transposase, Mutator family ZP_07133815
from E. coli MS 115-1
0
orfA 2159 - 2347 6.9 No significant similarity
orfB 2905 - 3081 6.6 Phage transcriptional regulator of MerR superfamily, induction of
downstream genes in stress conditions
ZP_07136235
from E. coli MS 115-1
3E-27
orfC 3221 - 3790 21.5 Small heat shock protein of the Hsp-20 family
containing α-crystallin domain,
the ATP-independent holding chaperone
ZP_04871399
from Escherichia sp. 1_1_43
2E-106
orfD 3896 - 6745 104.4 ATPase with chaperone activity ClpK,
disaggregation of misfolded and aggregated proteins
ZP_04871398 from Escherichia sp. 1_1_43
ClpK (YP_003864365) from K. pneumoniae
0
0
orfE 6745 - 6936 6.2 N-terminal fragment of phospholipase D ZP_04871397 from Escherichia sp. 1_1_43 7E-25
orfF 6997 - 7686 25.3 N-terminal fragment of metalloprotease FtsH YP_002980601 from R. pickettii 12D 3E-109
orfG 7686 - 7826 5.4 C-terminal fragment of metalloprotease FtsH YP_002980601 from R. pickettii 12D 4E-18
orfH 7914 - 8372 17.4 Small heat shock protein of the Hsp-20 family containing α-
crystallin domain, the ATP-independent holding chaperone
YP_003864367 from K. pneumoniae 1E-79
orfI 8395 - 9309 32.4 Conservative protein, YfdX family, unknown function,
link to thermal, osmotic and desiccation stress
YP_003864368 from K. pneumoniae 5E-168
orfJ 9412 - 10299 31.9 Conservative protein, YfdX family, unknown function,
link to thermal, osmotic and desiccation stress
YP_003864368 from K. pneumoniae 2E-164
orfK 10393 - 11004 22.5 Conservative transmembrane protein, HdeD family,
unknown function, acid tolerance in high densities
ZP_07136043 from Escherichia sp. 1_1_43
3E-105
orfL
11084 - 12229 43.6
Conserved hypothetical protein,
RNA polymerase sigma factor
ZP_04871396 from Escherichia sp. 1_1_43
YP_001372996 from O. anthropi ATCC 49188
0
9E-12
orfM 12219 - 12659 16.4 Thioredoxin,
reduction status of proteins, modulation of protein activity
ZP_04871395 from Escherichia sp. 1_1_43 2E-81
orfN 12663 - 14372 59.9 Sodium/hydrogen exchanger of KefC family,
glutathione-regulated potassium-efflux systems protein,
methylglyoxal detoxification
ZP_04871394 from Escherichia sp. 1_1_43 0
orfO 14375 - 14872 18.4 Conserved hypothetical protein containing PsiE domain ZP_04871393 from Escherichia sp. 1_1_43 9E-78
orfP 14850 - 15806 34.3 peptidase of the M48 superfamily homologous to HtpX, ZP_04871392 from Escherichia sp. 1_1_43 4E-159
16
quality controll of inner membrane proteins
orfQ 15831 - 16982 40.5 DegP2 peptidase of HtrA/DegP family,
periplasmic protein with chaperone and protease activity ZP_04871391 from Escherichia sp. 1_1_43 0
orfT3 17207 - 17788 21.5 transposase IS4 family ZP_07136036
from E. coli MS 115-1
7E-93
orfT2 17754 - 18275 19.6 transposase IS4 family YP_001750208
Pseudomonas putida W619
3E-84
orfT1 18335 - 18565 9.2 transposase – N-terminal part ISEhe3 transposase B (ADR67042)
from Klebsiella pneumoniae
5E-38
17
Figure 1. Alignment of the thermotolerance genomic region in selected bacteria
Regions shown: C. sakazakii ATCC 29544 (FR714908), M. flagellatus KT genes Mfla_1155 –
Mfla_1173 (CP000284), R. picketii 12D chromosome 1 genes Rpic12D_0611 – Rpic12D_0633
(CP001644), Escherichia sp. 1.1.43 genes ESCG_01078 – ESCG_01089 (NZ_GG665811), E.
cloacae ATCC 13047 genes ECL_03692 – ECL_03701 (CP001918).
Legend: homologous genes from the thermotolerance DNA region are shown in the same colour,
genes encoding for transposases are grey, genes with no homology in the Cronobacter
thermotolerance DNA region are white.
18
Figure 2. Transcription of genes from the thermotolerance region
A) OrfI transcription in different strains during exponential (1-3) and stationary (4-6) growth
phase, tested strains C. sakazakii ATCC 29544 (1, 4), C. sakazakii 210307/19 (2, 5) and E. coli
KL 53 (3, 6), GeneRuler 1 kb DNA Plus, Fermentas (9)
B) Transcription of different genes from thermotolerance region of C. sakazakii ATCC 29544.
Lanes: orfT1-T3 (1), orfQ (2), orfN (3), orfL (4), orfK (5), orfJ (6), orfI (7), orfH (8), orfD (9),
orfB (10), orfT4-T5 (11), GeneRuler 1 kb DNA Plus, Fermentas (12)
A 1 2 3 4 5 6 7 8 9
B 1 2 3 4 5 6 7 8 9 10 11 12