Constitutive COX-2 activity in cardiomyocytes confers permanent cardioprotectionConstitutive COX-2 expression and cardioprotection
Javier Inserte c,1, Belén Molla a,1, Rio Aguilar c, Paqui G. Través b, Ignasi Barba c, Paloma Martín-Sanz b,Lisardo Boscá b, Marta Casado a,⁎, David Garcia-Dorado c,⁎a Instituto de Biomedicina de Valencia (IBV-CSIC), Valencia, Spainb Instituto de Investigaciones Biomédicas Alberto Sols CSIC-UAM, Madrid, Spainc Servicio de Cardiologia, Hospital Universitari Vall d'Hebron, Barcelona, Spain
⁎ Corresponding authors. D. Garcia-Dorado is toCardiologia, Hospital Universitari Vall d'Hebron, Pas08035 Barcelona, Spain. Tel.: +34 93 4894038; fax:Instituto de Biomedicina de Valencia, IBV-CSIC, Jaime RTel.: +34 96 3393778; fax: +34 96 3690800.
uggest that inhibition of COX-2 activity exacerbates reperfusion injury, but directdata showing beneficial effects of increased COX-2 activity are lacking. The aim of this study was todetermine the effect of constitutive expression of COX-2 on cardiomyocyte tolerance to ischemia–reperfusion injury. We generated a transgenic mouse (B6D2-Tg (MHC-PTGS2)17Upme) that constitutivelyexpresses functional human COX-2 in cardiomyocytes under the control of α-myosin heavy chain promoter.COX-2 expression was confirmed by immunoblotting and by increased levels of PGE2 and PGI2 inmyocardium. Histological and echocardiographic analysis revealed no differences in the phenotype oftransgenic mice (TgCOX-2) with respect to wild type (Wt) mice. Tolerance to ischemia–reperfusion injurywas analysed in a Langendorff system. Reperfused TgCOX-2 hearts after 40 min of ischemia improvedfunctional recovery (32.9±6.2% vs. 9.45±4.4%, P=0.004) and reduced cell death assessed by LDH release(43% of reduction, Pb0.001) and triphenyltetrazolium staining (41% of reduction, P=0.002). Cardioprotectionwas not further increased by ischemic preconditioning. Pretreatment of mice with the COX-2 inhibitor DFUattenuated cardioprotection with a correlation between myocardial PGE2 levels and the extent of cell death.NMR spectroscopy showed a marked reduction in arachidonic acid (AA) content in TgCOX-2 hearts. Both,DFU pretreatment and perfusion of TgCOX-2 hearts with AA increased myocardial AA to values similar tothose measured in Wt hearts and reversed cardioprotection. We conclude that constitutive expression ofCOX-2 in cardiomyocytes confers a permanent cardioprotective state against reperfusion injury. IncreasedPGE2 synthesis and reduced AA content could explain this effect.
The pathophysiological role of COX-2 in cardiac diseases is asubject of controversy. COX-2 is stress-induced [1] and it has beendescribed that participates in inflammatory processes associated withcardiac disease [2]. However, epidemiological studies in patientschronically treated with selective COX-2 inhibitors consistentlydisclose an increased risk for thromboembolic events [3]. This adverseeffect has been related to an increased protrombotic state, potentiallypredisposing patients to heart attack and stroke. The mechanistic
be contacted at Servicio deseig Vall d'Hebron, 119-129,+34 93 4894032. M. Casado,oig 11, 46010 Valencia, Spain.
basis of this side effect is not fully understood although it has beenrelated to an altered thromboxane-prostacyclin balance [4,5] andother platelet-independent mechanisms [6,7].
There is growing evidence suggesting that COX-2 may have directcardioprotective effects. Induction of COX-2 and an increased synth-esis of prostanoids has been reported in reperfused myocardium [8]and, although with some exceptions [9,10], pharmacological inhibi-tion or genetic suppression of COX-2 exacerbates infarct size in variousin vitro and in vivo experimental models of ischemia–reperfusioninjury [11,12]. Moreover, several studies have shown that COX-2activation has a central role in the infarct-limiting effects of the latephase of ischemic preconditioning [13] and in mediating thecardioprotective effects of different drugs and cytokines, such asstatins and adiponectin, against reperfusion induced cell death [14,15].The two main products of COX-2 activity, PGE2 and PGI2 have beenproposed as the mediators of these cardioprotective effects throughdifferent signalling pathways associated to G-protein coupled recep-tors [14,16–20]. COX-2 induced cardioprotection could also be theresult of a reduction in the pool of unesterified arachidonic acid
161J. Inserte et al. / Journal of Molecular and Cellular Cardiology 46 (2009) 160–168
reducing its direct [21–23] and indirect deleterious effects associatedto the formation of active metabolites other than prostanoids [24,25].
Although the evidence that increased COX-2 activity mediatescardioprotective effects is established, direct data showing whetherpermanent expression of COX-2 in itself, in the absence of othercellular adaptations, induces cardioprotection are lacking. Wetherefore examined in this study the effects of myocardial over-expression of COX-2 on ischemia–reperfusion injury using atransgenic mouse line which, under the control of the cardiac α-myosin heavy chain (α-MyHC) promoter, constitutively expresseshuman COX-2 in cardiomyocytes.
The results of our study show direct evidence demonstrating thatspecific cardiomyocyte COX-2 expression generates a permanentcardioprotective state of magnitude similar to that obtained withischemic preconditioning.
2. Materials and methods
The experimental procedures conformed to the Guide for the Careand Use of Laboratory Animals published by the United States NationalInstitute of Health (NIH Publication No. 85-23, revised 1996), andwereapproved by the Research Commission on Ethics of the HospitalUniversitari Vall d'Hebron and Instituto de Biomedicina de Valencia.
2.1. Generation of COX-2-overexpressing mice (B6D2-Tg (MHC-PTGS2)Upme mice)
Mice with cardiac-specific overexpression of human COX-2(TgCOX-2) were created at the Instituto de Biomedicina de Valencia.Briefly, a pBluescript II KS (+) vector containing the mouse cardiac α-MyHC (clone 26, a gift from Dr. Jeff Robbins, Children's Hospital,Cincinnati, OH) [26] and the human COX-2 open reading frameincluding 5′ UTR region and the poly (A) signal sequences of humangrowth hormone, was cloned downstream α-MyHC promoter in theSalI/Hind III site of the pBS II vector which also contains the poly (A)
Fig. 1. Generation of B6D2-Tg (MHC-PTGS2)Upme mice. (A) Transgene construct for generapromoter, human COX-2 (hCox-2) and human growth hormone (hGH) polyadenylation seintegrated in the different lines generated, respectively.
signal sequences of human growth hormone (Fig. 1A). The orientationof the COX-2 was verified by sequencing.
The linearised and purified fragment of the recombinant plasmidwas microinjected into pronuclei of one-cell mouse embryos (C57BL/6J×DBA2 F1 mice, Charles River Laboratories, Wilmington, MA) andtransferred into the oviducts of pseudopregnant foster CD1 mouse aspreviously described [27]. Integration and number of copies oftransgene was checked by Southern blot and PCR analysis of genomictail DNA. Primers specific for the hCOX-2 (forward 5′CAGAGTTGGAAG-CACTCTATGG3′ and reverse 5′CTGTTTTAATGAGCTCTGGATC3′) wereused to amplify a 303 bp fragment that corresponds to nucleotides1558 to 1863 of Homo sapiens prostaglandin-endoperoxidasesynthase 2 mRNA (NM_00963).
Seven F0 lines (four females and three males) were generatedwith a transfection efficiency around 27.4% (Fig. 1B). A male line thatintegrated 3 copies of transgene (L17) was selected for this study(Fig. 1C). To rule-out the possibility of a spurious result due torandom integration of the transgene, the heart tolerance to ischemiawas confirmed in a second founder line with 2 copies of thetransgene (L12).
2.2. Cardiospecific transgene expression, protein analysis andimmunofluorescence
Total RNA from different tissues was extracted with Trizol Reagent(Invitrogen). First strand cDNAwas synthesized from 1 μg of total RNAusing random hexamer and expand reverse transcriptase (Roche) andamplified using the above-mentioned primers for hCOX-2 and murineGAPDH as endogenous control, 5′CAAGGTCATCCATGACAACTTTG3′and 5′CTGAGTGGCAGTGATGGCAT3′ (fragment size 73 bp).
Western immunoblotting analysis was performed as previouslydescribed [27], using antibodies against human COX-2 (Assay Design,AnnArbor,MI),without cross-reactivitywith humanCOX-1 andmouseCOX-2 [28], endogenous COX-2 (Santa Cruz, SC-1747)which recognisesboth human and murine COX-2 (total COX-2) [29], murine COX-1
tion of cardiospecific COX-2 overexpressing mice. Construct contains mouse α-MyHCquence. (B and C) PCR and Southern blots showing integration and number of copies
Fig. 2. Characterization of B6D2-Tg (MHC-PTGS2)17Upmemice. (A) Transgene expression and tissue specificity analysed by RT-PCR. (B) Human COX-2 protein expression analysed byWestern-blot in different tissues from Tg mice; A: aorta; H: heart, K: kidney, L: liver, Lu: lung, T: testicle, S: spleen, SI: small intestine, SM: skeletal muscle. (C) COX-1, human COX-2and total COX-2 (murine and hCOX-2) protein expression as analysed by Western-blot in myocardium from Wt and Tg mice. (D) Immunohistochemical detection of hCOX-2 and α-actinin corresponding to myocardium from Wt and Tg mice.
Table 1Heart weight and cardiac function parameters of isolated hearts at baseline
162 J. Inserte et al. / Journal of Molecular and Cellular Cardiology 46 (2009) 160–168
(Santa Cruz, SC-1752) or polyclonal MMP-9 (Torrey Pines Biolabs) [30].Target protein band densities were normalized to α-actin.
Histological sections were prepared as previously described [27]and incubated with antibodies against human COX-2 and cardiac α-actinin (clone EA-53, Sigma). Confocal images were obtained with anOlympus FV1000 Spectral microscope.
2.3. Determination of prostanoids, cAMP and MPO activity
Myocardial PGE2 (GE Healthcare), 6-keto-PGF1α (Cayman), a stablemetabolite of PGI2, PGF2α (Cayman) and TxB2, a stable metabolite ofTxA2 (Cayman) were measured in heart tissue using specificimmunoassays, following the manufacturer's instructions. Proteinlevels were determined with the Bradford reagent (Bio-Rad).
For cAMP assays, freeze-dried samples were extracted withtrichloroacetic acid, neutralised, purified with an AG 50W columnand assayed using a commercially available cAMP ELISA kit (GEHealthcare).
Mieloperoxidase (MPO) activity was measured in hearts homo-genates with 0.034% H2O2 and 18 mM tetrametilbencidine (TMB)and reading the absorbance at 630 nm as previously described[31].
2.4. Transthoracic echocardiography
Echocardiographic measurements were performed with a Vividportable ultrasound system using a ILS 12 MHz transducer (GEHealthcare) applied to the shaved chest wall of 3 months-old male Wt
and Tg mice (n=5) anesthetized with isoflurane. The ejection fraction(EF), end-diastolic left ventricular internal diameter (LVEDD), end-systolic left ventricular internal diameter (LVESD), interventricularseptum thickness (IVD) and posterior wall thickness (LVPW) weremeasured in M-mode recordings. Fractional shortening (FS) wascalculated as ([EDD−ESD]) /ESD)×100. Data obtained were normal-ized against body weight.
2.5. Studies in the isolated heart model
2.5.1. Isolated heart perfusionMale Wt and TgCOX-2 mice were intraperitoneally treated daily
for 3 days with the COX-2 inhibitor 5, 5-dimethyl-3(3-fluorophenyl)-4-(4-methylsulphonyl) phenyl-2(5H)-furanone (DFU; Merck, Rahway,NJ) at 5mg/kgor its vehicle (DMSO1%) [32]. Fortyminutes after the lastadministration of DFU, mice were anaesthetized by intraperitoneal
Table 2Echocardiographic data from Wt and Tg COX-2 mice
BW = body weight; LVEDD = left ventricular end diastolic diameter: EF = ejectionfraction; LVESD = left ventricular end systolic diameter; FS = left ventricular fractionalshortening; HR = heart rate; IVS = intraventricular septum thickness; LVPW = leftventricular posterior wall thickness. Data are expressed as mean±SEM.
163J. Inserte et al. / Journal of Molecular and Cellular Cardiology 46 (2009) 160–168
injection of sodium thiopental (150 mg/kg). Hearts were placed in aLangendorff apparatus, paced at 7.5 Hz and perfused with a Krebs–Henseleit bicarbonate buffer (in mM: NaCl 140, NaHCO3 24, KCl 2.7,KH2PO4 0.4, MgSO41, CaCl2 1.8, and glucose 11, 95%O2–5% CO2 at 37 °C)at constant flow initially adjusted to produce a perfusion pressure of80 mmHg. Left ventricle (LV) pressure was monitored as previouslydescribed [33].
Hearts were normoxically perfused for 30 min and then subjectedto 40 min of global ischemia followed by 60min of reperfusion. Pacing
Fig. 3. Ischemia–reperfusion protocol. (A) Experimental protocol. Mice were pretreated with D(B and C) Representative LV pressure tracings corresponding to Wt and TgCOX-2 mice. (D) T
was discontinued 1 min after the onset of ischemia and reinstated3 min after the onset of reperfusion. After reperfusion a series ofhearts from each group (n=5–6) were frozen in liquid nitrogen andanother series of hearts were used for infarct size measurements(n=6–8). In an additional set of experiments, Wt and TgCOX-2 micewere subjected to a preconditioning protocol consisting of two cyclesof 5 min of ischemia and 5 min of reperfusion (n=5). Finally, todetermine the involvement of unesterified arachidonic acid Wt andTgCOX-2 hearts were perfused with buffer containing 10 μM ofarachidonic acid (Sigma) before ischemia and during reperfusion(n=4).
LDH activity was spectrophotometrically measured and infarct sizedetermined after incubation with 1% 2,3,5-triphenyltetrazoliumchloride (TTC) at the end of the reperfusion as described previously[33].
2.6. NMR spectroscopy
Spectra were acquired in a 400 MHz (9.4 T) vertical bore magnetinterfaced to an AVANCE spectrometer (Bruker, Madrid) as describedpreviously [34]. Briefly, HR-MAS spectra were acquired from approxi-mately 10mg of tissue in a 12 μl rotor spun at 4200 Hz and kept at 0 °C.1D spectra consisted in the accumulation of 64 scans with a 1DNOESYpulse sequence; 2D 1H–1H correlation spectra were acquired as 128
FU or its vehicle before subjecting the isolated hearts to ischemia–reperfusion protocol.ime course of LDH release during reperfusion. Data are mean±SEM.
164 J. Inserte et al. / Journal of Molecular and Cellular Cardiology 46 (2009) 160–168
time increments of 32 scans each. Continuous wave pulse irradiationwas used to suppress the water resonance.
2.7. Statistical analysis
Data are expressed as means±SEM. Statistical significance ofdifferences among groups was evaluated by the U of Mann–Whitneytest or the one-way ANOVA followed by the LSD test for individualcomparisons. All tests have been calculated two-tail and thesignificance has been considered at Pb0.05.
3. Results
3.1. Generation and characterization of B6D2-Tg (MHC-PTGS2)Upmemice
Founder mice carrying human COX-2 were generated by injectingone-cell embryos with the construct (Fig. 1A) and used to establishseven lines of B6D2-Tg(MHC-PTGS2) mice. Screening of mice wasdone by PCR analysis and confirmed by Southern blot hybridization oftail DNA (Figs. 1B, C). We chose for the study the line with highest ofcopies of transgene (L17-3 copies). The study shows data correspond-ing to twelve weeks-old males from heterozygous B6D2-Tg (MHC-PTGS2)17Upme.
Transgene expression and its cardiospecificity were confirmed byRT-PCR analysis, Western blotting and immunohistochemistry indifferent tissues (Fig. 2). Western-blot analysis showed no differencesin the expression of COX-1 between Wt and TgCOX-2, and noexpression of hCOX-2 nor endogenous COX-2 in Wt hearts (Fig. 2B).Activity of COX-2, analysed by measuring the levels of myocardialprostanoids (Fig. 5), showed an 8-fold increase in PGE2 and 2-fold
Fig. 4. Effects of ischemia–reperfusion on left ventricular function, infarct size and cell deathrespect to basal values. (B) Total LDH released during reperfusion. (C) Representative myocainfarct size as percentage of ventricularmass. IR: hearts were subjected to 40min of ischemiareperfusion protocol; IPC: hearts were preconditioned with 2 cycles of ischemia–reperfusio
increase in PGI2. No significant differences in the levels of PGF2α andTxA2 between Wt and Tg hearts were observed. Treatment with DFUcompletely reverted the increase in PGI2, and induced a 67% ofreduction in the levels of PGE2 (Fig. 5).
3.2. Lack of phenotype under basal conditions
TgCOX-2 animals did not exhibit differences in heart weight/body weight ratio (Table 1) nor detectable histological changes inthe heart neither at the endothelium nor at smooth muscle asindicated by the staining of PECAM and α-actin (data not shown).COX-2 activity did not increase MPO activity (122.6±11.5% inTgCOX-2 mice respect to Wt mice, P=ns) nor MMP-9 expression(1.42±0.18 au in Wt mice vs. 1.02±0.92 au in TgCOX-2 miceP=0.121).
M-mode echocardiographic analysis revealed no significant differ-ences on LV dimensions or function between TgCOX-2 and Wt mice(Table 2).
3.3. Overexpression of COX-2 protects against ischemia–reperfusioninjury
In Wt hearts perfusion pressure was 81.1±2.8 mmHg, LVdevP91.4±5.3 mmHg and coronary flow 2.6±0.2 ml/min. No differencesbetween Wt and TgCOX-2 groups pretreated with DFU or its vehiclewere observed during equilibration (Table 1, Fig. 3). No-flowischemia resulted in cessation of contractile activity and indevelopment of ischemic contracture without differences betweenWt and TgCOX-2 hearts in the time to its onset (4.8±0.4 min and5.1±0.3 min respectively) or in its magnitude defined as the maximalincrease observed in LVEDP during ischemia (65.3±7.2 mmHg and
. (A) Recovery of contractility after 60 min of reperfusion and expressed as percentagerdial section stained with triphenyltetrazolium after reperfusion. (D) Quantification ofand 60min of reperfusion; IR+DFU: COX-2was inhibitedwith DFU before the ischemia–n. Results are presented as mean±SEM. ⁎Pb0.05 vs. Wt group.
Fig. 5. Quantification of PGE2, 6-keto-PGF1α, TxB2 and PGF2α in Wt and Tg mice pretreated with DFU or its vehicle and measured at baseline and after reperfusion. Results arepresented as mean±SEM. ⁎Pb0.05 vs. Wt group. $Pb0.05 with respect to Tg group.
Fig. 6. Correlation between reperfusion injury and expression of COX-2. Data show thelinear correlation between total LDH released during the reperfusion period andmyocardial PGE2 production measured at the end of reperfusion.
165J. Inserte et al. / Journal of Molecular and Cellular Cardiology 46 (2009) 160–168
61.5±5.4 mmHg respectively). On the contrary, during the reperfu-sion period TgCOX-2 mice improved contractile function (Fig. 4A)and reduced hypercontracture (calculated as the difference betweenmaximal LVEDP value at reperfusion and at the end of ischemia;34.5±3.9 mmHg vs. 46.4±3.5 mmHg in Wt group, P=0.015), LDHrelease (Fig. 4B) and infarct size (Fig. 4D). To rule-out the possibilityof a spurious result due to transgene insertional mutagenesis, thecardioprotective effects of COX-2 overexpression were confirmed in asecond founder line (L12 shown in Fig.1; LVdevP=38.4±6.3% respect tobaseline, LDH=148±21 U/60 min/gdw; infarct size=30.7±3.1%, P=nswith respect to L17).
Three-day pretreatment of Wt mice with 5 mg/kg DFU had noeffect on LVP values neither throughout the experiment nor in celldeath. However, DFU pretreatment of TgCOX-2 mice abolished thecardioprotection against ischemia–reperfusion induced injury (Fig. 4).
Reperfusion injury measured in Wt hearts subjected to ischemicpreconditioning was similar to that observed in non-preconditionedTgCOX-2 hearts. Preconditioning did not induce further cardioprotec-tion in TgCOX-2 hearts (Fig. 4).
3.4. Myocardial PGE2 levels at reperfusion correlates with cell death
Myocardial PGE2, PGI2 and PGF2α levels but not TxA2 increasedafter reperfusion with respect to preischemic values in both Wt and
TgCOX-2 mice (Fig. 5). PGE2 production remained 7-fold higher inmyocardium from TgCOX-2 mice. Pretreatment with DFU did notmodify PGE2 in Wt mice but attenuated by 61% the increase in
Fig. 7. NMR spectra. (A) HR-MAS spectra of myocardium from Wt and Tg mice. The resonance at 5.35 ppm corresponding to protons in fatty acid chains close to double bonds ismarkedwith an arrow. (B) correspond to the areas of interest in the 1H–1H COSY spectra ofWt and Tgmice. Cross-peaks at 5.35–2.0 and 5.35–2.8 ppm correspond to total unsaturatedand poly-unsaturated moieties of the fatty acyl chains respectively. (C) Ratio of polyunsaturated and total unsaturated fatty acid levels in Wt and Tg mice. (D) Total LDH release andinfarct size at the end of reperfusion. IR: hearts were subjected to 40 min of ischemia and 60 min of reperfusion; IR+DFU: COX-2 was inhibited with DFU before the ischemia–reperfusion protocol; IR+AA: hearts were perfused with 10 μM arachidonic acid during baseline and reperfusion. Results are presented as mean±SEM. ⁎Pb0.05 vs. Wt from IR group.
166 J. Inserte et al. / Journal of Molecular and Cellular Cardiology 46 (2009) 160–168
TgCOX-2 mice. Ischemia–reperfusion abolished the basal differencesin PGI2 levels between Wt and TgCOX-2. There was a closecorrelation between PGE2 values and cell death occurring duringreperfusion (Fig. 6).
There were no differences in the myocardial levels of cAMPbetween Wt and TgCOX-2 (186.3±9.2 pmol/gww vs. 179.2±4.0 pmol/gww, respectively).
3.5. Arachidonic acid content
1D NMR spectra showed a reduction in the 5.35 ppm peak,corresponding to the protons in methylene peaks of fatty acidchains next to a double bond, in the TgCOX-2 mouse heart (Fig.7A). Moreover, 2D correlation spectroscopy, demonstrated thatpolyunsaturated fatty acid (PUFA) cross peak at 5.35–2.85 ppm wasreduced in TgCOX-2 (ratio of PUFA peak volume/total unsaturatedfatty acids peak volume was 0.90±0.03 in Wt hearts and 0.56±0.02in TgCOX-2, Pb0.001) (Fig. 7). Arachidonic acid accounts for aboutone third of total polyunsaturated free fatty acids in the heart [35].Once the number of unsaturations is considered, arachidonic acidmakes about 60% of the polyunsaturated peak. These data, takentogether, clearly indicate a selective reduction of arachidonic acidin the TgCOX-2 mice compared to Wt animals. Both, pretreatmentof mice with DFU and perfusion of the isolated hearts witharachidonic acid increased the content of myocardial unesterifiedarachidonic acid in TgCOX-2 mice to values similar to thoseobtained in hearts from Wt mice, and this increase was associated
with a reduction in their tolerance to ischemia–reperfusion injury(Fig. 7C).
4. Discussion
The present study demonstrates increased tolerance to ischemia–reperfusion in mice genetically modified to selectively express COX-2in cardiomyocytes. The protection against ischemia–reperfusioninjury conferred by this modification is similar to that obtained withischemic preconditioning and it is markedly attenuated by pharma-cological inhibition of COX-2. These results provide direct evidencedemonstrating that constitutive COX-2 expression in cardiomyocytesgenerates a cardioprotective state that is independent of its influenceon hemodynamic factors or on blood constituents.
Previous studies have suggested that COX-2 expression plays acardioprotective role against ischemia–reperfusion injury. The evidenceis based on the exacerbation of injury observed when COX-2 ispharmacologically inhibited [11] or genetically suppressed [12] and onits contribution to the protective effects of late preconditioning [13],statins [14] or cytokines as adiponectin [15]. However, no direct datashowing beneficial effects of increased COX-2 activity without thecellular adaptations associated to preconditioning or pharmacologicalinterventions has beenpreviously published. Using aα-MyHCpromoterand the humanCOX-2gene,wehave developeda new transgenicmousethat constitutively and specifically expressed COX-2 in cardiomyocyteswithout inducing inflammatory response or adverse effects on LVdimensions or cardiac function. The present study shows that
167J. Inserte et al. / Journal of Molecular and Cellular Cardiology 46 (2009) 160–168
constitutive expression of COX-2 in cardiomyocytes increases thetolerance against ischemia–reperfusion injury and in a magnitudewhich is similar to that obtained by ischemic preconditioning. Thedescribed cardioprotection is attributable to COX-2 expression since itwas significantly reverted pretreating TgCOX-2 mice with the COX-2inhibitor DFU. The use of a Langendorff system demonstrates thatCOX-2 expression in cardiomyocytes is sufficient to induce protectionby acting directly on the myocardium.
Several studies suggest that there is an interaction between iNOSand COX-2 expression and activity in myocardium. Shinmura et al.demonstrated that iNOS modulates the activity of COX-2 via NOduring the late phase of preconditioning [36]. Furthermore, this studyshowed that while the activity of COX-2 following preconditioningrequires iNOS-derived NO, iNOS activity is independent of COX-2-derived prostanoids indicating that COX-2 is located downstream ofiNOS in the protective pathway of late preconditioning. The notionthat COX-2 is an obligatory downstream effector of iNOS-dependentcardioprotection has been further confirmed by the same group in amore recent study by using iNOS gene transfer methodology [37]. Ourstudy in mice expressing functional COX-2 in the absence of anypreconditioning stimulus is consistent with this hypothesis.
It has been described that COX-2metabolites, PGE2 and PGI2, protectmyocardium from ischemia–reperfusion injury [14,16–20]. Althoughexpression of COX-2 increased both metabolites in myocardium, theproduction of PGE2 was higher than PGI2 (10× fold vs. 1.5× fold,respectively) which is in agreement with previous studies showing thatPGE2 is the principal prostaglandin generated by ventricular cardio-myocytes [38]. The lack of differences in the expression of COX-1makesunlikely that the observed incomplete inhibition of PGE2 was due to ahigher activity of COX-1 in TgCOX-2 hearts. The incomplete inhibitioncould be related to the fact that DFU is a reversible competitive inhibitor[32] and it was not present during the perfusion protocol. Reperfusioninduced further increase in both prostaglandins,whichwasnot revertedby COX-2 inhibition suggesting an additive contribution of COX-1 [12].The absence of differences in PGI2 levels between Wt and TgCOX-2during reperfusion together with the observed correlation betweenPGE2 levels and cell death, supports a specific role of PGE2 in protectioninduced by permanent COX-2 expression.
The mechanism for the cardioprotection afforded by PGE2 isunclear but it probably involves a combination of actions. It has beendescribed that PGE2 has an inhibitory effect on the neutrophil functionand a potent vasodilatory action [39], both of which might contributeto the observed cardioprotection. However, the use of an isolatedheart model, free of blood, and the absence of differences betweenWtand TgCOX-2 hearts in coronary resistance (measured from changes inperfusion pressure) indicates that the observed cardioprotectiveaction is independent of these mechanisms.
The cardioprotective effects of PGE2 have been associated to EP3and EP4 receptor subtypes [16–19]. Both receptors are expressed incardiomyocytes, but while EP4 couples to Gs protein and stimulatesadenylyl cyclase increasing intracellular cAMP levels, EP3 couples to Giprotein and inhibits the synthesis of cAMP [40]. In our study,measurement of myocardial cAMP showed no differences betweenWt and TgCOX-2 mice, which is in agreement with the absence ofdifferences on myocardial contractile function. Our results couldindicate either a more complex situation in which pathways activatedby both EP3 and EP4 receptors participate in the cardioprotection orthe activation of mechanisms independent from changes in myocar-dial cAMP levels. Although little is known about the intracellularsignal transduction pathways downstream EP receptors implicated inthe cardioprotective effects of COX-2, it has been suggested theinvolvement of mechanisms classically implicated in preconditioningas opening of mitochondrial ATP-sensitive K+ channels [41], activationof PKC [42] or activation of the PI3K/ERK pathway [43].
Reperfusion induces an exaggerated hydrolysis of membranephospholipids causing an unphysiological rise in unesterified arachi-
donic acid associated with enhanced phospholipase A2 activity. Theaccumulation of arachidonic acid and the extent of reperfusion injuryhave been shown to be closely related [44]. Unesterified arachidonicacid is not metabolized by COX only, but also transformed bylipooxygenase and cytochrome P450 and by non enzymatic oxidativemodification. This results in a large number of biologically activecompounds with a variety of actions including both deleterious andprotective effects onmyocardial injury. Inhibition of 5-lipoxygenase orintravenous infusion of antagonists for the receptors activated byleukotrienes, reduce neutrophil influx and infarct size, and improverecovery of LV function after myocardial infarction [45,46]. In contrast,12-lipoxygenase and its major product 12-hydroxyeicosatetraenicacid (12-HETE) have been reported to limit myocardial ischemia–reperfusion injury [47] and to participate in opioid-induced pre-conditioning [48]. The cytochrome P450 hydroxylase and its product20-hydroxyeicosatetraenic acid (20-HETE) exacerbate myocardialinjury [49] while cytochrome P450 epoxygenases and their metabolites(epoxyeicosatrienoicacids, EETs)havebeenproposedtobecardioprotective[50]. However, the observed protective effects of non specific inhibitors ofcytochrome P450 against reperfusion injury demonstrate that thisenzymatic pathway has an overall detrimental effect on myocardialischemia–reperfusion injury [24,25]. It has been demonstrated thatinhibition of COX-2 increases the availability of unesterified arachidonicacid which, in the presence of the burst of reactive oxygen speciesgenerated at reperfusion, is subjected to non-enzymatic peroxidationproducing 8-iso-PGF2α, an isoprostane that aggravates reperfusion injury[24]. Moreover, arachidonic acid may also contribute to reperfusion injurydirectly by impairing the mitochondrial respiratory activity throughspecific inhibition of complex I and II and by triggering mPTP openinginduced by Ca2+ overload in intact cells [21–23]. In our study, NMR analysisshowed a marked reduction in polyunsaturated fatty acids mainlyattributable to arachidonic acid and specifically to the free form sinceNMR spectroscopy is only able to detect free rotating molecules.The observation that normalization of myocardial unesterified arachidonicacid levels in TgCOX-2 mice pretreated with DFU or perfused withexogenous arachidonic acid reverts the increased tolerance to ischemia–reperfusion injury observed in Tg mice is consistent with thehypothesis that reduced levels of myocardial unesterified arachidonicacid mediates, at least in part, the cardioprotective effects of COX-2overexpression.
In conclusion, this study shows direct evidence demonstrating thatspecific cardiomyocyte COX-2 expression generates a permanentcardioprotective state, of similar magnitude to that obtained withischemic preconditioning, which is associated to increased levels ofPGE2 and reduced levels of unesterified arachidonic acid. These resultsmay help to explain the adverse cardiovascular effects of chronic COX-2 inhibition reported in clinical studies and could serve as basis fordeveloping new cardioprotective strategies.
Acknowledgments
We thank Carme Cucarella, Alfonso Moyano and MaríaAngeles García for their excellent technical assistance and Dr.Muñoz Chapuli for his help with the PECAM immunolocalizationexperiments.
This study was supported by grants from the Fondo de Investiga-ción Sanitaria (FIS-RECAVA RD06/0014/0006 and RD06/0014/0025)and Comisión Interministerial de Ciencia y Tecnología (CICYT SAF2007-60551 and SAF 2005-1758).
[2] Chenevard R, Hurlimann D, Bechir M, Enseleit F, Spieker L, Hermann M, et al.Selective COX-2 inhibition improves endothelial function in coronary arterydisease. Circulation 2003;107:405–9.
168 J. Inserte et al. / Journal of Molecular and Cellular Cardiology 46 (2009) 160–168
[3] Fitzgerald GA. COX-2 in play at the AHA and the FDA. Trends Pharmacol Sci2007;28:303–7.
[4] Grosser T, Fries S, FitzGerald GA. Biological basis for the cardiovascularconsequences of COX-2 inhibition: therapeutic challenges and opportunities.J Clin Invest 2006;116:4–15.
[5] Schrör K, Weber AA. COX-2 inhibitors and the thrombotic risk. Thromb Haemost2006;96:391–2.
[6] Ghosh M, Wang H, Ai Y, Romeo E, Luyendyk JP, Peters JM, et al. COX-2 suppressestissue factor expression via endocannabinoid-directed PPARdelta activation. J ExpMed 2007;204:2053–61.
[7] Rabausch K, Bretschneider E, Sarbia M, Meyer-Kirchrath J, Censarek P, Pape R, et al.Regulation of thrombomodulin expression in human vascular smooth muscle cellsby COX-2-derived prostaglandins. Circ Res 2005;96:e1–6.
[8] Wong SC, Fukuchi M, Melnyk P, Rodger I, Giaid A. Induction of cyclooxygenase-2and activation of nuclear factor-kappaB in myocardium of patients with congestiveheart failure. Circulation 1998;98:100–3.
[9] Saito T, Rodger IW, Hu F, Robinson R, Huynh T, Giaid A. Inhibition of COX pathwayin experimental myocardial infarction. J Mol Cell Cardiol 2004;37:71–7.
[10] LaPointe MC, Mendez M, Leung A, Tao Z, Yang XP. Inhibition of cyclooxygenase-2improves cardiac function after myocardial infarction in the mouse. Am J Physiol2004;286:H1416–24.
[11] Timmers L, Sluijter JP, Verlaan CW, Steendijk P, Cramer MJ, Emons M, et al.Cyclooxygenase-2 inhibition increases mortality, enhances left ventricularremodeling, and impairs systolic function after myocardial infarction in the pig.Circulation 2007;115:326–32.
[12] Camitta MG, Gabel SA, Chulada P, Bradbury JA, Langenbach R, Zeldin DC, et al.Cyclooxygenase-1 and -2 knockout mice demonstrate increased cardiac ischemia–reperfusion injury but are protected by acute preconditioning. Circulation2001;104:2453–8.
[13] Bolli R, Shinmura K, Tang XL, Kodani E, Xuan YT, Guo Y, et al. Discovery of a newfunction of cyclooxygenase (COX)-2: COX-2 is a cardioprotective protein thatalleviates ischemia–reperfusion injury and mediates the late phase of precondi-tioning. Cardiovasc Res 2002;55:506–19.
[14] Birnbaum Y, Ye Y, Rosanio S, Tavackoli S, Hu ZY, Schwarz ER, et al. Prostaglandinsmediate the cardioprotective effects of atorvastatin against ischemia–reperfusioninjury. Cardiovasc Res 2005;65:345–55.
[15] Shibata R, Sato K, Pimentel DR, Takemura Y, Kihara S, Ohashi K, et al. Adiponectinprotects against myocardial ischemia–reperfusion injury through AMPK- and COX-2-dependent mechanisms. Nat Med 2005;11:1096–103.
[16] Martin M, Meyer-Kirchrath J, Kaber G, Jacoby C, Flogel U, Schrader J, et al.Cardiospecific overexpression of the prostaglandin EP3 receptor attenuatesischemia-induced myocardial injury. Circulation 2005;112:400–6.
[17] Xiao CY, Yuhki K, Hara A, Fujino T, Kuriyama S, Yamada T, et al. Prostaglandin E2protects the heart from ischemia–reperfusion injury via its receptor subtype EP4.Circulation 2004;109:2462–8.
[18] Hohlfeld T, Meyer-Kirchrath J, Vogel YC, Schror K. Reduction of infarct size byselective stimulation of prostaglandin EP(3)receptors in the reperfused ischemicpig heart. J Mol Cell Cardiol 2000;32:285–96.
[19] Thiemermann C, Zacharowski K. Selective activation of E-type prostanoid(3)-receptors reduces myocardial infarct size. A novel insight into the cardioprotectiveeffects of prostaglandins. Pharmacol Ther 2000;87:61–7.
[20] Xiao CY, Hara A, Yuhki K, Fujino T, Ma H, Okada Y, et al. Roles of prostaglandin I(2)and thromboxane A(2) in cardiac ischemia–reperfusion injury: a study using micelacking their respective receptors. Circulation 2001;104:2210–5.
[21] Scorrano L, Penzo D, Petronilli V, Pagano F, Bernardi P. Arachidonic acid causes celldeath through the mitochondrial permeability transition. Implications for tumornecrosis factor-alpha apoptotic signaling. J Biol Chem 2001;276:12035–40.
[22] Di Paola M, Lorusso M. Interaction of free fatty acids with mitochondria: coupling,uncoupling and permeability transition. Biochim Biophys Acta 2006;1757:1330–7.
[23] Cocco T, Di Paola M, Papa S, Lorusso M. Arachidonic acid interaction with themitochondrial electron transport chain promotes reactive oxygen speciesgeneration. Free Radic Biol Med 1999;27:51–9.
[24] Möbert J, Becker BF. Cyclooxygenase inhibition aggravates ischemia–reperfusioninjury in the perfused guinea pig heart: involvement of isoprostanes. J Am CollCardiol 1998;31:1687–94.
[25] Gottlieb RA. Cytochrome P450: major player in reperfusion injury. Arch BiochemBiophys 2003;420:262–7.
[26] Jones DA, Carlton DP, McIntyre TM, Zimmerman GA, Prescott SM. Molecularcloning of human prostaglandin endoperoxide synthase type II and demonstrationof expression in response to cytokines. J Biol Chem 1993;268:9049–54.
[27] Casado M, Mollá B, Roy R, Fernández-Martínez A, Cucarella C, Mayoral R, et al.Protection against Fas-induced liver apoptosis in transgenic mice expressingcyclooxygenase 2 in hepatocytes. Hepatology 2007;45:631–8.
[28] Oka A, Takashima S. Induction of cyclo-oxygenase 2 in brains of patients withDown's syndrome and dementia of Alzheimer type: specific localization inaffected neurones and axons. NeuroReport 1997;8:1161–4.
[29] Fakhrzadeh L, Laskin JD, Laskin DL. Ozone-induced production of nitric oxide andTNF-alpha and tissue injury are dependent on NF-kappaB p50. Am J Physiol LungCell Mol Physiol 2004;287:L279–85.
[30] Ju WK, Neufeld AH. Cellular localization of cyclooxygenase-1 and cyclooxygenase-2 in the normal mouse, rat, and human retina. J Comp Neurol 2002;452:392–9.
[31] Gil B, Sanz MJ, Terencio MC, De Giulio A, De Rosa S, Alcaraz MJ, Payá M. Effects ofmarine 2-polyprenyl-1,4-hydroquinones on phospholipase A2 activity and someinflammatory responses. Eur J Pharmacol 1995;285:281–8.
[32] Riendeau D, Percival MD, Boyce S, Brideau C, Charleson S, Cromlish W, et al.Biochemical and pharmacological profile of a tetrasubstituted furanone as a highlyselective COX-2 inhibitor. Br J Pharmacol 1997;121:105–17.
[33] Inserte J, Garcia-Dorado D, Hernando V, Soler-Soler J. Calpain-mediated impair-ment of Na+/K+-ATPase activity during early reperfusion contributes to cell deathafter myocardial ischemia. Circ Res 2005;97:465–73.
[34] Barba I, Jaimez-Auguets E, Rodriguez-Sinovas A, Garcia-Dorado D. 1H NMR-basedmetabolomic identification of at-risk areas after myocardial infarction in swine.Magma 2007;20:265–71.
[35] Conellan JM, Masters CJ. Fatty acid components of rat tissue lipids. Biochem J1965;94:81–4.
[36] Shinmura K, Xuan YT, Tang XL, Kodani E, Han H, Zhu Y, et al. Inducible nitric oxidesynthase modulates cyclooxygenase-2 activity in the heart of conscious rabbitsduring the late phase of ischemic preconditioning. Circ Res 2002;90:602–8.
[37] Li Q, Guo Y, Tan W, Ou Q, Wu WJ, Sturza D, et al. Cardioprotection afforded byinducible nitric oxide synthase gene therapy is mediated by cyclooxygenase-2 viaa nuclear factor-kappaB dependent pathway. Circulation 2007;116:1577–84.
[38] Mendez M, LaPointe MC. Trophic effects of the cyclooxygenase-2 productprostaglandin E(2) in cardiac myocytes. Hypertension 2002;39:382–8.
[39] Yamane H, Sugimoto Y, Tanaka S, Ichikawa A. Prostaglandin E(2) receptors, EP2 andEP4, differentially modulate TNF-alpha and IL-6 production induced by lipopoly-saccharide in mouse peritoneal neutrophils. Biochem Biophys Res Commun2000;278:224–8.
[40] Narumiya S, Sugimoto Y, Ushikubi F. Prostanoid receptors: structures, properties,and functions. Physiol Rev 1999;79:1193–226.
[41] Shinmura K, Tamaki K, Sato T, Ishida H, Bolli R. Prostacyclin attenuates oxidativedamage of myocytes by opening mitochondrial ATP-sensitive K+ channels via theEP3 receptor. Am J Physiol 2005;288:H2093–101.
[42] Zacharowski K, Olbrich A, Piper J, Hafner G, Kondo K, Thiemermann C. Selectiveactivation of the prostanoid EP(3) receptor reduces myocardial infarct size inrodents. Arterioscler Thromb Vasc Biol 1999;19:2141–7.
[43] Fujino H, Regan JW. EP(4) prostanoid receptor coupling to a pertussis toxin-sensitive inhibitory G protein. Mol Pharmacol 2006;69:5–10.
[44] De Windt LJ, Willems J, Roemen TH, Coumans WA, Reneman RS, Van Der Vusse GJ,et al. Ischemic-reperfused isolated workingmouse hearts: membrane damage andtype IIA phospholipase A2. Am J Physiol 2001;280:H2572–80.
[45] Rossoni G, Sala A, Berti F, Testa T, Buccellati C, Molta C, Muller-Peddinghaus R,Maclouf J, Folco GC. Myocardial protection by the leukotriene synthesis inhibitorBAY X1005: importance of transcellular biosynthesis of cysteinyl-leukotrienes.J Pharmacol Exp Ther 1996;276:335–41.
[46] Hock CE, Beck LD, Papa LA. Peptide leukotriene receptor antagonism in myocardialischaemia and reperfusion. Cardiovasc Res 1992;26:1206–11.
[47] Sexton A, McDonald M, Cayla C, Thiemermann C, Ahluwalia A. 12-Lipoxygenase-derived eicosanoids protect against myocardial ischemia/reperfusion injury viaactivation of neuronal TRPV1. FASEB J 2007;21:2695–703.
[48] Patel HH, Fryer RM, Gross ER, Bundey RA, Hsu AK, Isbell M, Eusebi LO, Jensen RV,Gullans SR, Insel PA, Nithipatikom K, Gross GJ. 12-lipoxygenase in opioid-induceddelayed cardioprotection: gene array, mass spectrometric, and pharmacologicalanalyses. Circ Res 2003;92:676–82.
[50] Gross GJ, Hsu A, Falck JR, Nithipatikom K. Mechanisms by which epoxyeicosa-trienoic acids (EETs) elicit cardioprotection in rat hearts. J Mol Cell Cardiol2007;42:687–91.
